WO1999056755A1 - Methodes de prevention et de traitement des parasitoses et maladies associees a l'aide d'oligonucleotides cpg - Google Patents

Methodes de prevention et de traitement des parasitoses et maladies associees a l'aide d'oligonucleotides cpg Download PDF

Info

Publication number
WO1999056755A1
WO1999056755A1 PCT/US1999/009863 US9909863W WO9956755A1 WO 1999056755 A1 WO1999056755 A1 WO 1999056755A1 US 9909863 W US9909863 W US 9909863W WO 9956755 A1 WO9956755 A1 WO 9956755A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
parasite
administered
cpg
infection
Prior art date
Application number
PCT/US1999/009863
Other languages
English (en)
Inventor
Robert A. Gramzinski
Arthur M. Krieg
Heather L. Davis
Stephen L. Hoffman
Original Assignee
University Of Iowa Research Foundation
Ottawa Civic Loeb Research Institute
United States Of America As Represented By The Secretary Of The Navy
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Iowa Research Foundation, Ottawa Civic Loeb Research Institute, United States Of America As Represented By The Secretary Of The Navy filed Critical University Of Iowa Research Foundation
Priority to EP99921705A priority Critical patent/EP1077708A1/fr
Priority to AU38841/99A priority patent/AU3884199A/en
Priority to JP2000546780A priority patent/JP2002513763A/ja
Priority to CA002328602A priority patent/CA2328602A1/fr
Publication of WO1999056755A1 publication Critical patent/WO1999056755A1/fr

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/20Interleukins [IL]
    • A61K38/208IL-12
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/21Interferons [IFN]
    • A61K38/217IFN-gamma
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents

Definitions

  • the present invention relates to the use of immunostimulatory CpG oligonucleotides in the prevention and treatment of parasitic infection and disease.
  • parasites are organisms which depend upon other organisms in order to survive and thus must enter, or infect, another organism to continue their life cycle.
  • the infected organism i.e., the host, provides both nutrition and habitat to the parasite.
  • the term parasite can include all infectious agents (i.e., bacteria, viruses, fungi, protozoa and helminths), generally speaking, the term is used to refer solely to protozoa, helminths, and ectoparasitic arthropods (e.g., ticks, mites, etc.).
  • Protozoa are single celled organisms which can replicate both intracellularly and extracellularly, particularly in the blood, intestinal tract or the extracellular matrix of tissues.
  • Helminths are multicellular organisms which almost always are extracellular (the exception being Trichinella spp.).
  • Helminths normally require exit from a primary host and transmission into a secondary host in order to replicate.
  • ectoparasitic arthropods form a parasitic relationship with the external surface of the host body.
  • parasitic infections particularly helmintic infections, and the diseases to which they give rise, are chronic conditions, due to the initial asymptomatic presence of some parasites.
  • the infection, and the related disease are acute and, if left untreated, can be lethal. These latter instances represent a small proportion of total parasitic infections, most probably because the parasite is ultimately dependent upon a viable host in order to propagate.
  • Parasites are capable of infecting almost any tissue or cell type, however, depending on the particular parasite, they tend to preferentially target a subset of cells including, in humans, red cells, fibroblasts, muscle cells, macrophages and hepatocytes.
  • the protozoan Entamoeba histolytica which is found in the intestinal tract and propagated by contact with host feces, can migrate across the intestinal mucosal lining to infect other bodily tissues such as the liver eventually forming amoebic abscesses.
  • Other parasites can be transmitted via intermediate hosts such as mosquitoes.
  • Ectoparasitic arthropods are a - 2 - nuisance for household pets (e.g., dogs, cats) and, more importantly, can contribute to wasting syndromes and act as a vehicle for the transmission of other infections (such as babesiosis and theileriasis) in agricultural livestock.
  • Malaria is the most prevalent parasitic disease in humans. It is estimated that malaria- causing parasites such as Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, Plasmodium knowlesi and Plasmodium ovale result in an estimated 300-500 million new infections and 1.5 to 2.7 million deaths annually in less developed areas of the world (WHO, 1995). In addition, tens of millions of travelers from countries, where malaria is not endemic, visit countries where it is, and many of these travelers succumb to illness during their travels or after returning home. In the latter case, there is a particular risk of failure to rapidly diagnose and initiate treatment, owing to the lack of experience with the disease by local physicians.
  • parasitic infections in humans include schistosomiasis, filariasis, hookworm, ascariasis, leishmaniasis, trichinosis, Chagas' disease and African trypanosomiasis.
  • parasites also pose a considerable risk to agricultural livestock and domestic and wild animals.
  • Agricultural livestock and in some cases zoo animals are ripe targets for widespread transmission of parasitic diseases for two major reasons.
  • livestock usually live in such close quarters thereby facilitating the transmission of a parasite to an entire flock or herd.
  • the maintenance of a parasite free environment through prevention of parasitic infections would be highly desirable in these circumstances.
  • the elimination of parasites by the immune system is usually incomplete due in part to the complex and varied life cycles of parasites which consist of antigenically distinct developmental stages.
  • the immune response to parasitic invasion is generally not humoral (i.e., antibody based) and thus immunological memory does not usually follow from an infection.
  • infected individuals do not develop an immunity to the parasite and continue to be susceptible to future infections.
  • the treatment and prevention of parasitic infection has traditionally depended on the discovery of drugs targeted against the particular parasite or a carrier of the parasite, such as mosquitoes (e.g., insecticides). Although historically productive, many of the parasites, particularly those that cause malaria, have now developed resistance to such drugs and there are few new drug candidates on the horizon (Hoffman and Miller.
  • the invention relates to the use of CpG oligonucleotides in the prevention and treatment of parasitic infections and related diseases.
  • the invention relates to a method for preventing a parasitic infection in a subject comprising administering to the subject at risk of being infected with a parasite an effective amount, for preventing a parasitic infection, of an oligonucleotide having a sequence including at least the following formula:
  • oligonucleotide includes at least 6 nucleotides wherein C and G are unmethylated and wherein X, and X 2 are nucleotides prior to exposure to a parasite.
  • the oligonucleotide is 6 to 100 nucleotides in length.
  • X, in the above formula is selected from the group of A, T or G.
  • X 2 in the above formula is selected from the group consisting of A, C or T.
  • the subject at risk of being infected with a parasite is a human.
  • the subject is non-human.
  • the invention is directed towards a subject selected from the group consisting of a cat, dog, cow, pig, sheep, horse, chicken, duck, goose, fish, goat, mouse, rat, gerbil, rabbit and a zoo animal.
  • the subject is at risk of infection with an intracellular parasite.
  • the parasite is an obligate intracellular parasite.
  • the method of the invention is directed towards the prevention of infection by the following parasites: Plasmodium falciparum, Plasmodium ovale, Plasmodium malariae, Plasmdodium vivax, Plasmodium knowlesi, Babesia microti, Babesia divergens, Trypanosoma cruzi, Toxoplasma gondii, Trichinella spiralis, Leishmania major, Leishmania donovani, Leishmania braziliensis and Leishmania tropica.
  • the method is directed towards the prevention of infection by the following parasites: Trypanosoma gambiense, Trypanosmoma rhodesiense and Schistosoma mansoni. In preferred embodiments, the method is directed towards the prevention of infection with parasites which cause malaria.
  • the subject is also administered an effective amount of one or more non-CpG oligonucleotide therapeutic agents.
  • the non-CpG oligonucleotide therapeutic agent is a parasiticide.
  • the non-CpG oligonucleotide therapeutic agent is selected from the group consisting of IL-1, IL-6, IL-12, IL-15, IL-18, IFN- ⁇ , TNF- ⁇ , GM-CSF, CD40 ligand and Flt3 ligand.
  • IL-12 and IFN- ⁇ are administered prior to IFN administration.
  • the oligonucleotide is administered more than once. In other embodiments, the oligonucleotide is administered at least 7 days prior to a parasite infection. In still other embodiments, the oligonucleotide is administered at least 2 days prior to a parasite infection. In still further embodiments, the oligonucleotide is administered at least 24 hours prior to a parasite infection.
  • the oligonucleotide is administered orally, mucosally, transdermally, subcutaneously, parenterally, or by inhalation.
  • the oligonucleotide is administered in a sustained release vehicle.
  • the sustained release vehicle is a liposome.
  • the invention in another aspect, relates to a pharmaceutical preparation comprising the oligonucleotide having a sequence including at least the following formula: 5' X,CGX 2 3' wherein the oligonucleotide includes at least 6 nucleotides wherein C and G are unmethylated and wherein X, and X 2 are nucleotides, at least one therapeutic agent and a therapeutically acceptable carrier.
  • the invention in another aspect, relates to a kit comprising the pharmaceutical preparation comprising the oligonucleotide of the invention with the above formula, a non-CpG oligonucleotide therapeutic agent in a therapeutically acceptable carrier - 5 - in at least one container and instructions for use wherein the oligonucleotide and the therapeutic agent are in separate containers.
  • a sustained release device is used to deliver the compounds of the invention.
  • a sustained release device comprising the oligonucleotide of the invention and a polymer capable of release for at least 7 days is used.
  • a sustained release device comprising the oligonucleotide of the invention and a polymer capable of release for at least 10 days is used.
  • a sustained release device comprising the oligonucleotide of the invention and a polymer capable of release for at least 30 days is used.
  • a sustained release device comprising the oligonucleotide of the invention and a polymer capable of release for at least 60 days is used.
  • a method for treating a subject infected with a parasite other than Leishmania comprising administering to the subject an effective amount for treating a non-Leishmania parasite infection of an oligonucleotide having a sequence including at least the following formula:
  • a "non-Leishmania parasite infection" is an infection caused by a parasite other than a species of Leishmania.
  • the treatment method involves the use of an oligonucleotide which is 6 to 100 nucleotides in length.
  • the treatment method uses oligonucleotides in which X
  • the treatment method uses oligonucleotides in which X 2 in the above formula is selected from the group consisting of A, C or T.
  • the method of treatment is directed to a human subject.
  • the method of treatment is directed to a non-human subject.
  • the subject having a parasitic infection is selected from the group consisting of a cat, dog, cow, pig, sheep, horse, chicken, duck, goose, fish, goat, mouse, rat, gerbil, rabbit and a zoo animal.
  • the method of treatment is directed to a subject infected with an - 6 - intracellular parasite.
  • the method of treatment is directed to a subject infected with an obligate intracellular parasite.
  • the method of treatment is directed to a subject infected with Plasmodium falciparum, Plasmodium ovale, Plasmodium malariae, Plasmdodium vivax, Plasmodium knowlesi, Babesia microti, Babesia divergens, Trypanosoma cruzi, Toxoplasma gondii or Trichinella spiralis.
  • the method of treatment is directed to a subject infected with Trypanosoma gambiense, Trypanosmoma rhodesiense and Schistosoma mansoni.
  • the method of treatment is directed to a subject infected with a parasite which causes malaria.
  • the subject having a parasitic infection is also administered an effective amount of one or more non-CpG oligonucleotide therapeutic agents.
  • the non-CpG oligonucleotide therapeutic agent is a parasiticide agent.
  • the subject having a parasitic infection is also administered an non-CpG oligonucleotide therapeutic agent selected from the group consisting of IL-1, IL-6, IL-12, IL-15, IL-18, IFN- ⁇ , TNF- ⁇ , GM-CSF, CD40 ligand and Flt3 ligand.
  • IL-12 is administered prior to IFN administration.
  • the oligonucleotide is administered more than once to the subject having a parasitic infection. In still other embodiments, the oligonucleotide is administered within 24 hours of parasite infection to the subject having a parasitic infection. In still further embodiments, the oligonucleotide is administered within 48 of parasite infection. In yet other embodiments, the oligonucleotide is administered within 7 days of parasite infection.
  • the oligonucleotide is administered orally, mucosally, transdermally, subcutaneously, parenterally, or by inhalation to a subject having a parasite infection.
  • the oligonucleotide is administered in a sustained release vehicle to a subject having a parasitic infection.
  • the sustained release vehicle is a liposome.
  • the oligonucleotide referred to is one having the sequence including at least - 7 - the following formula:
  • oligonucleotide includes at least 6 nucleotides wherein C and G are unmethylated and wherein X, and X 2 are nucleotides.
  • the invention is related to the discovery that administration of unmethylated CpG containing oligonucleotide to a subject prevented parasitic infection in the subject.
  • CpG containing oligonucleotides and “CpG oligonucleotides” are used interchangeably.
  • the observations on which the invention is premised demonstrate the ability of CpG oligonucleotides to stimulate the innate immune system thereby providing protection against parasites such as those causing malaria and treatment of parasitic infection.
  • the invention involves a method for preventing parasitic infection in a subject.
  • Parasitic infection arises from exposure to parasites which can occur in a number of ways. Transmission is possible through contact with bodily fluids, tissues or waste products from infected individuals, or through contact with intermediary hosts such as insects (e.g., insect bites). Individuals who are infected with parasites can be identified based on physical symptoms and/or clinical findings including the observation of parasitic bodies or debris in samples of bodily fluids, tissues or waste.
  • the methods of the invention involve administering to a subject, at risk of being infected with a parasite, a CpG containing oligonucleotide in an amount effective to prevent a parasitic infection in the subject.
  • a subject at risk of being infected with a parasite is one who has any risk of exposure to an infectious parasite such as conditions or environments in which parasite infections are common, including contact with an infected individual.
  • a subject is at risk of parasitic infection if there is a possibility that the subject will be exposed or come in contact with another individual either known to be or later diagnosed as suffering from a parasitic infection.
  • an individual anticipating travel to a region in which parasitic infections are endemic is considered a person at risk of being infected with a parasite.
  • the prevalence in some countries of parasites, and the diseases to which they give rise, increases the likelihood that travelers, workers and military personnel assigned to these regions will be at risk of parasitic exposure and subsequently, suffer from a - 8 - parasitic infection.
  • the invention also encompasses the use of the CpG oligonucleotide for the treatment of a subject having a parasite infection.
  • a "subject having a parasite infection” is a subject that has been exposed to an infectious parasite and has acute or chronic detectable levels of the pathogen in the body.
  • the CpG oligonucleotide can be used to mount an innate immune response that is capable of reducing the level of or eradicating the infectious pathogen (i.e., parasite). The innate immune response does not involve an antigen and is thus useful against any type of pathogen.
  • the CpG oligonucleotide may also enhance an antigen specific immune response if an antigen is administered with the CpG oligonucleotide.
  • An antigen specific immune response is not required for prophylactic or treatment purposes according to the invention.
  • An infectious parasitic disease as used herein, is a disease arising from the presence of a parasite in the body.
  • the subject has been exposed to malaria causing Plasmodium spp.
  • the subject has been infected with Trypanosoma cruzi, Trichinella spiralis, Babesia spp. or Toxoplasma gondii.
  • the CpG oligonucleotides of the invention can be administered following suspected or confirmed parasite exposure.
  • a subject infected with a parasite often times exhibits a set of symptoms which can be used to identify the presence of the parasitic infection and in some instances, the particular parasite involved.
  • Parasitic infections which the compounds and methods of the invention seek to prevent and treat include those occurring in humans and non-human vertebrates.
  • the methods of the invention are directed towards human subjects.
  • the methods of the invention are directed towards non-human vertebrates including agricultural livestock and domesticated and wild animals, such as, for example, cattle, horses, swine, goats and sheep, poultry and other winged vertebrates, rabbits, dogs, cats, ferrets and fish.
  • Non-human vertebrates which exist in close quarters and which are allowed to intermingle as in the case of zoo and research animals are also embraced as subjects for the methods of the invention.
  • Zoo animals such as the felid species including for example lions, tigers, leopards, cheetahs, and cougars; elephants, giraffes, bears, deer, wolves, - 9 - yaks, non-human primates, seals, dolphins and whales; and research animals such as mice, rats, hamsters and gerbils are all potential subjects for the methods of the invention.
  • Most parasites are host-specific or have a limited host range, i.e., they are able to infect a single or at most a few species.
  • P. yoelii is able to infect only rodents while P. falciparum and P. malariae are able to infect humans.
  • the parasitic infection to be targeted by the methods and compounds of the invention will depend upon the host species receiving the prophylactic treatment and the conditions to which that host will become exposed. Parasites can be classified based on whether they are intracellular or extracellular.
  • intracellular parasite as used herein is a parasite whose entire life cycle is intracellular.
  • human intracellular parasites include Leishmania spp., Plasmodium spp., Trypanosoma cruzi. Toxoplasma gondii, Babesia spp., and Trichinella spiralis.
  • An "extracellular parasite” as used herein is a parasite whose entire life cycle is extracellular. Extracellular parasites capable of infecting humans include Entamoeba histolytica, Giardia lamblia, Enterocytozoon bieneusi, Naegleria and Acanthamoeba as well as most helminths.
  • parasites are defined as being mainly extracellular but with an obligate intracellular existence at a critical stage in their life cycles. Such parasites are referred to herein as "obligate intracellular parasites". These parasites may exist most of their lives or only a small portion of their lives in an extracellular environment, but they all have at lest one obligate intracellular stage in their life cycles. This latter category of parasites includes Trypanosoma rhodesiense and Trypanosoma gambiense, Isospora spp., Cryptosporidium spp, Eimeria spp., Neospora spp., Sarcocystis spp., and Schistosoma spp.
  • the invention relates to the prevention and treatment of infection resulting from intracellular parasites and obligate intracellular parasites which have at least in one stage of their life cycle that is intracellular.
  • the invention is directed to the prevention of infection from obligate intracellular parasites which are predominantly intracellular.
  • the methods of the invention are not expected to function in the prevention of infection by extracellular parasites, i.e., helminths.
  • An exemplary and non-limiting list of parasites for some aspects of the invention is provided herein. - 10 -
  • Blood-borne and/or tissues parasites include Plasmodium spp., Babesia microti, Babesia divergens, Leishmania tropica, Leishmania spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma gambiense and Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma cruzi (Chagas' disease), and Toxoplasma gondii.
  • Typical parasites infecting horses are Gasterophilus spp.; Eimeria leuckarti, Giardia spp.; Tritrichomonas equi; Babesia spp. (RBC's), Theileria equi; Trypanosoma spp.; Klossiella equi; Sarcocystis spp.
  • Typical parasites infecting swine include Eimeria bebliecki, Eimeria scabra, Isospora suis, Giardia spp.; Balantidium coli, Entamoeba histolytica; Toxoplasma gondii and Sarcocystis spp., and Trichinella spiralis.
  • the major parasites of dairy and beef cattle include Eimeria spp., Cryptosporidium sp., Giardia sp.; Toxoplasma gondii; Babesia bovis (RBC), Babesia bigemina (RBC), Trypanosoma spp. (plasma), Theileria spp. (RBC); Theileria parva (lymphocytes); Tritrichomonas foetus; and Sarcocystis spp.
  • the major parasites of raptors include Trichomonas gallinae; Coccidia (Eimeria spp.);
  • Typical parasites infecting sheep and goats include Eimeria spp., Cryptosporidium sp., Giardia sp.; Toxoplasma gondii; Babesia spp. (RBC), Trypanosoma spp. (plasma), Theileria spp. (RBC); and Sarcocystis spp.
  • Typical parasitic infections in poultry include coccidiosis caused by Eimeria acervulina, E. necatrix, E. tenella, Isospora spp. and Eimeria truncata; histomoniasis, caused by Histomonas meleagridis and Histomonas gallinarum; trichomoniasis caused by Trichomonas gallinae; and hexamitiasis caused by Hexamita meleagridis.
  • Poultry can also be infected Emeria maxima, Emeria meleagridis, Eimeria adenoeides, Eimeria meleagrimitis, Cryptosporidium, Eimeria brunetti, Emeria adenoeides, Leucocytozoon spp., Plasmodium spp., Hemoproteus meleagridis, Toxoplasma gondii and Sarcocystis.
  • Parasitic infections also pose serious problems in laboratory research settings involving animal colonies.
  • Some examples of laboratory animals intended to be treated, or in - 11 - which parasite infection is sought to be prevented, by the methods of the invention include mice, rats, rabbits, guinea pigs, nonhuman primates, as well as the aforementioned swine and sheep.
  • Typical parasites in mice include Leishmania spp., Plasmodium berghei, Plasmodium yoelii, Giardia muris, Hexamita muris; Toxoplasma gondii; Trypanosoma duttoni (plasma); Klossiella muris; Sarcocystis spp.
  • Typical parasites in rats include Giardia muris, Hexamita muris; Toxoplasma gondii; Trypanosoma lewisi (plasma); Trichinella spiralis; Sarcocystis spp.
  • Typical parasites in rabbits include Eimeria sp.; Toxoplasma gondii; Nosema cuniculi; Eimeria sitedae, Sarcocystis spp.
  • Typical parasites of the hamster include Trichomonas spp.; Toxoplasma gondii; Trichinella spiralis; Sarcocystis spp.
  • Typical parasites in the guinea pig include Balantidium caviae; Toxoplasma gondii; Klossiella caviae; Sarcocystis spp.
  • the methods of the invention can also be applied to the treatment and/or prevention of parasitic infection in dogs, cats, birds, fish and ferrets.
  • Typical parasites of birds include Trichomonas gallinae; Eimeria spp., Isospora spp., Giardia; Cryptosporidium; Sarcocystis spp., Toxoplasma gondii, Haemoproteus/Parahaemoproteus, Plasmodium spp.,
  • Typical parasites infecting dogs include Trichinella spiralis; Isopora spp., Sarcocystis spp., Cryptosporidium spp., Hammondia spp., Giardia duodenalis (canis); Balantidium coli, Entamoeba histolytica; Hepatozoon canis; Toxoplasma gondii, Trypanosoma cruzi; Babesia canis; Leishmania amastigotes; Neospora caninum.
  • Typical parasites infecting feline species include Isospora spp., Toxoplasma gondii, Sarcocystis spp., Hammondia hammondi, Besnoitia spp., Giardia spp.; Entamoeba histolytica; Hepatozoon canis, Cytauxzoon sp., Cytauxzoon sp., Cytauxzoon sp. (red cells, RE cells).
  • Typical parasites infecting fish include Hexamita spp., Eimeria spp.; Cryptobia spp.,
  • Typical parasites of wild mammals include Giardia spp. (carnivores, herbivores), Isospora spp. (carnivores), Eimeria spp. (carnivores, herbivores); Theileria spp. (herbivores), Babesia spp. (carnivores, herbivores), Trypanosoma spp. (carnivores, herbivores); - 12 -
  • Schistosoma spp. (herbivores); Fasciola hepatica (herbivores), Fascioloides magna (herbivores), Fasciola gigantica (herbivores), Trichinella spiralis (carnivores, herbivores).
  • Parasitic infections in zoos can also pose serious problems.
  • Typical parasites of the bovidae family include Eimeria spp.
  • Typical parasites in the pinnipedae family (seal, sea lion) include
  • Eimeria phocae Typical parasites in the camelidae family (camels, llamas) include Eimeria spp. Typical parasites of the giraffidae family (giraffes) include Eimeria spp. Typical parasites in the elephantidae family (African and Asian) include Fasciola spp. Typical parasites of lower primates (chimpanzees, orangutans, apes, baboons, macaques, monkeys) include Giardia sp.; Balantidium coli, Entamoeba histolytica, Sarcocystis spp., Toxoplasma gondii; Plasmodim spp. (RBC), Babesia spp. (RBC), Trypanosoma spp. (plasma), Leishmania spp. (macrophages).
  • Parasite-related diseases also include: in cattle, ostertagiasis caused by Ostertagia infection and manifest as diarrhea, anorexia or loss of appetite and weight loss; in sheep, haemonchosis caused by H. contortus infection and manifest as unexpected death, weakness, anemia, hypoproteinemia, subcutaneous edema, weight loss, or poor or no weight gain.
  • the subject is free of parasitic infection and disease related symptoms.
  • subjects have been put at risk of contracting a parasite through close contact with an identified or suspected carrier or the bodily waste of such an individual.
  • the invention is directed to a method for treating a subject who has developed a parasitic infection as a result of being in contact with an infectious parasite such as from an individual having a parasitic infection.
  • Parasitic infection in a subject is often associated with a number of symptoms or conditions, combinations of which may be used in some embodiments to identify the particular parasite involved.
  • Severe malaria can manifest itself in unarousable coma (cerebral malaria), renal failure, severe anemia, pulmonary edema, hypoglycemia, hypotension or shock, bleeding or disseminated intravascular coagulation, convulsions, acidemia or acidosis, hemoglobinuria, jaundice and hyperpyrexia.
  • Symptoms particularly associated with gastrointestinal parasitic infections also include loss of blood resulting in pale mucous membranes, diarrhea with loss of water and electrolyte disturbances, poor weight gains or even weight loss in severe infections, protein losses, hypoproteinemia and associated edema, anorexia and reduced food intake, anemia, reduced digestion and absorption.
  • Diagnosis of a parasite infection in non-human animals can involve the initial observance of symptoms associated with particular infections. For example, haemonchosis in sheep should be suspected if the following conditions are observed: unexpected deaths, weakness, anemia, hypoproteinemia, subcutaneous edema, poor weight gains or weight loss. These conditions will be apparent and well known to a veterinarian.
  • the diagnosis of a parasitic infection in an individual can be used to determine the need for prophylactic treatment in other subjects previously in contact or likely to be in contact with the afflicted individual using the methods of the invention as well as for treatment of the infected individual.
  • a number of laboratory tests for the diagnosis of parasitic infections, well known in the art, are described, for example, in Harrison's: Principles of Internal Medicine (McGraw Hill, Inc., New York).
  • Methods for diagnosing parasitic infections are generally similar for human and non- human parasitic infections. Procedures for diagnosing parasitism vary depending on the type of parasite to be detected. These procedures are well known to any clinician or veterinarian and can be easily performed in almost any clinical or veterinary practice. Macroscopic and microscopic examination of a bodily sample is usually initially performed to detect the presence of ova and adult parasites. Tissue parasites can sometimes be detected through the examination of biopsies and aspirates.
  • a bodily sample can be a liquid such as urine, saliva, - 14 - cerebrospinal fluid, blood, serum, bronchoalveolar lavage, sputum, bile or the like; a solid or semi-solid such as tissues, feces, or the like; or, alternatively, a solid tissue such as those commonly used in histological diagnosis.
  • a liquid such as urine, saliva, - 14 - cerebrospinal fluid, blood, serum, bronchoalveolar lavage, sputum, bile or the like
  • a solid or semi-solid such as tissues, feces, or the like
  • a solid tissue such as those commonly used in histological diagnosis.
  • Tests for parasites in agricultural livestock include direct smear of bodily liquid such as blood or bodily waste such as feces; fecal flotation fluids, centrifugation technique with flotation fluid (magnesium sulfate), modified Wisconsin Procedure for egg counts by a flotation method (for cattle, horses, dogs, cats and swine), modified Knott's Method of concentrating microfilaria, skin scraping and squash preparation for the diagnosis of trichinosis.
  • bodily liquid such as blood or bodily waste such as feces
  • fecal flotation fluids centrifugation technique with flotation fluid (magnesium sulfate)
  • modified Wisconsin Procedure for egg counts by a flotation method for cattle, horses, dogs, cats and swine
  • Knott's Method of concentrating microfilaria for skin scraping and squash preparation for the diagnosis of trichinosis.
  • liquid samples should be stained in order to better visualize any parasite bodies.
  • Giemsa or Wright's stain are appropriate for analysis of a number of parasites including Plasmodium spp., Leishmania spp., African trypanosomes, Trypanosoma cruzi, Toxoplasma gondii and Naegleria fowleri in the blood, urine or spinal fluid.
  • a diagnosis of coccidiosis in poultry can be established by preparing a wet mount of a mucosal scraping from the intestines of an infected bird and examining it by light microscopy.
  • the coccidial oocytes and schizonts can readily be identified at 100X magnification.
  • a fecal flotation is also very effective in demonstrating coccidial oocysts.
  • Histomoniasis can be diagnosed based on characteristic gross lesions and/or histologic lesions and H. gallinarum can be isolated from tissues of freshly killed affected birds in special broth media.
  • Parasites can be detected in humans by a number of well recognized specific binding assays which have been previously discussed in U.S. Patent Nos. 4,366,241 ; 4,376,110; 4,517,288 and 4,837,168, all of which are incorporated in their entirety by reference herein.
  • Other laboratory tests available to the clinician or veterinarian include immunodetection methods for the detection of parasite antigens or host antiparasite antibodies.
  • enzyme-linked immunosorbent assay ELISA
  • tissue parasites such as Toxoplasma.
  • Still more sensitive assays involve nucleic acid amplification methods such as polymerase chain reaction (PCR) and nucleic acid hybridization methods for detecting parasitic nucleic acids.
  • Detection of parasitic infection through nucleic acid based methods usually leads to the diagnosis of low grade malaria not otherwise detectable using standard clinical and laboratory techniques.
  • the levels of parasite antigens or nucleic acids can be compared to the levels in a control biological fluid or tissue sample taken from an - 15 - uninfected individual.
  • a positively identified subject would then signal the required therapeutic treatment in that individual and also the prophylactic treatment of other individuals.
  • a person of ordinary skill in the art could easily apply any of the foregoing tests to determine when a subject has a parasitic infection in order to plan a treatment course for that individual, for individuals previously in contact with that individual and for individuals expected to be in contact with that individual prior to the elimination of the parasitic infection by the methods of the invention.
  • the CpG oligonucleotides of the invention are nucleic acid molecules which contain an unmethylated cytosine-guanine dinucleotide sequence (i.e. "CpG DNA” or DNA containing a 5' cytosine followed by 3' guanosine and linked by a phosphate bond) and activate the immune system.
  • the CpG oligonucleotides can be double-stranded or single- stranded. Generally, although double-stranded molecules are more stable in vivo, single- stranded molecules have increased immune activity.
  • nucleic acid and “oligonucleotide” are used interchangeably to mean multiple nucleotides (i.e. molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)).
  • substituted pyrimidine e.g. cytosine (C), thymine (T) or uracil (U)
  • purine e.g. adenine (A) or guanine (G)
  • the terms refer to oligoribonucleotides as well as oligodeoxyribonucleotides.
  • the terms shall also include polynucleosides (i.e. a polynucleotide minus the phosphate) and any other organic base containing polymer.
  • Nucleic acid molecules can be obtained from existing nucleic acid sources (e.g. genomic or cDNA), but are preferably synthetic (e.g. produced by oligonucleotide synthesis). The entire CpG oligonucleotide can be unmethylated or portions may be unmethylated but at least the C of the 5' CG 3' must be unmethylated.
  • the CpG oligonucleotide has a sequence including at least the following formula:
  • the invention provides a CpG oligonucleotide represented by at least the formula: - 16 -
  • X is adenine, guanine, or thymine
  • X 2 is cytosine, adenine, or thymine
  • N is any nucleotide and N, and N 2 are nucleic acid sequences composed of from about 0-25 N's each.
  • the invention provides an isolated CpG oligonucleotide represented by at least the formula:
  • N is any nucleotide and N, and N 2 are nucleic acid sequences composed of from about 0-25 N's each.
  • N, and N 2 of the nucleic acid do not contain a CCGG or a CGCG quadmer or more than one CCG or CGG trimer especially if the oligonucleotide has a modified phosphate backbone.
  • the CpG oligonucleotide has the sequence 5TCN 1 TX 1 X 2 CGX 3 X 4 3'.
  • the CpG oligonucleotides of the invention include X ⁇ X 2 selected from the group consisting of GpT, GpG, GpA and ApA and X 3 X 4 is selected from the group consisting of TpT and CpT.
  • CpG containing oligonucleotides are preferably in the range of 6 to 30 bases in length.
  • nucleic acids of any size greater than 6 nucleotides are capable of inducing an immune response according to the invention if sufficient immunostimulatory motifs are present and if the CpG oligonucleotide enters the cell, since larger nucleic acids are degraded into oligonucleotides inside of cells.
  • Preferred synthetic oligonucleotides do not include a CCGG quadmer or more than one CCG or CGG trimer at or near the 5' and/or 3' terminals.
  • Stabilized oligonucleotides, where the oligonucleotide incorporates a phosphate backbone modification, as discussed in more detail below are also preferred.
  • the modification may be, for example, a phosphorothioate or phosphorodithioate modification.
  • the phosphate backbone modification occurs in the region 5' to the CpG of the nucleic acid for example, at the first two nucleotides of the 5' end of the oligonucleotide.
  • the phosphate backbone - 17 - modification may occur in the region 3' to the CpG of the nucleic acid for example, at the last five nucleotides of the 3' end of the nucleic acid.
  • the oligonucleotide may be completely or partially modified (referred to herein as a chimeric phosphate modification).
  • CpG oligonucleotides represented as SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:55 and SEQ ID NO:61 may have higher activity if presented in a phosphodiester or a chimeric backbone, rather than an exclusively phosphorothioate backbone. Alternatively, they may have the same activity but the kinetics may vary.
  • the appropriate backbone for each sequence may be identified by those of ordinary skill in the art without undue experimentation.
  • the CpG oligonucleotide is in the range of between 6 and 100 and more preferably between 8 and 30 nucleotides in size.
  • CpG oligonucleotides can be produced on a large scale in plasmids and degraded into oligonucleotides.
  • "Palindromic sequence” shall mean an inverted repeat (i.e. a sequence such as
  • the CpG oligonucleotide contains a palindromic sequence.
  • a palindromic sequence used in this context refers to a palindrome in which the CpG is part of the palindrome, and preferably is the center of the palindrome.
  • the CpG oligonucleotide is free of a palindrome.
  • a CpG oligonucleotide that is free of a palindrome is one in which the CpG dinucleotide is not part of a palindrome.
  • Such an oligonucleotide may include a palindrome in which the CpG is not part of the palindrome.
  • a “stabilized nucleic acid molecule” shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease). Stabilization can be a function of length or secondary structure. Unmethylated CpG oligonucleotides that are tens to hundreds of kbs long are relatively resistant to in vivo degradation. For shorter CpG oligonucleotides, secondary structure can stabilize and increase their effect.
  • an oligonucleotide For example, if the 3 ' end of an oligonucleotide has self-complementarity to an upstream region, so that it can fold back and form a sort of stem loop structure, then the oligonucleotide becomes stabilized - 18 - and therefore exhibits more activity.
  • Preferred stabilized CpG oligonucleotides of the instant invention have a modified backbone. It has been demonstrated that modification of the oligonucleotide backbone provides enhanced activity of the CpG oligonucleotides when administered in vivo.
  • CpG constructs including at least two phosphorothioate linkages at the 5' end of the oligonucleotide and multiple, preferably 5, phosphorothioate linkages at the 3' end provides maximal activity and protects the oligonucleotide from degradation by intracellular exo- and endo-nucleases.
  • modified CpG oligonucleotides include phosphodiester modified oligonucleotide, combinations of phosphodiester and phosphorothioate oligonucleotide, methylphosphonate, methylphosphorothioate, phosphorodithioate, and combinations thereof.
  • phosphodiester modified oligonucleotide combinations of phosphodiester and phosphorothioate oligonucleotide, methylphosphonate, methylphosphorothioate, phosphorodithioate, and combinations thereof.
  • Each of these combinations and their particular effects on immune cells is discussed in more detail in copending PCT Published Patent Applications claiming priority to U.S. Serial Nos. 08/738,652 and 08/960,774, filed on October 30, 1996 and October 30, 1997 respectively, the entire contents of which is hereby incorporated by reference. It is believed that these modified CpG oligonucleotides may show more stimulatory activity due to enhanced nuclease resistance, increased cellular up
  • phosphorothioate and phosphodiester oligonucleotides containing CpG motifs are active in immune cells. However, based on the concentration needed to induce CpG specific effects, the nuclease resistant phosphorothioate backbone CpG oligonucleotides are more potent (0.4 ⁇ g/ml for the phosphorothioate vs. a total of 40 ⁇ g/ml for phosphodiester).
  • oligonucleotides include: nonionic DNA analogs, such as alkyl- and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Oligonucleotides which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
  • nucleic acid sequences of the invention which are useful for preventing parasitic infection are those broadly described above and disclosed in PCT Published Patent Applications claiming priority to U.S. Serial Nos. 08/738,652 and 08/960,774, filed on - 19 -
  • GCTAGACGTTAGCGT SEQ ID NO: 1
  • GCTAGATGTTAGCGT SEQ ID NO: 2
  • GCATGACGTTGAGCT SEQ ID NO: 4
  • ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 6)
  • ATZGACTCTCGAGCGTTCTC (SEQ ID NO: 7)
  • ATCGACTCTCGAGCGTTZTC SEQ ID NO: 8
  • ATCGACTCTCGAACGTTCTC SEQ IDNO: 9
  • GAGAACGCTCGACCTTCCAT SEQ ID NO: 11
  • GAGAACGCTCGACCTTCGAT SEQ ID NO: 12
  • nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. Such nucleic acids are referred to as "synthetic oligonucleotides". For example, the b-cyanoethyl phosphoramidite method (S.L. Beaucage and M.H. Caruthers, 1981, Tet. Let. 22:1859); nucleoside H-phosphonate method (Garegg, et al., 1986. Tet. Let. 27:4051-4051; Froehler, et al., 1986, Nucl. Acid. Res. 14:5399-5407; Garegg, et al., 1986, Tet. Let.
  • synthetic oligonucleotides For example, the b-cyanoethyl phosphoramidite method (S.L. Beaucage and M.H. Caruthers, 1981, Tet. Let. 22:1859); nucleoside H-phosphonate method (Gare
  • oligonucleotides can be prepared from existing nucleic acid sequences (e.g. genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases. Such oligonucleotides are referred to as isolated oligonucleotides.
  • nucleic acids are preferably relatively resistant to degradation (e.g. via endo- and exo-nucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications as discussed above. A preferred stabilized nucleic acid can be accomplished via phosphate backbone modifications. A preferred stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made for example as described in U.S. Patent No.
  • 4,469,863; and alkylphosphotriesters in which the charged oxygen moiety is alkylated as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574
  • alkylphosphotriesters in which the charged oxygen moiety is alkylated as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574
  • 2'-O-methyl nucleic acids with CpG motifs can also cause detectable immune activation, as do ethoxy-modified CpG nucleic acids.
  • the methods of the invention involve administering to a subject, prior to parasite exposure, a CpG containing oligonucleotide in an amount effective to prevent a parasitic infection in the subject.
  • Prior administration of a CpG oligonucleotide greatly - 23 - benefits the subject by inducing a response within the subject consisting at least of an activated innate immune system response prior to, during or following the exposure to a parasite.
  • prior administration it is meant that administration occurs before exposure to the parasite.
  • the compounds of the invention may be administered with a greater than 60 day period of time between the administration and the parasite exposure.
  • the CpG oligonucleotides may be administered at least 50, or 40, or 30, or 14, or 7 days prior to parasite exposure.
  • the CpG oligonucleotides may be administered within a 7, 6, 5, 4, 3 or 2 day period prior to infection.
  • the CpG oligonucleotide of the invention may be administered at least 24 hours prior to suspected parasitic exposure.
  • the CpG oligonucleotides may be administered within 24, 12 or 4 hours of parasite infection.
  • CpG oligonucleotides may be administered with a greater than 7 day period between the CpG oligonucleotide administration and the parasite exposure. In such cases, higher doses may be used but are not always required. In preferred embodiments, the CpG oligonucleotides are administered within 2 days of parasite exposure. The period of protection will depend upon the dose of CpG oligonucleotide administered, thus high doses can provide longer lasting protection. The length of protection will also depend upon the mode of administration and the particular infection being prevented.
  • the invention relates to the treatment of subjects infected with a parasite.
  • the subject has been exposed and is currently suffering from an infection by the following parasites: Plasmodium spp., Babesia spp., Trypanosoma cruzi, Toxoplasma gondii and Trichinella spiralis.
  • the CpG oligonucleotides are effective in treating the infection even if administered after exposure to the parasite.
  • the compounds of the invention may be administered immediately after the parasite exposure or after a period of time.
  • the CpG oligonucleotides may be administered once the parasitic infection has been diagnosed which may range from a few - 24 - days to several weeks after parasite exposure or contact.
  • the CpG oligonucleotides may be administered within 24 hours or 48 hours after parasite infection (i.e.. parasite exposure). If diagnosis or treatment is delayed, it is also envisioned that the oligonucleotides may be administered within 7 days of infection. There may still be other situations in which even longer (i.e., greater than 7 days, 14 days or 30 days) period of time may elapse between parasite exposure and oligonucleotide administration.
  • unmethylated CpG oligonucleotides may exert parasitic protection at least in part through the induction of an innate non-antigen specific immune response via the activation of immune cells including antigen presenting cells such as macrophages and dendritic cells, natural killer (NK) cells and granulocytes such as neutrophils and basophils.
  • CpG oligonucleotides may also function by inducing a cell-mediated immune response through the activation of Thl cells and the induction of Thl cytokines, such as IL-12 and IFN- ⁇ .
  • IL-12 plays a role in the subsequent induction of IFN- ⁇ which in turn induces the synthesis of nitric oxide (NO). NO ultimately plays a role in the elimination of infected cells including malaria diseased hepatocytes.
  • NO nitric oxide
  • the invention relates to the IL-12 and IFN related immune response induced by CpG oligonucleotides.
  • the invention is not limited to IL-12 and/or IFN immune mechanisms, but rather can encompass each and every immune and non-immune mechanism by which CpG oligonucleotides exert protection or therapeutic benefit against parasite infection and associated disease.
  • the CpG oligonucleotides of the invention are administered in effective amounts.
  • An effective amount is a dosage of CpG oligonucleotides sufficient to provide a medically desirable result.
  • the CpG oligonucleotides are administered in effective amounts to prevent a parasitic infection or to protect a subject from a parasitic infection.
  • the CpG oligonucleotides are administered in effective amounts to reduce the level of, inhibit or eliminate a parasitic infection in a subject having a parasitic infection. The presence of a parasitic infection can be determined using routine assays known in the art as described above.
  • a conclusive negative finding may still require a number of consecutive negative findings over a period of a week rather than a single negative finding.
  • the effective amount will vary with the particular condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of the treatment, the nature of the concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner.
  • the effective amount may also vary depending on whether a prophylactic effect or a change in the course of an infection is desired.
  • an effective amount in connection with liver affected malaria (i.e., Plasmodium infection), is that amount which prevents the appearance of, reduces the level of, or eliminates malaria infected hepatocytes and erythrocytes, or leads to the absence oi Plasmodium - 26 - parasites in the blood stream or in tissues of interest such as the liver.
  • an effective amount for preventing a parasite infection related disease is an amount sufficient to prevent the symptoms of such diseases as described herein.
  • an effective amount may be that amount necessary to reduce the number or, in some instances, eliminate altogether parasite bodies and/or fragments in a sample of bodily fluid, tissue or waste. In other embodiments, an effective amount may be that amount necessary to reduce or eliminate the number and severity of symptoms relating to the particular parasite infection in a subject having a parasitic infection. _An effective amount, is not however, an amount which is toxic to the subject.
  • the CpG oligonucleotides of the invention can be used to treat the above-noted conditions prophylactically in subjects at risk of developing the foregoing conditions, or therapeutically in subjects known or suspected to have a parasitic infection.
  • an effective amount will vary with the subject's age, condition, and sex, as well as the nature and extent of the parasitic infection being prevented in the subject, all of which can be determined by one of ordinary skill in the art.
  • the dosage may be adjusted by the individual physician or veterinarian, particularly in the event of any complication.
  • a prophylactically effective amount typically varies from 0.01 mg/kg to about 1000 mg/kg, preferably from about 0.1 mg/kg to about 200 mg/kg, and most preferably from about 0.2 mg//kg to about 20 mg/kg, in one or more dose administrations daily, every few days or weekly. Additionally, the dose to be administered will depend upon the timing and mode of administration.
  • a higher dose may be necessary.
  • the amount delivered in an individual dose may also be higher than would be otherwise tolerated.
  • One of skill in the art can determine an effective amount of a CpG oligonucleotides using in vitro or in vivo screening assays.
  • one screening assay useful according to the invention measures the ability of the CpG oligonucleotide to lyse malaria infected hepatocytes in vitro. The prevention of parasitemia following parasite challenge may also be assessed in an in vivo model.
  • An exemplary assay for measuring the ability of a CpG oligonucleotide of the invention to protect mice from Plasmodium infection is provided in the Examples.
  • the assay measures the ability of CpG oligonucleotides to prevent active infection following inoculation of Plasmodium sporozoities. Results of assays similar to those - 27 - described in the Examples can be used to select CpG oligonucleotides and doses of such for prophylactic applications.
  • the CpG oligonucleotides useful in the invention preferably exhibit a complete inhibition of parasite infection as measured by a number of clinical, laboratory or molecular assays (as described herein).
  • mice are administered CpG oligonucleotides at various doses either in a single or multiple boli.
  • the animals and/or their waste are analyzed for the presence of parasites.
  • a stained blood smear may suffice to detect the presence of parasites.
  • compositions of the invention can be administered alone or in combination with one or more non-CpG oligonucleotide therapeutic agents.
  • Non-CpG oligonucleotide therapeutic agents for the purpose of the invention, are agents useful in the prevention and treatment of parasitic infection and subsequent disease which are not CpG oligonucleotides as defined herein.
  • Non-CpG oligonucleotide therapeutic agents may be administered together or at a timed interval from the administration of the CpG oligonucleotides.
  • a useful non-CpG oligonucleotide therapeutic agent is an immune response inducer such as a cytokine or antibody.
  • Non-CpG oligonucleotide therapeutic agents can also include parasiticide agents previously used in the treatment of parasitic infection.
  • Parasiticides are well known in the art and generally commercially available.
  • Coadministration of the CpG oligonucleotides with other non-CpG oligonucleotide prophylactic or therapeutic agents is also possible.
  • Coadministered compounds may be those known to be active against a particular parasitic disease. Examples of parasiticides useful for human administration include but are not limited to albendazole, amphotericin B, benznidazole, bithionol.
  • Parasiticides used in non-human subjects include piperazine, diethylcarbamazine, thiabendazole, fenbendazole, albendazole, oxfendazole, oxibendazole, febantel, levamisole, pyrantel tartrate, pyrantel pamoate, dichlorvos, ivermectin, doramectic, milbemycin oxime, iprinomectin, moxidectin, N-butyl chloride, toluene, hygromycin B thiacetarsemide sodium, melarsomine, praziquantel, epsiprantel, benzimidazoles such as fenbendazole, albendazole, oxfendazole, clorsulon, albendazole, amprolium; decoquinate, lasalocid, monensin sulfadimethoxine; sul
  • Parasiticides used in horses include mebendazole, oxfendazole, febantel, pyrantel, dichlorvos, trichlorfon, ivermectin, piperazine; for S. western ivermectin, benzimiddazoles such as thiabendazole, cambendazole, oxibendazole and fenbendazole.
  • Useful parasiticides in dogs include milbemycin oxine, ivermectin, pyrantel pamoate and the combination of ivermectin and pyrantel.
  • the treatment of parasites in swine can include the use of levamisole, piperazine, pyrantel, thiabendazole, dichlorvos and fenbendazole.
  • anthelmintic agents include levamisole or ivermectin.
  • Caparsolate has shown some efficacy in the treatment of D. immitis (heartworm) in cats.
  • Agents used in the prevention and treatment of protozoal diseases in poultry, particularly trichomoniasis can be administered in the feed or in the drinking water and include protozoacides such as aminonitrothiazole, dimetridazole (Emtryl), nithiazide (Hepzide) and Enheptin.
  • the compounds of the invention can also be administered with other therapeutic - 29 - agents.
  • immune response agents such as growth factors and cytokines can be used in conjunction with the CpG oligonucleotides of the invention.
  • activators of innate immunity which synergize with CpG oligonucleotides, an example of which is GM- CSF, can also be co-administered in the methods of the invention.
  • the compounds of the invention can be administered with IL-12 alone, IFN- ⁇ alone, with both IL-12 and IFN- ⁇ , or with any individual or combination of cytokines, chemokines or growth factors deemed suitable for parasite infection control.
  • Immunopotentiating cytokines are those molecules and compounds which stimulate the humoral and/or cellular immune response.
  • cytokine is used as a generic name for a diverse group of soluble proteins and peptides which act as humoral regulators at nano- to picomolar concentrations and which, either under normal or pathological conditions, modulate the functional activities of individual cells and tissues. These proteins also mediate interactions between cells directly and regulate processes taking place in the extracellular environment.
  • cytokines useful according to the invention include, but are not limited to IL-1, IL-2, IL-6, IL-7, IL-12, IL-15, IL-18, granulocyte-macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), interferon- ⁇ , (IFN- ⁇ ), tumor necrosis factor (TNF- ⁇ ), Flt3 ligand, and CD40 ligand.
  • GM-CSF granulocyte-macrophage colony stimulating factor
  • G-CSF granulocyte colony stimulating factor
  • IFN- ⁇ interferon- ⁇
  • TNF- ⁇ tumor necrosis factor
  • Flt3 ligand Flt3 ligand
  • Fl ⁇ 3 ligand is a class of compounds described in EP0627487A2 and W094/28391.
  • a human Flt3 ligand cDNA was deposited with the American Tissue Type Culture Collection, Rockville, Maryland, and assigned accession number ATCC 69382.
  • Interleukins (ILs) have been described extensively in the art, e.g., Mosley, et al., 1989, Cell, 59:335, Idzerda. et al., 1990, J. Exp. Med., 171 :861.
  • GM-CSF is commercially available as sargramostine, leukine (Immunex).
  • Cytokines play a role in directing the T cell response.
  • Helper (CD4+) T cells orchestrate the immune response of mammals through production of soluble factors that act on other immune system cells, including other T cells. Most mature CD4+ T helper cells can be classified as either Thl or Th2 cells based on their cytokine release profiles. Thl cells produce IL-2 and IFN- ⁇ primarily as well as lower levels of IL-3, GM-CSF and TNF- ⁇ . The Thl subset promotes delayed-type hypersensitivity, cell-mediated immunity, and immunoglobulin class switching to IgG 2a , in mouse, and to comparable IgG subclasses, in humans.
  • the Th2 subset produces IL-4, IL-5, IL-6, IL-9, IL-10 and IL-13 and induces humoral immunity by activating B cells, promoting antibody production, and inducing class - 30 - switching to IgGi and IgE, in mouse for example.
  • a cytokine when CpG oligonucleotides are used to prevent or treat an existing parasite infection, a cytokine can also be administered along with the CpG oligonucleotide.
  • IL-12 or IFN- ⁇ is the cytokine of choice.
  • the co- administered cytokine(s) can act co-operatively, additively or synergistically with the CpG oligonucleotide of the invention to prevent parasite infection.
  • the cytokine is administered in effective amounts. Such amounts of IL-12 or IFN- ⁇ maybe less than those sufficient to provide a therapeutic benefit when the cytokine is administered alone and not in combination with a CpG oligonucleotide.
  • co-administered means administered proximally in time with another agent.
  • proximally in time it is meant that a CpG oligonucleotide of the invention is administered to the subject close enough in time with the administration of the therapeutic agent (e.g., parasiticide, growth factor, cytokine, chemokine, etc.) to produce the desired biological effect.
  • the therapeutic agent e.g., parasiticide, growth factor, cytokine, chemokine, etc.
  • targeting infected tissues may be desirable, particularly if the delivery of the CpG oligonucleotide to the affected area would otherwise be slow or inefficient.
  • Targeting motifs such as those described below may be directly conjugated to CpG oligonucleotides of the invention or they may be conjugated or linked to a carrier vehicle for the CpG oligonucleotide such as a lipid coating.
  • agents that target specific cell types include ligands for cell surface receptors for individual cell types. An exemplary and non-limiting list is provided herein.
  • hepatic receptors such as hyaluronic acid, collagen, N-terminal propeptide of collagen type III, mannose/N-acetylglucosamine, complement, asialoglycoprotein, tissue plasminogen activator, low density lipoprotein, insulin, ceruloplasmin, enterokinase, carcinoembryonic antigen, apamin, galactose/lactose
  • growth factor/cytokine receptors such as hepatocyte growth factor, epidermal growth factor, insulinlike growth factor I, II, interleukin-la/b, interleukin-2, IL-7, IL-4, interferon- ⁇ , interferon- ⁇ , keratinocyte growth factor, TNF-R p55
  • hormone receptors such as prolactin, thyroglobulin, - 31 - growth hormone, insulin, glucagon, leutinizing hormone, human choriogo
  • the compounds of the invention may also be associated with a molecule that results in higher affinity binding to the surface of an immune cell such as a dendritic cell.
  • the compounds can be associated with entities which increase their cellular uptake by target cells.
  • Nucleic acids can be ionically, or covalently associated with appropriate molecules using techniques which are well known in the art. A variety of coupling or crosslinking agents can be used, for example protein A, carbodiimide, and N- succinimidyl-3-(2-pyridyldithio) propionate (SPDP). Nucleic acids can alternatively be encapsulated in liposomes or virosomes using well-known techniques.
  • the CpG oligonucleotide may also be administered along with an antigen of parasitic origin or with an antibody or antibody fragment specific for either the parasite or the tissue affected by the infection.
  • an antigen non-specific immune response i.e., an innate immune system response
  • antigens specific for parasites may also be used to induce a separate antigen specific immune response.
  • the CpG oligonucleotides may have an additional secondary effect which enhances an antigen-specific immune response.
  • the CpG oligonucleotide could also be co-administered with an anti-idiotypic antibody.
  • pharmaceutically acceptable carriers for monoclonal antibodies, antibody fragments, and peptides are well-known to those of ordinary skill in the art.
  • a pharmaceutically acceptable carrier and “a therapeutically acceptable carrier” are used interchangeably and refer to a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients.
  • Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers and other - 32 - materials which are well-known in the art.
  • Exemplary pharmaceutically acceptable carriers for peptides in particular are described in U.S. Patent No. 5,21 1,657.
  • the peptides of the invention may be formulated into preparations in solid, semi-solid, liquid or gaseous forms such as tablets, capsules, powders, granules, ointments, solutions, depositories, inhalants and injections, and usual ways for oral, parenteral or surgical administration.
  • the invention also embraces locally administering the compositions of the invention, including as implants.
  • a CpG oligonucleotide may be administered alone or in combination with the above- described therapeutic agent as part of a pharmaceutical composition.
  • a pharmaceutical composition may include the CpG oligonucleotide in combination with any standard physiologically and/or pharmaceutically acceptable carriers which are known in the art.
  • the compositions should be sterile and contain a therapeutically effective amount of the CpG oligonucleotide in a unit of weight or volume suitable for administration to a subject.
  • pharmaceutically-acceptable carrier as used herein means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration into a human or other animal.
  • carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
  • the components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
  • Pharmaceutically acceptable further means a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism.
  • the characteristics of the carrier will depend on the route of administration.
  • Physiologically and pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials which are well known in the art.
  • compositions for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions and emulsions.
  • the compositions comprise a sterile aqueous preparation of the CpG oligonucleotide, which is isotonic with the bodily fluid, e.g., blood, of the recipient.
  • This aqueous preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • the sterile injectable preparation also may be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution - 33 - in 1,3-butane diol.
  • a non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or di- glycerides.
  • fatty acids such as oleic acid may be used in the preparation of injectables.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Those of skill in the art can readily determine the various parameters for preparing these alternative pharmaceutical compositions without resort to undue experimentation. Carrier formulations suitable for oral, subcutaneous, intravenous, intramuscular, etc.
  • administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.
  • the methods of the invention may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects.
  • modes of administration include oral, rectal, topical, mucosal, transdermal, subcutaneous, inhalation, intranasal. interdermal, or parenteral routes.
  • parenteral includes subcutaneous, intravenous, intramuscular, or infusion. While intravenous or intramuscular routes may not particularly suitable for long-term therapy and prophylaxis, they may be appropriate in emergency situations.
  • Modes of administration which allow for self-administration such as oral and transdermal (i.e., in the form of a patch or an ointment or cream) are useful in the invention particularly for persons on vacation or military personnel who are unable to receive prompt medical attention.
  • Oral or transdermal administration will be preferred for prophylactic treatment because of the convenience to the patient as well as in the ease of determining a dosing schedule.
  • the compounds of the invention can take a liquid or solid form such as tablets and pills, or be present in an inhaled composition such as an aerosol.
  • the compounds of the invention can also be administered using autoinjector devices such as those currently used by military personnel.
  • the CpG oligonucleotide may also be administered by gradual infusion over time.
  • the particular mode selected will depend, of course, upon the particular infection or disease being treated and/or prevented, the particular drug selected, the - 34 - severity of the condition being treated, and the dosage required for therapeutic efficacy. From a practical point of view, a brief period of protection from malaria may be adequate for persons passing through or spending short periods of time in malaria-endemic areas. Even in cases where protection for longer than a week is desired, it is possible to give repeat administrations of CpG oligonucleotides. Delayed release, or long-term release in the form of sustained release devices including implants and transdermal patches are also envisioned as suitable modes of administration. These latter devices are suitable for, among others, persons in chronic risk situations such as regions in which parasites are common.
  • CpG oligonucleotides should prove simpler, less expensive and safer to use than repeated administrations of cytokines.
  • compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the CpG oligonucleotide into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the CpG oligonucleotide into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
  • compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the CpG oligonucleotide.
  • Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, elixir or an emulsion.
  • a subject at risk of developing a parasite infection for an extended period of time can be administered CpG oligonucleotides using a long-term sustained, timed, or delayed release to prevent subsequent parasitic infections resulting from multiple exposures.
  • Long-term release means that the implant is constructed and arranged to delivery therapeutic levels of the active ingredient for at least 7 days, 10 days, 30 days, and preferably 60 days, and even more preferably for months or years. Such systems can avoid repeated administrations of the CpG oligonucleotide described above, increasing convenience to the subject and the physician. Long-term sustained release implants may also be particularly suitable for prevention in cases of chronic risk of infection or exposure.
  • This - 35 - mode of delivery is most preferred in the administration to individuals who are traveling abroad for extended periods of time without assurance of medical assistance. Additionally, persons living in developing or underdeveloped countries, or countries known to have a high incidence of particular parasitic infections are ideal subjects to receive long-term sustained release particularly given the sometimes nomadic lifestyles common in these countries. Many types of sustained, delayed or timed release implants, including those that function in the long-term, are well-known to those of ordinary skill in the art. Some of the release systems include polymeric systems, as well as polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides.
  • Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent 5,075,109.
  • Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like.
  • Specific examples include, but are not limited to: (a) erosional systems in which the CpG oligonucleotide is contained within a matrix such as those described in U.S. Patent Nos.
  • colloidal dispersion systems include lipid-based systems including oil-in- water emulsions, micelles, mixed micelles, and liposomes.
  • a preferred colloidal system of the invention is a liposome.
  • Liposomes are artificial membrane vessels which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vessels (LUV), which range in size from 0.2 - 4.0 ⁇ can encapsulate large macromolecules. RNA, DNA, and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem.
  • liposomes may be targeted to a particular tissue, such as the liver or any other such tissue affected by a parasite infection related disease. This is achieved by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein - 36 - capable of specifically recognizing a tissue of interest.
  • a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein - 36 - capable of specifically recognizing a tissue of interest.
  • Lipid formulations for transfection are commercially available from QIAGEN, for example as EFFECTENETM (a non-liposomal lipid with a special DNA condensing enhancer) and SUPER-FECTTM (a novel acting dendrimeric technology) from Gibco BRL, for example, as LIPOFECTINTM and LIPOFECTACETM, which are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)- propyl]-N, N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB).
  • EFFECTENETM a non-liposomal lipid with a special DNA condensing enhancer
  • SUPER-FECTTM a novel acting dendrimeric technology
  • LIPOFECTINTM and LIPOFECTACETM which are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)- propyl]-N, N
  • Liposomes also have been reviewed by Gregoriadis, G. in Trends in Biotechnology, V. 3, p. 235-241 (1985).
  • the invention embraces all modes of nucleic acid transfer which enhance or increase the efficiency of nucleic acid uptake into target cells of interest in vivo.
  • the association of the CpG oligonucleotides of the invention to cationic lipids or dendrimers is included in the methods of the invention.
  • the preferred vehicle is a biocompatible microparticie or implant that is suitable for implantation into a vertebrate recipient.
  • exemplary bioerodible implants that are useful in accordance with this method are described in PCT International application no. PCT/US/03307 (Publication No. WO 95/24929, entitled “Polymeric Gene Delivery System", claiming priority to U.S. patent application serial no. 213,668, filed March 15, 1994).
  • PCT/US/0307 describes a biocompatible, preferably biodegradable, polymeric matrix for containing an exogenous gene under the control of an appropriate promoter. The polymeric matrix is used to achieve sustained release of the exogenous gene in a subject.
  • the CpG containing oligonucleotides described herein are encapsulated or dispersed within the biocompatible, preferably biodegradable polymeric matrix disclosed in PCT/US/03307.
  • the polymeric matrix preferably is in the form of a microparticie such as a microsphere (wherein the CpG oligonucleotide is dispersed throughout a solid polymeric matrix) or a microcapsule (wherein the CpG oligonucleotide is stored in the core of a polymeric shell).
  • Other forms of the polymeric matrix for containing the CpG oligonucleotide include films, coatings, gels, implants, and stents.
  • the size and composition of the polymeric matrix device can be selected to result in favorable release kinetics in the tissue into which the matrix device is implanted.
  • the implant may be designed such that it releases sufficient levels of the CpG oligonucleotide to provide systemic exposure.
  • the size of the polymeric matrix devise can be further selected according to the method of - 37 - delivery which is to be used, typically injection into a tissue or administration of a suspension by aerosol into the nasal and/or pulmonary areas.
  • the polymeric matrix composition can be selected to have both favorable degradation rates and also to be formed of a material which is bioadhesive, to further increase the effectiveness of transfer when the devise is administered to a particular surface or tissue.
  • the matrix composition also can be selected not to degrade, but rather, to release by diffusion over an extended period of time.
  • Both non-biodegradable and biodegradable polymeric matrices can be used to deliver the CpG oligonucleotide of the invention to the subject.
  • Such polymers may be natural or synthetic polymers. Synthetic polymers are preferred.
  • the polymer is selected based on the period of time over which release is desired, generally in the order of a few hours to a year or longer. The period of sustained release will depend upon the subject and the environment. Typically, release over a period ranging from between a few hours and three to twelve months is most desirable.
  • the polymer optionally is in the form of a hydrogel that can absorb up to about 90% of its weight in water and further, optionally is cross-linked with multi-valent ions or other polymers.
  • the CpG oligonucleotides of the invention are delivered using the bioerodible implant by way of diffusion, or more preferably, by degradation of the polymeric matrix.
  • exemplary synthetic polymers which can be used to form the biodegradable delivery system include: polyamides, polycarbonates, polyalkylenes, polyalkylene glycols, polyalkylene oxides, polyalkylene terepthalates, polyvinyl alcohols, polyvinyl ethers, polyvinyl esters, poly-vinyl halides, polyvinylpyrrolidone, polyglycolides, polysiloxanes, polyurethanes and co-polymers thereof, alkyl cellulose, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitro celluloses, polymers of acrylic and methacrylic esters, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxy-propyl methyl cellulose, hydroxybutyl methyl
  • non-biodegradable polymers include ethylene vinyl acetate, poly(meth) acrylic acid, polyamides, copolymers and mixtures thereof.
  • biodegradable polymers include synthetic polymers such as polymers of lactic acid and glycolic acid, polyanhydrides, poly(ortho)esters, polyurethanes, poly(butic acid), poly(valeric acid), and poly(lactide-cocaprolactone), and natural polymers such as alginate and other polysaccharides including dextran and cellulose, collagen, chemical derivatives thereof (substitutions, additions of chemical groups, for example, alkyl, alkylene, hydroxylations, oxidations, and other modifications routinely made by those skilled in the art), albumin and other hydrophilic proteins, zein and other prolamines and hydrophobic proteins, copolymers and mixtures thereof. In general, these materials degrade either by enzymatic hydrolysis or exposure to water in vivo, by surface or bulk erosion.
  • Bioadhesive polymers useful in the invention include bioerodible hydrogels (described by H.S. Sawhney, C.P. Pathak and J.A. Hubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated herein), polyhyaluronic acids, casein, gelatin, glutin, polyanhydrides, polyacrylic acid, alginate, chitosan, poly(methyl methacrylates), poly(ethyl methacrylates), poly(butylmethacrylate), poly ⁇ sobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate).
  • the invention provides a composition of the above-described CpG
  • kits may comprise a carrier means being compartmentalized to receive in close confinement one or more container means such as vials, tubes, and the like, each of the container means comprising one of the separate elements to be used in the method.
  • container means such as vials, tubes, and the like
  • each of the container means comprising one of the separate elements to be used in the method.
  • one of the container means may comprise a CpG oligonucleotide of the invention.
  • the kit may also have containers comprising other non-CpG oligonucleotide therapeutic agents useful in the invention as listed above.
  • the kit may include containers for buffer(s) useful in the assay. If the mode of administration is by injection, the kit may also contain an injection delivery device such as an - 39 - assembled needle and syringe or an auto injector delivery device, such as those currently in use by the military. Alternatively, the kit may be designed for subcutaneous injection and placement of a long-term sustained release capsule or implant, and would therefore contain an appropriate injection device such as for example a wide-bore needle for transfer of the capsule or implant to a subcutaneous region.
  • an injection delivery device such as an - 39 - assembled needle and syringe or an auto injector delivery device, such as those currently in use by the military.
  • the kit may be designed for subcutaneous injection and placement of a long-term sustained release capsule or implant, and would therefore contain an appropriate injection device such as for example a wide-bore needle for transfer of the capsule or implant to a subcutaneous region.
  • kits useful in the invention can comprise means for measuring the extent of the immune response occurring in an individual, thereby indicating whether the individual is sufficiently primed to prevent a parasitic infection.
  • the kit can include means to measure cytokine levels.
  • kits can be used by the individual or more preferably by a physician, nurse or veterinarian.
  • the kits can be useful in determining whether a long-term release device is continuing to emit the compounds of the invention or in assessing whether a dose modification is necessary. If the kit is meant to measure cytokine or peptide levels in an individual, it will contain a readout system for measuring such a peptide.
  • This readout system may comprise an antibody or other binding peptide which may be prepared on a solid surface such as polystyrene or may be applied to the surface at the time of individual testing.
  • a bodily sample from an individual preferably a liquid sample such as blood, can then be added either directly or in diluted form onto the surface coated with binding peptide.
  • the binding of components within the sample to the binding peptides of the kit can be measured by the use of a secondary binding peptide conjugated to a label.
  • the label should be directly or indirectly detectable or visible.
  • a label which can be visualized using a colorimetric assay is most useful in the invention particularly if no additional instrumentation is required for detection.
  • Oligonucelotides were 1826, a 20-mer which contains two copies of a CpG motif known to have potent immunostimulatory effects on the murine immune system (TCCATGACGTTCCTGACGTT. CpG dinucleotides underlined for clarity, SEQ ID NO: 86), and 1982, a non-CpG control oligonucleotide (TCCAGGACTTCTCTCAGGTT, SEQ ID NO:92).
  • the oligonucleotides were synthesized with a nuclease-resistant phosphorothioate backbone by Oligos Etc. (Wilsonville, OR).
  • the Na + salts of the oligonucleotide were ethanol precipitated and then resuspended in phosphate - 40 - buffered saline (pH 7.2) and stored at 4 ° C prior to injection.
  • the endotoxin level in the oligonucleotides was undetectable (less than 1 ng/mg oligonucleotide) by Limulus assay (Whittaker Bioproducts, Walkersville, MD).
  • P. yoelii (17X NL non-lethal strain, clone 1.1) was maintained by alternating passages of the parasites in Anopheles stephensi mosquitoes and CD-I mice. Sporozoites were obtained from mosquito salivary glands 14 days after the mosquitoes had taken an infectious blood meal. Sporozoites were isolated from these mosquitoes by hand-dissection of the mosquito salivary glands in Ml 99 medium containing 5% normal mouse serum (Rockland, Inc. Gilbertsville, PA) as previously described (Siu et al., 1994). The recovered sporozoites were diluted to a final concentration of 250 infectious sporozoites per ml.
  • mice All studies were carried out in 4 to 8 week old female BALB/c mice (Jackson Laboratory, Bar Harbor, ME), with 10 mice in each experimental group. Mice received a single injection into the tibialis anterior muscle of 3, 10, 50 or 100 ⁇ g of CpG oligonucleotide (1826) or of non-CpG control oligonucleotide (1982) in 50 ⁇ l saline at seven, two or one day(s) prior to sporozoite infection, or on the day of infection. Two separate studies were carried out several months apart, however all mice within the same study were challenged with sporozoites from the same stock at the same time.
  • the first study comprised 9 groups (Table 2) and the second study comprised 13 groups (Table 3).
  • each mouse was injected, at day 0, in the tail vein with 50 P. yoelii sporozoites in a volume of 200 ⁇ l.
  • Blood was taken every other day between 4 and 14 days after infection by tail vein nicking (-10 ⁇ l) and Geimsa-stained blood films were prepared and examined microscopically for the presence of parasites. Protection was defined as the complete absence of blood-stage parasiternia at any time between infection and day 14.
  • mice receiving CpG oligonucleotide 2 days before challenge were also treated with mAbs to deplete IFN- ⁇ or IL-12 in vivo.
  • IP intraperitoneal
  • mice received intravenous (IV) injection of 1 mg of the anti-IFN- ⁇ mAb on each of days -3 and -2 and 1.5 mg on each of days -1, 0, +1, +2 and +4 relative to challenge (i.e., infection).
  • IV intravenous
  • mice mice (first study, group 6) were injected IP with 1 mg of the anti-IL12 mAb C17.8 (Cho et al, 1996) at 12 hours prior to and 3 - 41 - hours after infection.
  • mice Undepleted control groups were injected with purified rat Ig.
  • 1 mg rat Ig was given IP on each of days -2 and +2, and 2 mg on each of days -1 and 0 (relative to challenge).
  • the mice were administered by IV injection 1 mg of rat Ig on each of days -3 and -2, and 1.5 mg on days -1, 0, +1, +2 and +4 relative to challenge.
  • mice with P. yoelii sporozoites resulted in infection (i.e., parisitemia) in 100% of mice within 14 days (Table 2, group 9; Table 3. group 22).
  • Pre-treatment of mice with CpG oligonucleotide provided complete protection from infection when the CpG oligonucleotide was administered one or two days prior to challenge, as indicated by a complete absence of parisitemia up to 14 days after challenge (Table 2, groups 2 and 3; Table 3, group 10). Protection was only partial when the time between CpG administration and sporozoites challenge was increased to 7 days (Table 2, group 1; Table 3, groups 14-17).
  • ODN oligonucleotide - 44 -
  • ODN oligonucleotide - 45 -

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Zoology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)

Abstract

L'invention concerne une méthode de prévention des infections parasitaires et des maladies liées aux infections consistant à administrer à un sujet susceptible d'être exposé à un parasite un oligonucléotide CpG, et ce, avant l'exposition audit parasite. L'invention concerne également des méthodes de traitement de sujets atteints d'infections parasitaires par administration des oligonucléotides CpG après exposition au parasite.
PCT/US1999/009863 1998-05-06 1999-05-06 Methodes de prevention et de traitement des parasitoses et maladies associees a l'aide d'oligonucleotides cpg WO1999056755A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP99921705A EP1077708A1 (fr) 1998-05-06 1999-05-06 Methodes de prevention et de traitement des parasitoses et maladies associees a l'aide d'oligonucleotides cpg
AU38841/99A AU3884199A (en) 1998-05-06 1999-05-06 Methods for the prevention and treatment of parasitic infections and related diseases using cpg oligonucleotides
JP2000546780A JP2002513763A (ja) 1998-05-06 1999-05-06 Cpgオリゴヌクレオチドを使用して寄生生物感染および関連する疾患を予防および処置するための方法
CA002328602A CA2328602A1 (fr) 1998-05-06 1999-05-06 Methodes de prevention et de traitement des parasitoses et maladies associees a l'aide d'oligonucleotides cpg

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US8451298P 1998-05-06 1998-05-06
US60/084,512 1998-05-06

Publications (1)

Publication Number Publication Date
WO1999056755A1 true WO1999056755A1 (fr) 1999-11-11

Family

ID=22185416

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/009863 WO1999056755A1 (fr) 1998-05-06 1999-05-06 Methodes de prevention et de traitement des parasitoses et maladies associees a l'aide d'oligonucleotides cpg

Country Status (5)

Country Link
EP (1) EP1077708A1 (fr)
JP (1) JP2002513763A (fr)
AU (1) AU3884199A (fr)
CA (1) CA2328602A1 (fr)
WO (1) WO1999056755A1 (fr)

Cited By (79)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000061151A3 (fr) * 1999-04-12 2001-04-26 Us Health Un oligodesoxynucleotide et son emploi pour induire une reponse immunitaire
WO2001051500A1 (fr) * 2000-01-14 2001-07-19 The United States Of America, Represented By The Secretary, Department Of Health And Human Services Oligonucleotide synthetique et son utilisation pour induire une reaction immunitaire
WO2001068116A2 (fr) 2000-03-10 2001-09-20 Dynavax Technologies Corporation Prevention et traitement d'infections respiratoires virales au moyen de sequences polynucleotidiques immunomodulatoires
WO2003014316A2 (fr) 2001-08-07 2003-02-20 Dynavax Technologies Corporation Compositions immunomodulatrices, preparations, et leurs procedes d'utilisation
WO2003030656A2 (fr) 2001-10-06 2003-04-17 Merial Limited Procedes et compositions pour favoriser la croissance et l'immunite naturelle chez de jeunes animaux
US6552006B2 (en) 2000-01-31 2003-04-22 The Regents Of The University Of California Immunomodulatory polynucleotides in treatment of an infection by an intracellular pathogen
WO2004011650A2 (fr) 2002-07-24 2004-02-05 Intercell Ag Antigenes a phase de lecture alternante a partir de virus
WO2004084938A1 (fr) 2003-03-24 2004-10-07 Intercell Ag Vaccins ameliores
US6821957B2 (en) 1997-05-20 2004-11-23 University Of Iowa Research Foundation Vectors and methods for immunization or therapeutic protocols
US6943240B2 (en) 2000-09-15 2005-09-13 Coley Pharmaceuticals Gmbh Nucleic acids for high throughput screening of CpG-based immuno-agonist/antagonist
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
US7001890B1 (en) 1997-01-23 2006-02-21 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US7008774B2 (en) * 1999-12-01 2006-03-07 The United States Of America As Represented By The Secretary Of The Army Practical serological assay for the clinical diagnosis of leishmaniasis
US7038029B2 (en) 2002-05-30 2006-05-02 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US7129222B2 (en) 2000-03-10 2006-10-31 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US7150875B2 (en) * 2001-03-19 2006-12-19 The United States Of America As Represented By The Secretary Of The Army Recombinant Plasmodium vivax merozoite protein-1 p42 vaccine
US7157437B2 (en) 2000-03-10 2007-01-02 Dynavax Technologies Corporation Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
WO2007027718A1 (fr) * 2005-08-31 2007-03-08 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Procedes d'alteration d'une reponse immune induite par des cpg oligodeoxynucleotides
US7223398B1 (en) 1999-11-15 2007-05-29 Dynavax Technologies Corporation Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
US7250403B2 (en) 2000-03-10 2007-07-31 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
US7255868B2 (en) 2001-06-21 2007-08-14 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same—I
US7271156B2 (en) 1999-09-25 2007-09-18 University Of Iowa Research Foundation Immunostimulatory nucleic acids
WO2007119815A1 (fr) 2006-04-14 2007-10-25 Kyowa Hakko Kirin Co., Ltd. Agonistes du récepteur 9 de type toll
US7378234B2 (en) 2002-09-13 2008-05-27 Intercell Ag Method for isolating hepatitis C virus peptides
EP1985702A2 (fr) 2000-12-08 2008-10-29 Coley Pharmaceuticals GmbH Acides nucléiques de type CPG et leurs procédés d'utilisation
EP1992635A1 (fr) 2002-12-23 2008-11-19 Dynavax Technologies Corporation Oligonucléotides à séquence immunostimulatrice et ses procédés d'utilisation
EP2059253A2 (fr) * 2006-09-14 2009-05-20 The Trustees Of The University Of Pennsylvania Modulation de lymphocytes t régulateurs par l'il-18 humaine
US7611896B2 (en) * 1999-12-01 2009-11-03 The United States Of America As Represented By The Secretary Of The Army Practical serological assay for the clinical diagnosis of Leishmaniasis
EP2149583A1 (fr) 2004-09-24 2010-02-03 Intercell AG Protéine de capside VP1 modifiée du parvovirus B19
US7662949B2 (en) 2005-11-25 2010-02-16 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US7674777B2 (en) 1994-07-15 2010-03-09 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7713529B2 (en) 1994-07-15 2010-05-11 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US7727712B2 (en) 2000-03-10 2010-06-01 Dynavax Technologies Corporation Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
US7790189B2 (en) * 2003-05-15 2010-09-07 Mitsui Sugar Co., Ltd. Immunostimulating agents
US7795235B2 (en) 2004-10-20 2010-09-14 Coley Pharmaceutical Gmbh Semi-soft c-class immunostimulatory oligonucleotides
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
WO2010138193A2 (fr) 2009-05-27 2010-12-02 Selecta Biosciences, Inc. Nanosupports de synthèse ciblés se caractérisant par une libération sensible au ph d'agents immunomodulateurs
US7858588B2 (en) 2001-05-21 2010-12-28 Intercell Ag Immunostimulatory oligodeoxynucleic molecules
US7935675B1 (en) 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US7998492B2 (en) 2002-10-29 2011-08-16 Coley Pharmaceutical Group, Inc. Methods and products related to treatment and prevention of hepatitis C virus infection
US8114848B2 (en) 1994-07-15 2012-02-14 The United States Of America As Represented By The Department Of Health And Human Services Immunomodulatory oligonucleotides
US8114419B2 (en) 2002-07-03 2012-02-14 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US8148341B2 (en) 2005-07-01 2012-04-03 Index Pharmaceuticals Ab Method for modulating responsiveness to steroids
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US8158768B2 (en) 2002-12-23 2012-04-17 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US8188254B2 (en) 2003-10-30 2012-05-29 Coley Pharmaceutical Gmbh C-class oligonucleotide analogs with enhanced immunostimulatory potency
US8202688B2 (en) 1997-03-10 2012-06-19 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US8258107B2 (en) 2005-07-01 2012-09-04 Index Pharmaceuticals Ab Immunostimulatory method
US8283328B2 (en) 2002-08-19 2012-10-09 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
WO2012167046A1 (fr) 2011-06-01 2012-12-06 Janus Biotherapeutics, Inc. Nouveaux modulateurs du système immunitaire
US8372413B2 (en) 2000-12-27 2013-02-12 Dynavax Technologies Corporation Immunomodulatory polynucleotides and methods of using the same
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US8580268B2 (en) 2006-09-27 2013-11-12 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity
US8895522B2 (en) 2005-10-28 2014-11-25 Index Pharmaceuticals Ab Composition and method for the prevention, treatment and/or alleviation of an inflammatory disease
US9066978B2 (en) 2010-05-26 2015-06-30 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
US20160106826A1 (en) * 2014-09-30 2016-04-21 Qatar University Vaccines against pathogenic escherichia coli and methods of using the same
US9353115B2 (en) 2011-06-01 2016-05-31 Janus Biotherapeutics, Inc. Immune system modulators
WO2017021242A1 (fr) * 2015-07-31 2017-02-09 Bayer Animal Health Gmbh Amélioration de la réponse immunitaire pour des espèces aquatiques
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
WO2017037462A3 (fr) * 2015-09-03 2017-04-27 The Royal Veterinary College Procédés
WO2017087668A1 (fr) * 2015-11-17 2017-05-26 The Burlington Hc Research Group, Inc. Procédés pour une protection et une administration perfectionnées d'aminothiols et de leurs analogues
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US9873694B2 (en) 2011-10-04 2018-01-23 Janus Biotherapeutics, Inc. Imidazole quinoline-based immune system modulators
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US9994443B2 (en) 2010-11-05 2018-06-12 Selecta Biosciences, Inc. Modified nicotinic compounds and related methods
WO2018106948A1 (fr) * 2016-12-07 2018-06-14 Washington University Utilisation d'antiviraux pour inhiber des virus protozoaires
EP3398948A2 (fr) 2014-08-22 2018-11-07 Janus Biotherapeutics, Inc. Dérivés de ptéridine 2,4,6,7-tétrasubstituée et leurs procédés de synthèse et d'utilisation
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US10933129B2 (en) 2011-07-29 2021-03-02 Selecta Biosciences, Inc. Methods for administering synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte responses

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002514397A (ja) * 1998-05-14 2002-05-21 コーリー ファーマシューティカル ゲーエムベーハー CpGオリゴヌクレオチドを用いる造血調節の方法

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996002555A1 (fr) * 1994-07-15 1996-02-01 The University Of Iowa Research Foundation Oligonucleotides immunomodulateurs
EP0773295A2 (fr) * 1995-11-07 1997-05-14 Ottawa Civic Hospital Vaccination utilisant l'ADN par immersion des poissons
WO1998018810A1 (fr) * 1996-10-30 1998-05-07 The University Of Iowa Research Foundation Molecules d'acide nucleique immunostimulantes
EP0855184A1 (fr) * 1997-01-23 1998-07-29 Grayson B. Dr. Lipford Composition pharmaceutique comprenant un polynucléotide et un antigène notamment pour la vaccination

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996002555A1 (fr) * 1994-07-15 1996-02-01 The University Of Iowa Research Foundation Oligonucleotides immunomodulateurs
EP0773295A2 (fr) * 1995-11-07 1997-05-14 Ottawa Civic Hospital Vaccination utilisant l'ADN par immersion des poissons
WO1998018810A1 (fr) * 1996-10-30 1998-05-07 The University Of Iowa Research Foundation Molecules d'acide nucleique immunostimulantes
EP0855184A1 (fr) * 1997-01-23 1998-07-29 Grayson B. Dr. Lipford Composition pharmaceutique comprenant un polynucléotide et un antigène notamment pour la vaccination

Cited By (142)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7723022B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8129351B2 (en) 1994-07-15 2012-03-06 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8309527B2 (en) 1994-07-15 2012-11-13 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US8258106B2 (en) * 1994-07-15 2012-09-04 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8008266B2 (en) 1994-07-15 2011-08-30 University Of Iowa Foundation Methods of treating cancer using immunostimulatory oligonucleotides
US7713529B2 (en) 1994-07-15 2010-05-11 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US7674777B2 (en) 1994-07-15 2010-03-09 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8058249B2 (en) 1994-07-15 2011-11-15 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8158592B2 (en) 1994-07-15 2012-04-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acid molecules
US8114848B2 (en) 1994-07-15 2012-02-14 The United States Of America As Represented By The Department Of Health And Human Services Immunomodulatory oligonucleotides
US7723500B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7879810B2 (en) 1994-07-15 2011-02-01 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7935675B1 (en) 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7888327B2 (en) 1994-07-15 2011-02-15 University Of Iowa Research Foundation Methods of using immunostimulatory nucleic acid molecules to treat allergic conditions
US7001890B1 (en) 1997-01-23 2006-02-21 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US8202688B2 (en) 1997-03-10 2012-06-19 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US6821957B2 (en) 1997-05-20 2004-11-23 University Of Iowa Research Foundation Vectors and methods for immunization or therapeutic protocols
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US8173141B2 (en) 1999-02-17 2012-05-08 Csl Limited Immunogenic complexes and methods relating thereto
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
WO2000061151A3 (fr) * 1999-04-12 2001-04-26 Us Health Un oligodesoxynucleotide et son emploi pour induire une reponse immunitaire
US7271156B2 (en) 1999-09-25 2007-09-18 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
US7776344B2 (en) 1999-09-27 2010-08-17 University Of Iowa Research Foundation Methods related to immunostimulatory nucleic acid-induced interferon
US7223398B1 (en) 1999-11-15 2007-05-29 Dynavax Technologies Corporation Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
US7628990B2 (en) 1999-11-15 2009-12-08 Dynavax Technologies Corporation Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
US7008774B2 (en) * 1999-12-01 2006-03-07 The United States Of America As Represented By The Secretary Of The Army Practical serological assay for the clinical diagnosis of leishmaniasis
US7611896B2 (en) * 1999-12-01 2009-11-03 The United States Of America As Represented By The Secretary Of The Army Practical serological assay for the clinical diagnosis of Leishmaniasis
US7452721B2 (en) * 1999-12-01 2008-11-18 The United States Of America As Represented By The Secretary Of The Army Practical serological assay for the clinical diagnosis of leishmaniasis
US7919477B2 (en) 2000-01-14 2011-04-05 The United States Of America As Represented By The Department Of Health And Human Services Multiple CpG oligodeoxynucleotides and their use to induce an immune response
US8232259B2 (en) 2000-01-14 2012-07-31 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Multiple CpG oligodeoxynucleotide and their use to induce an immune response
WO2001051500A1 (fr) * 2000-01-14 2001-07-19 The United States Of America, Represented By The Secretary, Department Of Health And Human Services Oligonucleotide synthetique et son utilisation pour induire une reaction immunitaire
US6552006B2 (en) 2000-01-31 2003-04-22 The Regents Of The University Of California Immunomodulatory polynucleotides in treatment of an infection by an intracellular pathogen
US7250403B2 (en) 2000-03-10 2007-07-31 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
US7157437B2 (en) 2000-03-10 2007-01-02 Dynavax Technologies Corporation Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
US8124590B2 (en) 2000-03-10 2012-02-28 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
WO2001068116A2 (fr) 2000-03-10 2001-09-20 Dynavax Technologies Corporation Prevention et traitement d'infections respiratoires virales au moyen de sequences polynucleotidiques immunomodulatoires
US7129222B2 (en) 2000-03-10 2006-10-31 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
EP1261378B1 (fr) * 2000-03-10 2010-03-10 Dynavax Technologies Corporation Formulations immunomodulatrices biodegradables et procedes d'utilisation
US8226957B2 (en) 2000-03-10 2012-07-24 Dynavax Technologies Corporation Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide sequences
US7183111B2 (en) 2000-03-10 2007-02-27 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
EP2067487A2 (fr) 2000-03-10 2009-06-10 Dynavax Technologies Corporation Formulations immunomodulatrices et procédés d'utilisation correspondants
US7727712B2 (en) 2000-03-10 2010-06-01 Dynavax Technologies Corporation Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences
US6943240B2 (en) 2000-09-15 2005-09-13 Coley Pharmaceuticals Gmbh Nucleic acids for high throughput screening of CpG-based immuno-agonist/antagonist
US7820379B2 (en) 2000-09-15 2010-10-26 Coley Pharmaceutical Gmbh Process for high throughput screening of CpG-based immuno-agonist/antagonist
EP1985702A2 (fr) 2000-12-08 2008-10-29 Coley Pharmaceuticals GmbH Acides nucléiques de type CPG et leurs procédés d'utilisation
US8372413B2 (en) 2000-12-27 2013-02-12 Dynavax Technologies Corporation Immunomodulatory polynucleotides and methods of using the same
US7150875B2 (en) * 2001-03-19 2006-12-19 The United States Of America As Represented By The Secretary Of The Army Recombinant Plasmodium vivax merozoite protein-1 p42 vaccine
US7858588B2 (en) 2001-05-21 2010-12-28 Intercell Ag Immunostimulatory oligodeoxynucleic molecules
US9028845B2 (en) 2001-06-21 2015-05-12 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same-IV
EP2423335A2 (fr) 2001-06-21 2012-02-29 Dynavax Technologies Corporation Composés immunomodulateurs chimères et leur procédé d'utilisation
US7255868B2 (en) 2001-06-21 2007-08-14 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same—I
US8586555B2 (en) 2001-08-07 2013-11-19 Dynavax Technologies Corporation Immunomodulatory compositions, formulations, and methods for use thereof
WO2003014316A2 (fr) 2001-08-07 2003-02-20 Dynavax Technologies Corporation Compositions immunomodulatrices, preparations, et leurs procedes d'utilisation
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity
WO2003030656A2 (fr) 2001-10-06 2003-04-17 Merial Limited Procedes et compositions pour favoriser la croissance et l'immunite naturelle chez de jeunes animaux
WO2003030656A3 (fr) * 2001-10-06 2004-06-24 Merial Ltd Procedes et compositions pour favoriser la croissance et l'immunite naturelle chez de jeunes animaux
US9428536B2 (en) 2002-04-04 2016-08-30 Zoetis Belgium Sa Immunostimulatory G, U-containing oligoribonucleotides
US8658607B2 (en) 2002-04-04 2014-02-25 Zoetis Belgium Immunostimulatory G, U-containing oligoribonucleotides
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US7381807B2 (en) 2002-05-30 2008-06-03 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US7943316B2 (en) 2002-05-30 2011-05-17 David Horn, Llc Immunostimulatory oligonucleotides and uses thereof
US7038029B2 (en) 2002-05-30 2006-05-02 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US8114419B2 (en) 2002-07-03 2012-02-14 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7528223B2 (en) 2002-07-24 2009-05-05 Intercell Ag Antigens encoded by alternative reading frames from pathogenic viruses
WO2004011650A2 (fr) 2002-07-24 2004-02-05 Intercell Ag Antigenes a phase de lecture alternante a partir de virus
US8283328B2 (en) 2002-08-19 2012-10-09 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US8304396B2 (en) 2002-08-19 2012-11-06 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
EP2402026A2 (fr) 2002-09-13 2012-01-04 Intercell AG Procédé pour isoler des peptides du virus de l'hépatite C
US7378234B2 (en) 2002-09-13 2008-05-27 Intercell Ag Method for isolating hepatitis C virus peptides
US7998492B2 (en) 2002-10-29 2011-08-16 Coley Pharmaceutical Group, Inc. Methods and products related to treatment and prevention of hepatitis C virus infection
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US7745606B2 (en) 2002-12-23 2010-06-29 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US8158768B2 (en) 2002-12-23 2012-04-17 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US11312965B2 (en) 2002-12-23 2022-04-26 Trisalus Life Sciences, Inc. Immunostimulatory sequence oligonucleotides and methods of using the same
US8871732B2 (en) 2002-12-23 2014-10-28 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US10196643B2 (en) 2002-12-23 2019-02-05 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
EP1992635A1 (fr) 2002-12-23 2008-11-19 Dynavax Technologies Corporation Oligonucléotides à séquence immunostimulatrice et ses procédés d'utilisation
US9422564B2 (en) 2002-12-23 2016-08-23 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
EP2345420A1 (fr) 2003-03-24 2011-07-20 Intercell AG Utilisation d'un adjuvant induisant une réponse immunitaire du type généré par une TH1 pour renforcer des réponses immunitaires
WO2004084938A1 (fr) 2003-03-24 2004-10-07 Intercell Ag Vaccins ameliores
US8784837B2 (en) 2003-03-24 2014-07-22 Valneva Austria Gmbh Vaccines comprising an immunostimulatory peptide and an immunostimulatory oligodeoxynucleic acid molecule
US7704514B2 (en) 2003-03-24 2010-04-27 Intercell Ag Vaccines
US7790189B2 (en) * 2003-05-15 2010-09-07 Mitsui Sugar Co., Ltd. Immunostimulating agents
US8188254B2 (en) 2003-10-30 2012-05-29 Coley Pharmaceutical Gmbh C-class oligonucleotide analogs with enhanced immunostimulatory potency
EP2149583A1 (fr) 2004-09-24 2010-02-03 Intercell AG Protéine de capside VP1 modifiée du parvovirus B19
US7795235B2 (en) 2004-10-20 2010-09-14 Coley Pharmaceutical Gmbh Semi-soft c-class immunostimulatory oligonucleotides
US8569257B2 (en) 2005-07-01 2013-10-29 Index Pharmaceuticals Ab Method for modulating responsiveness to steroids
US8258107B2 (en) 2005-07-01 2012-09-04 Index Pharmaceuticals Ab Immunostimulatory method
US8148341B2 (en) 2005-07-01 2012-04-03 Index Pharmaceuticals Ab Method for modulating responsiveness to steroids
US8592390B2 (en) 2005-07-01 2013-11-26 Index Pharmaceuticals Ab Immunostimulatory method
US7892569B2 (en) 2005-08-31 2011-02-22 The United States Of America As Represented By The Department Of Health And Human Services Methods of altering an immune response induced by CpG oligodeoxynucleotides
US8470342B2 (en) 2005-08-31 2013-06-25 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Methods of altering an immune response induced by CpG oligodeoxynucleotides
WO2007027718A1 (fr) * 2005-08-31 2007-03-08 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Procedes d'alteration d'une reponse immune induite par des cpg oligodeoxynucleotides
AU2006284889B2 (en) * 2005-08-31 2011-08-18 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods of altering an immune response induced by CpG oligodeoxynucleotides
US8895522B2 (en) 2005-10-28 2014-11-25 Index Pharmaceuticals Ab Composition and method for the prevention, treatment and/or alleviation of an inflammatory disease
US7662949B2 (en) 2005-11-25 2010-02-16 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
WO2007119815A1 (fr) 2006-04-14 2007-10-25 Kyowa Hakko Kirin Co., Ltd. Agonistes du récepteur 9 de type toll
EP2059253A2 (fr) * 2006-09-14 2009-05-20 The Trustees Of The University Of Pennsylvania Modulation de lymphocytes t régulateurs par l'il-18 humaine
US8679471B2 (en) 2006-09-14 2014-03-25 The Trustees Of The Univesity Of Pennsylvania Modulation of regulatory T cells by human IL-18
EP2059253A4 (fr) * 2006-09-14 2011-09-14 Univ Pennsylvania Modulation de lymphocytes t régulateurs par l'il-18 humaine
US10260071B2 (en) 2006-09-27 2019-04-16 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US8580268B2 (en) 2006-09-27 2013-11-12 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US9382545B2 (en) 2006-09-27 2016-07-05 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US10329318B2 (en) 2008-12-02 2019-06-25 Wave Life Sciences Ltd. Method for the synthesis of phosphorus atom modified nucleic acids
WO2010138193A2 (fr) 2009-05-27 2010-12-02 Selecta Biosciences, Inc. Nanosupports de synthèse ciblés se caractérisant par une libération sensible au ph d'agents immunomodulateurs
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US9764031B2 (en) 2010-05-26 2017-09-19 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
US9066978B2 (en) 2010-05-26 2015-06-30 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US9994443B2 (en) 2010-11-05 2018-06-12 Selecta Biosciences, Inc. Modified nicotinic compounds and related methods
US9353115B2 (en) 2011-06-01 2016-05-31 Janus Biotherapeutics, Inc. Immune system modulators
US9637489B2 (en) 2011-06-01 2017-05-02 Janus Biotherapeutics, Inc. Immune system modulators
WO2012167046A1 (fr) 2011-06-01 2012-12-06 Janus Biotherapeutics, Inc. Nouveaux modulateurs du système immunitaire
US9359361B2 (en) 2011-06-01 2016-06-07 Janus Biotherapeutics, Inc. Immune system modulators
US10117875B2 (en) 2011-06-01 2018-11-06 Janus Biotherapeutics, Inc. Immune system modulators
US9126996B2 (en) 2011-06-01 2015-09-08 Janus Biotherapeutics, Inc. Immune system modulators
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10933129B2 (en) 2011-07-29 2021-03-02 Selecta Biosciences, Inc. Methods for administering synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte responses
US9873694B2 (en) 2011-10-04 2018-01-23 Janus Biotherapeutics, Inc. Imidazole quinoline-based immune system modulators
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US10590413B2 (en) 2012-07-13 2020-03-17 Wave Life Sciences Ltd. Chiral control
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
EP3398948A2 (fr) 2014-08-22 2018-11-07 Janus Biotherapeutics, Inc. Dérivés de ptéridine 2,4,6,7-tétrasubstituée et leurs procédés de synthèse et d'utilisation
US20160106826A1 (en) * 2014-09-30 2016-04-21 Qatar University Vaccines against pathogenic escherichia coli and methods of using the same
US9814769B2 (en) * 2014-09-30 2017-11-14 Qatar University Vaccines against pathogenic Escherichia coli and methods of using the same
WO2017021242A1 (fr) * 2015-07-31 2017-02-09 Bayer Animal Health Gmbh Amélioration de la réponse immunitaire pour des espèces aquatiques
TWI733688B (zh) * 2015-07-31 2021-07-21 德商拜耳動物保健有限公司 水生物種中增強之免疫反應
WO2017037462A3 (fr) * 2015-09-03 2017-04-27 The Royal Veterinary College Procédés
WO2017087668A1 (fr) * 2015-11-17 2017-05-26 The Burlington Hc Research Group, Inc. Procédés pour une protection et une administration perfectionnées d'aminothiols et de leurs analogues
US10780176B2 (en) 2015-11-17 2020-09-22 The Burlington Hc Research Group, Inc. Methods for improved protection and delivery of aminothiols and analogs thereof
US11554174B2 (en) 2015-11-17 2023-01-17 The Burlington Hc Research Group, Inc. Methods for improved protection and delivery of aminothiols and analogs thereof
WO2018106948A1 (fr) * 2016-12-07 2018-06-14 Washington University Utilisation d'antiviraux pour inhiber des virus protozoaires

Also Published As

Publication number Publication date
JP2002513763A (ja) 2002-05-14
EP1077708A1 (fr) 2001-02-28
CA2328602A1 (fr) 1999-11-11
AU3884199A (en) 1999-11-23

Similar Documents

Publication Publication Date Title
WO1999056755A1 (fr) Methodes de prevention et de traitement des parasitoses et maladies associees a l'aide d'oligonucleotides cpg
EP1350262B1 (fr) Acides nucleiques du type cpg et procedes d'utilisation correspondants
KR100863630B1 (ko) 면역자극성 핵산
ES2543710T3 (es) Oligorribonucleótidos inmunoestimulantes que contienen G y U
US20100098685A1 (en) Use of Inhibitors of Toll-Like Receptors in the Prevention and Treatment of Hypercholesterolemia and Hyperlipidemia and Diseases Related Thereto
US20050250716A1 (en) Immunostimulatory oligodeoxynucleotides
RU2401661C2 (ru) Индукция апоптоза в опухолевых клетках, экспрессирующих toll-подобный рецептор
US20040235770A1 (en) Immunostimulatory nucleic acid oil-in-water formulations and related methods of use
JP2009132737A (ja) 刺激性免疫応答用の核酸組成物
JP2008501807A (ja) 抗原ならびに免疫活性化アゴニストおよび免疫活性化アンタゴニストのための担体基本骨格としての無塩基オリゴヌクレオチド
KR20100010509A (ko) 면역자극 효과를 갖는 a 클래스 올리고뉴클레오타이드
EP2012772A1 (fr) Réduction d'une invasion de cellules cancéreuses au moyen d'un inhibiteur de signalisation du récepteur de type toll
JP2020503327A (ja) Smad7アンチセンスオリゴヌクレオチドの組成物および乾癬を処置するまたは予防する方法
CN112969799A (zh) 2′fana修饰的foxp3反义寡核苷酸及其使用方法
WO2016207314A2 (fr) Procédé de modulation de molécules de surveillance de l'adn cytosolique
EP4304606A1 (fr) Adjuvants à base de polysaccharide pour vaccins contre virus
WO2023064373A1 (fr) Ciblage du transport de muropeptide à médiation par slc46a2 pour traiter le psoriasis
EP3846817A1 (fr) Compositions et procédés pour prévenir et/ou traiter une maladie filarienne
Conforti CpG Motif-based Adjuvant Enhances Immunogenicity of a Recombinant LHRH Vaccine and Noninvasive Monitoring of Adrenal and Gonadal Function in the Jaguar (Panthera Onca)

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 546780

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref document number: 2328602

Country of ref document: CA

Ref country code: CA

Ref document number: 2328602

Kind code of ref document: A

Format of ref document f/p: F

NENP Non-entry into the national phase

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 1999921705

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 38841/99

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 1999921705

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1999921705

Country of ref document: EP