WO2000034439A1 - Desaturases and methods of using them for synthesis of polyunsaturated fatty acids - Google Patents
Desaturases and methods of using them for synthesis of polyunsaturated fatty acids Download PDFInfo
- Publication number
- WO2000034439A1 WO2000034439A1 PCT/US1999/028655 US9928655W WO0034439A1 WO 2000034439 A1 WO2000034439 A1 WO 2000034439A1 US 9928655 W US9928655 W US 9928655W WO 0034439 A1 WO0034439 A1 WO 0034439A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- desaturase
- nucleic acid
- sequence
- acid molecule
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6409—Fatty acids
- C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
- C12P7/6432—Eicosapentaenoic acids [EPA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6409—Fatty acids
- C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6436—Fatty acid esters
- C12P7/6445—Glycerides
- C12P7/6472—Glycerides containing polyunsaturated fatty acid [PUFA] residues, i.e. having two or more double bonds in their backbone
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
Definitions
- the invention relates to desaturase enzymes that can be used to produce polyunsaturated fatty acids with important dietary applications.
- BACKGROUND Fatty acids are fundamental components of living systems. They make up the major component of cytoplasmic membranes, common to plants, animals and protists alike.
- Certain specialized mammalian tissues such as brain (Naughton, J. Biochem. 13:21-32, 1981), testes (Wilder and Coniglio, Proc. Soc. Exp. Biol. Med. 177:399- 405, 1984), and retina (Aveldano de Caldironi et al., Prog. Lipid Res. 20:49-57, 1981) are especially rich in unsaturated fatty acids.
- Arachidonate and eicosapentaenoate serve both as precursors for synthesis of 22- carbon polyunsaturated fatty acids and, with dihomo- ⁇ -linoleate (20:3) (Yamazaki et al., Biochim. Biophys.
- Desaturase enzymes are specific to the position, number, and stereochemistry of the double bonds already present in the target fatty acid (Heinz, Lipid Metabolism in Plants, 33-89, 1993).
- mammals To synthesize 20-carbon polyunsaturated fatty acids, mammals must acquire the essential fatty acids 18:2 (Brenner, The Role of Fats in Human Nutrition, pp. 45-79, 1989) and 18:3 (Nelson, Fatty Acids in Foods and Their Health Implications, pp. 437-471 , 1992; Brenner, The Role of Fats in Human Nutrition, pp. 45-79, 1989; and Hulanicka et al. J. Biol. Chem.
- the products of this elongation-desatu ration, 20:3 and 20:4, are the same as the more usual desaturation- elongation pathway.
- the ⁇ 8 pathway is present in the soil amoebae Acanthamoeba sp. (Ulsamer et al, J. Cell Biol. 43:105-114, 1969), and in euglenoid species, where it is the dominant pathway for formation of 20-carbon polyunsaturated fatty acids (Hulanicka et al., Journal of Biological Chemistry 239:2778-2787 , 1964).
- This ⁇ 8 -desaturation pathway occurs in mammals, both in rat testis (Albert and
- the invention provides novel ⁇ 5 - (FIG. 6A) and ⁇ 8 - (FIG. 7A) desaturase enzymes that may be cloned and expressed in the cells of various organisms, including plants, to produce 20-carbon polyunsaturated fatty acids. Expression of such fatty acids enhances the nutritional qualities of such organisms.
- oil-seed plants may be engineered to incorporate the ⁇ 5 - and ⁇ 8 -desaturases of the invention. Such oil-seed plants would produce seed-oil rich in polyunsaturated 20:3, 20:4, 20:5, 22:4, and 22:5 fatty acids.
- Such fatty acids could be incorporated usefully into infant formula, foods of all kinds, dietary supplements, nutriceutical, and pharmaceutical formulations.
- the invention also provides proteins differing from the proteins of FIG. 6A and FIG. 7A by one or more conservative amino acid substitutions. Also provided are proteins that exhibit "substantial similarity" (defined in the "Definitions” section) with the proteins of FIG. 6A and FIG. 7A.
- the invention provides isolated novel nucleic acids that encode the above- mentioned proteins, recombinant nucleic acids that include such nucleic acids and cells, and plants and organisms containing such recombinant nucleic acids.
- novel ⁇ 5 - and ⁇ 8 -desaturase enzymes can be used individually, or in conjunction with one another, for instance in a metabolic pathway, to produce polyunsaturated fatty acids, such as 20:3, 20:4, 20:5, 22:4, and 22:5 fatty acids.
- the scope of the invention also includes portions of nucleic acids encoding the novel ⁇ 5 - and
- ⁇ 8 -desaturase enzymes portions of nucleic acids that encode polypeptides substantially similar to these novel enzymes, and portions of nucleic acids that encode polypeptides that differ from the proteins of FIG. 6A and FIG. 7A by one or more conservative amino acid substitutions.
- Such portions of nucleic acids may be used, for instance, as primers and probes for research and diagnostic purposes. Research applications for such probes and primers include the identification and cloning of related ⁇ 5 - and ⁇ 8 -desaturases in other organisms including humans.
- the invention also includes methods that utilize the ⁇ 5 - and/or the ⁇ 8 -desaturase enzymes of the invention.
- An example of this embodiment is a yeast or plant cell that carries genes for one or both desaturases of the invention and that, by virtue of these desaturases, is able to produce arachidonic acid and/or EPA.
- FIG. 1 A shows a common pathway for synthesis of 20-carbon polyunsaturated fatty acids that begins with ⁇ 6 desaturation of 18-carbon fatty acids followed by 2-carbon elongation, and then further desaturation and elongation.
- FIG. 1B shows an alternate pathway that begins with an elongation of 18-carbon fatty acid to 20-carbon fatty acids, followed by ⁇ 8 desaturation and a second desaturation at the ⁇ 5 position.
- FIG. 1C shows alternate pathways for the synthesis of polyunsaturated fatty acids using ⁇ 5 -, ⁇ 6 -, and ⁇ 8 -desaturases to produce arachidonic acid and EPA.
- FIG. 2 shows gas chromatographic (GC) analysis of fatty acid methyl esters from E. gracilis grown (heterotrophically) in the dark with sucrose as carbon source. Fatty acids were identified by comparison of retention times with known standards. Significant peaks are numbered with their retention times and proportion of the total fatty acid indicated.
- FIG. 3 shows amino acid sequence similarities between the Euglena ⁇ 8 -desaturase protein (EFD1) and the desaturase enzymes of C. elegans. The deduced amino acid sequence of the EFD1 gene shows similarity with the C. elegans ⁇ 6 (FAT-3) and ⁇ 5 (FAT-4) desaturases (Napier et al., Biochem. J. 330:611-614, 1998).
- FIG. 4 shows the results of gas chromatography of fatty acid methyl esters from recombinant yeast. Cultures of yeast containing either control pYES2 or pYES2-541 , which expresses the Euglena
- ⁇ 8 -desaturase (EFD1) gene were supplemented with the indicated 20-carbon fatty acids.
- the control strain does not desaturate the exogenous fatty acids.
- an arrow indicates the desaturation peak.
- FIG. 5 shows the results of mass spectrometry (MS) of desaturation products.
- MS mass spectrometry
- DMOX derivatives of EFD1 desaturation products were analyzed by GC-mass spectrometry.
- the molecular ion of each fatty acid is 2 a.m.u. (atomic mass units) less than the substrate provided, as expected for insertion of a double bond.
- Desaturation at the ⁇ 8 position is established by characteristic m/z peaks of 182 and 194 for each product, indicated by the bracket.
- FIG. 6A shows the primary amino acid sequence of the fatty acid ⁇ 5 -desaturase from Caenorhabditis elegans.
- FIG. 6B shows a nucleotide sequence including the ORF (open reading frame) that encodes the fatty acid ⁇ 5 -desaturase from Caenorhabditis elegans.
- FIG. 7A shows the primary amino acid sequence of the fatty acid ⁇ 8 -desaturase from the protist Euglena gracilis.
- FIG. 7B shows a nucleotide sequence including the ORF that encodes the ⁇ 8 - desaturase from the protist Euglena gracilis.
- FIG. 8 shows certain features of the structure of the C. elegans ⁇ 5 - and ⁇ 6 - 10 desaturase genes.
- the relative location of gene products T13F2.1 and W08D2.4 on their respective cosmids is shown above.
- the exon structure of T13F2.1 (fat-4) and W08D2.4 (fat-3) showing the sites of sequences encoding the SL1 splice site, the heme-binding motif of cytochrome bs (cyt bs), and the three conserved histidine box motifs (HBX) is shown below.
- FIG. 9 shows a comparison of the predicted amino acid sequences of the borage
- Mortierella alpina A desaturase (GenBank accession number AF054824).
- FIGS. 10A-10C show identification of arachidonic acid in transgenic yeast by gas
- GC-MS chromatography-mass spectroscopy
- FIGS. 11 A and 11 B show the novel desaturation products from substrates lacking a
- FIG. 12 is a table comparing the substrate specificities of C. elegans A “ and ⁇ " desaturases.
- FIG. 13 is a table comparing incorporation and desaturation of fatty acids by yeast strains transformed with a control construct pYES, and with pYES-541 , a clone containing EGD1 , the E. gracilis ⁇ 8 -desaturase gene.
- S. cervisiae strains containing a control vector (pYES) or expressing EFD1 (pYES-541) were cultured in the presence of the indicated fatty acids. The cultures were harvested, washed, and methyl esters prepared from total cells and analyzed by GC. The weight % of total fatty acid methyl esters is indicated.
- nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three-letter code for amino acids. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand.
- SEQ ID NO: 1 is the nucleotide sequence corresponding to the open reading frame of the fatty acid ⁇ 5 -desaturase from Caenorhabditis elegans.
- SEQ ID NO: 2 is the primary amino acid sequence of the fatty acid ⁇ 5 -desaturase from Caenorhabditis elegans.
- SEQ ID NO: 3 is the nucleotide sequence corresponding to the open reading frame of the fatty acid ⁇ 8 -desaturase from the protist Euglena gracilis.
- SEQ ID NO: 4 is the primary amino acid sequence of fatty acid ⁇ 8 -desaturase from the protist Euglena gracilis.
- SEQ ID NOs: 5-8 are primers used to amplify and clone the ⁇ 8 -desaturase- encoding nucleic acid sequence.
- SEQ ID NO: 9 is a polyadenylation signal.
- SEQ ID NO: 10 is a primer used to amplify and clone the ⁇ 5 -desaturase-encoding nucleic acid sequence.
- SEQ ID NO: 11 is a short RNA leader sequence.
- SEQ ID NO: 12 is the amino acid sequence of a histidine box motif.
- SEQ ID NO: 13 is the amino acid sequence of a histidine box motif DESCRIPTION OF THE INVENTION
- a portion of a nucleic acid molecule is a stretch of contiguous nucleic acids corresponding to the sequence of that molecule that may be about 15, 20, 30, 40, 50, or 60 nucleic acids in length. Such nucleotide portions may be used as probes or primers.
- a portion of a protein is a stretch of contiguous amino acids corresponding to the amino acid sequence of that protein that may be about 5, 10, 20, 30, 40, or 50 residues in length. As used herein, such a portion may correspond to any segment of a nucleic acid molecule, for instance such a portion may correspond to a segment consisting of nucleotides 1-500, 501- 1000, or 1001-1451 of the sequence shown in FIG. 6B, or nucleotides 1-400, 401-800, 801- 1251 of the sequence shown in FIG. 7B.
- Desaturase is an enzyme that promotes the formation of carbon- carbon double bonds in a hydrocarbon molecule.
- Desaturase activity may be demonstrated by assays in which a preparation containing an enzyme is incubated with a suitable form of substrate fatty acid and analyzed for conversion of this substrate to the predicted fatty acid product.
- a DNA sequence proposed to encode a desaturase protein may be incorporated into a suitable vector construct and thereby expressed in cells of a type that do not normally have an ability to desaturate a particular fatty acid substrate.
- Activity of the desaturase enzyme encoded by the DNA sequence can then be demonstrated by supplying a suitable form of substrate fatty acid to cells transformed with a vector containing the desaturase-encoding DNA sequence and to suitable control cells (for example, transformed with the empty vector alone).
- ⁇ 5 -desaturase activity may be assayed by these techniques using, for example, 20:3 ⁇ 8,11 ' 14 as substrate and detecting 20:4 ⁇ 5 ' 8,11,14 as the product (Michaelson et al., J. Biol. Chem. 273:19005-19059, 1998).
- ⁇ 5 activity assays include (but are not limited to) 10:2 ⁇ 11,14 (yielding 20:5 ⁇ 5,11,14 as the product) and 20:3 ⁇ 11 ' 14 ' 12 (yielding 20:4 ⁇ 5 11,14 ' 17 as the product).
- the ⁇ 8 -desaturase may be assayed by similar techniques using, for example, 20;3 ⁇ ⁇ ,i4,i7 as the substrate and detecting 20:4 ⁇ 8 ' 11 ' 14,17 as the product.
- ORF Open reading frame.
- An ORF is a contiguous series of nucleotide triplets coding for amino acids. These sequences are usually translatable into a peptide.
- Homologs Two nucleotide or amino acid sequences that share a common ancestral sequence and diverged when a species carrying that ancestral sequence split into two species. Homologs frequently show a substantial degree of sequence identity.
- a transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques.
- the term encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration.
- purified does not require absolute purity; rather, it is intended as a relative term.
- a purified protein preparation is one in which the subject protein or other substance is more pure than in its natural environment within a cell.
- a protein preparation is purified such that the protein represents at least 50% of the total protein content of the preparation.
- a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
- operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame. If introns are present, the operably linked DNA sequences may not be contiguous.
- Sequence similarity The similarity between two nucleic acids or two amino acid sequences is expressed in terms of percentage sequence identity. The higher the percentage sequence identity between two sequences, the more similar the two sequences are. In the case of protein alignments, similarity is measured not only in terms of percentage identity, but also takes into account conservative amino acid substitutions. Such conservative substitutions generally preserve the hydrophobicity and acidity of the substituted residue, thus preserving the structure (and therefore function) of the folded protein.
- the computer programs used to calculate protein similarity employ standardized algorithms that, when used with standardized settings, allow the meaningful comparison of similarities between different pairs of proteins.
- Sequences are aligned, with allowances for gaps in alignment, and regions of identity are quantified using a computerized algorithm. Default parameters of the computer program are commonly used to set gap allowances and other variables. Methods of alignment of sequences for comparison are well-known in the art.
- Biol. 215:403-410, 1990 is available from several sources, including the National Center for Biotechnology Information (NBCI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx.
- BLASTTM can be accessed at htp://www.ncbi. nlm.nih.gov/BLAST/. A description of how to determine sequence identity using this program is available at the web site. As used herein, sequence identity is commonly determined with the BLASTTM software set to default parameters.
- the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties).
- An alternative alignment tool is the ALIGN Global Optimal Alignment tool (version 3.0) available from Biology Workbench at http://biology.ncsa.uiuc.edu. This tool may be used with settings set to default parameters to align two known sequences. References for this tool include Meyers and Miller, CABIOS 4:11-17, 1989.
- Conservative amino acid substitutions are those substitutions that, when made, least interfere with the properties of the original protein, i.e., the structure and especially the function of the protein is conserved and not significantly changed by such substitutions.
- the table below shows amino acids that may be substituted for an original amino acid in a protein and that are regarded as conservative substitutions.
- Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
- substitutions which in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, e g , seryl or threonyl, is substituted for (or by) a hydrophobic residue, e g , leucyl, isoleucyl, phenylalanyl, valyl or alanyl, (b) a cysteme or prohne is substituted for (or by) any other residue, (c) a residue having an electropositive side chain, e g , lysyl, argmyl, or histadyl, is substituted for (or by) an electronegative residue, e g , glutamyl or aspartyl, or (d) a residue having a bulky side chain, e g , phenylalanme, is substituted for (or by) one not having a side chain, e g , glycine
- Probe An isolated nucleic acid attached to a detectable label or reporter molecule
- Typical labels include radioactive isotopes, gands, chemiluminescent agents, and enzymes
- Primers Short nucleic acids, preferably DNA oligonucleotides 10 nucleotides or more in length, that are annealable to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, then extendable along the target DNA strand by a DNA polymerase enzyme Primer pairs can be used for amplification of a nucleic acid sequence, e g , by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art
- PCR polymerase chain reaction
- Probes and primers as used in the present invention typically comprise at least 15 contiguous nucleotides In order to enhance specificity, longer probes and primers may also be employed, such as probes and primers that comprise at least 20, 30, 40, 50, 60, 70, 80, 90, 100, or 150 consecutive nucleotides of the disclosed nucleic acid sequences
- probes and primers may comprise at least 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or 150 consecutive nucleotides that share a defined level of sequence identity with one of the disclosed sequences, for instance, at least a 50%, 60%, 70%, 80%, 90%, or 95% sequence identity
- probes and primers may be nucleotide molecules that hybridize under specific conditions and remain hybridized under specific wash conditions such as those provided below These conditions can be used to identifying variants of the desaturases
- Nucleic acid molecules that are derived from the desaturase cDNA and gene sequences include molecules that hybridize under various conditions to the disclosed desaturase nucleic acid molecules, or fragments thereof
- hybridization conditions are classified into categories, for example very high stringency, high stringency, and low stringency The conditions for probes that are about 600 base pairs or more in length are provided below in three corresponding categories Very High Stringency (detects sequences that share 90% sequence identity)
- PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, 1991, Whitehead Institute for Biomedical Research, Cambridge, MA).
- Recombinant nucleic acid A sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques such as those described in Sambrook et al. Molecular
- nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid.
- Native The term “native” refers to a naturally-occurring ("wild-type") nucleic acid or polypeptide.
- the native nucleic acid or protein may have been physically derived from a particular organism in which it is naturally occurring or may be a synthetically constructed nucleic acid or protein that is identical to the naturally-occurring nucleic acid or protein.
- Isolated nucleic acid is one that has been substantially separated or purified away from other nucleic acid sequences in the cell of the organism in which the nucleic acid naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, by conventional nucleic acid-purification methods.
- the term also embraces recombinant nucleic acids and chemically synthesized nucleic acids.
- Plant encompasses any higher plant and progeny thereof, including monocots (e.g., corn, rice, wheat, barley, rapeseed, soy, sunflower, etc.), dicots (e.g., potato, tomato, etc.), and includes parts of plants, including seeds, fruit, tubers, etc.
- monocots e.g., corn, rice, wheat, barley, rapeseed, soy, sunflower, etc.
- dicots e.g., potato, tomato, etc.
- plants includes parts of plants, including seeds, fruit, tubers, etc.
- the present invention utilizes standard laboratory practices for the cloning, manipulation, and sequencing of nucleic acids, the purification and analysis of proteins, and other molecular biological and biochemical techniques, unless otherwise stipulated. Such techniques are explained in detail in standard laboratory manuals such as Sambrook et al., Molecular Cloning: A Laboratory Manual, 2 nd ed., Cold Spring Harbor Laboratory Press, NY, 1989; and Ausubel et al., Current Protocols in Molecular Biology, Green and Wiley- Interscience, NY, 1987.
- the inventors have identified, cloned, and expressed a novel fatty acid ⁇ 8 - desaturase from the protist Euglena gracilis and a novel fatty acid ⁇ 5 -desaturase from Caenorhabditis elegans that may be used together to produce polyunsaturated fatty acids.
- the invention provides novel purified ⁇ 5 and ⁇ 8 proteins (FIG. 6A and FIG. 7A, respectively).
- the invention also provides proteins differing from the proteins of FIG. 6A and FIG. 7A by one or more conservative amino acid substitutions, as well as proteins that show "substantial similarity" with the proteins of FIG. 6A and FIG. 7A. Substantial similarity is defined in the "Definitions" section.
- Proteins of the invention include proteins that show at least 50% amino acid similarity with the proteins shown in FIG. 6A and FIG. 7A.
- the term "50% amino acid similarity" is objectively and consistently defined by use of blastp sequence analysis software set at default parameters.
- Proteins of the invention also include proteins showing at least 60%, at least 70%, at least 80%, at least 90%, and at least 95% similarity (to the sequences of FIG. 6A or FIG. 7A) using blastp with default parameters.
- the invention provides isolated novel nucleic acids that encode the above- mentioned proteins, recombinant nucleic acids that include such nucleic acids and cells containing such recombinant nucleic acids. Nucleic acids of the invention thus include nucleic acids that encode: (1) amino acid sequences as shown in FIG.
- amino acid sequences that differ from the sequences shown in FIG. 6A and FIG. 7A by one or more conservative amino acid substitutions amino acid sequences that show at least 50% similarity (as measured by blastp at default parameters) with the sequence of FIG. 6A and FIG. 7A.
- Nucleic acids of the invention also include nucleic acids that show at least the term “50% similarity” with the nucleic acids shown in FIG. 6B and FIG. 7B.
- the term "50% similarity" is objectively defined by the use of blastn software set at default perimeters.
- Nucleic acids of the invention also include nucleic acids showing at least 60%, at least 70%, at least 80%, at least 90%, and at least 95% similarity (to the sequences of FIG. 6B and FIG.7B) using blastn with default perimeters.
- novel ⁇ 5 - and ⁇ 8 -desaturase enzymes can be used individually, or in conjunction with one another, for instance in a metabolic pathway, to produce polyunsaturated fatty acids, such as 20:3 and 20:4 fatty acids.
- FIG. 1 B shows an example of such a metabolic pathway.
- Such a pathway may be engineered into any cell by use of appropriate expression systems. A simple way to provide such elements is by the use of commercially available expression systems, discussed in detail below.
- the scope of the invention covers not only entire nucleic acids encoding the novel ⁇ 5 - and ⁇ 8 desaturase enzymes (and substantially similar derivatives of such enzymes) but also covers "portions" of such nucleic acids (as defined in the "Definitions” section, herein).
- Such claimed portions are identified by their possession of a particular degree of similarity with similar sized portions of the nucleotides of FIG. 6B and FIG. 7B and may have a length of about 15, 20, 30, 40, or 50 contiguous nucleotides.
- sequence comparison software such as the "blastn” and “blastp” software available from the National Center for Biotechnology Information (NBCI, Bethesda, MD) and on the Internet at htp://www.ncbi. nlm.nih.gov/BLAST/.
- sequence comparison software such as the "blastn” and “blastp” software available from the National Center for Biotechnology Information (NBCI, Bethesda, MD) and on the Internet at htp://www.ncbi. nlm.nih.gov/BLAST/.
- Similarity between portions of nucleic acids claimed and similar sized portions of the nucleic acid sequences of FIG. 6B and FIG. 7B may be at least 50%, 60%, 70%, 80%, 90%, 95%, or even 98%.
- Such portions of nucleic acids may be used, for instance, as primers and probes for research and diagnostic purposes.
- Portions of nucleic acids may be selected from any area of the sequences shown in FIG. 6B or FIG.
- Recombinant nucleic acids may, for instance, contain all or portion of a disclosed nucleic acid operably linked to another nucleic acid element such as a promoter, for instance, as part of a clone designed to express a protein.
- a promoter for instance, as part of a clone designed to express a protein.
- Pichia pastoris expression systems are available from Invitrogen (Carlsbad, CA). Such systems include suitable Pichia pastoris strains, vectors, reagents, sequencing primers, and media.
- Invitrogen Carlsbad, CA
- suitable Pichia pastoris strains include suitable Pichia pastoris strains, vectors, reagents, sequencing primers, and media.
- a similar system for expression of proteins in Saccharomyces cerevisiae is also available from Invitrogen, which includes vectors, reagents and media.
- a nucleotide sequence (e.g., a gene coding for the ⁇ 5 - or ⁇ 8 -desaturase enzyme of the invention) may be cloned into the yeast expression vector pYES2 and expressed under the control of an inducible promoter, such as a galactose- inducible promoter (GAL1).
- GAL1 galactose- inducible promoter
- Non-yeast eukaryotic vectors may also be used for expression of the desaturases of the invention.
- Examples of such systems are the well known Baculovirus system, the Ecdysone-inducible mammalian expression system that uses regulatory elements from Drosophila melanogaster to allow control of gene expression, and the Sindbis viral expression system that allows high level expression in a variety of mammalian cell lines. These expression systems are also available from Invitrogen.
- Standard prokaryotic cloning vectors may also be used, for example pBR322, pUC ⁇ 8 or pUC19 as described in Sambrook et al, 1989. Nucleic acids encoding the desaturases of the invention may be cloned into such vectors that may then be transformed into bacteria such as Escherischia coli (E. coli) which may then be cultured so as to express the protein of interest.
- Other prokaryotic expression systems include, for instance, the arabinose-induced pBAD expression system that allows tightly controlled regulation of expression, the IPTG-induced pRSET system that facilitates rapid purification of recombinant proteins and the IPTG-induced pSE402 system that has been constructed for optimal translation of eukaryotic genes. These three systems are available commercially from Invitrogen and, when used according to the manufacturer's instructions, allow routine expression and purification of proteins.
- a plant expression system could be used. Plant expression systems are commercially available. A gene of interest of the invention may be cloned into a vector and the construct used to transform a plant cell. Any well known vector suitable for stable transformation of plant cells and/or for the establishment of transgenic plants may be used, including those described in, e.g., Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp. 1987; Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; and Gelvin et al. , Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Such plant expression vectors can include expression control sequences (e.g., inducible or constitutive, environmentally or developmentally regulated, or cell- or tissue-specific expression-control sequences).
- expression control sequences e.g., inducible or constitutive, environmentally or developmentally regulated, or cell- or tissue-specific expression-control sequences.
- constitutive plant promoters useful for expressing desaturase enzymes in plants include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter (see, e.g., Odel et al., Nature 313:810, 1985; Dekeyser et al., Plant Cell 2:591 , 1990; and Terada and Shimamoto, Mol. Gen. Genet. 220:389, 1990); the nopaline synthase promoter (An et al., Plant Physiol. 88:547, 1988) and the octopine synthase promoter (Fromm et al., Plant Ce// 1:977, 1989).
- CaMV cauliflower mosaic virus
- Tissue-specific expression may be facilitated by use of certain types of promoters, for example, the napin promoter is a seed- storage protein promoter from Brassica and specific to developing seeds.
- the ⁇ -conglycinin promoters drive the expression of recombinant nucleic acids thus allowing, the ⁇ 5 or ⁇ 8 proteins of the invention to be expressed only in specific tissues, for example, seed tissues.
- Plant expression vectors can include regulatory sequences from the 3'-untranslated region of plant genes (Thornburg et al., Proc. Natl. Acad. Sci.
- a 3' terminator region to increase mRNA stability of the mRNA such as the Pl-ll terminator region of potato or the octopine or nopaline synthase 3' terminator regions.
- Useful dominant selectable marker genes for expression in plant cells include, but are not limited to: genes encoding antibiotic-resistance genes (e.g., resistance to hygromycin, kanamycin, bleomycin, G418, streptomycin, or spectinomycin); and herbicide- resistance genes (e.g., phosphinothricin acetyltransferase).
- Useful screenable markers include, but are not limited to, ⁇ -glucuronidase and green fluorescent protein.
- the invention also provides cells or plants or organisms transformed with recombinant nucleic acid constructs that include all or a portion of the newly discovered polynucleotides that encode the novel ⁇ 5 and/or ⁇ 8 desaturase enzymes.
- An example of such a transformed plant or organism would be a potato, tomato, rapeseed, sunflower, soy, wheat, or corn plant.
- Multi-celled fungi, such as edible mushrooms, may also be transformed.
- Transformed oil-seed plants are of particular interest as 20-carbon polyunsaturated fatty acids would accumulate within the seed-oil.
- Nucleic acid constructs that express a nucleic acid according to the invention can be introduced into a variety of host cells or organisms in order to alter fatty acid biosynthesis. Higher plant cells, eukaryotic, and prokaryotic host cells all may be so transformed using an appropriate expression system as described above.
- a cDNA or gene
- standard techniques may be used to express the cDNA in transgenic plants in order to modify the particular plant characteristic.
- the basic approach is to clone the cDNA into a transformation vector, such that the cDNA is operably linked to control sequences (e.g., a promoter) directing expression of the cDNA in plant cells.
- the transformation vector is then introduced into plant cells by any of various techniques, for example by Agrobacterium- mediated transformation of plants or plant tissues, or by electroporation of protoplasts, and progeny plants containing the introduced cDNA are selected. All or part of the transformation vector stably integrates into the genome of the plant cell.
- That part of the transformation vector that integrates into the plant cell and that contains the introduced cDNA and associated sequences for controlling expression may be referred to as the "recombinant expression cassette.” Selection of progeny plants containing the introduced transgene may be made based upon the detection of an altered phenotype. Such a phenotype may result directly from the cDNA cloned into the transformation vector or may be manifested as enhanced resistance to a chemical agent (such as an antibiotic) as a result of the inclusion of a dominant selectable marker gene incorporated into the transformation vector.
- a chemical agent such as an antibiotic
- Patent No. 5,750,871 Transformation and Foreign Gene Expression in Brassica Species
- U.S. Patent No. 5,268,526 Overexpression of Phytochrome in Transgenic Plants
- U.S. Patent No. 5,262,316 Genetically Transformed Pepper Plants and Methods for their Production
- the invention also pertains to antibodies to the desaturase enzymes, and fragments thereof, these antibodies may be useful for purifying and detecting the desaturases.
- the provision of the desaturase sequences allows for the production of specific antibody-based binding agents to these enzymes.
- Monoclonal or polyclonal antibodies may be produced to the desaturases, portions of the desaturases, or variants thereof.
- antibodies raised against epitopes on these antigens will specifically detect the enzyme. That is, antibodies raised against the desaturases would recognize and bind the desaturases, and would not substantially recognize or bind to other proteins.
- the determination that an antibody specifically binds to an antigen is made by any one of a number of standard immunoassay methods; for instance, Western blotting , Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed. : Vols. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
- a given antibody preparation such as a preparation produced in a mouse against the ⁇ 5 -desaturase specifically detects the desaturase by Western blotting
- total cellular protein is extracted from cells and electrophoresed on a SDS-polyacrylamide gel.
- the proteins are then transferred to a membrane (for example, nitrocellulose) by Western blotting, and the antibody preparation is incubated with the membrane.
- the presence of specifically bound antibodies is detected by the use of an anti-mouse antibody conjugated to an enzyme such as alkaline phosphatase; application of 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium results in the production of a densely blue-colored compound by immuno-localized alkaline phosphatase.
- Antibodies that specifically detect a desaturase will, by this technique, be shown to bind substantially only the desaturase band (having a position on the gel determined by the molecular weight of the desaturase).
- Non-specific binding of the antibody to other proteins may occur and may be detectable as a weaker signal on the Western blot (which can be quantified by automated radiography) The non-specific nature of this binding will be recognized by one skilled in the art by the weak signal obtained on the Western blot relative to the strong primary signal arising from the specific anti-desaturase binding
- Substantially pure desaturase suitable for use as an immunogen can be isolated from transfected cells, transformed cells, or from wild-type cells Concentration of protein in the final preparation is adjusted, for example, by concentration
- peptides that comprise at least 10, 15, 20, 25, or 30 consecutive ammo acid residues of the ammo acid sequence may be employed
- Monoclonal or polyclonal antibodies to the intact desaturase, or peptide fragments thereof may be prepared as described below
- Monoclonal antibody to any of various epitopes of the desaturase enzymes that are identified and isolated as described herein can be prepared from murine hybridomas according to the classic method of Kohler & Milstem, Nature 256:495, 1975, or a derivative method thereof Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein over a period of a few weeks The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated The spleen cells are fused by means of polyethylene glycol with mouse myeloma cells, and the excess unfused cells destroyed by growth of the system on selective media comprising aminopterm (HAT media) The successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall
- Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988.
- Polyclonal antiserum containing antibodies to heterogenous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein, which can be unmodified or modified, to enhance immunogenicity.
- Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species. For example, small molecules tend to be less immunogenic than other molecules and may require the use of carriers and an adjuvant.
- host animals vary in response to site of inoculations and dose, with both inadequate or excessive doses of antigen resulting in low- titer antisera. Small doses (ng level) of antigen administered at multiple intradermal sites appear to be most reliable.
- An effective immunization protocol for rabbits can be found in Vaitukaitis et al., J. Clin. Endocrinol. Metab. 33:988-991 , 1971.
- Booster injections can be given at regular intervals, and antiserum harvested when the antibody titer thereof, as determined semi-quantitatively, for example, by double immunodiffusion in agar against known concentrations of the antigen, begins to fall. See, for example, Ouchterlony et al., Handbook of Experimental Immunology, Wier, D. (ed.), Chapter 19, Blackwell, 1973. A plateau concentration of antibody is usually in the range of 0.1 to 0.2 mg/mL of serum (about 12 ⁇ M). Affinity of the antisera for the antigen is determined by preparing competitive binding curves using conventional methods.
- Antibodies may be raised against the desaturases of the present invention by subcutaneous injection of a DNA vector that expresses the enzymes in laboratory animals, such as mice. Delivery of the recombinant vector into the animals may be achieved using a hand-held form of the Biolistic system (Sanford et al., Paniculate Sci. Technol. 5:27-37, 1987, as described by Tang et al., Nature (London) 356:153-154, 1992). Expression vectors suitable for this purpose may include those that express the cDNA of the enzyme under the transcriptional control of either the human ⁇ -actin promoter or the cytomegalovirus (CMV) promoter.
- CMV cytomegalovirus
- Antibody fragments may be used in place of whole antibodies and may be readily expressed in prokaryotic host cells. Methods of making and using immunologically effective portions of monoclonal antibodies, also referred to as “antibody fragments,” are well known and include those described in Better & Horowitz, Methods Enzymol 178 476-496, 1989, Glockshuber et al Biochemistry 29 1362-1367, 1990, and U S Patent Nos 5,648,237 ("Expression of Functional Antibody Fragments"), No 4,946,778 (“Single Polypeptide Chain Binding Molecules”), and No 5,455,030 (“Immunotherapy Using Single Cham Polypeptide Binding Molecules”), and references cited therein
- the strain Euglena gracilis Z was obtained from Columbia Scientific The organism was cultured on Cramer and Meyers medium (Cramer, and Meyers, Archiv fur Mikrobiologie 17 384-402, 1952) with the addition of sucrose as a carbon source Cultures were maintained at 25°C in absolute darkness
- C elegans was obtained from Caenorhabditis Genetics Center, St Paul, Minnesota, and grown under standard conditions (Sulston et al , The Nematode Caenorhabditis elegans (Wood, W B , Eds ), pp 587-606, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988)
- C elegans genomic database was searched using BLASTTM with sequences of plant desaturase enzymes, including the B officmalis ⁇ 6 -desaturase (GenBank accession number U79010) Two C elegans polypeptides with the highest scores were a peptide on cosmid W08D2 (high score 163), and one on T13F2 (high score 121)
- the amplification protocol was developed using published guidelines for use of degenerate primers (Compton, PCR Protocols: A Guide To Methods And Applications, 1990).
- the amplification consisted of 5 preliminary cycles at very low annealing temperature (30 seconds at 94°C, 1 -minute ramp to 37°C, 45 seconds at 37°C, 3-minute ramp to 72°C) followed by 30 cycles with higher temperature (30 seconds at 94°C, 1 -minute ramp to 50°C, 45 seconds at 50°C, 3-minute ramp to 72°C.
- Preliminary amplifications to optimize thermal cycling parameters used Pfu DNA polymerase (Stratagene, La Jolla, California). Amplification was successful at 3 mM magnesium and each primer at 4 ⁇ M. Subsequently Taq polymerase was used for amplification under identical conditions. Polymerase chain reaction products from 350 to 750 bp were isolated from agarose gels with commercial reagents (Qiagen, Valencia, California) and sequenced directly using the degenerate primers and dye-termination sequencing technology (Applied Biosystems, Foster City, California). A group of identical amplification products contained an open reading frame that was homologous to known desaturases when analyzed by BLASTTM search (Altschul et al., Nucleic Acids Res.
- RNA isolation and reverse transcription-PCR were performed as follows. RT-PCR was used to amplify the coding sequences of the two putative desaturase genes. Total RNA from mixed stage C. elegans was used for the RT- PCR template.
- RT- PCR was performed using the SuperscriptTM One-Step RT-PCR system (Gibco-BRL/Life
- RNA was added to a reaction mixture consisting 0.2 mM of each dNTP, 1.2 mM MgS ⁇ 4, Superscript IITM RT/Taq polymerase mix, and 200 ⁇ M of appropriate downstream and upstream primers. The reactions were incubated at 50°C for 30 min., then subject to 35 cycles of PCR amplification.
- T13F2.1 gene fat- 4
- a 5' primer corresponding to bases 34339-34361 of cosmid T13F2 was used. Smal,
- the resulting primer [CCCGGGAAGCTTCTCGAGGAATTTTCAATCCTCCTTGGGTC; SEQ. ID NO: 7] anneals to the cosmid T13F2 19-42 base pairs upstream of the putative start codon ATG of the fat-4 gene.
- a primer was used corresponding to the inverse complement of bases 37075-37095 of cosmid T13F2, with the addition of Smal and SamHI sites to facilitate cloning the polynucleotide of interest: CCCGGGTGGATCCGGAACATATCACACGAAACAG; SEQ. ID NO. 8].
- This primer begins 93 base pairs after the putative stop codon TAG and ends 20 base pairs upstream of the predicted polyadenylation signal (AAUAAA; SEQ ID NO: 9) of the fat-4 gene.
- downstream primers corresponding to the complement of bases 35009-35028 of the T13F2 were used for the T13F2.1 gene.
- the upstream PCR primers were either SL1-20 or SL2-20 (Spieth et al., Cell 73:521-532, 1993).
- the C. elegans homologue of the ribosomal-protein L37 was used as an SL1 -specific control, and K06H7.3 was used as an SL2-specific control (Zorio et al., Nature 372:270-272, 1994.
- SL1-20, SL2-20, and control primers were kindly provided by Diego A. R. Zorio. RT- PCR products visualized by gel electrophoresis were confirmed by blotting the gel and probing with gene-specific oligonucleotides corresponding to the appropriate gene as previously described (Spieth et al., Cell 73:21-532, 1993).
- a set of primers was used to prime a reverse transcription specifically for the open reading frame.
- the primer for the 5' end of the gene began 3 nucleotides before the start codon and included the first 26 nucleotides of the open reading frame.
- the 3' primer was complementary to the sequence between 22 and 52 nucleotides downstream from the predicted termination codon.
- This PCR amplification was conducted with Pfu polymerase to minimize the chance of an amplification error.
- the PCR reactions produced a single band of the predicted size when analyzed by agarose gel electrophoresis. This band was cloned into the vector pCR-Script CamTM (Stratagene), and a single clone designated pJW541 was chosen for analysis.
- the fat-4 cDNA amplification product (see Example 3) was digested with Hind ⁇ and SamHI and ligated to the yeast expression vector pYES2 (Invitrogen) cut with Hinc ⁇ W and SamHI .
- the resulting plasmid was named pYFAT4.
- the cloned ⁇ 8 gene was transferred to the yeast expression vector pYES2 (Invitrogen, Carlsbad, California) by standard cloning techniques (Ausubel, Current Protocols In Molecular Biology, 1988) using enzymes obtained from New England Biolabs, Beverly, Massachusetts.
- the resulting yeast expression construct containing the open reading frame under the control of a galactose-inducible promoter was designated pYES2- 541.
- Saccharomyces cerevisiae strain INVSd (Invitrogen) was transformed with pYES2- 541 and cultured using standard methods (Ausubel, Current Protocols In Molecular Biology, 1988).
- Liquid medium containing 2% galactose was supplemented with fatty acid soaps (NuCheck Prep, Elysian MN) at a final concentration of 0.2 mM.
- Tergitol 1%, NP40
- Yeast were incubated overnight at 28°C , harvested by centrifugation, washed once with 1% Tergitol, once with 0.5% Tergitol, and finally once with distilled water.
- the constructs were transformed into Saccharomyces cerevisiae strain INVSd using the S.c. EasyComp transformation kit (Invitrogen).
- FAT-4 peptide transformed yeast were grown overnight in uracil- deficient media containing 2% galactose, 0.2 mM fatty acid, and 1% NP-40. Under these conditions the percentage of these supplemented fatty acids which were incorporated into yeast lipids ranged from 14-28% of the total yeast fatty acids.
- the 1% NP-40 was replaced by 5% DMSO to achieve better incorporation of this fatty acid.
- Example 6 Analysis of Fatty Acids Using Gas Chromatography and GC-Mass Spectrometry Extraction of lipids and preparation of fatty acid methyl esters was carried out by standard methods (Miquel and Browse, J. Biol. Chem. 267:1502-1509, 1992). Gas chromatography of the methyl esters was conducted by established methods (Spychalla et al., Proc. Natl. Acad. Sci. USA 94:1142-1147, 1997). Fatty acid 4,4-Dimethyloxazoline (DMOX) derivatives of yeast lipid extracts were prepared by standard methods (Fay and Richli, J. Chromatogr. 541:89-98, 1991). GC-mass spectrometry was conducted on a
- RNA isolated from heterotrophic cultures was used as template for reverse transcription followed by PCR amplification using degenerate primers that spanned the first and third conserved histidine-rich regions of microsomal desaturase proteins.
- the C. elegans ⁇ 6 -desaturase gene, FAT-3 was used as the principal basis for primer design.
- amplification reactions began with five cycles of low-temperature annealing and a long temperature ramp between the annealing and polymerization steps.
- Preliminary amplifications to optimize thermal cycling parameters used the proofreading Pfu DNA polymerase.
- Tag polymerase was used to generate a number of bands detectable on agarose gels. Several of these bands, of approximately 650 bp, had identical sequence. This DNA sequence contained an open reading frame in which the predicted amino acid sequence was homologous to other membrane desaturases, and included a characteristic central His-box. Primers designed to be specific to the amplified sequence were used to amplify the termini of the cDNA using 3' and 5' RACE techniques. The full-length cDNA for this gene was 1745 bp in length. It included an open reading frame of 1272 bp and a 472-bp 3' untranslated region.
- RNA processing step left a conserved sequence (TTTTTTTCG; SEQ. ID NO. 11) at the beginning of each message (Cui et al., J. Biochem. (Tokyo) 115:98-107, 1994). The presence of this leader in the cDNA sequence confirmed that the message was full- length at the 5' end.
- RT-PCR with primers flanking the open reading frame on the 5' and 3' ends resulted in a single band that was cloned into the vector pCR-Script CamTM (Stratagene), and designated pJW541.
- the gene corresponding to this ORF was designated EFD1 (Euglena fatty acid desaturase 1).
- the translated open reading frame indicated a protein of 422 amino acids with a predicted molecular mass of 48.8 kDa.
- FIG. 3 A BLASTTM search of sequence databases revealed that the predicted protein sequence exhibited regions of homology with the known group of membrane fatty acid desaturases, especially in the highly conserved histidine-rich regions (Shanklin et al., Biochemistry 33:12787-12794, 1994).
- EFD1 contains a variant third His-box, QXXHH (SEQ ID NO: 13), starting at amino acid 361 , similar to the cloned ⁇ 5 - and ⁇ 6 -desaturases.
- EFD1 exhibits conservation of protein sequence in the regions surrounding the highly conserved regions, especially with FAT-3 and FAT-4, the ⁇ 6 - and ⁇ 5 -desaturases of C. elegans (FIG. 3). Outside the highly conserved regions, the amino acid sequence shows considerably less similarity to other desaturases. Overall, the amino acid identity with FAT-3 and FAT-4 is 33%, compared to 28% identity with the borage ⁇ 6 -desaturase.
- EFD1 also contains a cytochrome b 5 -like motif at its N-terminus.
- the protein encodes seven of the eight most highly conserved amino acids characteristic of cytochrome b 5 (FIG. 3), which are responsible for heme binding. Similar motifs are found at the N- terminal regions of FAT-3 and FAT-4 (FIG. 3), and the borage ⁇ 6 protein, as well as the carboxyl terminus of a yeast ⁇ 9 protein.
- the structure of the Euglena protein also exhibits similarities with known desaturases.
- Membrane desaturases are type II multiple membrane spanning proteins, and hydropathy analysis of the cloned Euglena gene indicates that the predicted protein has at least three significant hydrophobic regions long enough to span the membrane bilayer twice. As is true for most desaturase enzymes, there are 31 amino acid residues between the first two His-boxes. The distance between the between the second and third His-box is 173 residues, within the range previously observed (Shanklin and Cahoon, Annu. Rev. Plant Physiol. Plant Mol. Biol. 48:611-641 , 1998).
- the EFD cDNA was transferred from pJW541 to yeast expression vector pYES2 under the control of a galactose-inducible promoter.
- the resulting construct, pYES2-541 was introduced into S. cerevisiae.
- Yeast membranes do not contain 20-carbon fatty acids but incorporate them from the culture medium. Accordingly, yeast cultures were supplemented with various fatty acid soaps, using a yeast strain containing the empty vector as control, and analyzed the fatty acids of the cultures by methyl-ester derivatization and gas chromatography.
- the ability of the experimental yeast strain to produce ⁇ 8 desaturation was shown when the culture medium was supplemented with 20:2 (FIG. 4). A desaturation peak whose retention time is identical to authentic 20:3 was produced.
- the vector-only control culture did not desaturate 20:2 (FIG. 4).
- the yeast strain expressing the Euglena gene also desaturated 20:3 and 20:1 (FIG. 4), again without desaturation activity in the control cultures.
- the cloned Euglena protein was most active with 20:3 and 20:2 as substrates, desaturating 70% and 73% of the total incorporated 20-carbon fatty acid.
- EFD1 was least active with 20:1 , converting 32% of that substrate to a desaturation product (FIG. 4).
- DMOX yeast fatty acids were analyzed by GC-MS. DMOX derivatives have mass spectra that are more easily interpreted than spectra of methyl esters, and permit unambiguous determination of double-bond locations in polyunsaturated fatty acids (Christie, Lipids 33:343-353, 1998). For the experiment that desaturated the fatty acid 20:2, the retention time of the product on the GC-MS instrument was 16.8 min., identical to DMOX- derivatized authentic 20:3. The mass spectrum of this desaturation product and its molecular ion (m/z 359) indicated that it was the 20:3 compound.
- the fat-3 and fat-4 genes are located next to each other on overlapping cosmids in the same 5' to 3' orientation, with only 858 nucleotide base pairs separating the putative polyadenylation signal of the fat-4 gene and the ATG start codon of the faf-3 gene (FIG. 8).
- This gene organization is reminiscent of operons, in which two or more genes are transcribed under the control of a single promoter and regulatory region.
- the polycistronic pre-mRNA is converted to monocistronic mRNA by cleavage and polyadenylation at the 3' end of the upstream gene and transplicing to the SL2 sequence at the 5' end of the downstream gene, with the two mRNAs being subsequently independently translated.
- the distances between the 3' end of the upstream gene and the 5' end of the downstream gene are generally about 100 base pairs, with a few separated by 300-400 base pairs (Blumenthal et al, C. elegans II, pp. 117-145, Cold Spring Harbor Laboratory Press, Cold Spring, NY, 1997).
- the C. elegans fat-3 and fat-4 genes were tested to determine whether they were trans-spliced to either SL1 or SL2 in order to determine if they might be co-transcribed in a single operon. It was found that the fat-4 gene was transpliced to SL1 , but that the faf-3 gene was not transpliced to either spliced leader sequence. Therefore, it was concluded that each gene contains its own 5' promoter and regulatory region.
- the faf-4 gene sequence matched the T13F2 genomic sequence exactly. However the gene product encoded by the cDNA was seven amino acids shorter than predicted by Genefinder for T13F2.1 (GenBank accession number Z81122) because the DNA sequence encoding amino acid residues 198- 204 was not present in the faf-4 cDNA. The resulting peptide length was 447 amino acids instead of the previously predicted 454 amino acids.
- the gene product encoded by the faf-3 cDNA also matched the genomic sequence of W08D2.4 (GenBank accession number Z70271 ) perfectly. However, the gene product was also shorter than the predicted protein sequence. Codons for amino acid residues 38-67 of W08D2.4 were not present in the cDNA. In both cases the gene-prediction software used in the genomic sequencing project appeared to have misidentified some intron DNA as coding sequences.
- alpina A -desaturase is a sequence of 36 residues incorporating the third His box which has 44% identity and 56% similarity.
- the most closely related pair of sequences are faf-3 and faf-4, which are 46% identical on the amino acid level and 54% identical over the entire cDNA sequence.
- FIG. 9 shows the sequence comparison of the borage ⁇ -desaturase, C. elegans
- Example 12 Fatty Acid Desaturase Activity and Substrate Specificity 5 in Yeast for C. elegans A
- the protein was expressed in Saccharomyces cerevisiae supplemented with polyunsaturated fatty acid substrates that are not normally present in this yeast.
- the FAT-4 protein was expressed in the yeast expression vector pYES2 from the GAL1 promoter by growing the cells in the
- 25 gene encodes a ⁇ -desaturase capable of synthesizing arachidonic acid from the substrate di-homo- ⁇ -linolenic acid.
- the FAT-4 protein showed no activity when linoleic acid
- FAT-4-desaturase was supplemented with unconventional ⁇ -substrates such as 20:1 ⁇ ,
- the faf-3 gene was expressed in the yeast expression vector pMK195 containing the constitutive ADH promoter.
- the FAT-3 protein was able to desaturate linoleic acid
- the FAT-3 protein showed no activity on 20: 1 ⁇ , 20:2 ⁇ , 20:3 ⁇ , or 20:3 ⁇ Therefore, the substrate specificities of the C. elegans ⁇ 5 and ⁇ 6 -desaturases were determined to be specific and non-overlapping.
- Example 13 Discussion of the E. gracilis ⁇ 8 -desaturase. Desaturation at the ⁇ 8 -position has not been reported for any previously cloned gene
- the predicted EFD1 protein has 33% amino acid identity with both FAT-3 and FAT- 4, (FIG. 9), while its identity with the cloned borage ⁇ 6 -desaturase is 28%.
- the highest sequence conservation is found in the His-box motifs which are critical for desaturase activity, most likely because they serve as the diiron-oxo component of the active site (Shanklin et al., Biochemistry 33:12787-12794, 1994).
- the 20-carbon substrates for ⁇ 8 desaturation are available in abundance in heterotrophically grown E. gracilis (FIG. 2). These same substrates also are available in mammals, since 20:2 and 20:3 are produced by elongation from 18:2 and 18:3, in competition with the typical ⁇ 6 desaturation (FIG. 1). Labeling experiments with rat liver homogenates indicate that elongation of the 18-carbon fatty acids is five-fold more rapid than the competing desaturation (Pawlosky et al., J. Lipid Res. 33:1711-1717, 1992).
- Implicit in the current understanding of the ⁇ 6 pathway of 20-carbon polyunsaturated fatty acid biosynthesis is a reliance on alternating desaturation and elongation to control flux through the pathway. While elongation often appears to be non-specific, most desaturations are specific both as to chain length of the substrate and to existing desaturation pattern of the fatty acid (Heinz, Lipid Metabolism in Plants, pp. 33-89, 1993). However, data from experiments in mammalian tissue (Bernert and Sprecher, Biochim. Biophys. Acta. 398:354- 363, 1975; Albert et al., Lipids 14:498-500, 1979) and with yeast expressing the C.
- elegans ⁇ 5 -desaturase gene indicate that ⁇ 5 enzymes desaturate fatty acids having a double bond at the ⁇ 11 -position but not at the ⁇ 8 -position, producing the non-methylene- interrupted 20:3 and 20:4 compounds at significant rates.
- ⁇ 8 desaturation occurs in competition with ⁇ 5 activity on the substrates 20:2 and 20:3.
- lipid profiles of mammalian tissue do not contain fatty acids with the ⁇ 5,11 (Heinz, Lipid Metabolism in Plants, pp. 33-89, 1993; and Ulsamer et al., J. Cell Biol. 43:105-114, 1969) desaturation pattern, nor are they seen in Euglena.
- ⁇ 8 -desatu ration of the common substrates occurs very rapidly, while ⁇ 5 -desaturation proceeds more slowly, so that little ⁇ 5,11 product is formed.
- the Euglena A 8 appears to be a very active desaturase when expressed in yeast (FIG. 4), compared to similarly expressed ⁇ 5 -desaturase enzymes.
- the Euglena desaturase must be sufficiently active to account for all the long chain polyunsaturates of rapidly growing Euglena cultures (FIG. 2).
- the observed rates of ⁇ 8 -desaturation in mammalian tissue are relatively slow.
- ⁇ 8 -desaturase gene permit examinations of the alternate pathway for biosynthesis of 20-carbon polyunsaturated fatty acids and will give insight into the possible mechanisms of ⁇ 8 -desaturation.
- operation of this alternative pathway may be confined to specialized tissues, where the demand for polyunsaturated fatty exceeds the supply provided through rate-limiting ⁇ 6 desaturation.
- the pathway may be of greater significance where ⁇ 6 desaturation is reduced or absent. Since fatty acid desaturase metabolism is perturbed in many cell lines, both transformed (Grammatikos et al., Ann. N. Y. Acad. Sci. 745:92-105, 1994) and untransformed (Rosenthal, Prog.
- ⁇ 8 activity is only revealed in the absence of ⁇ 6 activity.
- ⁇ 8 activity may arise or increase with cell neoplasia.
- the isolation and examination of this ⁇ 8 gene, and analysis of its substrate specificity, should facilitate the determination of the role of ⁇ 8 activity in both normal and cancerous mammalian tissue.
- Example 14 Discussion of the C. elegans A 5 -desaturase.
- chromosome IV contains the ⁇ - and ⁇ - desaturase genes.
- the amino acid sequences encoded by the two genes are 46% identical to each other, and each contains an N-terminal heme binding domain typical of the electron carrier cytochrome J 5 and three histidine boxes.
- Both genes contain the consensus sequence of the third His box (QXXHH; SEQ. ID NO. 11) that has so far been shown to be unique to the microsomal desaturases involved in double-bond insertion at carbons below position 9.
- the C. elegans A -desaturase (FAT-3) specifically acts on two 18-carbon substrates, linoleic and ⁇ -iinolenic acid, and always desaturates in a methylene-interrupted 6 pattern (one double bond every three carbons).
- the mammalian ⁇ -desaturase system has likewise been demonstrated to insert double bonds strictly in a methylene-interrupted pattern and to have no activity on 20-carbon substrates (Schmitz et al., Lipids 12:307-313, 1997).
- the C. elegans A -desaturase (FAT-4), in contrast, acts on a number of 20-carbon 5 substrates, as well as on an endogenous 18:1 fatty acid of yeast, and is capable of inserting double bonds in a non-methylene interrupted pattern.
- Non-methylene-interrupted fatty acids such as 20:2 ⁇ , 20:3 ⁇ , 18:2 ⁇
- the C. elegans fat-3 and faf-4 genes are present in a gene cluster in the same 5' to 3' orientation. Yet, unlike other gene clusters of this sort in C. elegans, the downstream faf-3 gene is not transpliced to SL2, and therefore is unlikely to be co-transcribed with the upstream faf-4 gene. The two genes could be located next to each other as a result of an
- ⁇ -desaturases are important regulatory enzymes in humans. They participate in critical steps in the pathway to produce precursors for synthesis of hormone-like eicosanoid 35 molecules from the essential dietary fatty acids, linoleic acid and ⁇ -linolenic acid. The activities of these desaturases have been shown to be under hormonal and nutritional control, but the mechanism of this control is still unknown.
- Example 15 A Plant Cell Transformed with the ⁇ 5 and ⁇ 8 -desaturase Genes of the Invention
- ⁇ 5 - and ⁇ 8 -desaturases of the invention may be cloned and expressed in plants to produce plants with enhanced amounts of 20-carbon polyunsaturated fatty acids. Such plants provide an inexpensive and convenient source of these important fatty acids in a readily harvestable and edible form.
- the ⁇ 5 - and ⁇ 8 -desaturases of the invention can be cloned into a common food crop, such as corn, wheat, potato, tomato, yams, apples, pears, or into oilseed plants such as sunflower, rapeseed, soy, or peanut plants.
- a common food crop such as corn, wheat, potato, tomato, yams, apples, pears, or into oilseed plants such as sunflower, rapeseed, soy, or peanut plants.
- the resulting plant would express the appropriate enzyme that would catalyze the formation of 20-carbon polyunsaturated fatty acids.
- the seed oil would be a rich source of 20-carbon polyunsaturated fatty acids.
- the ⁇ 5 - and ⁇ 8 -desaturase genes may be cloned and expressed either individually, or together in a host plant cell.
- the corresponding desaturases can be expressed using a variety of different control sequences, such as promoters, enhancers, and 3'-termination sequences. These control sequences can be used to control the expression of each desaturase individually.
- the ⁇ 5 -desaturase can be cloned such that it is under the control of a strong promoter, and the
- ⁇ 8 -desaturase can be cloned such that it is under the control of a weak promoter, thus yielding a transgenic plant that expresses more ⁇ 5 -desaturase than ⁇ 8 -desaturase.
- expression can be controlled by operably linking one or more of the desaturase genes of interest to a promoter that is activated by exposure of the plant cell to an appropriate regulatory agent such as an inducer, repressor, de-repressor or inhibitor agent. Such regulation is discussed above.
- expression of non-contiguous genes may be coordinated by linking the expression of a first gene with the expression of an inducer or de-repressor molecule that induces or de-represses the expression of a second gene.
- the genes of the invention can be integrated into the genome of a plant (for example, by AgroJ acfer/t/m-mediated
- T-DNA transfer or animal (for example, by use of broad host-range retroviruses, e.g., an adenovirus vector) so that the ⁇ 5 and ⁇ 8 -desaturases of the invention are expressed as part of the genome.
- the T-DNA vector may be used that would result in integration of transgenes ( ⁇ 5 and/or ⁇ 8 ) into the host cell genome.
- the expression of the ⁇ 5 -and ⁇ 8 - desaturases in a plant can be achieved by constructing a plant transformation vector to introduce the cDNA of each desaturase into the plant.
- the vector can contain a tissue specific promoter so that the desaturase protein will be expressed during seed development.
- seed specific promoters examples include that for phaseolin (van der Geest and Hall, Plant Mol. Biol. 32:579-88, 1996) or the promoter for napin (Stalberg et al., Plant Mol. Biol. 23: 671-83, 1993).
- Other seed-specific promoters that can be used are those located on the genomic BAC clone T24A18 (LOCUS ATT24A18. (1999) 45980 bp Arabidopsis thaliana DNA chromosome 4.ACCESSION # AL035680, NID g4490701 ) of the Arabidopsis genome. These promoters regulate seed storage protein expression in Arabidopsis.
- promoters which express genes specifically in seeds like those described in (Parcy et al., Plant Cell 6:1567-1582, 1994) can also be used.
- the constructs containing the desaturase coding sequence and promoter sequence can then transferred to standard plant transformation T- DNA vectors similar to pART27 (Gleave, Plant Mol. Biol. 20:1203-1207, 1992), pGPTV (Becker et al., Plant Mol. Biol. 20:1195-7, 1992), or pJIT119 (Guerineau et al., Plant Mol. Biol. 15:127-136, 1992). If the plant is to be transformed with two constructs, i.e.
- the vector carrying the ⁇ 5 -desaturase can be constructed such that it contains the kanmycin (npfll) gene
- the vector carrying the ⁇ 8 -desaturase can be constructed such that it contains the phosphinothricin (bar) gene.
- Transformants are then selected on media containing kanmycin and phosphinothricin. Transformation of Arabidopsis is readily achieved using the Agrobacterium-mediated vacuum infiltration process (Katavic et al., Mol. Gen. Genet.
- Transgenic progeny will be identified by selection using the appropriate antibiotic or herbicide, either kanmycin or phosphinothricin, or both. Since the ⁇ 8 and ⁇ 5 constructs use different selectable markers the double transformants are readily isolated. Plants which survive the transgenic selection are grown to maturity and their seed harvested. The seeds of transformed plants are analyzed by isolation of fatty acid methyl esters followed by gas chromatography to determine the fatty acid composition.
- Plants expressing only the ⁇ 8 -desaturase will desaturate the 20: 1 ⁇ 11 fatty acid that occurs naturally in the Arabidopsis seed to 20:2 ⁇ 8,11 .
- Seed harvested from plants doubly transformed with both desaturases will, in addition, convert the 20:2 ⁇ 8,11 product of the ⁇ 8 - desaturase plants to 20:3 ⁇ 5,8,11 as a result of the expression of the ⁇ 5 -desaturase. These changes will be easily detected by the fatty acid methyl ester analysis.
- Example 16 A Yeast Cell Transformed with the ⁇ 5 - and ⁇ 8 -desaturase Genes of the Invention
- the cDNA portion of pJW541 (Wallis and Browse, Arch. Biochem. Biophys. 365:307-316, 1999) containing the Euglena ⁇ 8 -desaturase was excised from that plasmid with the restriction enzymes EcoRI and Spel.
- the purified DNA fragment representing the insert was ligated into the yeast expression vector pYX232 (R&D Systems, Inc.) that had been prepared by digestion with EcoRI and Nhe ⁇ , to give compatible sticky ends.
- Plasmid pYX232 carries the marker conferring yeast prototrophy for tryptophan (TRP1 mutation), and uses the triose phosphate isomerase (TPI) promoter for constitutive expression of the inserted DNA.
- TPI triose phosphate isomerase
- the resulting plasmid, pYX232-541 was introduced into the Saccharomyces cerevisiae strain already harboring the ⁇ 5 -desaturase (pYFAT4; Watts and Browse, Arch. Biochem. Biophys. 362:175-182, 1999) plasmid that confers yeast prototrophy for uracil using a lithium acetate transformation procedure (Invitrogen). Transformants were selected simultaneously for uracil and tryptophan prototrophy. Selected colonies arising after the transformation were inoculated into yeast minimal medium that also lacked both uracil and tryptophan.
- the activities of the desaturases were substantially identical against all three substrates. Between 70 and 72% of the substrate was not converted, and 17 or 18% underwent a single desaturation by only one of the enzymes. However, for each substrate, between 11 and 13% of the substrate was desaturated by both enzymes acting in concert to produce a fatty acid with two double bonds more than in molecules of the supplied substrate.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Nutrition Science (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
- Fats And Perfumes (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE69935162T DE69935162T2 (de) | 1998-12-07 | 1999-12-06 | Desaturasen und verfahren ihrer anwendung zur synthese von mehrfach ungesättigten fettsäuren |
| NZ512656A NZ512656A (en) | 1998-12-07 | 1999-12-06 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
| AU31090/00A AU776711B2 (en) | 1998-12-07 | 1999-12-06 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
| EP99965105A EP1147174B1 (en) | 1998-12-07 | 1999-12-06 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
| JP2000586873A JP4383671B2 (ja) | 1998-12-07 | 1999-12-06 | 不飽和化酵素、およびそれらを多価不飽和脂肪酸の合成のために用いる方法 |
| US09/857,583 US6825017B1 (en) | 1998-12-07 | 1999-12-06 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
| CA2354672A CA2354672C (en) | 1998-12-07 | 1999-12-06 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
| US10/975,692 US7402735B2 (en) | 1998-12-07 | 2004-10-26 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
| US12/141,865 US8124838B2 (en) | 1998-12-07 | 2008-06-18 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
| US13/406,248 US8791327B2 (en) | 1998-12-07 | 2012-02-27 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
| US14/308,456 US9695450B2 (en) | 1998-12-07 | 2014-06-18 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
| US15/621,699 US10351871B2 (en) | 1998-12-07 | 2017-06-13 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US11130198P | 1998-12-07 | 1998-12-07 | |
| US60/111,301 | 1998-12-07 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09/857,583 A-371-Of-International US6825017B1 (en) | 1998-12-07 | 1999-12-06 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
| US09857583 A-371-Of-International | 1999-12-06 | ||
| US10/975,692 Division US7402735B2 (en) | 1998-12-07 | 2004-10-26 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2000034439A1 true WO2000034439A1 (en) | 2000-06-15 |
Family
ID=22337705
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1999/028655 Ceased WO2000034439A1 (en) | 1998-12-07 | 1999-12-06 | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids |
Country Status (8)
| Country | Link |
|---|---|
| EP (1) | EP1147174B1 (https=) |
| JP (1) | JP4383671B2 (https=) |
| AT (1) | ATE353952T1 (https=) |
| AU (1) | AU776711B2 (https=) |
| CA (2) | CA2354672C (https=) |
| DE (1) | DE69935162T2 (https=) |
| NZ (1) | NZ512656A (https=) |
| WO (1) | WO2000034439A1 (https=) |
Cited By (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2002253211A (ja) * | 2001-02-28 | 2002-09-10 | Gekkeikan Sake Co Ltd | 香気成分高生産性酵母 |
| WO2002057464A3 (de) * | 2001-01-19 | 2003-02-27 | Basf Plant Science Gmbh | Verfahren zur expression von biosynthesegenen in pflanzlichen samen unter verwendung von multiplen expressionskonstrukten |
| WO2004057001A3 (en) * | 2002-12-19 | 2004-11-04 | Univ Bristol | Method for the production of polyunsaturated fatty acids |
| WO2006012326A1 (en) * | 2004-06-25 | 2006-02-02 | E.I. Dupont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| WO2006052871A2 (en) | 2004-11-04 | 2006-05-18 | E.I. Dupont De Nemours And Company | Docosahexaenoic acid producing strains of yarrowia lipolytica |
| US7087432B2 (en) | 2000-09-28 | 2006-08-08 | Bioriginal Food & Science Corp. | Fad4, Fad5, Fad5-2 and Fad6, novel fatty acid desaturase family members and uses thereof |
| WO2007042510A2 (en) | 2005-10-13 | 2007-04-19 | Basf Plant Science Gmbh | Process for the production of arachidonic acid and/or eicosapentaenoic acid |
| WO2007127381A2 (en) | 2006-04-28 | 2007-11-08 | E. I. Du Pont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| CN100412197C (zh) * | 2002-12-19 | 2008-08-20 | 布里斯托尔大学 | 生产多不饱和脂肪酸的方法 |
| WO2008124194A1 (en) * | 2007-04-10 | 2008-10-16 | E. I. Du Pont De Nemours And Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| WO2008128240A1 (en) | 2007-04-16 | 2008-10-23 | E. I. Du Pont De Nemours And Company | Delta 9 elongases and their use in making polyunsaturated fatty acids |
| WO2008063340A3 (en) * | 2006-10-23 | 2008-11-20 | Du Pont | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| US7601889B2 (en) | 2001-03-26 | 2009-10-13 | Napier Johnathan A | Elongase gene and production of Δ9-polyunsaturated fatty acids |
| US7645604B2 (en) | 2005-11-23 | 2010-01-12 | E.I. Du Pont De Nemours And Company | Delta-9 elongases and their use in making polyunsaturated fatty acids |
| US7709239B2 (en) | 2006-12-07 | 2010-05-04 | E.I. Du Pont De Nemours And Company | Mutant Δ8 desaturase genes engineered by targeted mutagenesis and their use in making polyunsaturated fatty acids |
| US7736884B2 (en) | 2004-06-04 | 2010-06-15 | Fluxome Sciences A/S | Metabolically engineered Saccharomyces cells for the production of polyunsaturated fatty acids |
| WO2010142522A2 (en) | 2009-06-08 | 2010-12-16 | Basf Plant Science Company Gmbh | Novel fatty acid elongation components and uses thereof |
| WO2011006948A1 (en) | 2009-07-17 | 2011-01-20 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases and elongases and uses thereof |
| WO2011023800A1 (en) | 2009-08-31 | 2011-03-03 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
| WO2011064183A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid elongase and uses thereof |
| WO2011064181A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid desaturase and uses thereof |
| US8017838B2 (en) | 2006-12-07 | 2011-09-13 | E.I. Du Pont De Nemours And Company | Mutant delta-8 desaturase genes engineered by targeted mutagensis and their use in making polyunsaturated fatty acids |
| US8049070B2 (en) | 2006-05-17 | 2011-11-01 | E.I. Du Pont De Nemours And Company | Delta-5 desaturase and its use in making polyunsaturated fatty acids |
| EP2357243A3 (en) * | 2004-04-22 | 2011-11-23 | Commonwealth Scientific and Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells. |
| WO2011161093A1 (en) | 2010-06-25 | 2011-12-29 | Basf Plant Science Company Gmbh | Acyltransferases and uses therof in fatty acid production |
| EP2441843A1 (en) | 2007-02-12 | 2012-04-18 | E. I. du Pont de Nemours and Company | Production of arachidonic acid in oilseed plants |
| WO2012052468A2 (en) | 2010-10-21 | 2012-04-26 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases, elongases, elongation components and uses therof |
| EP2471928A1 (en) | 2007-05-03 | 2012-07-04 | E. I. du Pont de Nemours and Company | Method of obtaining oi comprising polyunsaturated fatty acids from transgenic seeds comprising delta-5 desaturases |
| WO2014020533A2 (en) | 2012-08-03 | 2014-02-06 | Basf Plant Science Company Gmbh | Novel enzymes, enzyme components and uses thereof |
| US8828690B2 (en) | 2007-04-03 | 2014-09-09 | E I Du Pont De Nemours And Company | Multizymes comprising delta-9 elongase and delta-8 desaturase and their use in making polyunsaturated fatty acids |
| EP2821492A2 (en) | 2009-05-13 | 2015-01-07 | BASF Plant Science Company GmbH | Acyltransferases and uses thereof in fatty acid production |
| US8962917B2 (en) | 2006-05-17 | 2015-02-24 | E. I. Du Pont De Nemours And Company | Delta-5 desaturase and its use in making polyunsaturated fatty acids |
| US9458410B2 (en) | 2004-04-22 | 2016-10-04 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
| US9624477B2 (en) | 2004-02-27 | 2017-04-18 | Basf Plant Science Gmbh | Method for producing unsaturated omega-3-fatty acids in transgenic organisms |
| US10035989B2 (en) | 2004-02-27 | 2018-07-31 | Basf Plant Science Gmbh | Method for producing polyunsaturated fatty acids in transgenic plants |
| US10190131B2 (en) | 2006-02-21 | 2019-01-29 | Basf Plant Science Gmbh | Method for producing polyunsaturated fatty acids |
| US11180769B2 (en) | 2003-08-01 | 2021-11-23 | Basf Plant Science Gmbh | Method for the production of multiple-unsaturated fatty acids in transgenic organisms |
| US11952581B2 (en) | 2003-08-01 | 2024-04-09 | Basf Plant Science Gmbh | Process for the production of polyunsaturated fatty acids in transgenic organisms |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SG11201807430WA (en) * | 2016-03-04 | 2018-09-27 | Euglena Co Ltd | Antiviral agent and antiviral food |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5057419A (en) * | 1988-09-22 | 1991-10-15 | Rutgers University | Genetically engineered plasmid and organisms for the production of specialized oils |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5614393A (en) * | 1991-10-10 | 1997-03-25 | Rhone-Poulenc Agrochimie | Production of γ-linolenic acid by a Δ6-desaturase |
| FR2755638B1 (fr) * | 1996-11-14 | 1999-02-05 | Mphi Sa | Machine de soudage de feuilles ou films en matiere synthetique |
| BR9808506A (pt) * | 1997-04-11 | 2000-05-23 | Calgene Llc | Métodos e composições para sìntese de ácidos graxos poliinsaturados de cadeia longa em plantas |
-
1999
- 1999-12-06 AT AT99965105T patent/ATE353952T1/de not_active IP Right Cessation
- 1999-12-06 AU AU31090/00A patent/AU776711B2/en not_active Expired
- 1999-12-06 WO PCT/US1999/028655 patent/WO2000034439A1/en not_active Ceased
- 1999-12-06 DE DE69935162T patent/DE69935162T2/de not_active Expired - Lifetime
- 1999-12-06 NZ NZ512656A patent/NZ512656A/en not_active IP Right Cessation
- 1999-12-06 JP JP2000586873A patent/JP4383671B2/ja not_active Expired - Fee Related
- 1999-12-06 CA CA2354672A patent/CA2354672C/en not_active Expired - Lifetime
- 1999-12-06 CA CA2791961A patent/CA2791961A1/en not_active Abandoned
- 1999-12-06 EP EP99965105A patent/EP1147174B1/en not_active Revoked
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5057419A (en) * | 1988-09-22 | 1991-10-15 | Rutgers University | Genetically engineered plasmid and organisms for the production of specialized oils |
Cited By (110)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7977469B2 (en) | 2000-09-28 | 2011-07-12 | Bioriginal Food & Science Corp. | Fad4, fad5, fad5-2, and fad6, novel fatty acid desaturase family members and uses thereof |
| US9359597B2 (en) | 2000-09-28 | 2016-06-07 | Bioriginal Food & Science Corp. | Fad4, Fad5, Fad5-2, and Fad6, novel fatty acid desaturase family members and uses thereof |
| US8088906B2 (en) | 2000-09-28 | 2012-01-03 | Bioriginal Food & Science Corp. | FAD4, FAD5, FAD5-2, and FAD6, novel fatty acid desaturase family members and uses thereof |
| US7671252B2 (en) | 2000-09-28 | 2010-03-02 | Bioriginal Food & Science Corp. | Fad4, Fad5, Fad5-2, and Fad6, novel fatty acid desaturase family members and uses thereof |
| US7087432B2 (en) | 2000-09-28 | 2006-08-08 | Bioriginal Food & Science Corp. | Fad4, Fad5, Fad5-2 and Fad6, novel fatty acid desaturase family members and uses thereof |
| WO2002057464A3 (de) * | 2001-01-19 | 2003-02-27 | Basf Plant Science Gmbh | Verfahren zur expression von biosynthesegenen in pflanzlichen samen unter verwendung von multiplen expressionskonstrukten |
| JP2002253211A (ja) * | 2001-02-28 | 2002-09-10 | Gekkeikan Sake Co Ltd | 香気成分高生産性酵母 |
| US7601889B2 (en) | 2001-03-26 | 2009-10-13 | Napier Johnathan A | Elongase gene and production of Δ9-polyunsaturated fatty acids |
| US7714185B2 (en) | 2002-12-19 | 2010-05-11 | University Of Bristol | Method for the production of polyunsaturated fatty acids |
| CN100412197C (zh) * | 2002-12-19 | 2008-08-20 | 布里斯托尔大学 | 生产多不饱和脂肪酸的方法 |
| WO2004057001A3 (en) * | 2002-12-19 | 2004-11-04 | Univ Bristol | Method for the production of polyunsaturated fatty acids |
| AU2003296638B2 (en) * | 2002-12-19 | 2009-06-11 | University Of Bristol | Method for the production of polyunsaturated fatty acids |
| US11180769B2 (en) | 2003-08-01 | 2021-11-23 | Basf Plant Science Gmbh | Method for the production of multiple-unsaturated fatty acids in transgenic organisms |
| US11952581B2 (en) | 2003-08-01 | 2024-04-09 | Basf Plant Science Gmbh | Process for the production of polyunsaturated fatty acids in transgenic organisms |
| US9624477B2 (en) | 2004-02-27 | 2017-04-18 | Basf Plant Science Gmbh | Method for producing unsaturated omega-3-fatty acids in transgenic organisms |
| US10035989B2 (en) | 2004-02-27 | 2018-07-31 | Basf Plant Science Gmbh | Method for producing polyunsaturated fatty acids in transgenic plants |
| US10781463B2 (en) | 2004-04-22 | 2020-09-22 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
| US9926579B2 (en) | 2004-04-22 | 2018-03-27 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
| US9458410B2 (en) | 2004-04-22 | 2016-10-04 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
| US9951357B2 (en) | 2004-04-22 | 2018-04-24 | Commonweatlh Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
| US9453183B2 (en) | 2004-04-22 | 2016-09-27 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
| US9963723B2 (en) | 2004-04-22 | 2018-05-08 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
| EP2363492A3 (en) * | 2004-04-22 | 2012-03-14 | Commonwealth Scientific and Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells. |
| US9970033B2 (en) | 2004-04-22 | 2018-05-15 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
| US9994880B2 (en) | 2004-04-22 | 2018-06-12 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
| US10443079B2 (en) | 2004-04-22 | 2019-10-15 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
| EP2357244A3 (en) * | 2004-04-22 | 2011-11-23 | Commonwealth Scientific and Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells. |
| US11220698B2 (en) | 2004-04-22 | 2022-01-11 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
| US11597953B2 (en) | 2004-04-22 | 2023-03-07 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
| EP2357243A3 (en) * | 2004-04-22 | 2011-11-23 | Commonwealth Scientific and Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells. |
| US7736884B2 (en) | 2004-06-04 | 2010-06-15 | Fluxome Sciences A/S | Metabolically engineered Saccharomyces cells for the production of polyunsaturated fatty acids |
| AU2005267202B2 (en) * | 2004-06-25 | 2011-10-27 | Corteva Agriscience Llc | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| WO2006012326A1 (en) * | 2004-06-25 | 2006-02-02 | E.I. Dupont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| WO2006012325A1 (en) * | 2004-06-25 | 2006-02-02 | E.I. Dupont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| US7550651B2 (en) | 2004-06-25 | 2009-06-23 | E.I. Du Pont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| US7256033B2 (en) | 2004-06-25 | 2007-08-14 | E. I. Du Pont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| US8685682B2 (en) | 2004-11-04 | 2014-04-01 | E I Du Pont De Nemours And Company | Docosahexaenoic acid producing strains of yarrowia lipolytica |
| US8815566B2 (en) | 2004-11-04 | 2014-08-26 | E I Du Pont De Nemours And Company | High eicosapentaenoic acid producing strains of Yarrowia lipolytica |
| WO2006055322A2 (en) | 2004-11-04 | 2006-05-26 | E.I. Dupont De Nemours And Company | High arachidonic acid producing strains of yarrowia lipolytica |
| EP2649887A2 (en) | 2004-11-04 | 2013-10-16 | E. I. du Pont de Nemours and Company | High eicosapentaenoic acid producing strains of Yarrowia lipolytica |
| US7550286B2 (en) | 2004-11-04 | 2009-06-23 | E. I. Du Pont De Nemours And Company | Docosahexaenoic acid producing strains of Yarrowia lipolytica |
| WO2006052871A2 (en) | 2004-11-04 | 2006-05-18 | E.I. Dupont De Nemours And Company | Docosahexaenoic acid producing strains of yarrowia lipolytica |
| WO2006052870A2 (en) | 2004-11-04 | 2006-05-18 | E.I. Dupont De Nemours And Company | High eicosapentaenoic acid producing strains of yarrowia lipolytica |
| US8518674B2 (en) | 2004-11-04 | 2013-08-27 | E I Du Pont De Nemours And Company | High eicosapentaenoic acid producing strains of Yarrowia lipolytica |
| WO2006052871A3 (en) * | 2004-11-04 | 2009-04-09 | Du Pont | Docosahexaenoic acid producing strains of yarrowia lipolytica |
| US7588931B2 (en) | 2004-11-04 | 2009-09-15 | E. I. Du Pont De Nemours And Company | High arachidonic acid producing strains of Yarrowia lipolytica |
| WO2006055322A3 (en) * | 2004-11-04 | 2009-01-22 | Du Pont | High arachidonic acid producing strains of yarrowia lipolytica |
| EP2458000A1 (en) | 2004-11-04 | 2012-05-30 | E. I. du Pont de Nemours and Company | High arachidonic acid producing strains of yarrowia lipolytica |
| US7932077B2 (en) * | 2004-11-04 | 2011-04-26 | E. I. Du Pont De Nemours And Company | High eicosapentaenoic acid producing strains of Yarrowia lipolytica |
| WO2007042510A2 (en) | 2005-10-13 | 2007-04-19 | Basf Plant Science Gmbh | Process for the production of arachidonic acid and/or eicosapentaenoic acid |
| US8258371B2 (en) | 2005-10-13 | 2012-09-04 | Basf Plant Science Gmbh | Process for the production of arachidonic acid and/or eicosapentaenoic acid |
| US8273958B2 (en) | 2005-10-13 | 2012-09-25 | Basf Plant Science Gmbh | Process for the production of arachidonic acid and/or eicosapentaenoic acid |
| EP2450434A2 (en) | 2005-10-13 | 2012-05-09 | BASF Plant Science GmbH | Process for the production of arachidonic acid and/or eicosapentaenoic acid |
| US8017839B2 (en) | 2005-10-13 | 2011-09-13 | Basf Plant Science Gmbh | Process for the production of arachidonic acid and/or eicosapentaenoic acid |
| US8049062B2 (en) | 2005-11-23 | 2011-11-01 | E.I. Du Pont De Nemours And Company | Delta-9-elongases and their use in making polyunsaturated fatty acids |
| US7645604B2 (en) | 2005-11-23 | 2010-01-12 | E.I. Du Pont De Nemours And Company | Delta-9 elongases and their use in making polyunsaturated fatty acids |
| US9150874B2 (en) | 2005-11-23 | 2015-10-06 | E I Du Pont De Nemours And Company | Delta-9 elongases and their use in making polyunsaturated fatty acids |
| US8048653B2 (en) | 2005-11-23 | 2011-11-01 | E.I. Du Pont De Nemours And Company | Microbial oils produced in transformed host cells comprising delta-9 elongases |
| US8420892B2 (en) | 2005-11-23 | 2013-04-16 | E. I. Du Pont De Nemours And Company | Delta-9 elongases and their use in making polyunsaturated fatty acids |
| US10533183B2 (en) | 2006-02-21 | 2020-01-14 | Basf Plant Science Gmbh | Oils, lipids and fatty acids produced in transgenic Brassica plant |
| US10190131B2 (en) | 2006-02-21 | 2019-01-29 | Basf Plant Science Gmbh | Method for producing polyunsaturated fatty acids |
| US10301638B2 (en) | 2006-02-21 | 2019-05-28 | Basf Plant Science Gmbh | Oils, lipids and fatty acids produced in transgenic Brassica plant |
| US10533182B2 (en) | 2006-02-21 | 2020-01-14 | Basf Plant Science Gmbh | Oils, lipids and fatty acids produced in transgenic brassica plant |
| EP2405012A1 (en) | 2006-04-28 | 2012-01-11 | E.I. Du Pont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| WO2007127381A2 (en) | 2006-04-28 | 2007-11-08 | E. I. Du Pont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| US8058517B2 (en) | 2006-04-28 | 2011-11-15 | E.I. Du Pont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| US7943823B2 (en) | 2006-04-28 | 2011-05-17 | E.I. Du Pont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| US8470571B2 (en) | 2006-04-28 | 2013-06-25 | E. I. Du Pont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
| US8962917B2 (en) | 2006-05-17 | 2015-02-24 | E. I. Du Pont De Nemours And Company | Delta-5 desaturase and its use in making polyunsaturated fatty acids |
| US8049070B2 (en) | 2006-05-17 | 2011-11-01 | E.I. Du Pont De Nemours And Company | Delta-5 desaturase and its use in making polyunsaturated fatty acids |
| EP2390339A1 (en) | 2006-10-23 | 2011-11-30 | E. I. du Pont de Nemours and Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| US8859849B2 (en) | 2006-10-23 | 2014-10-14 | E. I. Du Pont De Nemours And Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| US7863502B2 (en) | 2006-10-23 | 2011-01-04 | E.I. Dupont De Nemours And Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| AU2007322223B2 (en) * | 2006-10-23 | 2012-12-13 | Corteva Agriscience Llc | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| EP2390338A1 (en) | 2006-10-23 | 2011-11-30 | E. I. du Pont de Nemours and Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| WO2008063340A3 (en) * | 2006-10-23 | 2008-11-20 | Du Pont | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| US8017838B2 (en) | 2006-12-07 | 2011-09-13 | E.I. Du Pont De Nemours And Company | Mutant delta-8 desaturase genes engineered by targeted mutagensis and their use in making polyunsaturated fatty acids |
| US8026089B2 (en) | 2006-12-07 | 2011-09-27 | E.I. Du Pont De Nemours And Company | Mutant Δ8 desaturase genes engineered by targeted mutagenesis and their use in making polyunsaturated fatty acids |
| US7709239B2 (en) | 2006-12-07 | 2010-05-04 | E.I. Du Pont De Nemours And Company | Mutant Δ8 desaturase genes engineered by targeted mutagenesis and their use in making polyunsaturated fatty acids |
| EP2441843A1 (en) | 2007-02-12 | 2012-04-18 | E. I. du Pont de Nemours and Company | Production of arachidonic acid in oilseed plants |
| EP2441842A1 (en) | 2007-02-12 | 2012-04-18 | E. I. du Pont de Nemours and Company | Production of arachidonic acid in oilseed plants |
| US8828690B2 (en) | 2007-04-03 | 2014-09-09 | E I Du Pont De Nemours And Company | Multizymes comprising delta-9 elongase and delta-8 desaturase and their use in making polyunsaturated fatty acids |
| US8318463B2 (en) | 2007-04-10 | 2012-11-27 | E I Du Pont De Nemours And Company | Δ8 desaturases and their use in making polyunsaturated fatty acids |
| US8338152B2 (en) | 2007-04-10 | 2012-12-25 | E. I. Du Pont De Nemours And Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| WO2008124806A3 (en) * | 2007-04-10 | 2010-07-22 | E. I. Du Pont De Nemours And Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| US8188338B2 (en) | 2007-04-10 | 2012-05-29 | E. I. Du Pont De Nemours And Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| WO2008124194A1 (en) * | 2007-04-10 | 2008-10-16 | E. I. Du Pont De Nemours And Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| AU2008236595B2 (en) * | 2007-04-10 | 2013-06-13 | E. I. Du Pont De Nemours And Company | Delta-8 desaturases and their use in making polyunsaturated fatty acids |
| US7790156B2 (en) | 2007-04-10 | 2010-09-07 | E. I. Du Pont De Nemours And Company | Δ-8 desaturases and their use in making polyunsaturated fatty acids |
| WO2008128241A1 (en) | 2007-04-16 | 2008-10-23 | E. I. Du Pont De Nemours And Company | Delta 9 elongases and their use in making polyunsaturated fatty acids |
| WO2008128240A1 (en) | 2007-04-16 | 2008-10-23 | E. I. Du Pont De Nemours And Company | Delta 9 elongases and their use in making polyunsaturated fatty acids |
| EP2471928A1 (en) | 2007-05-03 | 2012-07-04 | E. I. du Pont de Nemours and Company | Method of obtaining oi comprising polyunsaturated fatty acids from transgenic seeds comprising delta-5 desaturases |
| EP2821492A2 (en) | 2009-05-13 | 2015-01-07 | BASF Plant Science Company GmbH | Acyltransferases and uses thereof in fatty acid production |
| WO2010142522A2 (en) | 2009-06-08 | 2010-12-16 | Basf Plant Science Company Gmbh | Novel fatty acid elongation components and uses thereof |
| DE112010002353T5 (de) | 2009-06-08 | 2012-08-09 | Basf Plant Science Company Gmbh | Neue fettsäure-elongations-komponenten und anwenduingen davon |
| US8993841B2 (en) | 2009-06-08 | 2015-03-31 | Basf Plant Science Company Gmbh | Fatty acid elongation components and uses thereof |
| WO2011006948A1 (en) | 2009-07-17 | 2011-01-20 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases and elongases and uses thereof |
| DE112010002967T5 (de) | 2009-07-17 | 2012-10-11 | Basf Plant Science Company Gmbh | Neue Fettsäuredesaturasen und -elongasen und Anwendungen davon |
| EP3121283A1 (en) | 2009-08-31 | 2017-01-25 | BASF Plant Science Company GmbH | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
| EP3178937A1 (en) | 2009-08-31 | 2017-06-14 | BASF Plant Science Company GmbH | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
| WO2011023800A1 (en) | 2009-08-31 | 2011-03-03 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
| EP3418387A1 (en) | 2009-08-31 | 2018-12-26 | Basf Plant Science Company GmbH | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
| WO2011064181A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid desaturase and uses thereof |
| WO2011064183A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid elongase and uses thereof |
| WO2011161093A1 (en) | 2010-06-25 | 2011-12-29 | Basf Plant Science Company Gmbh | Acyltransferases and uses therof in fatty acid production |
| DE112011103527T5 (de) | 2010-10-21 | 2013-10-17 | Basf Plant Science Company Gmbh | Neue Fettsäure-Desaturasen, -Elongasen, -Elongations-Komponenten und Anwendungen davon |
| EP2695936A1 (en) | 2010-10-21 | 2014-02-12 | BASF Plant Science Company GmbH | Novel fatty acid desaturases and uses thereof |
| WO2012052468A2 (en) | 2010-10-21 | 2012-04-26 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases, elongases, elongation components and uses therof |
| US9458477B2 (en) | 2010-10-21 | 2016-10-04 | Basf Plant Science Company Gmbh | Fatty acid desaturases, elongases, elongation components and uses thereof |
| WO2014020533A2 (en) | 2012-08-03 | 2014-02-06 | Basf Plant Science Company Gmbh | Novel enzymes, enzyme components and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2354672A1 (en) | 2000-06-15 |
| CA2791961A1 (en) | 2000-06-15 |
| DE69935162D1 (de) | 2007-03-29 |
| JP2002531116A (ja) | 2002-09-24 |
| ATE353952T1 (de) | 2007-03-15 |
| JP4383671B2 (ja) | 2009-12-16 |
| EP1147174A4 (en) | 2004-10-06 |
| NZ512656A (en) | 2003-09-26 |
| AU776711B2 (en) | 2004-09-16 |
| DE69935162T2 (de) | 2007-11-22 |
| CA2354672C (en) | 2012-10-02 |
| EP1147174A1 (en) | 2001-10-24 |
| AU3109000A (en) | 2000-06-26 |
| EP1147174B1 (en) | 2007-02-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1147174B1 (en) | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids | |
| US8124838B2 (en) | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids | |
| US10174297B2 (en) | Fatty acid desaturases from primula | |
| JP6746648B2 (ja) | オメガ−3脂肪酸を産生するための酵素および方法 | |
| EP1086236A2 (en) | Polyunsaturated fatty acids in plants | |
| AU2011200614A1 (en) | Delta-15 desaturases suitable for altering levels of polyunsaturated fatty acids in oilseed plants and oleaginous yeast | |
| EP1576166A2 (en) | Novel method for the production of polyunsaturated fatty acids | |
| US20030172398A1 (en) | Novel delta-12 desaturase and methods of using it for synthesis of polyunsaturated fatty acids | |
| US10351871B2 (en) | Desaturases and methods of using them for synthesis of polyunsaturated fatty acids | |
| WO2001092489A2 (en) | Palmitate desaturase gene | |
| US20050170478A1 (en) | Expression of phospholipid:diacylglycerine acyltranssferase (pdat) for the production of plant storage lipids with polyunsaturated fatty acids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 2354672 Country of ref document: CA Ref country code: CA Ref document number: 2354672 Kind code of ref document: A Format of ref document f/p: F |
|
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2000 586873 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 31090/00 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 512656 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1999965105 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 09857583 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1999965105 Country of ref document: EP |
|
| WWG | Wipo information: grant in national office |
Ref document number: 31090/00 Country of ref document: AU |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1999965105 Country of ref document: EP |