AU2005202229B2 - Cytokine Receptor Chain - Google Patents
Cytokine Receptor Chain Download PDFInfo
- Publication number
- AU2005202229B2 AU2005202229B2 AU2005202229A AU2005202229A AU2005202229B2 AU 2005202229 B2 AU2005202229 B2 AU 2005202229B2 AU 2005202229 A AU2005202229 A AU 2005202229A AU 2005202229 A AU2005202229 A AU 2005202229A AU 2005202229 B2 AU2005202229 B2 AU 2005202229B2
- Authority
- AU
- Australia
- Prior art keywords
- protein
- binding
- seq
- cells
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
- C07K14/7155—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Description
AUSTRALIA
Patents Act 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT Name of Applicant: Address for Service: Invention Title: Genetics Institute, LLC Johns Hopkins University CULLEN CO.
Level 26 239 George Street Brisbane QId 4000 Cytokine Receptor Chain The following statement is a full description of the invention, includinig the best method of performing it, known to us: 0 0 ci l Field of the Invention The present invention relates to mammalian cytokine receptor proteins with O affinity for IL-13 (including without limitation human and murine receptor
N
proteins), fragments thereof and recombinant polynucleotides and cells useful for 0 5 expressing such proteins.
i SBackground of the Invention Ci| A variety of regulatory molecules, known as cytokines, have been identified including interleukin-13 (IL-13). Various protein forms of IL-13 and DNA encoding various forms of IL- 13 activity are described in McKenzie et al., Proc.
Nail. Acad. Sci. USA 90:3735 (1993); Minty et al., Nature 362:248 (1993); and Aversa et al., W094/04680. Thus, the term "IL- 13" includes proteins having the sequence and/or biological activity described in these documents, whether produced by recombinant genetic engineering techniques; purified from cell sources producing the factor naturally or upon induction with other factors; or synthesized by chemical techniques; or a combination of the foregoing.
IL-13 is a cytokine that has been implicated in production of several biological activities including: induction of IgG4 and IgE switching, including in human immature B cells (Punnonen et al., J. Immnunol. 152:1094 (1994)); induction of germ line IgE heavy chain transcription and CD23 expression in normal human B cells (Punnonen et al., Proc. Natl. Acad. Sci. USA 90:3730 (1993)); and induction of B cell proliferation in the presence of CD40L or anti-CD40 mAb (Cocks et al., Int. Immunol. 5:657 (1993)). Although many activities of IL-13 are similar to those of IL-4, in contrast to JL-4, IL-13 does not have growth promoting O effects on activated T cells or T cell clones (Zurawski et al., EMBO J. 12:2663 (1993)).
Like most cytokines, IL-13 exhibits certain biological activities by interacting with an IL-13 receptor ("IL-13R") on the surface of target cells. ILci 13R and the IL-4 receptor sharing a common component, which is required for receptor activation; however, IL- 13 does not bind to cells transfected with the 130 kD L-4R (Zurawski et al., supra). Thus, the IL-13R must contain at (c1 least one other ligand binding chain. Cytokine receptors are commonly composed o or two or three chains. The cloning of one ligand binding chain for IL-13 has been recently reported (Hilton et al-, Proc. Nati. Acad. Sci. 93:497-501).
oIt would be desirable to identify and clone the sequence for any other IL13 binding chain of IL-13R so that IL-13R proteins can be produced for various reasons, including production of therapeutics and screening for inhibitors of IL- 13 binding to the receptor and receptor signaling.
Summary of the Invention In accordance with the present invention, polynucleotides encoding the IL- 13 binding chains of the interleukin- 13 receptor are disclosed, including without limitation those from the murine and human receptors. In certain embodiments, the invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: the nucleotide sequence of SEQ I) NO: I from nucleotide 256 to nucleotide 1404; the nucleotide sequence of SEQ ID NO:3 from nucleotide 103 to nucleotide 1242; a nucleotide sequence varying from the sequence of the nucleotide sequence specified in or as a result of degeneracy of the genetic code; a nucleotide sequence capable of hybridizing under stringent conditions to the nucleotide specified in or a nucleotide sequence encoding a species homologue of the sequence specified in or and S an allelic variant of the nucleotide sequence specified in or Preferably, the nucleotide sequence encodes a protein having a biological activity of the human L-,13 receptor. The nucleotide sequence may be operably linked to an expression control sequence. In preferred embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 1 from nucleotide 256 to nucleotide 1404; the nucleotide sequence of SEQ ID NO: 1 from nucleotide 319 to nucleotide 1257; the nucleotide sequence of SEQ ID NO:I from nucleotide 1324 tt-f to nucleotide 1404; the nucleotide sequence of SEQ ID NO:3 from nucleotide 103 ci to nucleotide 125; the nucleotid sequence of SEQ ID NO:3 from nucleotide 10 to nucleotide 1125; or the nucleotide sequence of SEQ ID NO:3 from nucleotide O1189 to nucleotide 1242.
The invention also provides isolated polynucleotides comprising a nucleotide sequence encoding a peptide or protein comprising an amino acid sequence selected from the group consisting of: the amino acid sequence of SEQ lID NO:2; the amino acid sequence of SEQ ID NO:2 from amino acids 22 to 334; the amino acid sequence of SEQ ID NO:2 from amino acids 357 to 383; the amino acid sequence of SEQ ID NO:4; the amino acid sequence of SEQ ID NO:4 from amino acids 26 to 341; the amino acid sequence of SEQ ID NO:4 from amino acids 363 to 380; and fragments of having a biological activity Of the EL-13 receptor binding chain. Other preferred embodiments encode the amino acid sequence of SEQ ID NO:2 from amino acids 1 to 331 and the amino acid sequence of SEQ ID NO:2 from amino acids 26 to 331.
Host cells, preferably mammalian cells, transformed with the polynucleotides are also provided.
0 oIn other embodiments, the invention provides a process for producing a ILl3bc protein. The process comprises: growing a culture of the host cel of the present invention in a suitable culture medium; and purifying the human IL-l3bc protein from the culture.
Proteins produced according to these methods are also provided.
The present invention also provides for an isolated JL-13bc protein ccomprising an amino acid sequence selected from the group consisting of: ci the amino acid sequence of SEQ ID NO:2; the amino acid sequence of SEQ ID NO:2 from amino acids 22 to 0 334; ci the amino acid sequence of SEQ ID NO:2 from amino acids 357 to 383; the amino acid sequence of SEQ ID NO:4; the amino acid sequence of SEQ ID NO:4 from amino acids 26 to 341; the amino acid sequence of SEQ ID NO:4 from amino acids 363 to 380; and fragments of having a biological activity of the IL- 13 receptor binding chain Preferably the protein comprises the amino acid sequence of SEQ ID NO:2; the sequence from amino acid 22 to 334 of SEQ ID NO:2; the sequence of SEQ ID NO:4; or the sequence from amino acid 26 to 341 of SEQ ID NO:4. In other preferred embodiments, the specified amino acid sequence is part of a fusion protein (with an additional amino acid sequence not derived from IL-13bc).
Preferred fusion proteins comprise an antibody fragment, such as an Fc fragment.
Particularly preferred embodiments comprise the amino acid sequence of SEQ ID NO:2 from amino acids 1 to 331 and the amino acid sequence of SEQ ID NO:2 from amino acids 26 to 331.
Pharmaceutical compositions comprising a protein of the present invention and a pharmaceutically acceptable carrier are also provided.
o The present invention further provides for compositions Comprising an antibody which specifically reacts with a protein of the present invention.
Methods of identifying an inhibitor ofILAr 3 binding to the IL,-i3bc or EL- 13 receptor are also provided. These methods comprise: combining an IL- l3bc protein or a fragment thereof with IL, 13 or a fragment thereof, said combination forming a first binding mixture; measuring the amount of binding between the protein and the IL-l3 ci or fragment in the first binding mixture; o(c) combining a compound with the protein and the IL- 13 or fragment to form a second binding mixture; o(d) measuring the amount of binding in the second binding mixture; and Cl(e) comparing the amount of binding in the first binding mnixtur with the amount of binding in the second binding mnixture; wherein the compound is capable of inhibiting EIL-13 binding to the IL, l3bc protein or 1Lr13 receptor when a decrease in the amount of binding of the second binding mixture occurs. Inhibitors of IL-13R identified by these methods and pharmaceutical compositions containing them are also provided.
Methods of inhibiting binding of IL-13 to the IL-l3bc proteins or IL-13 receptor in a mnanmnalian subject are also disclosed which comprise administering a therapeutically effective amount of a composition containing an IL- l3bc protein, an I1L-l3bc or IL- 13R inhibitor or an antibody to an ItL, 3bc protein.
Methods are also provided for potentiating IL- 13 activity, which comprise combining a protein having IL- 13 activity with a protein of claim I1I and contacting such combination with a cell expressing at least one chain of IL-i 3R other than R,- 1 3bc. 'Preferably, the contacting step is performed by administering a therapeutically effective amount of such combination to a mammalian subject.
Further methods are provided for treating an IL-i 3-relaxed condition in a mammalian subject, said method comprising administering a therapeutically effective amount of a composition comprising an IL-13 antagonist and a pharmaceutically acceptable carrier. Other methods provide for a method of inhibiting the interaction of IL- 13 with an IL-I 3bc protein in a mammalian subject in 0 o comprising administering a therapeutically effective amount of a composition comprising an IL-13 antagonist and a pharmaceutically acceptable carrier.
c Preferably, the antagonist is selected from the group consisting of an IL-13bc 11 protein, a soluble form of IL-13Ral, an antibody to IL-13 or an L-13-binding c 5 fragment thereof, an antibody to IL-13bc or an IL- 13bc-binding fragment thereof, an antibody to IL-13Ral or an IL-13Ral-binding fragment thereof, IL13R- 0binding mutants of IL-4, a small molecule capable of inhibiting the interaction of c-,i C IL-13 with IL- 13bc and a small molecule capable of inhibiting the interaction of IL- ,i o 13 with IL-13Ral.
c-,i o Brief Description of the Figure SFig. 1: The figure presents photographs of IL-13, IL-4, IL- 11 and mock transfected COS cells after exposure to IL-13bc-Fc as described in Example 4 below.
Fig. 2: Reversal of allergen-induced airway hyper responsiveness by in vivo blockade of interleukin-13. 10 days after initial intrawracheal challenge, OVA- and PBS-immunized mice were again challenged intratracheally with either OVA or PBS. Mice were given sIL-13bc-Fc (400ug) or an equivalent amount of control hu- IgG by intraperitoneal injection on Day 0, 1 and +3 of the secondary antigen challenge. The allergic phenotype was assessed 4 days after the PBS or OVA challenge. Airway hyper responsiveness (AHR) to acetylcholine challenge, defined by the time-integrated rise in peak airway pressure (airway-pressure-time index [APTI] in cmHO x sec). Inflammatory cell composition of bronchoalveolar lavage fluids. Cell differential percentages were determined by light microscopic evaluation of cytospin preparations. Data are expressed as absolute numbers of cells. OVA-specific serum IgE concentrations. Results are means SEM of 8-10 animals per group. *P 0.05 compared with respective PBS control groups; 0.05 compared to OVA/Hu-Ig group (one-way ANOVA followed by Fisher's least significant difference test for multiple comparisons).
Fig. 3: Effects of IL-13 blockade on allergen-driven increases in mucuscontaining cells in the airway epithelium. Lung sections (N 4 per experimental
O
o group, four sections per animal) were fixed in formalin, cut into tOum sections and stained with hematoxylin and eosin, and periodic acid Schiff. Representative sections are shown. Bars =100 urn. PBS/Hu-Ig: PBS-immunized and challenged controls, demonstrating few mucus-containing cells. OVA/Hu-lg: allergen-induced increases in interstitial inflammatory cells and increases in the number of goblet cells containing mucus. OVA/sIL-13bc-Fc: dramatic inhibitory effect of IL-13 blockade on allergen-induced goblet cell mucus production.
Fig. 4: IL-13 induction of airway hyperreactivity. Naive mice were given recombinant IL-13 (5 ug/mouse, 50 ul volume) or PBS daily by intratracheal instillation. 24 hrs after the last treatment, Airway hyper responsiveness, (B) o BAL eosinophil levels, Serum total IgE levels, and Mucus score were C'i determined. Results are means SEM (vertical bars) of 7-10 animals per group.
*P 0.05 compared to PBS group (Student's t test).
Detailed Description of Preferred Embodiments The inventors of the present application have for the first time identified and provided polynucleotides encoding the IL-13 binding chain of IL-13R (hereinafter "IL-13bc"), including without limitation polynucleotides encoding murine and human IL-13bc.
SEQ ID NO: 1 provides the nucleotide sequence of a cDNA encoding the murine IL-13bc. SEQ ID NO:2 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-21. The mature murine IL-13bc is believed to have the sequence of amino acids 22-383 of SEQ ID NO:2. The mature murine receptor chain has at least three distinct domains: an extracellular domain (comprising approximately amino acids 22-334 of SEQ ID NO:2), a transmembrane domain (comprising approximately amino acids 335-356 of SEQ ID NO:2) and an intracellular domain (comprising approximately amino acids 357-383 of SEQ ID NO:2).
SEQ ID NO:3 provides the nucleotide sequence of a cDNA encoding the human IL-13bc. SEQ ID NO:4 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-25. The mature human IL- 13bc is believed to have the sequence of amino acids 26-380 of 0 o SEQ ID NO:4. The mature human receptor chain has at least three distinct domains: an extracellular domain (comprising approximately amino acids 26-341 of SEQ ID NO:4), a transmembrane domain (comprising approximately amino acids 342-362 of SEQ ID NO:4) and an intracellular domain (comprising c- 5 approximately amino acids 363-380 of SEQ ID NO:4).
The first 81 amino acids of the human IL-13bc sequence are identical to the translated sequence of an expressed sequence tag (EST) identified as "yg99f10.r I ci C- Homo sapiens cDNA clone 41648 and assigned database accession number o R52795.gb_est2. There are no homologies or sequence motifs in this EST sequence which would lead those skilled in the art to identify the encoded protein o as a cytokine receptor. A cDNA clone corresponding to this database entry is ci publicly-available from the I.M.A.G.E. Consortium. Subsequent to the priority date of the present application, such clone was ordered by applicants and sequenced. The sequence of such clone was determined to be the sequence previously-reported by applicants as SEQ ID NO:3 herein.
Soluble forms of IL-I 3bc protein can also be produced. Such soluble forms include without limitation proteins comprising amino acids 1-334 or 22-334 of SEQ ID NO:2 or amino acids 1-341 or 26-341 of SEQ ID NO:4. The soluble forms of the IL- 13bc are further characterized by being soluble in aqueous solution, preferably at room temperature. IL-13bc proteins comprising only the intracellular domain or a portion thereof may also be produced. Any forms of IL-13bc of less than full length are encompassed within the present invention and are referred to herein collectively with full length and mature forms as "IL-I3bc" or "IL-13bc proteins." IL-13bc proteins of less than full length may be produced by expressing a corresponding fragment of the polynucleotide encoding the full-length lL-13bc protein (SEQ ID NO: 1 or SEQ ID NO:3). These corresponding polynucleotide fragments are also part of the present invention. Modified polynucleotides as described above may be made by standard molecular biology techniques, including construction of appropriate desired deletion mutants, site-directed mutagenesis methods or by the polymerase chain reaction using appropriate oligonucleotide primers.
in 0 o For the purposes of the present invention, a protein has "a biological activity of the IL-13 receptor binding chain" if it possess one or more of the c following characteristics: the ability to bind IL-13 or a fragment thereof S(preferably a biologically active fragment thereof); and/or the ability to interact with the second non-IL-13-binding chain of [IL.-13R to produce a signal characteristic of the binding of IL-13 to IL-13R. Preferably, the biological activity Spossessed by the protein is the ability to bind IL-13 or a fragment hereof, more q preferably with a K D of about 0.1 to about 100 nM. Methods for determining ci Swhether a particular protein or peptide has such activity include without limitation the methods described in the examples provided herein.
o IL-13bc or active fragments thereof (IL-13bc proteins) may be fused to Cl carrier molecules such as immunoglobulins. For example, soluble forms of the IL- 13bc may be fused through "linker" sequences to the Fc portion of an immunoglobulin. Other fusions proteins, such as those with GST, Lex-A or MBP, may also be used.
The invention also encompasses allelic variants of the nucleotide sequences as set forth in SEQ ID NO: 1 or SEQ ID NO:3, thai is, naturally-occurring alternative forms of the isolated polynucleotide of SEQ ID NO: 1 or SEQ ID NO:3 which also encode IL- 13bc proteins, preferably those proteins having a biological activity of IL-13bc. Also included in the invention are isolated polynucleotides which hybridize to the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO:3 under highly stringent conditions (for example, 0.lxSSC at 65°C). Isolated polynucleotides which encode IL-13bc proteins but which differ from the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO:3 by virtue of the degeneracy of the genetic code are also encompassed by the present invention.
Variations in the nucleotide sequence as set forth in SEQ ID NO: 1 or SEQ ID NO:3 which are caused by point mutations or by induced modifications are also included in the invention.
The present invention also provides polynucleotides encoding homologues of the murine and human IL-13bc from other animal species, particularly other mammalian species. Species homologues can be identified and isolated by making "I probes or primers from the murine or human sequences disclosed herein and screening a library from an appropriate species, such as for example libraries 1 constructed from PBMCs, thymus or testis of the relevant species.
The isolated polynucleotides of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 (1991), in order to produce C' the IL-I 3bc protein recombinantly. Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also o known and are exemplified in R. Kaufman, Methods in Enzymology 185, 537-566 tn 10 (1990). As defined herein "operably linked" means enzymatically or chemically o ligated to form a covalent bond between the isolated polynucleotide of the invention and the expression control sequence, in such a way that the IL-13bc protein is expressed by a host cell which has been transformed (transfected) with the ligated polynucleotide/expression control sequence.
A number of types of cells may act as suitable host cells for expression of the IL-13bc protein. Any cell type capable of expressing functional IL-13bc protein may be used. Suitable mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human Colo205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, U937. HaK, Rat2, BaF3, 32D, FDCP-1, PC12, Mix or C2C12 cells.
The IL- 13bc protein may also be produced by operably linking the isolated polynucleotide of the invention to suitable control sequences in one or more insect expression vectors, and employing an insect expression system. Materials and methods for baculovirus/minsect cell expression systems are commercially available in kit form from, Invitrogen, San Diego, California, U.S.A. (the MaxBac® kit), and such methods are well known in the anrt, as described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987), incorporated herein by reference. Soluble forms of the IL-1 3bc protein may also o be produced in insect cells using appropriate isolated polynucleotides as described above.
CAlternatively, the IL-13bc protein may be produced in lower eukaryotes Ssuch as yeast or in prokaryotes such as bacteria- Suitable yeast strains include 5 Saccharomycs cerevisiac, Schizosaccharomyces pombe, Kluyveromnyces strains, Candida, or any yeast strain capable of expressing heterologous proteins. Suitable bacterial strains include Escherichia coli. Bacillus subrilis, Salmonella ci typhimuriumn, or any bacterial strain capable of expressing heterologous proteins.
SExpression in bacteria may result in formation of inclusion bodies 10 incorporating the recombinant protein. Thus, refolding of the recombinant protein 0may be required in order to produce active or more active material. Several xl methods for obtaining correctly folded heterologous proteins from bacterial inclusion bodies are known in the art. These methods generally involve solubilizing the protein from the inclusion bodies, then denaturing the protein completely using a chaowropic agent. When cysteine residues are present in the primary amino acid sequence of the protein, it is often necessary to accomplish the refolding in an environment which allows correct formation of disulfide bonds (a redox system). General methods of refolding are disclosed in Kohno, Meth.
Enzvm., 185:187-195 (1990). EP 0433225 and copending application USSN 08/163,877 describe other appropriate methods.
The IL-1 3bc protein of the invention may also be expressed as a product of transgenic animals, as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a polynucleotide sequence encoding the IL-13bc protein.
The IL-13bc protein of the invention may be prepared by growing a culture transformed host cells under culture conditions necessary to express the desired protein. The resulting expressed protein may then be purified from the culture medium or cell extracts. Soluble forms of the IL-13bc protein of the invention can be purified from conditioned media. Membrane-bound forms of IL-13bc protein of the invention can be purified by preparing a total membrane fraction from the 0 o expressing cell and extracting the membranes with a non-ionic detergent such as Triton X-100.
1 The IL-13bc protein can be purified using methods known to those skilled in the art. For example, the IL-1 3bc protein of the invention can be concentrated c' 5 using a commercially available protein concentration filter, for example, an Arnicon or Millipore Pellicon ultrafiltration unit. Following the concentration step, 0the concentrate can be applied to a purification matrix such as a gel filtration c'i medium. Alternatively, an anion exchange resin can be employed, for example, a o matrix or substrate having pendant diethylaminoethyl (DEAE) or polyetheyleneirnine (PEI) groups. The matrices can be acrylamide, agarose, o dextran, cellulose or other types commonly employed in protein purification.
Alternatively, a cation exchange step can be employed. Suitable cation exchangers include various insoluble matrices comprising sulfopropyi or carboxymethyl groups. Sulfopropyl groups are preferred S-Sepharose® columns). The purification of the IL- 13bc protein from culture supernatant may also include one or more column steps over such affinity resins as concanavalin A-agarose, heparintoyopearl® or Cibacrom blue 3GA Sepharose®; or by hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or by immunoaffinity chromatography. Finally, one or more reverse-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP- HPLC media, silica gel having pendant methyl or other aliphatic groups, can be employed to further purify the IL-13bc protein. Affinity columns including IL- 13 or fragments thereof or including antibodies to the IL-13bc protein can also be used in purification in accordance with known methods. Some or all of the foregoing purification steps, in various combinations or with other known methods, can also be employed to provide a substantially purified isolated recombinant protein. Preferably, the isolated IL-13bc protein is purified so that it is substantially free of other mammalian proteins.
IL-13bc proteins of the invention may also be used to screen for agents which are capable of binding to IL-13bc or IL-13R or which interfere with the binding of IL-13 to the IL- 13 or IL-13bc (either the extracellular or intracellular o domains) and thus may act as inhibitors of normal binding and cytokine action 1R inhibitors"). Binding assays using a desired binding protein. immobilized or not, are well known in the art and may be used for this purpose using the IL- 13kc protein of the invention. Purified cell based or protein based (cell free) screening assys may be used to identify such agents. For example, IL-3bc protein may be immobilized in purified form on a carrier and binding to purified I.-lI3bc protein may be measured in the presence and in the absence of potential inhibiting agents. A suitable binding assay may alternatively employ a soluble o form of IL- 13k of the invention. Another example of a system in which inhibitors may be screened is described in Example 2 below.
o In such a screening assay, a first binding mixture is formed by combining Cl IL- 13 or a fragment thereof and IL-l13bc protein, and the amount of binding in the first binding mixture (B 0 is measured. A second binding mixture is also formed by combining IL- 13 or a fragment thereof, IL- I 3kc protein, and the compound or agent to be screened, and the amount of binding in the second binding mixture (B) is measured. The amounts of binding in the first and second binding mixtures are compared. for example, by performing a calculation of the ratio B/B. A compound or agent is considered to be capable of inhibiting binding if a decrease in binding in the second binding mixture as compared to the first binding mixture is observed.
Optionally, the second chain of IL- 1 3R can be added to one or both of the binding mixtures. The formulation and optimization of binding mixtures is within the level of skill in the art, such binding mixtures may also contain buffers and salts necessary to enhance or to optimize binding, and additional control assays may be included in the screening assay of the invention.
Compounds found to reduce the binding activity of IL- I 3kc protein to 11-13 or its fragment to any degree, preferably by at least about 10%, more preferably greater than about 50% or more, may thus be identified and then secondarily screened in other binding assays and in vivo assays. By these means compounds having inhibitory activity for IL- 13bc binding which may be suitable as therapeutic agents may be identified.
0 o IL-13bc proteins, and polynucleodtides encoding them, may also be used as Cq diagnostic agents for detecting the expression or presence of IL-I 3bc, IL- 13R, IL- 0 13 or cells expressing IL- 13bc, IL- 13R or IL- 13. The proteins or polynucleotides r may be employed for such purpose in standard procedures for diagnostics assays 5 using these types of materials. Suitable methods are well known to those skilled in the art.
0" As used herein "IL-13R" refers to IL- 13bc and/or a second IL-13 receptor C-q C, chain known as "IL,-13Ral 1" or "NR4" (see: murine receptor chain, Hilton et al., o Proc. Natl. Acad- Sci. USA 1996,93:497-501; human receptor chain, Aman et al., J. Biol. Chem. 1996, 271:29265-70, and Gauchat et al., Ear. J. Immunol. 1997, o 27:971-8).
IL-13bc acts as a mediator of the known biological activities of IL-13. As a result, IL-13bc protein (particularly, soluble IL- 3bc proteins), IL-13R inhibitors antagonists of interaction of IL-13 with IL-13R (such as, for example, antibodies to IL-13R (including particularly to IL-13bc or to IL-13Rl) and fragments thereof, antibodies to IL-13 and fragments thereof, soluble IL-1 3Ral I proteins, and small molecule and other inhibitors of the interaction of IL-13 with IL-13R (including with IL- 13bc and/or with IL-13Ral) may be useful in treatment or modulation of various medical conditions in which IL- 13 is implicated or which are effected by the activity (or lack thereof) of IL-13 (collectively "IL-13-related conditions"). Mutated forms of RL-4 which bind to IL- 13R can also be used as IL- 13 antagonists (see, for example, those disclosed in Shanafelt et al., Proc. Natl.
Acad. Sci. USA 1998, 95:9454-8; Aversa et al., J. Exp. Med. 1993, 178:2213-8; and Grunewald et al., J. Imrmunol. 1998, 160:4004-9).
IL-13-related conditions include without limitation Ig-mediated conditions and diseases, particularly IgE-mediated conditions (including without limitation atopy, allergic conditions, asthma, immune complex diseases (such as, for example.
lupus, nephrotic syndrome, nephritis, glomerulonephritis, thyroiditis and Grave's disease)); inflammatory conditions of the lungs; immune deficiencies, specifically deficiencies in hematopoietic progenitor cells, or disorders relating thereto; cancer and other disease. Such pathological states may result from disease, exposure to o radiation or drugs, and include, for example, leukopenia, bacterial and viral C infections, anemia, B cell or T cell deficiencies such as immune cell or hematopoietic cell deficiency following a bone marrow transplantation. Since IL- 13 inhibits macrophage activation, EL-13bc proteins may also be useful to enhance macrophage activation in vaccination, treatment of mycobacterial or intracellular organisms, or parasitic infections).
IL- 13bc proteins may also be used to potentiate the effects of IL-13 in vitro C and in vivo. For example, an IL-13bc protein can be combined with a protein having IL-13 activity (preferably IL-13) and the resulting combination can be Cl 10 contacted with a cell expressing at least one chain of IL-13R other than IL-13bc S(preferably all chains of IL- 13R other than IL-I 3bc, such as IL- 13Ra Preferably, Cl, the contacting step is performed by administering a therapeutically effective amount of such combination to a mammalian subject in vivo. The pre-established association of the IL-13 protein with the IL- 3bc protein will aid in formation of the complete IL-13/IL,-13R complex necessary for proper signaling. See for example the methods described by Economides et al., Science 270:1351 (1995).
IL- 13bc protein and IL-13R inhibitors, purified from cells or recombinantly produced, may be used as a pharmaceutical composition when combined with a pharmaceutically acceptable carrier. Such a composition may contain, in addition to IL-13bc or inhibitor and carrier, various diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration.
The pharmaceutical composition of the invention may also contain cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, L-8, IL-9, IL- 10, IL-11, IL- 12, IL- 14, IL- G-CSF, stem cell factor, and erythropoietin. The pharmaceutical composition may also include anti-cytokine antibodies. The pharmaceutical composition may contain thrombolytic or anti-thrombotic factors such as plasminogen activator and Factor VIII. The pharmaceutical composition may further contain other anti- 0 inflammatory agents. Such additional factors and/or agents may be included in the C'4 pharmaceutical composition to produce a synergistic effect with isolated IL-13bc iprotein or IL- 13bc inhibitor, or to minimize side effects caused by the isolated IL- 13bc or IL- 13bc inhibitor. Conversely, isolated IL-I 3bc or IL- 13bc inhibitor may C 5 be included in formulations of the particular cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or andi-inflammatory O agent to minimize side effects of the cytokine, lymphokine, other hematopoictic ci C'i factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent.
c'i o The pharmaceutical composition of the invention may be in the form of a C'4 l 10 liposome in which isolated IL- 13bc protein or IL- 13bc inhibitor is combined, in 0 Saddition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamrnellar layers which in aqueous solution. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like.
Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Patent No. 4,235,871; U.S. Patent No. 4,501,728; U.S. Patent No. 4,837,028; and U.S. Patent No. 4,737,323, all of which are incorporated herein by reference.
As used herein, the term "therapeutically effective amount" means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, amelioration of symptoms of, healing of, or increase in rate of healing of such conditions. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to a combination, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
In practicing the method of treatment or use of the present invention, a therapeutically effective amount of isolated IL-13bc protein or IL- l3bc inhibitor is administered to a mammal. Isolated IL-13bc protein or IL-13bc inhibitor may be administered in accordance with the method of the invention either alone or in o combination with other therapies such as treatments employing cytokines, lymphokines or other hematopoietic factors. When co-administered with one or more cytokines, lymphokines or other hematopoietic factors, IL-I 3bc protein or IL- 13bc inhibitor may be administered either simultaneously with the cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors, or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering IL-13bc protein or IL-13bc inhibitor in combination with cytokine(s), lymphokine(s), other hematopoictic factor(s), thrombolytic or anti-thrombotic factors.
Ci 10 Administration of IL-13bc protein or IL-13bc inhibitor used in the Opharmaceutical composition or to practice the method of the present invention can C'I be carried out in a variety of conventional ways, such as oral ingestion, inhalation, or cutaneous, subcutaneous, or intravenous injection. Intravenous administration to the patient is preferred.
When a therapeutically effective amount of IL-13bc protein or IL13bc inhibitor is administered orally, IL-13bc protein or IL-13bc inhibitor will be in the form of a tablet, capsule, powder, solution or elixir. When administered in tablet form, the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant. The tablet, capsule, and powder contain from about 5 to 95% IL- 3bc protein or IL-13bc inhibitor, and preferably from about 25 to 90% IL-13bc protein or IL- 13bc inhibitor. When administered in liquid form, a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added. The liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol. When administered in liquid form, the pharmaceutical composition contains from about to 90% by weight of IL- 3bc protein or IL- 13bc inhibitor, and preferably from about I to 50% IL-13bc protein or IL-13bc inhibitor.
When a therapeutically effective amount of IL-13bc protein or IL-13bc inhibitor is administered by intravenous, cutaneous or subcutaneous injection, ILo 1 3bc protein or 3bc inhibitor will be in the form of a pyrogen-free, parenterally acceptable aqueous solution. The preparation of such parenterally acceptable protein solutions, 'having due regard to pH, isotonicity, stability, and the like, is within the skill in the art. A preferred pharmaceutical composition for intravenous, c'i 5 cutaneous, or subcutaneous injection should contain, in addition to IL- 13bc protein or IL-13bc inhibitor an isotonic vehicle such as Sodium Chloride Injection, Ringers Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, ciq ci Lactated Ringer's Injection, or other vehicle as known in the art. The opharmaceutical composition of the present invention may also contain stabilis, ciq preservatives, buffers, antioxidants, or other additive known to those of skill in the oart_ ci The amount of -3be protein or IL- 13b inhibitor in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone. Ultimately, the attending physician will decide the amount of IL, 13be protein or IL-13be inhibitor with which to treat each individual patient.
Initially, the attending physician will administer low doses of IL-13be protein or IL-13bc inhibitor and observe the patient's response. Larger doses of IL-l3bc protein or IL-13bc inhibitor may be administered until the optimal therapeutic effecf is obtained for the patient, and at that point the dosage is not generally increased further. It is contemplated that the various pharmaceutical compositions used to practice the method of the present invention should contain about 0.1 pg to about 100 mg of IL- I3bc protein or IL- I3b inhibitor per kg body weight.
The duration of intravenous therapy using the pharmaceutical composition of the present invention will Yary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient. It is contemplated that the duration of each application of the IL-13bc protein or IL- 13b inhibitor Will be in the range of 12 to 24 hours of continuous intravenous administration. Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention.
o IL-13bc proteins of the invention may also be used to immunize animals to Ci obtain polyclonal and monoclonal antibodies which specifically react with the IL- 13bc protein and which may inhibit binding of IL-13 or fragments thereof to the receptor. Such antibodies may be obtained using the entire IL-13bc as an immunogen, or by using fragments of IL-13bc, such as the soluble mature IL-13bc.
Smaller fragments of the IL-13bc may also be used to immunize animals. The peptide immunogens additionally may contain a cysteine residue at the carboxyl C' terminus, and are conjugated to a hapten such as keyhole limpet bemocyanin Ci (KLH). Additional peptide immunogens may be generated by replacing tyrosine C, 10 residues with sulfated tyrosine residues. Methods for synthesizing such peptides o are known in the art, for example, as in R.P. Merrifield, J.Amer.Chem.Soc. C 2149-2154 (1963); J.L. Krstenansky, et al., FEBS Lett. 211, 10(1987).
Neutralizing or non-neutralizing antibodies (preferably monoclonal antibodies) binding to IL 13bc protein may also be useful therapeutics for certain tumors and also in the treatment of conditions described above. These neutralizing monoclonal antibodies may be capable of blocking IL-13 binding to the IL-13bc.
Example 1 Isolation of IL-13bc cDNAs Isolation of the murine IL-13 receptor chain.
ug of polyA+ RNA was prepared from the thymuses of 6-8 week old C3H/HeJ mice. Double stranded, hemimethylated cDNA was prepared using Stratagene's cDNA synthesis kit according to manufacturers instructions. Briefly, the first strand was primed with an oligodT-Xho primer, and after second strand synthesis, EcoRI adapters were added, and the cDNA was digested with Xhol, and purified. The cDNA was ligated to the XhoI-EcoRI sites of the Zap Express (Stratagene) lambda vector, and packaged using Gigapak II Gold packaging extracts (Stratagene) according to the manufacturers instructions. A library of x 106 resulting recombinant phage was amplified following manufacturer's instructions. This library was screened with a degenerate 17mer oligonucleotide probe of the sequence KSRCTCCABK CRCTCCA (SEQ ID NO:5) (K G+T; S=
I
O
o C+G; R=A+G; B=C+G+T) using standard TMAC hybridization conditions as described (Current Protocols in Molecular Biology, Ausubel, et al., editors., John Wiley and Sons, 1995, section Clone A25 was identified because it hybridized to the 17mer probe, but not to probes derived from known C 5 hematopoietin receptors. This clone was isolated in plasmid form from the ZapExpress vector as per manufacturers instruction, and the DNA sequence was Sdetermined. The DNA sequence encoded a novel member of the hematopoietin c receptor family.
SClone A25 containing the polynucleotide having the sequence of SEQ ID NO: 1 was deposited with ATCC as pA25pBKCMV at accession number 69997 on 0 SFebruary 22, 1996.
Isolation of the human IL-13 receptor chain.
A partial fragment of the human homolog of the murine receptor was isolated by PCR using oligonucleotides derived from the murine sequence. cDNA was prepared from human testis polyA+ RNA that was obtained from Clontech.
A DNA fragment of 274 base pairs was amplified from this cDNA by PCR with the following oligonucleotides: ATAGTTAAACCATTGCCACC (SEQ ID NO:6) and CTCCATrCGCTCCAAATTCC (SEQ ID NO:7) using AmpliTaq polymerase (Promega) in IX Taq buffer containing 1.5 mM MgC12 for 30 cycles of incubation (94*C x 1 minute, 42'C for I minute, and 72°C for 1 minute). The DNA sequence of this fragment was determined, and two oligonucleotides were prepared from an internal portion of this fragment with the following sequence: AGTCTATCTTACTTrrACTCG (SEQ ID NO:8) and CATCTGAGCAATAAATATTCAC (SEQ ID NO:9). These oligonucleotides were used as probes to screen a human testis cDNA library purchased from CLONTECH (cat #HLI 161) Filters were hybridized at 52 0 C using standard hybridization conditions and washed in 2X SSC at 52C Twenty two clones were isolated that hybridized to both oligonucleotides in a screen of 400,000 clones. DNA sequence was determined from four of the cDNA clones, and all encoded the same novel hematopoictin receptor. The predicted DNA sequence of the full length human receptor chain is shown as SEQ ID NO:3.
The human clone was deposited with ATCC as phA25#ll11pDR2 at accession number 69998 on February 22, 1996.
Example 2 Expression of Soluble IL-13bc Protein and C, Assay of Activity Cl 10 Production and purification of soluble IL-13bc-Ig.
o DNA encoding amino acids 1-331 of the extracellular domain of murine ILl, 1l3bc was fused to a spacer sequence encoding gly-ser-gly by PCR and ligated in frame with sequences encoding the hinge CH2 CH3 regions of human IgGI of the COS- 1 expression vector pED.Fc IL-13bc-lg was produced from DEAE-dextran transfected COS-1 cells and purified via protein A sepharose chromatography (Pharmacia).
B9 proliferation assay Stimulation of proliferation of B9 cells (Aarden et al. Eur. J. Immunol.
1987. 17:1411-1416) in response to IL-13 or [L-4 was measured by 3H-thymidine incorporation into DNA. Cells (5 x 103/well) were seeded into 96 well plates with media containing growth factors at varying concentrations in the presence or absence of IL-13bc-Ig at lug/ml. After incubation for 3 days luCi/well of 3Hthymidine was added and the cells incubated for an additional 4 hrs. Incorporated radioactivity was determined using a LKB 1205 Plate reader.
The B9 cell line proliferated in response to IL-13, IL-4 or II.-6. Only responses to IL-13 were inhibited by the soluble IL-13bc-Ig, indicating that this receptor binds IL-13 specifically, but not IL-4 or IL-6. The tables show cpm. Two separate experiments are shown.
2005202229 24 May 2005 cytokine IL- 13 IL-13 plus 1L-4 1L-4 plus Cos 1L-6 dilution (Jng/m1) A25-Fc (20 nglml) A25-Fc (1/10,000) lug/mi) (l ug/mi0) 137734 1943 6443 6945 37887 1/3 30398 1571 2680 2442 36500 1/10 16101 1461 1767 1771 33335 1/30 2148 1567 1619 1783 27271 1/100 1574 1419 1522 1576 188311 1/300 1512 1531 1373 1577 7768 1U1000 1316 1392 1190 1474 2760 1/3000 1834 1994 1482 1819 1672 2005202229 24 May 2005 cytokine IL-U 13L- 13 plus IL-4 IL- plus Cos IL-6 Cos IL-6 dilution (3ng/ml) A25-Fc (20 nglrnl) A25-Fc (1/10,0)00) pius (Stag/mi) 1 6413 295 1216 1158 6969 7703 1/3 5432 281 518 656 7827 8804 1/10 2051 281 489 520 8345 10027 1/30 506 319 279 476 8680 9114 1/l00 430 372 288 423 7426 10364 1/300 330 287 323 420 5531 6 2 54A 1/1000 326 389 348 nt2524 nt no cytokine 339 279 404 394 326 279 SExample 3 Direct Binding of Soluble IL-l3bc to IL-13 Measured by Surface Plasmon Resonance (Biacore Analysis).
C 5 A Biacore biosensor was used to measure directly the specific binding of IL-13 to purified IL-13bc-Ig (Phannacia, Johnsson et al., 1991). Approximately 10,000 to 17,000 resonance units (RU) of purified IL-13bc-Ig human IgGI or C' irrelevant receptor were each covalently immobilized to different flow cells on the O sensor chip as recommended by the manufacturer. (RU's are a refelction of the tl, 10 mass of protein bound to the sensor chip surface.) Purified IL-13 was injected 0 0 across the flow cells at 5 ul/min for 10 mins in the presence or absence of excess purified IL-13bc-Ig. Binding was quantified as the difference in RU before and after sample injection. Specific IL-13 binding of 481.9 RU was observed only for immobilized IL-13bc-Ig whereas coinjection of IL- 13 plus IL- 13bc-Ig resulted in no binding to the immobilized IL- 13bc-Ig (4 RU). No IL- 13 binding was observed for either immobilized IgG or IL-11 R-Ig (5.4 and 3.7 RU respectively).
2005202229 24 May 2005 Sample IL-13bc-Ig IgG control IL-l R-Ig (10,383 RU) (13,399 RU) (17,182 RU) 100 ng/ml human IL-13 481.9 RU bound 5.4 RU bound 3.7 RU bound 100 ng/ml human IL-13 4.0 RU bound not tested not tested soluble IL-13bc-Ig
O
0 Example 4 Binding of IL-13 Expressed in COS Cells to Labeled IL-13BC-Ig Fusion Protein: COS in situ Detection of IL-13 with IL-13bc-Fc (C Expression vectors for IL-13, IL-4, IL-11 or empty vector were transfected into COS-1 cells in duplicated plates via the DEAE-dextran method. Two days after transfection cells were washed twice in phosphate buffered saline (PBS) and O fixed in the culture dish for 10' at 40 C with methanol. Following fixation cells 10 were washed twice with PBS then rinsed once with binding buffer (PBS, 1% (w/v) 0 Sbovine serum albumin, 1% sodium azide) and incubated for two hours at 4° C in binding buffer with IL-13bc-Fc at 1.Oug/ml or with relevant anti-cytokine antisera. Cells were washed twice with PBS and incubated at 4o C with shaking in alkaline phosphatase labeled Rabbit F(ab)2' anti-human IgG diluted 1:500 in binding buffer (for Fe fusion detection) or Rabbit F(ab)2' anti-rat IgG (for anticytokine detection) Cells were again washed twice in PBS. Alkaline phosphatase activity was visualized using nitro blue tetrazolium and 5-bromo-4-chloro-3indolyl-phosphate.
Specific binding was visualized under the microscope. Only cells transfected with IL-13 showed specific binding to IL13bc-Ig. (see photo of transfected cells, the Figure).
Example Other Systems for Determination Biological Activity of IL-13bc Protein Other systems can be used to determine whether a specific IL-I 3bc protein exhibits a "biological activity" of IL-13bc as defined herein. The following are examples of such systems.
Assays for IL-13 Binding The ability of a IL- 13bc protein to bind IL- 13 or a fragment thereof can be determine by any suitable assays which can detect such binding. Some suitable examples follow.
Binding of IL-13 to the extracellular region of the IL-13bc protein will specifically cause a rapid induction of phosphotyrosine on the receptor protein.
C']
Assays for ligand binding activity as measured by induction of phosphorylation are described below.
C' Alternatively, a ILI -13bc protein (such as, for example, a soluble form of the extracellular domain) is produced and used to detect IL- 13 binding. For example, 10 a DNA construct is prepared in which the extracellular domain (truncated prior, 0 preferably immediately prior, to the predicted transmembrane domain) is ligated 0' in frame to a cDNA encoding the hinge C, 2 and CH 3 domains of a human immunoglobulin (Ig) y1l. This construct is generated in an appropriate expression vector for COS cells, such as pEDAC or pMT2. The plasmid is transiently transfected into COS cells. The secreted IL-13bc-Ig fusion protein is collected in the conditioned medium and purified by protein A chromatography.
The purified I. 13bc-Ig fusion protein is used to demonstrate IL-13 binding in a number of applications. IL- 13 can be coated onto the surface of an enzymelinked immunosorbent assay (ELISA) plate, and then additional binding sites blocked with bovine serum albumin or casein using standard ELISA buffers. The IL-13bc-Ig fusion protein is then bound to the solid-phase IL-13, and binding is detected with a secondary goat anti-human Ig conjugated to horseradish peroxidase.
The activity of specifically bound enzyme can be measured with a colorimetric substrate, such as tetramethyl benzidine and absorbance readings.
IL-13 may also be expressed on the surface of cells, for example by providing a transmembrane domain or glucosyl phosphatidyl inositol (GPI) linkage. Cells expressing the membrane bound IL-13 can be identified using the IL-13bc-Ig fusion protein. The soluble IL-13bc-lg fusion is bound to the surface of these cells and detected with goat anti-human Ig conjugated to a fluorochrome, such as fluorescein isothiocyanate and flow cytomeiry.
Interaction Trap Cxl SA yeast genetic selection method, the "interaction trap" [Gyuris et al. Cell 75:791-803, 1993], can be used to determine whether a IL-13bc protein has a biological activity of IL,-13bc as defined herein. In this system, the expression of Cl 5 reporter genes from both LexAop-Leu2 and LexAop-LacZ relies on the interaction between the bait protein, for example in this case a species which interacts with Shuman IL-13bc, and the prey, for example in this case the human IL-13bc protein.
Cxl C"l Thus, one can measure the strength of the interaction by the level of Leu2 or LacZ C<l o expression. The most simple method is to measure the activity of the LacZ C~l 10 encoded protein, P-galactosidase. This activity can be judged by the degree of o blueness on the X-Gal containing medium or filter. For the quantitative measurement of P-galactosidase activity, standard assays can be found in "Methods in Yeast Genetics" Cold Spring Harbor, New York. 1990 (by Rose, Winston, and Hieter, In such methods, if one wishes to determine whether the IL-13bc protein interacts with a particular species (such as, for example, a cytosolic protein which binds to the intracellular domain of the IL- 13bc in vivo), that species can be used as the "bait" in the interaction trap with the IL- 13bc protein to be tested serving as the "prey", or vice versa.
Example 6 Treatment of Asthma Using Soluble IL- 13bc Protein A well-characterized murine model of allergic asthma was used, in which allergen exposure leads to airway hyper responsiveness pulmonary eosinophilia, elevations in antigen-specific serum IgE levels, and increases in airway epithelial mucus content 11). Male A/J mice were immunized intraperitoneally and subsequently challenged intratracheally with soluble ovalbumrnin (OVA), the allergic phenotype being assessed 4 days after antigen challenge Blockade of IL-13 was performed by the systemic administration of a soluble IL-13bc-IgGFc fusion protein (sIL-13bc-Fc), which specifically binds to and neutralizes IL-13, 24 hours before subsequent intratracheal allergen O challenge Challenge of allergen-imnmunized mice resulted in significant Cl increases in airway responsiveness to acetylcholine (15) (Fig. 2A). Blockade of ILc 13 resulted in complete reversal of such established allergen-induced AHR; thus IL- 13 is necessary for the expression of AHR in this model. The ability of IL- 13 ablation to reverse AHR after full development of the phenotype of allergic asthma Cl contrasts with the inability of IL-4 ablation to accomplish such a reversal. The mechanism underlying the effectiveness of IL-4Ru blockade in reversing allergen- Cl induced AHR may be the inhibition of IL-13-mediated processes, consistent with Cl COl the fact that Stat6 activation is downstream of IL-4Ra-mrnediated signaling for both 0 Cl 10 cytokines. IL-13 is probably the primary CD4+ T cell-derived factor responsible o for allergen-induced AHR.
i To evaluate candidate mechanisms underlying IL-I 3-dependent expression of AHR, we characterized known allergic effector cascades. Eosinophils have been implicated as primary effector cells in asthma and asthmatic AHR but inhibition of IL-13 prior to repeat antigen provocation did not significantly affect allergen-induced pulmonary eosinophilia (17) (Fig. 2B3). To assess the relevance of IgE-mediated pathways, we measured OVA-specific serum IgE OVAspecific levels of IgE were observed in OVA-sensitized and -challenged mice, whereas no antigen-specific antibody levels were detected in PBS-immunized and -challenged mice (Fig. 2C). Blockade of IL-13 did not alter OVA-specific IgE levels, a lack of suppression which is likely due to the fact that IL-13 blockade occurred after initial antigen priming and antibody formation. Nonetheless, these results show that AHR is not dependent upon IgE production in this model, consistent with reports that allergic AHR develops normally in IgE deficient and B cell deficient mice (19).
In congruence with the pathology of human asthma, allergic asthma in murine models is associated with a marked increase in the mucus content of the airway epithelium 11). Mucus hypersecretion is particularly profound in autopsy specimens from patients who die of acute asthma attacks Blockade of IL-13 reverses allergen-induced increases in mucus- containing cells in the airways (Fig. demonstrating that allergen-induced increases in airway mucus content are dependent upon IL-13. IL-4 is also implicated in this process, as IL-4 ransgenic mice display marked goblet cell hyperplasia in the absence of antigen sensitization However, transfer of Th2 clones from both IL-4-deficient and control mice into murine airways induces mucus overproduction suggesting, iyet again, that the immunoregulatory role of IL-4 needs to be carefully differentiated from its role as an effector molecule.
Daily administration of recombinant IL- 13 (rIL-13) to the airways of naive 0(unimmunized) mice induced AHR, demonstrating that increases in IL-13 activity were sufficient to induce AHR (Fig. 4A) AHR developed by 72 hours after the start of rIL-13 administration. A significant influx of eosinophils into 10 bronchoalveolar lavage fluid was observed early after rIL-13 administration, o however pulmonary eosinophilia was not observed at the time of expression of C'l AHR (Fig. 4B). Although the significance of the time course of eosinophil influx remains unclear, it suggests that IL-13 alone may be sufficient to initiate eosinophilic infiltration of the airways, perhaps through its ability to upregulate chemokine expression Airway administration of rIL-13 also resulted in a time-dependent increase in total serum IgE (Fig. 4C) in line with the previously-reported ability of IL-13 to regulate IgE synthesis Increases in serum IgE were independent of any immunization with allergen, findings that resonate with the observation that the human asthmatic phenotype correlates better with total, rather than allergen-specific, serum IgE concentrations As predicted from the above IL-13 inhibition studies, the administration of rIL-13 induced an increase in airway mucus production (Fig. 4D) (27).
References and Notes 1. R. M. Sly, Ann. Allergy 53, 20 (1984); R. Evans et al., Chest 91, (1987): N. Halfon and P. W. Newcheck, Am. J. Pub. Health 76, 1308 (1986); R.
M. Jackson, M. R. Sears, R. Beaglehole, H. H. Rea, Chest 94, 914 (1988); P. J.
Gergen and K. B. Weiss, JAMA 264, 1688 (1990); W. M. Vollmer, A. S. Buist, M.
L. Osborne, J. Clin. Epid. 45, 999 (1992).
2. R. Beasley, W. R. Roche, J. A. Roberts, S. T. Holgate. Am. Rev. Respir.
Dis. 139, 806 (1989); R. Pauwels, Clin. Exp. Allergyl9, 395 (1989); J. Bousquet et al., N. Eng. J. Med. 323, 1033 (1990).
S3. S. H. Gavett et al., Am. J Resp. Cell. Mol. Biol. 10, 587 (1994); A. A.
C Gerblich, H. Salik, M. R. Schuyler, Amer. Rev. Resp. Dis. 143, 533 (1991); C. J.
Corrigan, A. B. Kay, Am. Rev. Resp. Dis. 141, 970 (1990); D. S. Robinson et al., N. EngL J. Med. 326, 298 (1992); C. Walker et al., Am. Rev. Resp. Dis. 146, 109 (1992); S. H. Gavett et al., J. Exp. Med. 182, 1527 (1995); N. W. Lukacs, R. M.
Stricter, S. W. Chensue, S. L. Kunkel, Am. J. Resp. Cell Mol. Biol. 10, 526 (1994).
4. F. D. Finkelman et al., J. Immunol. 141, 2335 (1988); J. M. Wang et al., C Eur. J. Immunol. 19,701 (1989).
C
1 5. J. A. Rankin ct al., Proc. Nall Acad. Sci. USA 93, 7821 (1996).
10 6. G. Brusselle, J. Kips, G. Joos, H. Bluethmann, R. Pauwels, Am. J. Resp.
tt SCell. Mol. Biol. 12, 254 (1995); D. B. Corry, et al., J. Exp. Med. 183, 109 (1996); CN P. S. Foster et al., J. Exp. Med 183, 195 (1996).
7. A. J. Coyle et al., Am. J. Resp. Cell. Mol. Biol. 13, 54 (1995).
8. A. K. Abbas, K. M. Murphy, A. Sher, Nature 383,787 (1996).
9. S. P. Hogan, et al., J. Immunol. 161, 1501 (1998).
J. Punnonen et al., Proc. Natl. Acad Sci. USA 90, 3730 (1993); R. de Waal Malefyt, C. G. Figdor, J. E. de Vries, Res. Immuno. 144, 629 (1993); G. Zurawski, J. E. de Vries, ImmunoL Today 15, 19 (1994).
11. S. H. Gavett et al., Am. J. Physiol 272, L253 (1977); D. Kuperman, B.
Schofield, M. Wills-Karp, M. J. Grusby, J. Exp. Med. 187, 939 (1998).
12. S. M. Zurawski, G. Zurawski, EMBO J. 11, 3905 (1993); S. M. Zurawski et al., J. Biol. Chem. 270, (1995). Lin et al., Immunity 2, 331 (1995).
13. Six-week-old male A/J mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and were housed under laminar flow hoods in an environmentally-controlled specific pathogen-free animal facility for the duration of experiments (N 4-10 mice/experimental group). The studies reported here conformed to the principles for laboratory animal research outlined by the Animal Welfare Act and the Department of Health, Education and Welfare guidelines for the experimental use of animals. Mice were immunized by an intraperitoneal injection of 10 ug ovalbumin (OVA; Crude grade IV, Sigma; St.
Louis, MO) in 0.2 ml PBS or PBS alone. 14 days after immunization, mice were anesthetized with a mixture of ketamine and xylazine (45 and 8 mg/kg, 0 respectively) and challenged intratracheally with 50 ul of a 1.5% solution of OVA or an equivalent volume of PBS as a control. 10 days after this first antigen challenge, mice were challenged again intratracheally with either OVA or PBS.
Characterization of the allergic phenotype was performed 96 hours after the second antigen challenge.
14. Human IL- 13bc was cloned as described above. For soluble expression of the murine homolog, a pED expression vector containing DNA encoding the Cl murine slL-13bc extracellular domain, fused in frame with the hinge CH2/CH3 O regions of human IgGI (as described in previous examples), was transfected into
CO
tt 10 CHO cells D. Donaldson et al., J. Immunol. 161,2317 (1998)]. The sIL-13bc- SFc was purified with rProtein A-Sepharose F. Urban et al., Immunity 8, 255 (1998)]. The in vitro ID,5, as determined by the ability to neutralize 3 ng/ml of murine IL-13 in the B9 proliferation assay was approximately 10 ng/ml. Human IgG, used as a control for sIL-13bc-Fc, was similarly purified by rProtein A- Sepharose chromatography from a 10% solution of human immune globulin that is commercially available for intravenous administration (Miles) [ibid]. Mice were given sIL-13bc-Fc (400ug), or an equivalent amount of the control hu-IgG, by intraperitoneal injection on Day 0, and +3 of secondary antigen challenge.
Airway reactivity to intravenous administration of acetylcholine was measured 3 days after final intratracheal challenge. Mice were anesthetized with sodium pentobarbital (90 mg/kg), intubated, ventilated at a rate of 120 breaths/minute with a constant tidal volume of air (0.2 ml), and paralyzed with decamethonium bromide (25 mg/kg). After establishment of a stable airway pressure, acetylcholine was injected intravenously (50 ug/kg) and dynamic airway pressure was followed for 5 minutes.
16. G. J. Gleich, J. All Clin. Immunol. 8,422 (1990).
17. Bronchoalveolar lavage was conducted as described (11).
18. A kidney was excised, and pooled blood was collected for antibody analysis as described Serum was separated by centrifugation and stored at -80°C until analysis. Serum OVA-specific IgE levels were determined by sandwich ELISA Sample wells were coated with a 0.01% OVA solution in PBS, blocked with FBS in PBS, and washed with 0.05% Tween-20 in PBS. Serum samples were
O
o diluted 1:10 and 1:100 with 10% FBS in PBS.:After an overnight incubation, plates were washed with 0.05% Tween-20 in PBS and biotin-conjugated anti-mouse IgE (PharMingen, San Diego, CA) was added. After a wash, 0.0025 mg/ml avidin peroxidase (Sigma) in 10% FBS/PBS was added, and plates were developed with ABTS (2.2'-azino-did[3-ethyl-benzthiazone sulfonate]) (Kirkegaard and Perry).
Plates were read at 405 nm within 30 minutes. Reported 0.D. values are of serum samples diluted 1:10 since these values were proven to be below the saturation point of the assay by comparison of O.D. values of serum samples diluted 1:100 C with 10% FBS/PBS.
CN 10 19. P. D. Mehlhop et al., Proc. Natl. Acad. Sci. USA 94, 1344 (1997); M.
SKorsgren et al., J. Exp. Med. 185, 885 (1997).
C 20. T. Aikawa et al., Chest 101, 916 (1992).
21. L. Cohn, R. J. Homer, A. Marinov, J. Rankin, K. Bottomly. J. Exp. Med.
186, 1737 (1997).
22. DNA encoding a honeybee melittin leader C. Tessier, D. Y. Thomas, H. E. Khouri, F. Laliberte, T. Vernet, Gene 2, 177 (1991)1 followed by a sixhistidine tag was fused by an enterokinase cleavage site to the mature region of murine IL-13 at Gly21 and constructed in the mammalian expression vector pHTop. H6-EK murine IL-13 protein was produced from stably- transfected CHO cells and purified via Ni-NTA chromatography to greater than 97% purity as determined by SDS-PAGE. Protein concentration was determined by absorption at 280 nm and endotoxin contamination was less than 30 EU/mg as measured by Cape Cod Associates LAL assay. The EDs0 of H6-EK murine IL- 13 as determined by the Ba/F3.IL-13R 1 proliferation assay was Ing/ml. Murine rIL-13 (5ug in a total volume of 50ul) was administered daily by intratracheal instillation to naive mice anesthesized with a mixture of ketamine and xylazine (45 and 8 mg/kg, respectively).
23. M. Goebeler et al., Immunol. 91, 450 (1997).
24. A murine IgE-specific ELISA was used to quantitate total IgE immunoglobulin levels in serum using complementary antibody pairs for mouse IgE (R35-72 and R35-92) obtained from PharMingen according to the manufacturer's instructions. Duplicate samples (of a 1/10 dilution in 10% FBS in o PBS) were examined from each animal. O.D. readings of samples were converted Cl Sto pg/ml using values obtained from standard curves generated with known Sconcentrations of recombinant mouse IgE (5-2000 pg/ml), and the final concentration was obtained by multiplying by the dilution factor.
C 5 25. C. L. Emson, S. E. Bell, A. Jones, W. Wisden. A. N. J. McKenzie, J. Exp.
Med. 188, 399 (1998).
ON 26. L. R. Friedhoff, D. G. Marsh, Int. Arch. All. ImmunoL 100, 355 (1993).
C¢l Cl 27. To examine the effects of rIL-13 on mucus cell content of the airway
(N
o epithelium, lungs were excised and fixed in 10% formnalin. They were then washed Cl in 70% ethanol, dehydrated, embedded in glycol methacrylate, cut into 10 uM o sections, mounted on slides, and stained with hematoxylin and eosin and periodic acid Schiff. Four sections were examined per animal; 4 fields were scored per lung section. Sections were scored on a scale from 1-4 with 1 representing no mucus cell content.
28. J. Luyimbazi, X. Xu, M. Wills-Karp, unpublished results.
29. C. Walker et al., Am. Rev. Respir. Dis. 146,109 (1992); M. Humbert et al., J. All. Clin. ImmunoL. 99, 657 (1997); S. K- Huang, J. ImmunoL 155,2688 (1995).
D. G. Marsh, et al., Science 264, 1152 (1996).
31. L. J. Rosenwasser. N. EngL. J. Med. 337, 1766 (1977).
32. G. IC Hershey et al., N Engl. J. Med. 337, 1720 (1997).
All patent and literature references cited herein are incorporated by reference as if fully set forth.
Claims (2)
- 2. The method of claim 1, wherein said IL-13 antagonist is a soluble form of r, IL-13Ral. o 3. The method of claim 1, wherein said IL-13 antagonist is an IL-13 antibody or an IL-
- 13-binding fragment thereof. O 4. The method of claim 1, wherein said IL-13 antagonist is an antibody to IL-13. The method of claim 1, wherein said IL-13 antagonist is an antibody to IL-13RRal or an I L-13Ra 1 -binding fragment thereof. 6. The method of any one of claims 1 to 5, wherein said condition is an IgE-mediated condition. 7. The method of claim 6, wherein said condition is selected from the group consisting of atopy, an allergic condition, asthma and an immune complex disease. 8. The method of claim 7, wherein said condition is atopy. 9. The method of claim 7, wherein said condition is an allergic condition. 10. The method of claim 7, wherein said condition is an immune complex disease. 11. The method of claim 7, wherein said condition is asthma. 12. The method of claim 11, wherein said IL-13 antagonist is an IL-13 antibody. 13. The method of any one of claims 1 to 5, wherein said condition is selected from the group consisting of lupus, nephritis, thyroiditis and Grave's disease. Genetics Institute, LLC Johns Hopkins University By their patent attorneys CULLEN CO. Date: 24 May 2005
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US09/211335 | 1998-12-14 | ||
PCT/US1999/029493 WO2000036103A1 (en) | 1998-12-14 | 1999-12-13 | Cytokine receptor chain |
AU21775/00A AU780031B2 (en) | 1998-12-14 | 1999-12-13 | Cytokine receptor chain |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU21775/00A Division AU780031B2 (en) | 1998-12-14 | 1999-12-13 | Cytokine receptor chain |
Publications (2)
Publication Number | Publication Date |
---|---|
AU2005202229A1 AU2005202229A1 (en) | 2005-06-16 |
AU2005202229B2 true AU2005202229B2 (en) | 2006-11-16 |
Family
ID=39367213
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2005202229A Ceased AU2005202229B2 (en) | 1998-12-14 | 2005-05-24 | Cytokine Receptor Chain |
Country Status (1)
Country | Link |
---|---|
AU (1) | AU2005202229B2 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997031946A1 (en) * | 1996-03-01 | 1997-09-04 | Genetics Institute, Inc. | Il-13 binding chain of il-13 receptor |
WO1997033913A1 (en) * | 1996-03-13 | 1997-09-18 | Zymogenetics, Inc. | Cytokine-receptor expressed in testis cells |
-
2005
- 2005-05-24 AU AU2005202229A patent/AU2005202229B2/en not_active Ceased
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997031946A1 (en) * | 1996-03-01 | 1997-09-04 | Genetics Institute, Inc. | Il-13 binding chain of il-13 receptor |
US5710023A (en) * | 1996-03-01 | 1998-01-20 | Genetics Institute, Inc. | IL-13 cytokine receptor chain |
WO1997033913A1 (en) * | 1996-03-13 | 1997-09-18 | Zymogenetics, Inc. | Cytokine-receptor expressed in testis cells |
Also Published As
Publication number | Publication date |
---|---|
AU2005202229A1 (en) | 2005-06-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5710023A (en) | IL-13 cytokine receptor chain | |
US7507706B1 (en) | Cytokine receptor chain | |
US20100086516A1 (en) | Cytokine receptor chain | |
EP1173484B1 (en) | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains | |
EP0797664B1 (en) | Use of a human interleukin-11 receptor | |
US7078494B1 (en) | Antibodies to human IL-13bc and methods of their use in inhibiting IL-13 binding | |
WO2000078336A1 (en) | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains | |
AU2005202229B2 (en) | Cytokine Receptor Chain | |
US20070111939A1 (en) | Human interleukin-11 receptor |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FGA | Letters patent sealed or granted (standard patent) | ||
MK14 | Patent ceased section 143(a) (annual fees not paid) or expired |