WO1999055838A1 - Compositions et procedes permettant de caracteriser et de transplanter des cellules souches retiniennes prelevees sur un mammifere - Google Patents

Compositions et procedes permettant de caracteriser et de transplanter des cellules souches retiniennes prelevees sur un mammifere Download PDF

Info

Publication number
WO1999055838A1
WO1999055838A1 PCT/US1999/007377 US9907377W WO9955838A1 WO 1999055838 A1 WO1999055838 A1 WO 1999055838A1 US 9907377 W US9907377 W US 9907377W WO 9955838 A1 WO9955838 A1 WO 9955838A1
Authority
WO
WIPO (PCT)
Prior art keywords
retinal
cells
retina
progenitors
stem cell
Prior art date
Application number
PCT/US1999/007377
Other languages
English (en)
Inventor
Iqbal Ahmad
Original Assignee
University Of Nebraska Board Of Regents
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Nebraska Board Of Regents filed Critical University Of Nebraska Board Of Regents
Priority to AU39647/99A priority Critical patent/AU3964799A/en
Publication of WO1999055838A1 publication Critical patent/WO1999055838A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0623—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0621—Eye cells, e.g. cornea, iris pigmented cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/11—Epidermal growth factor [EGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/08—Coculture with; Conditioned medium produced by cells of the nervous system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • This invention relates to the fields of cell biology and opthamology. More specifically, the invention provides compositions and methods for the isolation and transplantation of retinal progenitor cells to correct certain degenerative disorders of the retina. Screening methods are also provided for assaying test agents for survival and differentiation promoting effects on retinal progenitor cells.
  • Photoreceptors are cells of the neurosensory retina which play a pivotal role in generating the signal for vision. Degeneration of photoreceptors, whether it is inherited or age-related, is the most common cause of blindness. In both retinitis pigmentosa (RP) and macular degeneration (MD) , two of the most prevalent of the sight robbing diseases, photoreceptors are the target. RP, which is a heterogenous group of inherited degenerative diseases, affects 1.5 million people worldwide and approximately 100,000 people in the USA from all walks of life. RP patients have difficulty seeing at night and their peripheral visual field is restricted in early adulthood. With the progression of the disease, the peripheral visual field constricts so much so that by the age of 60, the majority of RP patients become legally blind. Despite the extensive genetic heterogeneity, RP primarily affects the photoreceptors .
  • compositions and methods for reversing retinal degeneration are provided herein.
  • the present invention provides compositions and methods for the generation of retinal progenitor cells suitable for transplantation in test subjects having retinal degenerative disorders.
  • multipotent retinal stem cell progenitors are provided which have the capacity to differentiate into photoreceptors. Such cells may be used to advantage in retinal transplant procedures to prevent and/or correct retinal degenerative disorders.
  • the retinal stem cell progenitors of the invention may be genetically engineered to express growth factors for promoting survival of the transplanted cells. Expression of growth factors by the transplanted cells should promote graft survival in the retina. Growth factors envisioned for this purpose include, but are not limited to, EGF, bFGF, BDNF, TGF , TGF ⁇ , IGF and CNTF .
  • nucleic acid sequences encoding these growth factors are readily available and may be obtained from GenBank.
  • Methods for introducing nucleic acids into the retinal progenitor cells of the invention include but are not limited to retroviral mediated transformation, electroporation, transfection, lipofection, and calcium phosphate precipitation.
  • the primary retinal progenitor cells of the invention are immortalized using methods known to those of skill in the art.
  • Cells may be immortalized via the introduction of nucleic acid molecules encoding the following: SV40 large T antigen, papillomavirues E6 and E7 , adenovirus EIA, Epstein Barr virus, oncogenes such as myc , and mutant p53.
  • Retinal cells so immortalized may be used to advantage in assays to assess the survival promoting effects of test agents suspected of having this activity.
  • a method for preparing retinal progenitor stem cells of the invention is also provided. This method entails obtaining embryonic retina explants and dissociating the explants into single cell retinalsphere suspensions. The retinalspheres are then plated and exposed to an effective amount of a growth factor. Exposure to EGF for example gives rise to retinal cells having the sustained proliferative properties.
  • the cells are co-cultivated with PN1 cells to promote growth and differentiation.
  • the retinal progenitor cells of the invention may be cryopreserved for future use.
  • a method for determining the survival promoting effects of a test agent on retinal stem cell progenitors entails exposing a population of retinal stem cell progenitors to a test agent suspected of having survival promoting effects. The survival promoting effects if any, will then be assessed. Survival enhancement may be indicated by enhanced proliferation and/or prolonged survival in culture.
  • the invention provides a method for determining the effect of a test agent on the differentiation of retinal stem cell progenitors.
  • a population of retinal stem cell progenitors is contacted with a test agent suspected of inducing differentiation of retinal stem cells.
  • the differentiating effects of the test agent are then assessed.
  • Differentiation of stem cells may be analyzed using a variety of methods, including, but not limited to immunohistochemical and morphological assays, and molecular biological assays. Reagents are available for use in all of the assays described above for determining the presence or absence of retinal cell differentiation markers following exposure to the test agent.
  • a method for transplanting retinal stem cell progenitors into a retina of a test subject Following preparation of a retinal stem cell population, the cells are resuspended in a biologically compatible medium and delivered to the retina of a test subject. In one embodiment, the cells are injected into a lesion site between the choroid of the eye and the retina, i.e. the subretinal space.
  • the retinal stem cells so transplanted may optionally include at least one heterologous nucleic acid molecule encoding a growth factor. Retinal cells expressing growth factors may be superior in promoting graft survival following transplantation .
  • a "retinal stem cell progenitor” as used herein refers to a multipotent stem cell, which under the appropriate culture conditions may be induced to differentiate into photoreceptor cells.
  • growth factor refers generally to multifunctional, locally acting, intercellular signaling peptides which control both the ontogeny and maintenance of tissue form and function.
  • growth factors include, without limitation, bFGF, EGF, TGF , TGF ⁇ , IGFs, and CNTF .
  • the nucleic acid sequences encoding these factors are known and readily available to one of ordinary skill in the art.
  • Nucleic acid or a “nucleic acid molecule” as used herein refers to any DNA or RNA molecule, either single or double stranded and, if single stranded, the molecule of its complementary sequence in either linear or circular form.
  • nucleic acid molecules a sequence or structure of a particular nucleic acid molecule may be described herein according to the normal convention of providing the sequence in the 5 ' to 3 ' direction.
  • a “replicon” is any genetic element, for example, a plasmid, cosmid, bacmid, phage or virus, that is capable of replication largely under its own control .
  • a replicon may be either RNA or DNA and may be single or double stranded.
  • a “vector” is a replicon, such as a plasmid, cosmid, bacmid, phage or virus, to which another genetic sequence or element (either DNA or RNA) may be attached so as to bring about the replication of the attached sequence or element.
  • an “expression operon” refers to a nucleic acid segment that may possess transcriptional and translational control sequences, such as promoters, enhancers, translational start signals (e.g., ATG or AUG codons), polyadenylation signals, terminators, and the like, and which facilitate the expression of a polypeptide coding sequence in a host cell or organism.
  • transcriptional and translational control sequences such as promoters, enhancers, translational start signals (e.g., ATG or AUG codons), polyadenylation signals, terminators, and the like, and which facilitate the expression of a polypeptide coding sequence in a host cell or organism.
  • the terms “transform”, “transfect”, “transduce”, shall refer to any method or means by which a nucleic acid is introduced into a cell or host organism and may be used interchangeably to convey the same meaning. Such methods include, but are not limited to, transfection, electroporation, microinjection, PEG- fusion and the like.
  • the introduced nucleic acid may or may not be integrated (covalently linked) into nucleic acid of the recipient cell or organism.
  • the introduced nucleic acid may be maintained as an episomal element or independent replicon such as a plasmid.
  • the introduced nucleic acid may become integrated into the nucleic acid of the recipient cell or organism and be stably maintained in that cell or organism and further passed on or inherited to progeny cells or organisms of the recipient cell or organism.
  • the introduced nucleic acid may exist in the recipient cell or host organism only transiently.
  • a “clone” or “clonal cell population” is a population of cells derived from a single cell or common ancestor by mitosis.
  • a "cell line” is a clone of a primary cell or cell population that is capable of stable growth in vi tro for many generations.
  • an "immortalized cell” is used herein to refers to a cell which will proliferate indefinitely in culture. Cells obtained from primary cultures have a finite life span. However, the introduction of nucleic acids encoding certain oncogenes or viral proteins transforms such cells such that they may be passaged indefinitely in culture. Immortalizing nucleic acids known to be effective in the generation continuous cells lines, include, without limitation, those encoding SV40 large T antigen, papillomaviruses E6 and E7, adenovirus E1A, Epstein Barr virus, human T cell leukemia virus, herpesvirus saimiri, oncogenes such as myc and mutated p53.
  • a "signal peptide” as used herein refers to a nucleic acid sequence that directs newly synthesized secretory or membrane proteins to and through membranes of the cell.
  • An exemplary signal peptide of the present invention is the prepro sequence of NGF, however, other signal peptides may prove useful in the practice of the present invention. Sequences encoding such signal
  • test subject includes both humans and animals.
  • FIGs 1A and IB are micrographs that show the growth stimulatory effects of epidermal growth factor (EGF) on retinal progenitor cells.
  • EGF epidermal growth factor
  • the dividing cells identified by the silver grains corresponding to the incorporated tritiated thymidine, were localized in the outer neuroblastic layer (Nbl) which harbors the retinal progenitors, Fig. 1A.
  • the proportion of dividing cells (arrows) in the outer neuroblastic layer increased in response to EGF (Fig. IB) in comparison to that in the control (Fig. 1A) , suggesting that the developing retina harbors EGF-responsive progenitors similar to those found in the developing striatum (1,2) .
  • IR Inner retina .
  • Figures 2A-2C are micrographs depicting retinalspheres formed in response to saturating concentrations of EGF (20 ng/ml) .
  • EGF 20 ng/ml
  • Figures 3A-3C are a series of micrographs showing the proliferating progenitors in retinalspheres following immunostaining with anti-BrdU and anti-nestin.
  • the majority of the cells in the retinalspheres incorporated BrdU suggesting that these cells were in the S-phase of the cell cycle when exposed to BrdU (Figs. 3A and 3B) .
  • the BrdU ⁇ cells were also positive for nestin, a marker for neuroectodermal stem cells (Fig. 3B; magnification, 400) suggesting that the proliferating cells in retinalspheres possess progenitors' properties.
  • Figure 3A is a Nomarski image .
  • Figures 4A-4I are a series of micrographs showing retinalspheres which were fixed and analyzed by double immunocytochemistry in the following combinations: anti-BrdU/anti-neurofilament (NfL; neuronal marker) ; anti-BrdU/anti 04 (oligodendrocytic markers) and anti -BrdU/anti -GFAP (astrocytic markers) .
  • the BrdU+ cells in the retinalspheres expressed the neuronal (Fig. 4A) , oligodendrocytic (Fig. 4B) and astrocytic (Fig. 4C) markers suggesting that the EGF-responsive progenitors are multipotential .
  • Figures 4A, 4D and 4G are Nomarski images. Magnification, x400.
  • Figure 5 shows the results of Southern analysis which reveal the expression of the opsin gene in retinal progenitors treated with EGF.
  • RT-PCR analysis to amplify 400bp of the opsin transcript, the data show that the expression of opsin increases significantly when EGF is withdrawn from the culture for three days.
  • the upper panel in the figure shows Southern analysis of the RT-PCR products obtained by amplifying cDNAs using opsin gene specific primers (4) .
  • the lower panel shows the ethidium bromide staining of RT-PCR products obtained by amplifying corresponding cDNAs using primers corresponding to the sequence of a constitutively expressed gene, ⁇ -actin.
  • the RT-PCR products were resolved on 1% agarose gel by electrophoresis.
  • Figures 6A and 6B depict a pair of micrographs showing that co-culture with PN1 retinal cells promotes the differentiation of retinal progenitors into photoreceptors.
  • the cells in neurosheres were fixed and subjected to double- immunocytochemistry using anti-BrdU and RetPl (anti-opsin) antibodies.
  • Fig. 6A is a
  • Figure 7 is a schematic diagram depicting the methodology utilized for generating retinal progenitor cells of the invention.
  • Figure 8 is a schematic diagram depicting the protocol for introduction of nucleic acid constructs in to retinal stem cells followed by transplantation into a test subject.
  • Photoreceptors are cells of the neurosensory retina without which the signal for vision cannot be generated.
  • RP retinitis pigmentosa
  • MD macular degeneration
  • photoreceptors degenerate.
  • RP and MD retinal cells are spared. Accordingly, it may be possible to restore vision by therapeutical intervention via treatment with growth factors that promote the survival of photoreceptor accompanined by retinal transplantation. If photoreceptors may be rescued from degeneration and/or replaced with the restoration of connections with unaffected neurons in the diseased retina, some recovery of visual function may be obtained.
  • exogenous growth factors and retinal transplantation have distinct advantages as therapeutic approaches to photoreceptor dystrophy.
  • survival promoting growth factor can prevent premature death of photoreceptor thus delaying the degenerative process.
  • Retinal transplantation has the added advantage of reconstructing damage retina by providing new photoreceptors that can restore functional circuitry needed for vision.
  • RCS rats are the most studied for transplantation purposes (5) .
  • RCS rats are the most studied for transplantation purposes (5) .
  • the rds mouse is one of the most promising rodent models of RP .
  • the structural gene peripherin is mutated (73,74) . Mutations in this gene have been linked with autosomal dominant RP and some ARMD (78,79) .
  • a population of cells from embryonic rat retina have been isolated which are available in virtually unlimited supply. These cells may be used for retinal transplantation to repopulate damaged and diseased retina and cryopreserved for such use in the future.
  • the cells behave like the ancestral cells of the nervous system known as stem cells, from which neurons and supporting cells of the brain are derived. The capacity
  • these progenitor cells can be induced to become photoreceptors, the cells that degenerate in RP and MD. Accordingly, these cells are suitable reagents for retinal transplantation and additionally will provide novel insights of the differentiation mechanisms by which retinal progenitor cells develop into photoreceptors. These data will yield valuable information about factors which may prevent photoreceptor degeneration. Such cells may provide survival factors which can slow or prevent photoreceptor degeneration.
  • the cultured progenitor cells of the invention possess tremendous therapeutic potential to address the problem related to photoreceptor degeneration.
  • the progenitor cells of the invention may be genetically engineered via the introduction of heterologous nucleic acid molecules encoding growth factors with retinal cell survival promoting effects.
  • compositions and methods of the present invention will provide valuable information and resources for understanding and treating RP and MD .
  • the retinal progenitor cells of the invention will also offer a viable alternative to fetal tissue dependence since the cultured progenitors have the potential to be cryopreserved and re-expanded for future transplantation purposes.
  • the retinal progenitor cells of the invention may be prepared from embryonic retina obtained from mammalian test subjects.
  • the retina explants are dissociated, and exposed to growth factors which induce the formation of retinalsphreres .
  • Retinalspheres are proliferative and multipotent. Under the appropriate culture conditions, such retinalspheres may be induced to differentiate into photoreceptors. These cells will facilitate understanding of retinal neuron differentiation and may be used to repopulate retina that has undergone degenerative changes.
  • the retinal stem cells so produced may then be genetically engineered using appropriate transformation vectors.
  • Vectors may be produced for expressing growth factors in the progenitor cells of the invention. Additionally, vectors expressing appropriate nucleic acids for immortalizing progenitor cells may be synthesized. Any molecular cloning, recombinant DNA or cell culture and transformation techniques not psecivially described are carried out by standard
  • the retinal progenitor cells of the invention may be used in a variety of ways having utility in research, diagnostic, therapeutic and pharmaceutical applications. Representative methods of use for the compositions of the invention are described below.
  • immortalizing genes may introduced into the progenitor cells of the invention to generate continuous cell lines.
  • Such cell lines will have utility in methods for assaying test compounds for survival promoting and/or differentiation inducing effects.
  • the survival promoting effects of such test compounds may be assessed using cell viability and proliferation assays.
  • Differentiation may be assess by the induction of expression of differentiation markers, including but not limited to opsin, IRBP, and recoverin.
  • the potential utility of agents or test compounds identified using the compositions and assay methods of the invention will be broad and will include uses for therapeutic intervention and prevention of retinal degenerative disorders.
  • the retinal stem cell progenitors of the invention may be used for transplantation to regenerate and reconstruct dystrophic retina.
  • Time-pregnant (E-18) Sprague Dawley rats were obtained obtained from the supplier (Sasco) and retina dissociated as previously described (41) . Briefly, after determining the developmental stage of the embryo by crown rump length and external features (47) eyes will be enucleated and retina removed in Hanks buffered salt solution (HBSS) with Ca ++ and Mg ++ . The retina will be transferred to HBSS without Ca ++ and Mg ++ containing 0.25% trypsin, ImM EDTA and 20 ⁇ g/ml DNase I and incubated at 37°C for 20 minutes. Trypsin will be neutralized by washing the tissue in HBSS containing 20% FBS .
  • HBSS Hanks buffered salt solution
  • Cells will be dissociated by trituration (10-15 times) in the culture medium (DMEM: F12, lxN2 supplement (GIBCO), 2mM L-glutamine, lOOu/ml penicillin, lOO g/ml streptomycin) and plated at a low density (2-3xl0 3 cells/cm 2 ) in 24-well culture dishes or in 75m 2 T-flasks for the bulk culture in the presence of 20ng/ml of EGF (GIBCO) .
  • the culture will be maintained at 37°C in 5% C0 2 .
  • retinalspheres 1,2
  • the culture will be continued for another week by which time the individual retinalspheres attain a definite and compact spherical shape.
  • the retinalspheres will be passaged every two weeks for prolonged expansion.
  • the retinalspheres will be exposed to BrdU (lO ⁇ M) for four days.
  • the retinalspheres will be harvested and washed extensively in retinal culture medium to remove BrdU and EGF and will be dissociated into individual cells as described above except that the incubation in trypsin wil be reduced from twenty to five minutes.
  • the proportion of labeled progenitors to be transplanted will be assessed by plating an aliquot of the dissociated cells on poly-D-lysine coated glass coverslips and counting BrdU- incorporated cells after anti-BrdU immunocytochemistry .
  • cells will be labeled with Fast blue.
  • the doubled labeled cells will be assessed for viability by Trypan blue dye exclusion test .
  • Cryopreservtion of retinal progenitors will be carried out according to previously described methods to cryopreserve neurons from primary culture (48) .
  • a similar method has been used to successivefully cryopreserve cultured spinal cord neuroblasts (49) and embryonic retinal tissue (50) .
  • Retinalspheres, 14 days in culture (DIC) will be resuspended in fresh retinal culture medium containing lx N2 supplement, EGF (20ng/ml) and 10% DMSO.
  • the suspension will be transferred into Nunc tubes, capped tightly and placed in a pre-chilled styrofoam container in -80 °C. The next day the frozen vial will be transferred for storage in a liquid nitrogen container.
  • the vials will be thawed quickly at 37°C and the content will be added to pre-warmed 50 ml of retinal culture medium containing EGF with a large-bore pipet . Care will be exercised for re-expansion of progenitors.
  • Each batch of retinal progenitors used for transplantation will be analyzed for clonal expansion by triturating individual primary retinalspheres into single cells and plating them in individual wells in a 96-well culture plate containing 200 ⁇ l of retinal culture medium with EGF (20ng/ml) for the generation of secondary retinalspheres.
  • the retinalspheres will be collected in conical -bottom tubes and washed three times in the retinal culture medium to remove EGF followed by plating on plated on poly-D-lysine (50 ⁇ g/ml) coated glass coverslips in a 24-well culture plate.
  • the retinal culture medium will be supplemented with 1% FBS to promote differentiation and the culture will be continued for one week.
  • the retinalspheres will be fixed in 4% paraformaldehyde for 15 minutes at 4°C, washed in PBS and subjected to immunocytochemical analyses using anti-neurofilament and anti-MAP2, anti-04, anti GalC, and anti-GFAP antibodies.
  • Photoreceptor Differentiation Incubation of progenitors with FBS following the removal of EGF results in photoreceptor differentiation. To determine the effects of host tissue on the ability of progenitors to differentiate, retinalspheres will be co-cultured with dissociated retinal cells obtained from the retina of neonatal (PN1) and 2 month old Sprague
  • progenitors 19 transplantation. This possibility will be tested by culturing the progenitors in presence of growth factors which have been reported to promote photoreceptor differentiation. These include bFGF (3) and retnoic acid (51) . BrdU tagged progenitors will be cultured in the presence of bFGF (20ng/ml) or all-trans RA (100-500nM) for one, two and three days. At the end of each incubation period, the progentors will be washed extensively to remove growth factors and cultured for another four days in presence of 1% FBS. Cells will be fixed and subjected to imunocytochemistry using anti-opsin, anti-syntaxin and anti- ⁇ -tubulin antibodies. The experiment is likely to yield information regarding the duration of exposure for optimum photoreceptor differentiation prior to transplantation. Growth factor-exposed progenitors will be used in case post-transplantational differentiation is not satisfactory.
  • RT-PCR analysis (29) of the temporal expression of opsin gene will be performed on differentiating retinal progenitors following withdrawal of EGF.
  • the retinalspheres will be washed in retinal culture medium as described above to remove EGF and will be cultured in suspension in the presence of 1% FBS.
  • the retinalspheres will be collected and dissociated by trypsinization as described above and counted.
  • RNA will be isolated from collected cells using Trizol (GIBCO) , precipitated in presence of tRNA as a carrier, dissolved in lXPCR-amplification buffer (lOmM Tris-HCl, pH 8.0; 50mM KC1; 1.5mM MgCl 2 ) and treated with RNAse free DNAse
  • first strand cDNA will be synthesized in IX PCR amplification buffer with random hexamer (Pharmacia) using MuM V reverse transcriptase (GIBCO) at 42 °C for 30 minutes.
  • the cDNA reaction will be used for PCR amplification using primers to amplify the cDNA of interest and a pair of primers to amplify ⁇ -actin cDNA as an internal control. Specific amplified products will be identified by Southern blotting.
  • Amplification of the opsin transcript will be accomplished by using gene-specific forward ( 5 ' CATGCAGTGTTCATGTGGGAT3 ) and reverse ( 5 ' GTGAGCATGCAGTTCCGGAAC3 ) primers. Southern analysis will be carried out using radio-labeled rat opsin cDNA cloned in our lab (4) .
  • mice All animals will be maintained according to recommendations by the Department of Health and Human Services and ARVO guidelines. Sprague Dawley rats and rd mice will be purchased from Sassco and Charles River, respectively. A breeding pair of rds mice is available to us from Dr. Michael Chaitin at the University of North Texas Health Science Center, Fortworth, Texas. The animals will be housed in the animal care facility of
  • PN10 immature
  • Sprague Dawley rats To evaluate the parameters of survival, differentiation and integration of the graft transplantation will be carried out in immature (PN10) and young adult Sprague Dawley rats. Transplantation in immature and young adult host will provide information regarding host-transplant interaction with respect to the host's age. Evaluation of transplantation will be carried out at 2-, 4-, 8 weeks and after a year by morphological and morphometric analyses using light and electron microscopy, immunocytochemistry and in situ hybridization.
  • the rd mouse is a suitable model for the evaluation of retinal progenitors to repopulate and reconstruct damaged retina since photoreceptors degenerate rapidly (completed by fourth post-natal week) in this animal.
  • Sub-retinal transplantation will be carried out in 2-3 month old rd mice and the transplant will be analyzed as described above at 2-, 4-, 8 weeks and 6 months post-transplantation.
  • the rds mouse is a suitable model to evaluate the potential of the retinal progenitors to rescue native photoreceptors from further degeneration since degeneration in this animal is relatively slow in comparison to that in the rd mouse.
  • the most prominent of pre-degenerate characteristics of the rds retina is the lack of outer segments (11) .
  • the outer nuclear layer of the rds mouse has normal thickness until the age of 14 days. However, a rapid reduction in the thickness of the outer nuclear layer takes place between 14 and 21 days of age. Thereafter the rate of degeneration decreases and takes 9-12 months to complete. Sub-retinal
  • transplantation will be carried out one week before the onset of degeneration (PN6) and around the time of the onset of degeneration (PN14) .
  • Analyses of transplantation will be carried out as previously described at 1-, 2-, 4-, 8 weeks and 6 months post -transplantation .
  • the transplantation protocol will be carried out in collaboration with Dr. James Turner (52) .
  • Rats and mice will be anesthetized with Ketamine (100 mg/kg bodyweight) and xyazine (5 mg/kg bodyweight) .
  • An incision will be made through the superior eye lid to expose the dorsal surface of the eye.
  • the eye will be retracted anteriorly and inferiorly exposing the full extent of the superior rectus muscle.
  • the muscle will be cut at its anterior attachments and reflected posteriorly exposing the sclera.
  • a small penetrating lesion 0.5-1.0 mm
  • the incision will be made perpendicular to the anterior posterior axis along the equatorial plane of the eye. Penetration of the sclera to the level of the choroid will be indicated by slight bleeding at the incision site. With one additional cut, the choroid will be penetrated and the retina exposed. A 32 -gauge blunt-tipped needle attached to lO ⁇ l Hamilton syringe will be held parallel to the surface and inserted with the beveled edge facing sideways, into one corner of the lesion site between the choroid and retina.
  • Transplanted cells will be considered graft if the following criteria (45) are fulfilled.
  • the cells should exist as ectopic cell clusters in the sub-retinal space in serially sectioned eyes. Each cluster has more than ten cells and are not formed by macrophages, plasma cells and lymphocytes. Cells in cluster have Fast blue fluorescence and are positve for BrdU labeling. These cells will be screened for pyknotic and disintegrating nuclei to distinguish degeneration.
  • immune tolerance could be a potential problem for rat retinal progenitor xenografts in rd and rds mice. This problem can be circumvented by immunosuppression. It has been reported that xenograft of human fetal neural retina survive and are well tolerated in the sub-retinal space of cyclosporine-immunosuppressed rats (39) .
  • retinalspheres will be treated with BrdU (lO ⁇ m/ml) for four days .
  • BrdU lO ⁇ m/ml
  • the prolonged exposure to BrdU ensures maximal labeling since cells with stem cell-like properties have extended cell-cycle.
  • the labeled retinalspheres will be washed extensively in culture medium prior to dissociation. Cells will be analyzed for viability by Trypan blue dye exclusion test. Additionally, a portion of cells will be plated on poly-d-lysine ( 5O ⁇ g/ml) submerged coverslips and subjected to anti-BrdU immunocytochemistry to estimate the percentage of proliferating cells.
  • BrdU incorporation is a reliable method of identifying transplanted cells in retina (57) and in other brain regions (58,59) . Since host's photoreceptors are post-mitotic they will not incorporate BrDu and therefore can be easily distinguished from the differentiated transplants.
  • animals will be anesthetized with ketamine (100 mg/kg bodyweight) and xylazine (5 mg/kg bodyweight) and eyes will be enucleated and fixed in 4% paraformaldehyde for five hours at 4°C .
  • the eyes will be trimmed around the site transplantation (identified by the position of the suture) , cyroprotected in 30% sucrose overnight at 4°C,
  • Immunocytochemical analyses (60,61) will be carried out to identify and analyze the differentiated transplanted retinal progenitors. Similar analyses will be carried out for the characterization (clonal expansion, multipotentiality and ability to differentiate into photoreceptors) of the retinalspheres prior to transplantation. Paraformaldehyde- fixed retinalspheres, dissociated cells, or tissue sections will be blocked for 30 minutes at RT in 5% serum
  • Triton X-100 Triton X-100. The following day sections will be washed in PBS and incubated for one hour at RT in cy3 conjugated secondary antibody. Sections will be washed in PBS and will be subjected to BrdU immunocytochemistry . Sections will be incubated at 37°C for 45 minutes in 2N HCL to denature DNA followed by a ten minute incubation at RT in 0. IM boric acid. Sections will be washed in PBS and BrdU immunocytochemistry will be carried out as described above. The secondary antibody used to visualize BrdU labeling will be will be conjugated with FITC. The sections will be mounted in fluoromount and viewed with Leitz-DMR microscope. The primary antibodies will also be detected, when necessary, using biotinylated secondary antibodies using ABC Vectastain (Vector) kit.
  • ABC Vectastain (Vector) kit ABC Vectastain
  • RETP-1 and HPC-1 are available to us from Dr. C.J. Barnstable (62) and anti -CRALBP from Dr. J. Saari (63) .
  • cryostat-sections of post-fixed (4% paraformaldehyde in phosphate buffer saline) retina will be treated with proteinase K (2 ⁇ g ml "1 proteinase K in 500 mM NaCl , lOmM Tris-HCL, pH 8.0) for 10 minutes at room temperature.
  • each section will be covered with 10 ⁇ l of prehybridization buffer (50% formamide; 300 mM NaCl ; 20mM Tris HCL, pH 8.0; 5 mM EDTA; lXDenhardt ; 10% dextran sulfate; 10 mM DTT) and the slides will be placed in a box saturated with 4 X SSC and 50% formamide.
  • prehybridization buffer 50% formamide; 300 mM NaCl ; 20mM Tris HCL, pH 8.0; 5 mM EDTA; lXDenhardt ; 10% dextran sulfate; 10 mM DTT
  • RNASE A solution (20 ⁇ g ml "1 RNase A in 500 mM NaCl, lOmM Tris-HCl, pH 8.0) at room temperature for 30 minutes.
  • Sections will be washed several times, with the final wash in 0.1 x SSC, lOmM ⁇ -mercaptoethanol , ImM EDTA at 50 ° C for 2 hours and then dehydrated in graded concentrations of ethanol containing 300 MM ammonium acetate. After emulsion-autoradiography, sections will be washed several times, with the final wash in 0.1 x SSC, lOmM ⁇ -mercaptoethanol , ImM EDTA at 50 ° C for 2 hours and then dehydrated in graded concentrations of ethanol containing 300 MM ammonium acetate. After emulsion-autoradiography, sections will be washed several times, with the final wash in 0.1 x SSC, lOmM ⁇ -mercaptoethanol , ImM EDTA at 50 ° C for 2 hours and then dehydrated in graded concentrations of ethanol containing 300 MM ammonium acetate. After emulsion-autoradiography, sections will be washed several
  • Synaptic formation, the organization, and the morphology of the outer segments at the ultrastructural level will be evaluated by electron microscopy in transplanted and control eyes to determine the differentiation and the extent of integration of transplanted cells into the host retina.
  • Enucleated eye will be fixed in Karnovsky fixature for 30 minutes.
  • the anterior segment will be cut at the ora serrata to facilitate diffusion and fixation continued overnight 4°C.
  • the eyes will be post fixed in 7% osmium tetroxide, stained with lead citrate, dehydrated through an alcohol series and embedded in Epon. Thick sections (1 ⁇ M) will be cut with diamond knife, placed on copper mesh, carbon coated and photographed with the Phillip Electron Microscope .
  • the isolation and characterization of EGF-responsive retinal progenitors with stem cell properties serves two broad purposes.
  • the cultured retinal progenitors can be utilized as the reagent for retinal transplantation. This is significant since a phase I clinical trial of fetal retinal transplantation in RP patients has already begun.
  • the present invention may alleviate the problems associated with the scarcity of fetal tissues.
  • exogenous growth factors such as bFGF, BDNF and CNTF reduce photoreceptor degeneration in inherited or light induced dystrophic retina (53).
  • the exogenous growth factors may not be suitable for long term treatment due to the blood-retinal barrier and may cause pathological changes such as neovascularization.
  • diffusible factors have been shown to mediate cell differentiation in the retina cultured retinal progenitors are candidates for elaborating factors that may promote survival .
  • transplanted progenitors have the potential to repair neural tissues that have undergone degenerative changes by generating site-specific neurons. Therefore cultured retinal progenitors with stem cell properties possess tremendous therapeutic potential.
  • E18 embryonic day 18 retinal explants were grown in retinal medium in the presence of EGF (20ng/ml) for four days. In the last 24 hours of culture tritiated thymidine (l ⁇ ci/ml, NEN) was added to identify proliferating cells in the S-phase of the cell -cycle. The explants were fixed, cryo-protected, cryo-sectioned and subjected to emulsion
  • the EGF-responsive procreni tors can be isolated and clonall ⁇ expanded
  • E18 retina was dissociated (61) and cultured in suspension in the presence of a saturating concentration of EGF (20ng/ml) .
  • EGF a saturating concentration of EGF (20ng/ml) .
  • retinalspheres By the end of the first week in culture, retinalspheres of various sizes are observed (Figure 2A; magnification xlOO) .
  • Figure 2B magnification, x200
  • each neurosphere can be dissociated by trituration and upon re-culture in suspension cells can form secondary retinalspheres (Figure 2C, magnification, xlOO) suggesting that the cells have the self-renewal property of stem cells.
  • the EGF responsive progeni tors are mul tipotential
  • Multipotentiality is one of the properties of progenitors with stem-cell like features.
  • the ability of EGF-responsive retinal progenitors to differentiate along multiple lineages was tested by analyzing the phenotypes of the dividing cells following the withdrawal of EGF.
  • Fourteen day old retinalspheres in culture medium containing EGF were incubated for 48 hours with BrdU (lO ⁇ m/ml) .
  • the retinalspheres were washed extensively to remove EGF completely and the culture was continued without EGF for seven days in presence of 1% FBS.
  • the retinalspheres were fixed and double immunocytochemical analyses were carried out in the following combination: anti-BrdU/anti-neurofilament
  • the EGF-responsive progeni tors can differentiate into photoreceptors .
  • the upper panel in the figure shows Southern analysis of the RT-PCR products obtained amplifying cDNAs using opsin gene specific primers (4) .
  • the Lower panel shows the ethidium bromide staining of RT-PCR products obtained by amplifying corresponding cDNAs using primers corresponding to the sequence of a constitutively expressed gene, ⁇ -actin.
  • the RT-PCR products were resolved on 1% agarose gel by electrophoresis .
  • Co-culture wi th PN1 retinal cells promotes the differentiation of retinal progeni tors into photoreceptors .
  • Figure 7 shows a schematic diagram which depicts the culturing methods of the invention.
  • exogenous growth factors and retinal transplantation have distinct advantages as therapeutic approaches to photoreceptor dystrophy.
  • survival promoting growth factors may prevent premature death of photoreceptors, thus delaying the degenerative process.
  • Retinal transplantation has the added advantage of reconstructing damaged retina by providing new photoreceptors that can restore functional circuitry needed for vision.
  • bFGF survival -promoting growth factor for photoreceptors
  • bFGF is involved in the differentiation of photoreceptors and vitreal and subretinal injection of bFGF has been shown to delay photoreceptor degeneration in diseased and light damaged retina.
  • the genetically engineered progenitors should act like a pump, providing bFGF to the damaged photoreceptor on a continuous basis thereby sustaining their survival over a prolonged period. Since bFGF has been shown to be protective to cells that make it, it should promote survival of the graft also.
  • the bFGF expressing progenitors may also facilitate the reconstruction of damaged retina by differentiating to new photoreceptors as these progenitors have the capacity to become photoreceptor-like given the right micro-environment . Transplantation of genetically engineered progenitors offers a multifaceted approach to treat photoreceptor degeneration encountered in sight robbing diseases. In addition, the approach described herein
  • the genetically engineered progenitor to serve as as a vehicle for delivering other growth factors or cytokines to the diseased or damaged retina.
  • Retrovirus-mediated gene transfer is preferred over adenovirus-mediated gene transfer because (1) retinal progenitors are proliferating cells and retrovirus infects dividing cells with higher efficiency; (2) the recombinant retrovirus carrying bFGF transgene will integrate stably in host cell genome; and (3) recombinant retrovirus has been used to overexpress NeuroD, a retinal differentiation factor, to facilitate differentiation of rod photoreceptors.
  • cDNA corresponding to mouse bFGF is subcloned into retroviral vector pSRaMSVtkneo (pSRa) (Muller et al .
  • bFGF-C bFGF without signal peptide
  • bFGF-S signal peptide
  • bFGF-S may be more effective in rescuing photoreceptor degeneration as it should function over a longer distance.
  • a cDNA sequence corresponding to the prepro sequence of NGF will be operably linked to bFGF cDNA at 5 'end.
  • This recombinant sequence which has been shown to encode a biologically active form of bFGF, will be cloned into pSRa (Ray et al . , 1995, J. Neuro. Chem. 64:503-513). Recombinant retrovirus will be produced in 293T cells.
  • E17 rat retina will be dissociated into single cells and cultured in the presence of EGF (20ng/ml) as described in Example I. Under these conditions, a subset of cells (progenitors) survive and proliferate to generate spheres of cells called retinal - spheres .
  • the retinal spheres will be infected with recombinant retrovirus containing bFGF transgenes, bFGF-C or bFGF-S.
  • Retinal spheres carrying recombinant retrovirus will be selected by culturing in the presence of the G418 (400ug/ml) .
  • the expression of the transgene in progenitors will be ascertained by (1) RNAse protection assay (2) immunoprecipitation of cell lysate (3) radioimmunoassay (RIA) carried out on conditioned medium using bFGF antibody (Santa-Cruz) .
  • RIA radioimmunoassay
  • the biological activity of bFGF- C and bFGF-S will be determined by their ability to promote survival of hippocampal neurons in a co-culture condition as described previously (Ray et al . , 1995,
  • Controls will include non-transduced progenitors .
  • the ability of genetically engineered progenitors to differentiate to photoreceptors will also be determined.
  • Cultured progenitors when co-cultured with neonatal retinal cells display photoreceptor-specific properties.
  • the BrdU tagged-genetically engineered cells will be co-cultured with PNl retinal cells for 4-5 days and analyzed for expression for photoreceptor- specific markers such as the opsin, recoverin and IRBP.
  • bFGF retinal progenitor cells While delivery of bFGF retinal progenitor cells has been exemplified herein, other growth factors may be utilized in the present invention. The survival and or differentiating effects of these additional growth factors will be assessed using the criteria described herein. Growth factors contemplated for use in the present invention.
  • EGF EGF
  • TGF TGF
  • CNTF CNTF
  • IGF IGF
  • the retinal degeneration slow (rds) gene product is a photoreceptor disc membrane-associated glycoprotein. Neuron 6: 61-70.

Abstract

L'invention concerne des procédés de génération de cellules souches rétiniennes pouvant servir dans la transplantation rétinienne chez des patients atteints de troubles dégénératifs de la rétine. Les cellules faisant l'objet de cette invention peuvent servir à cribler des agents thérapeutiques bénéfiques favorisant la survie des cellules souches rétiniennes et agissant sur la différentiation de celles-ci.
PCT/US1999/007377 1998-04-24 1999-04-23 Compositions et procedes permettant de caracteriser et de transplanter des cellules souches retiniennes prelevees sur un mammifere WO1999055838A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU39647/99A AU3964799A (en) 1998-04-24 1999-04-23 Compositions and methods for the characterization and transplantation of mammalian retinal stem cells

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US8297098P 1998-04-24 1998-04-24
US60/082,970 1998-04-24

Publications (1)

Publication Number Publication Date
WO1999055838A1 true WO1999055838A1 (fr) 1999-11-04

Family

ID=22174602

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/007377 WO1999055838A1 (fr) 1998-04-24 1999-04-23 Compositions et procedes permettant de caracteriser et de transplanter des cellules souches retiniennes prelevees sur un mammifere

Country Status (2)

Country Link
AU (1) AU3964799A (fr)
WO (1) WO1999055838A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001058460A1 (fr) 2000-02-11 2001-08-16 The Schepens Eye Research Institute, Inc. Isolation et transplantation de cellules souches retiniennes
WO2004069268A1 (fr) 2003-02-03 2004-08-19 Japan Science And Technology Agency Regeneration et neogenese de cellules visuelles de la retine par le gene otx2
US20120148536A1 (en) * 2010-12-14 2012-06-14 Morehouse School Of Medicine Methods and storage and retrieval of functional mature retinal cells
US10758572B2 (en) 2012-02-17 2020-09-01 The Schepens Eye Research Institute Phenotype profile of human retinal progenitor cells
US11096968B2 (en) * 2016-01-27 2021-08-24 Protokinetix Inc. Use of anti-aging glycoprotein for enhancing survival of neurosensory precursor cells
US11241460B2 (en) 2013-03-15 2022-02-08 Astellas Institute For Regenerative Medicine Photoreceptors and photoreceptor progenitors produced from pluripotent stem cells

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5416260A (en) * 1989-07-25 1995-05-16 University Of North Carolina At Chapel Hill Homologous recombination for universal donor cells and chimeric mammalian hosts
US5453357A (en) * 1992-10-08 1995-09-26 Vanderbilt University Pluripotential embryonic stem cells and methods of making same

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5416260A (en) * 1989-07-25 1995-05-16 University Of North Carolina At Chapel Hill Homologous recombination for universal donor cells and chimeric mammalian hosts
US5453357A (en) * 1992-10-08 1995-09-26 Vanderbilt University Pluripotential embryonic stem cells and methods of making same

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7514259B2 (en) 2000-02-11 2009-04-07 Schepens Eye Research Institute Isolation and transplantation of retinal stem cells
EP1261357A1 (fr) * 2000-02-11 2002-12-04 The Schepens Eye Research Institute, Inc. Isolation et transplantation de cellules souches retiniennes
JP2003521910A (ja) * 2000-02-11 2003-07-22 ザ スキーペンズ アイ リサーチ インスティテュート インコーポレイテッド 網膜幹細胞の分離及び移植
EP1261357A4 (fr) * 2000-02-11 2004-05-19 Schepens Eye Res Inst Isolation et transplantation de cellules souches retiniennes
WO2001058460A1 (fr) 2000-02-11 2001-08-16 The Schepens Eye Research Institute, Inc. Isolation et transplantation de cellules souches retiniennes
US20090104694A1 (en) * 2000-02-11 2009-04-23 Schepens Eye Research Institute Isolation and transplantation of retinal stem cells
AU2001234998B2 (en) * 2000-02-11 2006-06-08 Childrens Hospital Of Orange County A California Corporation Isolation and transplantation of retinal stem cells
WO2004069268A1 (fr) 2003-02-03 2004-08-19 Japan Science And Technology Agency Regeneration et neogenese de cellules visuelles de la retine par le gene otx2
EP1591127A1 (fr) * 2003-02-03 2005-11-02 Japan Science and Technology Agency Regeneration et neogenese de cellules visuelles de la retine par le gene otx2
EP1591127A4 (fr) * 2003-02-03 2009-09-02 Japan Science & Tech Agency Regeneration et neogenese de cellules visuelles de la retine par le gene otx2
US7858346B2 (en) 2003-02-03 2010-12-28 Japan Science Technology Agency Regeneration and neogenesis of retinal visual cell-expressing Otx2 protein
US8137934B2 (en) 2003-02-03 2012-03-20 Japan Science And Technology Agency Regeneration and neogenesis of retinal photoreceptor cell using Otx2 gene
US20120148536A1 (en) * 2010-12-14 2012-06-14 Morehouse School Of Medicine Methods and storage and retrieval of functional mature retinal cells
US9777255B2 (en) * 2010-12-14 2017-10-03 Morehouse School Of Medicine Methods and storage and retrieval of functional mature retinal cells
US10758572B2 (en) 2012-02-17 2020-09-01 The Schepens Eye Research Institute Phenotype profile of human retinal progenitor cells
US11957719B2 (en) 2012-02-17 2024-04-16 The Schepens Eye Research Institute Phenotype profile of human retinal progenitor cells
US11241460B2 (en) 2013-03-15 2022-02-08 Astellas Institute For Regenerative Medicine Photoreceptors and photoreceptor progenitors produced from pluripotent stem cells
US11096968B2 (en) * 2016-01-27 2021-08-24 Protokinetix Inc. Use of anti-aging glycoprotein for enhancing survival of neurosensory precursor cells
US11826387B2 (en) 2016-01-27 2023-11-28 Protokinetix Inc. Use of anti-aging glycoprotein for enhancing survival of neurosensory precursor cells

Also Published As

Publication number Publication date
AU3964799A (en) 1999-11-16

Similar Documents

Publication Publication Date Title
Sawamoto et al. Generation of dopaminergic neurons in the adult brain from mesencephalic precursor cells labeled with a nestin-GFP transgene
Canola et al. Retinal stem cells transplanted into models of late stages of retinitis pigmentosa preferentially adopt a glial or a retinal ganglion cell fate
Ladurner et al. Spatial distribution and differentiation potential of stem cells in hatchlings and adults in the marine platyhelminth Macrostomum sp.: a bromodeoxyuridine analysis
Klassen et al. Isolation of retinal progenitor cells from post‐mortem human tissue and comparison with autologous brain progenitors
USRE37978E1 (en) Myocardial grafts and cellular compositions
US8268302B2 (en) Cultures, products and methods using umbilical cord matrix cells
EP1261357B1 (fr) Isolation et transplantation de cellules souches retiniennes
US6015671A (en) Myocardial grafts and cellular compositions
JP4371179B2 (ja) 系列限定ニューロン前駆体
US7785882B2 (en) Neuronal progenitor cells from hippocampal tissue and a method for isolating and purifying them
Lu et al. Transplantation of EGF-responsive neurospheres from GFP transgenic mice into the eyes of rd mice
JPH08509215A (ja) 移植治療のための神経由来胎児セルラインの使用
Reh et al. Retinal stem cells
NO324411B1 (no) Anvendelse av isolerte mulitipotente nervestamceller som prolifererer i et kulturmedium for fremstilling av et cellepreparat for a oppna remyelinering av et demyelinert akson in vivo.
JP2003506076A (ja) トリ始原生殖細胞を使用して、未分化のトリ細胞培養物を取得する方法
JP2006122045A (ja) 細胞株
Sinclair et al. Dopamine cells in nigral grafts differentiate prior to implantation
US6214334B1 (en) Compositions and methods for producing and using homogenous neuronal cell transplants to treat neurodegenerative disorders and brain and spinal cord injuries
WO2003089631A1 (fr) Procede de propagation de cellules embryonnaires et/ou de cellules progenitrices
JP2002518043A (ja) 上衣神経幹細胞とその分離方法
Yan et al. Photoreceptor-like cells in transgenic mouse eye
US20220354896A1 (en) Compositions and methods for the treatment of retinal degeneration
WO1999055838A1 (fr) Compositions et procedes permettant de caracteriser et de transplanter des cellules souches retiniennes prelevees sur un mammifere
US20230272339A1 (en) Compositions and methods for cellular component transfer therapy
JPH11508142A (ja) 不死化網膜細胞系およびその適用

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase

Ref country code: KR

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase