WO1999052552A1 - T cell inhibitory receptor compositions and uses thereof - Google Patents
T cell inhibitory receptor compositions and uses thereof Download PDFInfo
- Publication number
- WO1999052552A1 WO1999052552A1 PCT/US1999/008430 US9908430W WO9952552A1 WO 1999052552 A1 WO1999052552 A1 WO 1999052552A1 US 9908430 W US9908430 W US 9908430W WO 9952552 A1 WO9952552 A1 WO 9952552A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- killer
- biliary glycoprotein
- fragment
- ligand
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
Definitions
- the invention relates to compositions which bind T cell inhibitory receptor molecules and modulate T cell activity.
- ilEL human intestinal intraepithelial lymphocytes
- IEC intestinal epithelial cell
- TCR ⁇ -T cell receptors
- ilELs are memory cells which localize to the basolateral surface of IECs for the recognition of a limited number of antigens in the context of major histocompatibility complex (MHC) class I or class I-like molecules on the IEC.
- MHC major histocompatibility complex
- ilELs in mouse and human are CD28' suggesting that other costimulatory molecules for TCR/CD3 complex-mediated activation may be important in providing necessary secondary signals for ilEL activation (Gelfanov et al., J. Immunol, 155:76-82, 1995; Gramzinski et al., Int. Immunol. 5:145-153, 1993; Russell et al., J.
- Candidate costimulatory molecules for human ilELs include CD2 (Ebert, Gastroenterology, 97:1372-1381, 1989), CD101 (Russell et al., 1996), BY-55 (Anumanthan et al., J.Immunol, 161:2780-2790, 1998) and ⁇ E ⁇ 7 (Parker et al., Proc. Natl. Acad. - 2 -
- T cells can express a variety of molecules that deliver an inhibitory signal such that either the initial activation of the T cell is prevented or the activated state is downregulated.
- the former include the killer inhibitory receptors (KIR) which are expressed on a subset of T cells and bind specific types of major histocompatibility complex (MHC) class I molecules on the target cells (Lanier et al., Immunology, 7:75-82, 1995).
- KIR killer inhibitory receptors
- MHC major histocompatibility complex
- CTLA-4 CD 152 which, when expressed after T cell activation, binds either CD80 (B7.1) or CD86 (B7.2) on antigen presenting cells (Walunas et al., J. Exp.
- inhibitory receptors characteristically contain immunoglobulin-like domains extracellularly and one or more immune receptor tyrosine-based inhibitory motifs (ITIM) in their cytoplasmic tails which consists of the consensus sequence I/L/VxYxxL/V (Vely et al., J Immunol, 159:2075-2077, 1997).
- ITIM immune receptor tyrosine-based inhibitory motifs
- CTLA-4 the ITIM is slightly modified to GxYxxM (Cambier, Proc. Natl Acad. Set, 94:5993-5995, 1997).
- ITIM-containing receptors function in the recruitment of either the Src homology domain- containing protein tyrosine phosphatases, SHP-1 and SHP-2, or the SH2 domain-containing inositol polyphosphate 5-phosphatase, SHIP (Isakov, Immunol Res., 16:85-100, 1997).
- These phosphatases function in the dephosphorylation of signaling molecules recruited by immune receptor tyrosine-based activation motif (ITAM) bearing receptors like those contained in the CD3- ⁇ , ⁇ , e and ⁇ chains that associate with the TCR.
- ITAM immune receptor tyrosine-based activation motif
- ITIM bearing receptors on T cells are predicted to downregulate activation events elicited by ITAM bearing receptors if both are ligated in close proximity to one another.
- CTLA-4 nor CD80/CD86 have been observed on human ilELs or IECs of the small intestine, respectively.
- BGP biliary glycoprotein
- C-CAM carcinoembryonic antigen family
- methods for enhancing specifically the - 3 - cytotoxicity or proliferation of killer T cells in a subject include administering to a subject in need of such treatment an agent that selectively reduces cross- linking of biliary glycoprotein polypeptides in an amount effective to enhance the cytotoxicity or proliferation of killer T cells in the subject.
- the agent is an antibody or antibody fragment which binds only a single biliary glycoprotein polypeptide.
- Preferred antibody fragments include Fab fragments.
- the agent comprises a ligand for the biliary glycoprotein polypeptide, wherein the ligand binds only a single biliary glycoprotein polypeptide.
- the ligand is fused to an immunoglobulin molecule or a fragment thereof, or is a soluble biliary glycoprotein molecule or fragment thereof.
- methods for suppressing specifically the cytotoxicity or proliferation of killer T cells in a subject include administering to a subject in need of such treatment an agent that selectively increases cross- linking of biliary glycoprotein polypeptides in an amount effective to suppress the activity of killer T cells in the subject.
- the agent is an antibody, preferably a monoclonal antibody.
- the agent comprises a ligand for the biliary glycoprotein polypeptide which binds two or more biliary glycoprotein polypeptides.
- the ligand is fused to an immunoglobulin molecule or a fragment thereof, or the ligand includes a biliary glycoprotein polypeptide or fragment thereof.
- a composition is provided.
- the composition includes an agent that selectively reduces cross-linking of biliary glycoprotein polypeptides in an amount effective to enhance cytotoxicity or proliferation of killer T cells in a subject, and a pharmaceutically-acceptable carrier.
- the agent is an antibody or antibody fragment which binds only a single biliary glycoprotein molecule.
- Preferred antibody fragments include Fab fragments.
- the agent comprises a ligand for the biliary glycoprotein polypeptide which binds only a single biliary glycoprotein polypeptide.
- a ligand is fused to an immunoglobulin molecule or a fragment thereof.
- ligand is biliary glycoprotein or a fragment thereof.
- the compositions are pharmaceutical compositions.
- a composition which includes an agent that selectively increases cross-linking of biliary glycoprotein polypeptides in an amount effective to suppress cytotoxicity or proliferation of killer T cells in a subject.
- the composition also include a pharmaceutically-acceptable carrier.
- the agent - 4 - is an antibody, preferably a monoclonal antibody.
- the agent includes a ligand for the biliary glycoprotein polypeptide which binds two or more biliary glycoprotein polypeptides.
- the ligand is fused to an immunoglobulin molecule or a fragment thereof.
- the ligand is biliary glycoprotein or a fragment thereof.
- the compositions are pharmaceutical compositions.
- methods for enhancing specifically the cytotoxicity or proliferation of killer T cells include contacting a population of killer T cells with an agent that selectively reduces cross-linking of biliary glycoprotein polypeptides in an amount effective to enhance the cytotoxicity or proliferation of the killer T cells.
- the biliary glycoprotein binding agents are as described above in methods for enhancing killer T cell activity in a subject.
- methods for suppressing specifically cytotoxicity or proliferation of killer T cells include contacting a population of killer T cells with an agent that selectively increases cross-linking of biliary glycoprotein polypeptides in an amount effective to suppress the cytotoxicity or proliferation of the killer T cells.
- the biliary glycoprotein binding agents are as described above in methods for suppressing killer T cell activity in a subject.
- an isolated fusion protein includes a biliary glycoprotein polypeptide or a fragment thereof fused to an immunoglobulin molecule or a fragment thereof.
- the components of the fusion protein can be fused directly, or a linker molecule such as a peptide can be interposed between the biliary glycoprotein component and the immunoglobulin component.
- Other polypeptides can be substituted for the immunoglobulin component as will be apparent to one of ordinary skill in the art.
- biliary glycoprotein (or fragment thereof) component of the fusion protein selectively binds a monoclonal antibody selected from the group consisting of 34B 1 , 5F4 and 26H7.
- the fragment of biliary glycoprotein is selected from the group consisting of the N-domain of CD66a, NA1B1 domains of CD66a, the NA1B1A2 domains of CD66a.
- the fragment of the immunoglobulin molecule preferably is the Fc portion of the immunoglobulin molecule.
- an isolated fusion protein is provided which includes two or more biliary glycoprotein polypeptides, or fragments thereof which bind biliary glycoprotein.
- the fusion protein is useful for selecting biliary glycoprotein binding agents which - 5 - bind two (or more) biliary glycoprotein molecules, particularly those agents which cross-link biliary glycoprotein molecules.
- methods for identifying compounds which enhance or suppress killer T cell activity include contacting a population of killer T cells which express biliary glycoprotein with a compound that binds biliary glycoprotein, and determining the cytotoxicity or proliferation of the population of killer T cells relative to a control.
- Compounds which increase the cytotoxicity or proliferation are compounds which enhance the killer T cell activity, and compounds which decrease the cytotoxicity or proliferation are compounds which suppress the killer T cell activity.
- the methods includes the steps of providing a biliary glycoprotein polypeptide or a fragment thereof, contacting the biliary glycoprotein polypeptide or a fragment thereof with a compound, and determining the binding of the compound to the biliary glycoprotein polypeptide or a fragment thereof.
- the compound is used in the foregoing methods for testing the increase or decrease of killer T cell cytotoxicity or proliferation.
- methods for selectively treating a subject having a condition characterized by aberrant killer T cell activity are provided. The methods include administering to a subject in need of such treatment a pharmacological agent which is selective for biliary glycoprotein, in an amount effective to normalize the aberrant killer T cell activity.
- preferred killer T cells include CD4 + T cells, CD8 + T cells, NK cells, intestinal intraepithelial lymphocytes and peripheral blood T cells. Particularly preferred killer T cells are CD8 + T cells.
- compositions related to immune system function including autoimmune disease, cancer and transplantation.
- Fig. 1 depicts identification of three mAbs (34B1, 5F4 and 26H7) which recognize IECs but not resting ilELs.
- Fig. 2 shows that ilELs and PBTs express an antigen that is recognized by the 34B1, 5F4 and 26H7 mAbs after activation. - 6 -
- Fig. 3 shows that the N-domain of BGP is the cognate antigen of the 34B1 -related mAbs.
- Fig. 4 shows that the 34B1 -related mAbs specifically immunoprecipitate BGP on COS cell transfectants and activated ilELs.
- Fig. 5 depicts the specificity of the anti-BGP mAbs for other CD66 family members.
- Fig. 6 shows an analysis of CD66 isoform expression by activated human ilELs.
- Fig. 7 depicts inhibition of anti-CD3 directed and lymphokine activated killer activity of ilELs by anti-BGP antibodies.
- Fig. 8 shows inhibition of human allo-mixed lymphocyte reaction by anti-BGP monoclonal antibodies.
- Human biliary glycoprotein is a member of the CEA family of glycoproteins, part of the immunoglobulin supergene family, and encoded in a large cluster on chromosome 19 (Watt et al., Blood, 84:200-210, 1994; Daniel et al., Int. J. Cancer, 55:303-310, 1993; Teixeira et al, Blood, 84:211-219, 1994; Teixeira, 1996; Barnett et al, Molec. Cell. Biol, 13:1273-1282, 1993).
- the CEA-cluster is highly related to the genetically linked, pregnancy specific gene cluster (Thompson et al, J. Clin. Lab Anal.
- CEA-subgroup of this family is serologically defined as CD66a (BGP or C-CAM), CD66b (CGM6), CD66c (NCA), CD66d (CGMl) and CD66e (CEA).
- BGP or C-CAM
- CD66b CD66b
- NCA CD66c
- CD66d CD66d
- CEA CD66e
- CGM6 and NCA which are linked to the membrane by a glycosyl phosphatidyl-inositol anchor
- CGMl and BGP are type 1 transmembrane glycoproteins. Both of the latter exist as isoforms containing short or long - 7 - cytoplasmic tails.
- Biliary glycoprotein and its mouse and rat homologues C-CAM (Rosenberg et al., Cancer Res., 53:4938-4945, 1993; Lin et al., J Biol Chem., 264:14408-14414, 1989; Obrink, BioEssays, 13:227-234, 1991), have been regarded mainly as molecules which function in cell- cell adhesion that are expressed primarily by epithelial cells of the gastrointestinal tract and biliary tree, neutrophils and, more recently, B cells.
- Biliary glycoprotein also serves as a receptor for mouse hepatitis virus (Williams et al, Proc. Natl. Acad.
- Biliary glycoprotein also exhibits a high degree of alternate transcriptional processing resulting in at least eight potential alternate transmembrane transcripts.
- BGPa and BGPb encode a long cytoplasmic tail of 67 amino acids containing two ITIM motifs which suggest a role as inhibitory receptors (Obrink, 1997). Indeed, this cytoplasmic tail, when tyrosine phosphorylated, is capable of binding SHP-1 in a mouse colon carcinoma cell line (Beauchemin et al., Oncogene, 783-790, 1996). Such interactions may account for the inhibitory growth effect of this molecule on epithelial cells.
- the studies contained herein describe the unexpected finding that, whereas biliary glycoprotein is constitutively expressed by IECs, it is an activation molecule on T cells adjacent to the epithelium.
- cytotoxicity which is a major function of ilELs, as a measure, it appears that biliary glycoprotein on activated ilELs functions as an inhibitory molecule for CD3 -directed cytotoxic activity. In this manner, biliary glycoprotein should be considered as a killer inhibitory receptor.
- a candidate ligand is biliary glycoprotein itself or another CD66 family member in view of the known homophilic and heterophilic interactions between the CD66 group members (Watt et al., 1994; Oikawa et al., - 8 -
- the invention involves the finding that molecules which bind to biliary glycoprotein (i.e., "biliary glycoprotein binding agents") on killer T cells, such as antibodies, can inhibit or enhance the activity of killer T cells, such as cytotoxicity and/or proliferation.
- “killer T cells” includes CD4 + T cells, CD8 + T cells, and NK cells.
- Biliary glycoprotein binding agents which increase cross-linking of biliary glycoprotein polypeptides increase the inhibitory signal of biliary glycoprotein, thereby suppressing the activity of killer T cells.
- Biliary glycoprotein binding agents which decrease cross-linking of biliary glycoprotein polypeptides decrease the inhibitory signal of biliary glycoprotein, thereby enhancing the activity of killer T cells.
- the invention also embraces molecules which enhance or suppress killer T cell activity but which do not function according to the cross-linking properties described above.
- a particular biliary glycoprotein binding agent which suppresses the activity of killer T cells may bind biliary glycoprotein and increase the inhibitory signal of biliary glycoprotein without increasing cross-linking (e.g., by inducing a conformational change in biliary glycoprotein).
- Modulation of killer T cell activity by molecules which bind biliary glycoprotein expressed on the surface of killer T cells is useful for specifically enhancing or suppressing an immune response in vivo, which may be useful for the treatment of conditions related to immune function including autoimmune disease, cancer, and transplantation (e.g., bone marrow or organs). Modulation of killer T cell activity also is useful in in vitro and/or non-therapeutic applications including determining whether T cells of a subject are functional (e.g.
- the molecules which bind biliary glycoprotein and modulate killer T cell activity include antibodies and fragments thereof, ligands for biliary glycoprotein, fragments thereof and fusion proteins containing ligands or other biliary glycoprotein binding molecules. Still other biliary glycoprotein binding agents can be identified by screening compounds for the ability to enhance or suppress killer T cell activity, using assays described herein and those assays of T cell activity which are standard in the art. Exemplary methods for preparing fusion proteins useful according to the invention for modulating killer T cell activity are described herein; additional exemplary methods for preparing such fusion proteins are described in U.S. Patent 5,434,131.
- the molecules which bind biliary glycoprotein can be used alone as a primary therapy or in combination with other therapeutics as a combination therapy to enhance the therapeutic benefits of other medical treatments.
- the invention also involves agents which bind to biliary glycoprotein and/or fragments of the biliary glycoprotein and induce or suppress killer T cell activity.
- binding agents can be used in screening assays to detect the presence or absence of a biliary glycoprotein polypeptide, the presence or location of ilELs and in purification protocols to isolate ilELs and other killer T cells which express biliary glycoprotein.
- binding agents can be used to selectively target drugs, toxins or other molecules to killer T cells which express biliary glycoprotein. In this manner, killer T cells which express biliary glycoprotein can be treated with cytotoxic compounds, thereby reducing unwanted immune responses.
- the biliary glycoprotein binding agents useful according to the invention are isolated agents.
- isolated means that the agents are substantially pure and are essentially free of other substances with which they may be found in nature or in vivo systems to an extent practical and appropriate for their intended use.
- the agents are sufficiently pure and are sufficiently free from other biological constituents of their hosts cells so as to be useful in, for example, producing pharmaceutical preparations.
- an isolated biliary glycoprotein binding agent may be admixed with a pharmaceutically acceptable carrier in a pharmaceutical preparation, the biliary glycoprotein binding agents may comprise only a small percentage by weight of the preparation.
- a biliary glycoprotein binding agent is nonetheless substantially pure in that it has been substantially separated from the substances with which it may be associated in living systems.
- the biliary glycoprotein binding agent used in the - 10 - invention is an intact anti-biliary glycoprotein monoclonal antibody in an isolated form, preferably in a soluble form, or in a pharmaceutical preparation.
- An intact monoclonal antibody as is well known in the art, is an assembly of polypeptide chains linked by disulfide bridges. Two principle polypeptide chains, referred to as the light chain and heavy chain, make up all major structural classes (isotypes) of antibody. Both heavy chains and light chains are further divided unto subregions referred to as variable regions and constant regions.
- the term "monoclonal antibody” refers to a homogenous population of immunoglobulins which specifically bind to an epitope (i.e. antigenic determinant) of human biliary glycoprotein.
- the invention includes the use of antibodies or fragments of antibodies having the ability to selectively bind to biliary glycoprotein, particularly as expressed on the cell surface of killer T cells, such as intestinal intraepithelial lymphocytes and activated peripheral blood lymphocytes.
- Antibodies include polyclonal and monoclonal antibodies, prepared according to conventional methodology. Examples include the monoclonal antibodies 34B 1 , 5F4 and 26H7 described in the Examples. Additional antibodies which are reactive with biliary glycoprotein, particularly those raised against biliary glycoprotein expressed on killer T cells, can be prepared according to standard methods.
- Antibodies can be prepared by any of a variety of methods, including administering protein, fragments of protein, cells expressing the protein or fragments thereof and the like to an animal to induce polyclonal antibodies.
- the production of monoclonal antibodies is according to techniques well known in the art. As detailed herein, such antibodies may be used, for example, to identify tissues expressing protein or to purify protein.
- Antibodies also may be coupled to specific labeling agents for imaging or to cytotoxic agents, including, but not limited to, methotrexate, radioiodinated compounds, toxins such as ricin, other cytostatic or cytolytic drugs, and so forth.
- an antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region designated an F(ab') 2 fragment, retains both of the antigen binding sites of an intact antibody.
- an antibody from which - 1 1 - the Fc region has been enzymatically cleaved, or which has been produced without the Fc region designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule.
- Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd.
- the Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitope- binding ability in isolation.
- CDRs complementarity determining regions
- FRs framework regions
- CDRl through CDR3 complementarity determining regions
- the present invention also provides for F(ab') 2 , Fab, Fv and Fd fragments; chimeric antibodies in which the Fc and/or FR and/or CDRl and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric F(ab') 2 fragment antibodies in which the FR and/or CDRl and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric Fab fragment antibodies in which the FR and/or CDRl and/or CDR2 and/or light chain CDR3 regions have been replaced by homologous human or non- human sequences; and chimeric Fd fragment antibodies in which the FR and/or CDRl and/or - 12 -
- the present invention also includes so-called single chain antibodies.
- the invention involves polypeptides of numerous size and type that bind specifically to biliary glycoprotein. These polypeptides may be derived also from sources other than antibody technology.
- polypeptide binding agents can be provided by degenerate peptide libraries which can be readily prepared in solution, in immobilized form or as phage display libraries.
- Combinatorial libraries also can be synthesized of peptides containing one or more amino acids. Libraries further can be synthesized of peptoids and non-peptide synthetic moieties.
- Phage display can be particularly effective in identifying binding peptides useful according to the invention, using methods such as those described in Hart et al., J. Biol. Chem. 269:12468 (1994). Briefly, one prepares a phage library (using e.g. ml3, fd, or lambda phage), displaying inserts from 4 to about 80 amino acid residues using conventional procedures. The inserts may represent a completely degenerate or biased array. One then can select phage- bearing inserts which bind to biliary glycoprotein or a fragment thereof. This process can be repeated through several cycles of reselection of phage that bind to biliary glycoprotein or a fragment thereof.
- biliary glycoprotein can be used to screen peptide libraries, including phage display libraries, to identify and select peptide biliary glycoprotein binding agents for modulating killer T cell activity.
- the biliary glycoprotein binding agents are characterized as to their ability to cross-link biliary glycoprotein.
- binding molecules can also be used, as described, for screening assays, for diagnostic assays, for purification protocols or for targeting drugs, toxins and/or labeling agents (e.g. radioisotopes, fluorescent molecules, etc.) to cells, especially killer T cells, which express biliary glycoprotein on the cell surface.
- Drug molecules that would disable or destroy cells which express such biliary glycoprotein or a fragment thereof are known to those skilled in the art and are commercially available.
- the immunotoxin art provides examples of toxins which are effective when delivered to a cell by an antibody or fragment thereof.
- toxins include ribosome-damaging toxins derived from plants or bacterial such as ricin, abrin, - 13 - saporin, Pseudomonas endotoxin, diphtheria toxin, A chain toxins, blocked ricin, etc.
- polypeptides including those containing the biliary glycoprotein binding fragment (CDR3 region) may easily be synthesized or produced by recombinant means to produce a biliary glycoprotein binding agent useful according to the invention. Such methods are well known to those of ordinary skill in the art. Peptides can be synthesized for example, using automated peptide synthesizers which are commercially available. The peptides can be produced by recombinant techniques by incorporating the DNA expressing the peptide into an expression vector and transforming cells with the expression vector to produce the peptide.
- the sequence of the CDR regions, for use in synthesizing peptide biliary glycoprotein binding agents, may be determined by methods known in the art.
- the heavy chain variable region is a peptide which generally ranges from 100 to 150 amino acids in length.
- the light chain variable region is a peptide which generally ranges from 80 to 130 amino acids in length.
- the CDR sequences within the heavy and light chain variable regions which include only approximately 3-25 amino acid sequences may easily be sequenced by one of ordinary skill in the art.
- the peptides may even be synthesized by commercial sources.
- any known binding assay may be employed.
- the peptide may be immobilized on a surface and then contacted with labeled biliary glycoprotein.
- the amount of biliary glycoprotein which interacts with the peptide or the amount which does not bind to the peptide may then be quantitated to determine whether the peptide binds to biliary glycoprotein.
- a surface having the aforementioned anti-biliary glycoprotein monoclonal antibodies immobilized thereto may serve as a positive control.
- Screening of biliary glycoprotein binding agents also can be carried out utilizing a competition assay. If the biliary glycoprotein binding agent being tested competes with an anti- biliary glycoprotein monoclonal antibody, as shown by a decrease in binding of the monoclonal antibody, then it is likely that the agent and the anti-biliary glycoprotein monoclonal antibody bind to the same, or a closely related, epitope.
- Still another way to determine whether an agent has the specificity of the anti-biliary glycoprotein monoclonal antibodies described above is to pre-incubate the monoclonal antibody with biliary glycoprotein with which it is normally reactive (i.e., binds), and then add the agent being tested to determine if the agent being tested is inhibited in its ability to bind biliary glycoprotein. If the agent being tested is inhibited then, in all likelihood, it has the same or a functionally equivalent epitope and specificity as the anti- - 14 - biliary glycoprotein monoclonal antibodies.
- a biliary glycoprotein binding agent is useful according to the invention by determining whether the agent is one which modulates killer T cell proliferation or cytotoxicity in an in vitro assay such as measuring release of TNF from killer T cells or by 51 Cr release assay (see, e.g., Herin et al, Int. J. Cancer 39:390-396, 1987). Other assays are described in the Examples and elsewhere herein.
- polypeptides e.g. antibodies
- other biliary glycoprotein binding agents described above can also be used immunotherapeutically for killer T cell sensitive disorders in humans.
- immunotherapeutically or “immunotherapy” as used herein in conjunction with the biliary glycoprotein binding agents denotes both prophylactic as well as therapeutic administration.
- the peptides can be administered to high-risk subjects in order to lessen the likelihood and/or severity of a killer T cell sensitive disease, such as a tumor, transplant rejection or autoimmune disease, or administered to subjects already evidencing such diseases.
- the invention encompasses methods for modulating specifically the cytotoxicity or proliferation of killer T cells in situ.
- the method includes administering to a subject in need of such treatment an agent which binds selectively a biliary glycoprotein polypeptide in an amount effective to enhance or suppress the cytotoxicity or proliferation of the killer T cells in the subject.
- an agent which binds selectively a biliary glycoprotein polypeptide in an amount effective to enhance or suppress the cytotoxicity or proliferation of the killer T cells in the subject.
- the activity of killer T cells is subject to specific modulation because killer T cells express biliary glycoprotein.
- Methods for modulating specifically the cytotoxicity or proliferation of killer T cells also are provided wherein a population of killer T cells is contacted with a biliary glycoprotein binding agent. When a biliary glycoprotein binding agent is administered to a subject or contacted to a population of killer T cells, the inhibitory activity of biliary glycoprotein is modulated.
- Biliary glycoprotein binding agents which increase or decrease killer T cell activity can be selected using the assays described herein and according to standard killer T cell cytotoxicity and proliferation assays, such as mixed lymphocyte reactions, chromium release assays, TNF release assays, and thymidine incorporation assays.
- a monovalent biliary glycoprotein binding agent will inhibit the inhibitory signal of biliary glycoprotein by reducing cross-linking of biliary glycoprotein polypeptides expressed by killer T cells, and that a multivalent biliary glycoprotein binding agent (having two or more biliary glycoprotein binding sites) will increase the inhibitory signal of biliary glycoprotein in killer T cells by increasing cross-linking of biliary glycoprotein - 15 - polypeptides expressed by killer T cells.
- the term "in situ" encompasses and includes the terms in vivo, ex vivo and in vitro.
- the compositions of the invention are useful for many in vitro purposes.
- the compositions of the invention are useful for screening compounds which inhibit killer T cell proliferation or cytotoxicity.
- Such a screening assay may be performed in vitro by setting up cell proliferation or cytotoxicity assays including a biliary glycoprotein binding agent which increases killer T cell proliferation or cytotoxicity and a population of killer T cells.
- Potential killer T cell proliferation or cytotoxicity inhibitors may be added to the mixture and the effect on proliferation or cytotoxicity may be measured.
- Agents which increase proliferation or cytotoxicity of killer T cell can be screened using similar assays.
- Ex vivo uses include, for example, the stimulation of proliferation or cytotoxicity of killer T cells which have been removed from a mammalian subject and which are subsequently returned to the body of the mammalian subject.
- the present invention also includes methods for treating a condition characterized by aberrant killer T cell activity, such as cytotoxicity or proliferation.
- the methods involve the step of administering to a subject having such a condition a pharmacological agent which selectively binds biliary glycoprotein and modulates a killer T cell activity, in an amount effective to increase or decrease T-cell proliferation or cytotoxicity.
- a "condition characterized by aberrant killer T cell activity" as used herein is any condition associated with adverse physiological consequences in which an increase or decrease of killer T cell function, embodied by an increase or decrease in killer T cell proliferation or cytotoxicity, results in an improvement of the adverse physiological consequences.
- Such conditions include disorders of the immune system, such as immunodeficiency, auto immunity and transplant rejection, as well as disorders involving undesirable cellular invasion by microorganisms or undesirable cell growth such as tumors.
- an "effective amount" of a biliary glycoprotein binding agent is an amount which is - 16 - sufficient to modulate (increase or decrease) biliary glycoprotein inhibitory function, resulting in a modulation of killer T cell proliferation or cytotoxicity. Modulating biliary glycoprotein inhibition of killer T cell activity is sufficient to produce the desired effect in which the symptoms associated with the conditions characterized by aberrant killer T cell activity are ameliorated or decreased.
- an effective amount of the peptide is a therapeutically effective amount for modulating killer T cell proliferation or cytotoxicity in vivo.
- a therapeutically effective amount may vary with the subject's age, condition, weight and gender, as well as the extent of the disease in the subject and can be determined by one of skill in the art as a matter of routine experimentation. The dosage may be adjusted by the individual physician in the event of any complication.
- a therapeutically effective amount typically will vary from about 0.01 mg/kg to about 500 mg/kg, were typically from about 0.1 mg/kg to about 200 mg/kg, and often from about 0.2 mg/kg to about 20 mg/kg, in one or more dose administrations daily, for one or several days (depending of course of the mode of administration and the factors discussed above).
- One of skill in the art can determine what an effective amount of a biliary glycoprotein binding agent is by determining the ability of the agent to modulate killer T cell proliferation or cytotoxicity in an in vitro assay.
- Exemplary assays for measuring the ability of a biliary glycoprotein binding agent to modulate killer T cell proliferation or cytotoxicity are provided in the Examples and have been discussed above.
- the exemplary assays are predictive of the ability of a biliary glycoprotein binding agent to modulate killer T cell activity in vivo and/or ex vivo and, hence, can be used to select agents for therapeutic applications.
- a biliary glycoprotein binding agent may be administered in a pharmaceutically acceptable composition.
- pharmaceutically-acceptable carriers for antibodies, antibody fragments, and other biliary glycoprotein binding agents are well-known to those of ordinary skill in the art.
- a pharmaceutically-acceptable carrier means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients, i.e., the ability of the agent to modulate killer T cell activity.
- Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers and other materials which are well-known in the art.
- compositions which are formulated for local administration, such as by implants.
- the agents can be administered by injection, by gradual infusion over time or by any other medically acceptable mode.
- the administration may, for example, be intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous or transdermal.
- Preparations for parenteral administration includes sterile aqueous or nonaqueous solutions, suspensions and emulsions.
- nonaqueous solvents are propylene glycol, polyethylene glycol, vegetable oil such as olive oil, an injectable organic esters such as ethyloliate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like. Those of skill in the art can readily determine the various parameters for preparing these alternative pharmaceutical compositions without resort to undue experimentation.
- the methods of the invention also encompass administering biliary glycoprotein binding agents in conjunction with conventional therapies for treating immune system disorders.
- the methods of the invention may be practiced simultaneously with conventional treatments.
- the particular conventional treatment depends, of course, on the nature of the disorder.
- a conventional mode of treatment is chemotherapy.
- the agents of the invention which increase killer T cell activity e.g., decrease biliary glycoprotein inhibitory activity
- Other immune system diseases can be treated concurrently with the biliary glycoprotein binding agents described herein and other molecules which bind T cells and affect T cell function, such as CTLA4Ig fusion proteins, as described in U.S. Patent 5,434,131.
- Antibodies The 34B1, 26H7 and 5F4 monoclonal antibodies (mAbs) were produced by immunizing BALB/c mice with the activated human mucosal lymphocyte line, 19 IE, as previously described (Russell et al., 1996). Three intraperitoneal injections and a final intravenous injection of 5 x 10 6 lymphocytes were given at two-week intervals. Three days after the intravenous immunization, splenocytes were isolated and fused with NS 1 murine myeloma cells in the presence of PEG (m.w. 1450) as described previously.
- PEG m.w. 1450
- Hybridomas were selected with aminopterin-containing medium, and hybridoma supernatants were screened by indirect immunoperoxidase staining of frozen intestinal and tonsillar tissue sections. Positive hybridomas were subcloned twice by limiting dilution, and ascites containing the antibody was produced by intraperitoneal injection of the hybridoma cells into pristane-treated BALB/c mice.
- the isotypes of 34B1 (IgGl), 26H7 (IgGl) and 5F4 (IgGl) were determined by ELISA using murine isotype-specific mAb (Boehringer Mannheim, Indianapolis, IN).
- W6/32 is a mouse IgG2a mAb specific for human MHC class I (kindly provided by Dr. Jack Strominger, Dana- Farber Cancer Institute, Boston, MA).
- OKT3 IgG2a is a mouse anti-human CD3 mAb (kindly provided by Dr. Robert Finberg, Dana-Farber Cancer Institute, Boston, MA).
- TS2/18 (kindly provided by Dr. Llyod Lanestein, Brigham and Women's Hospital) is an anti-CD2 mAb (mouse IgG2a).
- OKT11 (kindly provided by Dr. Ellis Reionherz, Dana-Farber Cancer Institute) is an anti-CD2 mAb (mouse IgG29).
- OKT4 and OKT8 are mouse IgG2a mAbs specific for human CD4 and CD8- ⁇ , respectively (obtained from American Type Culture Collection, Bethesda, MD).
- UCHT1 directly conjugated to phycoerythrin, is a mouse IgGl mAb specific for human CD3-e (Dako, Denmark).
- the MA22 (CD66a; clone YG-C94G7; IgGl), MA26 (CD66a; clone 4.3.17; IgGl), MA27 (CD66e; clone 26/5/1; IgG2a), MA28 (CD66e; clone 26/3/13; IgGl), MA30 (CD66c; clone 9A6; IgGl), MA41 (CD66b; clone BIRMA17c; IgGl), MA61 (CD66b; clone 80H3; IgGl), MA76 (CD66ae; clone 12-140-4; IgGl), MA79 (CD66b; clone B13.9; IgGl), MA81 (CD66b; clone G10F5; IgGl), MA83 (CD66e; clone b7.8.5; IgGl), MA84 (CD66de; clone COL-1; IgG2
- the isotype matched mouse IgGl negative control mAb was purchased from Kakopatts (Copenhagen, Denmark) or Cappel (West Chester, PA). mAbs were purified by affinity purification and protein-A or G sepharose columns by standard methods. - 19 -
- PBMC Peripheral blood mononuclear cells
- PHA-P phytohemagglutin-P
- Human ilEL cell lines EEI-10 (small intestine), EEI-5 (small intestine) and CLI (large intestine) were generated as previously described (Christ et al, Immunol Let, 58:159-165, 1997) and maintained by stimulation with 1 ⁇ g/ml PHA-P cells in RPMI-1640 containing 10% human serum (type AB, Sigma, St. Louis, MO), 5 units/ml rIL-4 (Genzyme, Cambridge, MA) and 2 nM rIL-2 (a kind gift from Ajinomoto Co., Ltd., Japan) and irradiated PBMC as feeder cells.
- HT29 is a human intestinal epithelial cell (IEC) line obtained from the ATCC.
- COS is a monkey kidney fibroblast cell line. These latter cell lines were maintained in RPMI-1640 containing 10% heat-inactivated fetal calf serum (Gibco), penicillin and streptomycin, nonessential amino acids and 10 mM HEPES (complete medium) at 37°C in 5% CO 2 .
- Transfectants The BGPx' molecule was constructed as follows.
- the N terminal domain and the transmembrane/ cytoplasmic domains of human BGPc were each amplified separately by PCR with the primer pairs BGPAMP-S: caucaucaucauaagcttatggggcacctc (SEQ ID NO:l) and NTM- AS: gccattttcttggggcabctccgggtatac (SEQ ID NO:2); NTM-S: gtatacccggagctgccccaagaaaatggc (SEQ ID NO:3) and BGPTRANS-CYT-AS: cuacuacuacuaagactatgaagttggttg (SEQ ID NO:4), respectively, where the NTM primers were hybrids of the 3' end of the N terminal domain and the 5' end of the transmembrane domain.
- the PCR reaction consisted of 5 ⁇ l lOxTaq buffer (10 mM Tris-HCl pH8.3, 50 mM KC1, 0.1% gelatin), 3 ⁇ l 1.5 mM MgCl 2 , l ⁇ l 200 ⁇ M of each dNTP, 1 ⁇ M of each primer, 1 Unit Taq polymerase and 1 ⁇ g cDNA in a final volume of 50 ⁇ l.
- the PCR reaction was carried out at conditions of 94°C for 10 min, followed by 25 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min, plus a final extension time of 10 min at 72°C.
- PCR products After passing the PCR products through S-300 columns, 5 ⁇ l of each PCR product were used in a second PCR. After the PCR products had annealed, the BGP AMP and TRANS-CYT AS primers were added to the reaction mix and the PCR reaction carried out as described above. The resulting PCR product was cloned into the pAMP 1 vector using the CloneAMP system as detailed by the manufacturer (Gibco- BRL, Gaithersburg, MD), transformed into DH5 ⁇ competent bacteria and positive transformants selected by PCR. The resulting BGPx' cDNA was extracted and sequenced by standard - 20 - methods.
- the BGPx' cDNA was digested with EcoRI and Notl restriction enzymes and subcloned into the pcDNAl/Amp vector (Invitrogen, Carlsbad, CA).
- the BGPx' cDNA in this vector and the pSV2neo plasmid were linearized with ⁇ Ti I and BamRl, respectively, and electroporated into CHO cells at a ratio of 15:1, selected in G418 and on the FACS cell sorter to create a stable CHO-BGPx' cell line as described earlier (Watt et al, 1994).
- Flow Cytometry For one color immunofluorescence, approximately lxlO 6 cells were stained with 1 ⁇ g of the primary mAb for 30 minutes on ice.
- PBS phosphate buffered saline
- WB bovine serum albumin
- WB sodium azide
- the cells were washed with WB and either examined fresh or resuspended in 1%) paraformaldehyde in PBS.
- the stained and fixed cells were analyzed on either an Epics V flow cytometer (Coulter, Hialeah, FL) or a FACSCalibur (Becton-Dickinson, Sunnyvale, CA). For two color immunofluorescence, staining was performed as described above except that after incubation with primary conjugate, the stained cells were blocked for 20 minutes in PBS containing 20%) normal mouse serum followed by incubation with a directly conjugated mAb.
- Immunohistochemistry Tissue samples were mounted in OCT compound (Ames Co., Elkart, IN), frozen in liquid nitrogen or in a cryostat and stored at -70°C.
- Frozen tissue sections 4 ⁇ m thick were fixed in acetone for 5 minutes, air dried, and stained by an indirect immunoperoxidase method (Canchis et al., Immunology, 80:561-569, 1994) using avidin-biotin- peroxidase complex (Vector Laboratories, Burlingame, CA) and 3-amino-9-ethylcarbazole (Aldrich Chemical Co., Inc., Milwaukee, WI) as the chromogen.
- avidin-biotin- peroxidase complex Vector Laboratories, Burlingame, CA
- 3-amino-9-ethylcarbazole Aldrich Chemical Co., Inc., Milwaukee, WI
- COS cell expression cloning A cDNA library was constructed in the pCDM8 vector using poly(A) + RNA from resting and activated human PBT and from NK cells in the vector pAEXF (Hall et al., Proc. Natl. Acad. Sci., 93:11780-11785, 1996). For the first round of selection, COS cells were transfected via the DEAE-Dextran procedure (Seed et al., Proc. Natl Acad. Set, 84:3365-3369, 1987) with 0.2 ⁇ g of library DNA per 100 mm dish.
- COS cells 96 hours after transient transfection, were removed nonnenzymatically from plastic Petri dishes and labeled with Na-[ 125 I] by the lactoperoxidase catalyzed method as previously described (Balk et al., Science, 265:259-262, 1994).
- radiolabeled cells were lysed in immunoprecipitation buffer (IPB) containing 150 mM sodium chloride, 50 mM Tris pH 7.8, 10 mM Iodoacetamide, 1 mM EDTA (1 mM PMSF and 1 ⁇ g/ml each of leupeptin, pepstatin, aprotinin, and chymostatin with 1%> Nonidet P40 as a detergent).
- IPB immunoprecipitation buffer
- Cells were lysed on ice for 30- 60 minutes followed by centrifugation at 14,000g for 15 minutes at 4°C. The supernatant from the centrifugation was then centrifuged at 100,000g at 4°C in a TL-100 ultracentrifuge.
- Immunprecipitates were then either treated with 1 unit of N-glycanase (Genzyme, Boston, MA) or mock treated at 37°C overnight and resuspended in Laemmli buffer containing reducing agents. Solubilized immunoprecipitates were then resolved in 12.5% polyacrylamide gels in the presence of SDS.
- Fc, NAIBI-Fc and NA1B1A2-Fc were transfected into COS cells and the secreted soluble protein purified on protein-A Sepharose as previously described (Watt et al., 1994; Teixeira et al., 1994).
- the effector cells Prior to addition of target cells, the effector cells were incubated for 20 minutes at room temperature with the OKT3 mAb (200 ng/ml of purified antibody) and/or 34B1, 26H7 or 5F4 mAbs (either 1:600 dilution of ascites or varying concentrations of purified antibody). After 5 hours, 100 ⁇ l of supernatant were removed for analysis in a ⁇ -counter (LKB Wallac Clini Gamma 1272, Finland). Spontaneous and maximal release were measured by incubating target cells with medium or 1% Nonidet-P40, respectively. Percent cytotoxicity was calculated using the formula (experimental release - spontaneous release) x 100/ (maximal release - spontaneous release).
- Example 1 Constitutive expression of the 34Bl-related antigen on the cell surface of normal - 23 - human IECs.
- Fig. 1 depicts identification of three mAbs (34B1, 5F4 and 26H7) which recognize IECs but not resting ilELs.
- Panels A-C show immunohistology of normal human large intestine stained with the 34B1 (panel A), 5F4 (panel B) and 26H7 (panel C) mAbs with binding detected by subsequent incubation with a goat anti-mouse horseradish peroxidase conjugated antibody as described in the Materials and Methods.
- the precipitated brown reaction product indicates specific staining on the enterocyte. [Magnification: 20X]. Staining with normal mouse serum was negative (data not shown).
- Example 2 The 34B1 -related antigen is an activation antigen on normal human ilELs and peripheral blood T Cells.
- ilEL cell lines expressed neoantigens that were shared with IECs were examined after in vitro cultivation with PHA-P.
- One color flow cytometry analysis was performed of an activated ilEL cell line derived from the small intestine, EEI-5, as described in Fig. 1.
- ilELs in situ and freshly isolated ilELs did not stain with the 34B1, 26H7 and 5F4 mAbs.
- all of the ilELs expressed the antigen recognized by these three mAbs Fig. 2A).
- Fig. 2B shows the two-color fluorescence analysis of normal PBTs, before and after three days of stimulation with 1 ⁇ g/ml PHA-P, with the 34B 1 , 5F4 and 26H7 mAbs after gating on the CD3- positive lymphocytes and after subtracting background staining with directly conjugated, isotype matched control antibody.
- the thick black line shows staining of PBTs without PHA-P stimulation and the thin black line (arrow) with PHA-P stimulation.
- the 34B1 -related antigen is an activation antigen on both normal human T cells in the intestinal epithelium and peripheral blood.
- Example 3 The 34Bl-related antigen is expressed on epithelial cells, B cells and granulocytes in a wide variety of organs.
- the 34B1 -related antigen was expressed by epithelial cells of the intestine and activated T cells. A limited organ survey of the distribution of this cellular expression was therefore examined.
- Table 1 the antigen(s) recognized by the 34B1, 26H7 and 5F4 mAbs were similarly expressed within a wide variety of tissues suggesting that the molecule(s) of interest had a functional role in diverse organ systems. All three mAbs consistently recognized an antigen on epithelial cells of the small and large intestine, biliary tree, kidney, skin and thymus. In addition, scattered granulocytes in several organs and cells within germinal centers of tonsils, which were consistent with B cells, also stained positive.
- Example 4 Identification of the 34Bl-related antigen as biliary glycoprotein (BGP).
- the 34B1 mAb was used to clone the cDNA which coded for the cognate antigen of the 34B1 mAb by COS cell expression cloning after transfection with a mixture of three cDNA libraries from resting and activated human PBTs and NK cells. These cDNA libraries were utilized because previous studies showed expression of the antigen recognized by the 34B1, 26H7 and 5F4 mAbs in these cell types.
- Transiently transfected COS cells were subjected to three rounds of immunoselection and panning with the 34B1 mAb. After the third round of panning, 17 of 50 random-selected E.
- coli transformants contained plasmids with a 3.3kb-insert. The inserts in these plasmids were - 26 - similar by restriction digest analysis. COS cells transfected with these plasmids were specifically stained with the 34B1 mAb. One of these plasmids, pPAN3.1, was selected for further characterization.
- This plasmid directed the translation, when transfected into COS cells, of a 120-kD glycoprotein which was specifically recognized by the 34B1 and 5F4 mAbs and that resolved as a major band of approximately 70-kD and several minor bands of lower molecular weight after digestion with N-glycanase (Fig. 4).
- BGPs are members of the immunoglobulin supergene family that consists of an N- terminal immunoglobulin V- (IgV) related domain, that is highly homologous to the N-domains of other carcinoembryonic antigen (CEA) or CD66 family members, followed by several IgC2- related domains Al and Bl , and the A2, Y or Z domains which are unique to BGP isoforms (Watt et al., 1994; Oikawa et al., 1992; Teixeira, 1994; Barnett et al, 1993; Thompson, 1991).
- IgV immunoglobulin V-
- Fig. 3 A is a schematic diagram of the Fc-fusion proteins used in the ELISA to test the mAbs as described in the Materials and Methods.
- Fc-fusion proteins containing the N, NA1B1 and NA1B1 A2 domains of CD66a or N-CAM (CD56) as a negative control were tested in an ELISA as described in the Materials and Methods with the 34B1, 5F4 and 26H7 mAbs in - 27 - comparison to the positive control antibodies, MA22, MA76 and MA26 (Fig. 3B).
- these studies confirmed the recognition of BGP (CD66a) by the three mAbs and showed that all three mAbs reacted with the N-domain.
- the three mAbs were tested for their ability to stain CHO cells stably transfected with several splice variants of BGP (BGPa, BGPc and BGPx') and HeLa cells transfected with other members of the CD66 serologic cluster including CD66b (CEA gene related member 1, CGMl), CD66c (CEA gene related member 6, CGM6), CD66d (Nonspecific cross reacting antigen, NCA) and CD66e (CEA).
- CD66b CEA gene related member 1, CGMl
- CD66c CEA gene related member 6, CGM6
- CD66d Nonspecific cross reacting antigen
- NCA Nonspecific cross reacting antigen
- FIG. 5 shows the flow cytometric analysis of BGPa, BGPc and BGPx' transfectants of CHO, and CEA, NCA, CCGM6 and CGMl transfectants of HeLa cells in comparison to the mock (Neo) transfectants after staining with either the 34B1, 5F4 and 26H7 mAbs or isotype matched IgGl antibody as a negative control. All transfectants were positively stained with control mAbs specific for the transfected cDNA (data not shown). Except for CGMl (CD66b), the 34B1 mAb stained all the CD66 family members tested including all of the CD66a splice variants.
- Example 5 ilELs express only CD66a isoform.
- Activated human ilELs were stained with a panel of mAbs that have been presented at the Sixth International Workshop on Monoclonal Antibodies and which are specific for all of the CD66 isoforms.
- the human ilEL cell line from small intestine, EEI-10 was stained 8 days after activation with a series of anti-CD66 mAbs as described in the Materials and Methods.
- Each panel shows an overlay of the CD66 specific mAbs with the staining obtained with normal mouse serum as a negative control. The specificity of the mAbs for the CD66 isoforms is indicated in the panels.
- Activated ilELs do not express any CD66 isoforms other than CD66a based upon staining with a large panel of mAbs specific for CD66a-e (mAbs MA27, MA28, MA30, MA41, MA61, MA76, 79, MA81, MA83, MA84, MA86 and MA91 (Fig. 6). - 28 -
- the reaction was stopped with 1 ml PBS containing lOmM Na 2 VO 3 (Sigma), the pellet incubated on ice for 30 minutes in 100 ⁇ l lysis buffer containing 0.2X PBS, lOO ⁇ M Na 2 VO 3 , 1 mM PMSF, 5 mM iodoacetamide and 20 ⁇ g/ml aprotinin and Laemmli buffer added with reducing agents.
- the lysates were boiled for 5 minutes, resolved by SDS-PAGE on a 10% gel, Western transferred to Immobilon filters, immunoblotted with the PY20 mAb (Zymed, San Francisco, CA) and developed with a horseradish peroxidase conjugated goat anti-mouse antibody (Zymed) and enhanced chemiluminescence.
- Cross-linking of CD3 with the OKT3 mAb in the presence of the 5F4 mAb in comparison to an isotype controlled antibody, resulted in a significant alteration in the kinetics and level of phosphorylation suggesting that a phosphatase was activated as a consequence of BGP cross-linking.
- Example 6 BGP functions as a killer inhibitory receptor for ilELs.
- BGP was expressed on activated ilELs as defined by staining with the BGP-specific mAbs, 34B1, 26H7 and 5F4 was unique and unexpected since BGP has previously been primarily viewed as a molecule expressed on epithelial cells and granulocytes and involved in cell-cell adhesion and regulation of epithelial cell growth.
- the cytoplasmic tail of the BGPa and BGPb splice variants, but not CD66b-e, contain two ITIM domains within the cytoplasmic tail separated by 21 amino acids raising the possibility that BGP might function as an inhibitory molecule on T cells (Beauchemin et al., 1996; Obrink, 1997).
- BGP antigen in order to define the role of the BGP antigen in T cell function, the effects of the three mAbs on the function of ilELs was examined.
- a major function of activated ilELs is as cytolytic effector cells. Therefore, the effects of the three mAbs on the cytolytic function of ilELs was examined in a redirected lysis assay, the results of which are depicted in Fig. 7.
- the anti-CD3 directed lysis (OKT3) of the KJ-3 ilEL cell line was examined as described in the Materials and Methods in the absence or presence of either - 29 - the CD66a specific mAbs, 5F4 or 26H7, or an isotype matched IgGl antibody at a concentration of 100.0 ⁇ g/ml at effector:target ratios of 100:1, 50:1 and 25:1.
- cytolysis in the absence of added antibodies (medium) and presence of the test antibodies alone are also shown.
- the standard error of the mean for each measurement is indicated.
- the data presented in Fig. 7 is representative of six experiments.
- an ilEL cell line, EEI- 10 derived from normal human small intestine, was examined in a redirected lysis assay with the P815 mouse mastocytoma cell line as a target cell, significant cytotoxicity was elicited with, but not without, anti-CD3 cross-linking using the OKT3 mAb (Fig. 7).
- the anti-CD3 directed cytolysis was not inhibited by a CD2-specific mAb, TS 2/18, which would be expected to inhibit CD58-like interactions with the P815 cell line, suggesting that the inhibition by the anti-CD66a mAbs was not likely due simply to an effect on adhesion.
- cross-linking of BGP inhibited the anti-CD3 directed cytolytic activity of ilELs.
- ilELs were harvested early after cytokine treatment, a significant amount of cytolysis was observed against the P815 cell line consistent with cytokine induced killer activity (lymphokine activated killer activity, LAK), a property previously described for ilEL.
- the ilEL cell line was exposed to the P815 cell line as target in the presence or absence of the BGP specific mAbs, a pool of the BGP specific mAbs or normal IgGl .
- the effects of the anti-BGP specific mAbs 34B1, 26H7 and 5F4 on cytolysis of the p815 cell line by the EEI- 10 ilEL cell line was examined at an effector target ratio of 25 : 1.
- the cytolysis of the p815 cell line was not affected by the irrelevant IgGl antibody at either 2 ⁇ g/ml or 6 ⁇ g/ml.
- the anti-BGP mAbs inhibited the cytolytic activity of the ilEL cell line by as much as 70% using the pool of mAbs at 2 ⁇ g/ml each, and up to 50% inhibition at doses of individual mAbs of 2 ⁇ g/ml, indicating the lymphokine activated killer activity of ilELs was also - 30 - subject to inhibition by the anti-BGP antibodies.
- Example 7 Anti-BGP antibodies can inhibit the BGP inhibitory signal in an allogenic mixed lymphocyte reaction.
- Human peripheral blood mononuclear cells donor A were irradiated (5000 Rads) and cococultivated with an equivalent number of nonirradiated peripheral blood mononuclear cells prepared by Ficoll-Hypaque gradient centrifugation at a total concentration of 2 X 10 5 cells per well of a 96-well U-bottom plate in a total volume of 200 ⁇ l in quadruplicate. After 96 hours, 0.5 ⁇ Ci of [ 3 H]-thymidine was added per well for 18 hours of incubation and the plates harvested and counted.
- the culture conditions contained no additives (medium) or various concentration of diluted ascites (mouse anti-human BGP monoclonal antibodies 34B1 and 5F4) or normal mouse serum.
- the experimental data depicted in Table II are representative of 5 experiments. The mean ⁇ SE is presented. The augmentation of T cell proliferation in the presence of anti- BGP antibodies is consistent with the inhibition of a BGP inhibitory signal.
- Table IT Allogeneic Mixed Lymphocyte Reaction
- Fig. 8 shows the results of similar experiments.
- Stimulator irradiated peripheral blood mononuclear cells
- responder nonirradiated peripheral blood mononuclear cells
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Transplantation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE69925909T DE69925909T2 (de) | 1998-04-15 | 1999-04-15 | T-zell inhibierende rezeptorzusammensetzungen sowie deren verwendung |
| CA002328725A CA2328725A1 (en) | 1998-04-15 | 1999-04-15 | T cell inhibitory receptor compositions and uses thereof |
| AT99918627T ATE298248T1 (de) | 1998-04-15 | 1999-04-15 | T-zell inhibierende rezeptorzusammensetzungen sowie deren verwendung |
| EP99918627A EP1073465B1 (en) | 1998-04-15 | 1999-04-15 | T cell inhibitory receptor compositions and uses thereof |
| JP2000543162A JP4843138B2 (ja) | 1998-04-15 | 1999-04-15 | T細胞阻害性受容体組成物およびその使用 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US8189598P | 1998-04-15 | 1998-04-15 | |
| US60/081,895 | 1998-04-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1999052552A1 true WO1999052552A1 (en) | 1999-10-21 |
Family
ID=22167103
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1999/008430 Ceased WO1999052552A1 (en) | 1998-04-15 | 1999-04-15 | T cell inhibitory receptor compositions and uses thereof |
Country Status (8)
| Country | Link |
|---|---|
| US (4) | US6852320B2 (https=) |
| EP (1) | EP1073465B1 (https=) |
| JP (2) | JP4843138B2 (https=) |
| AT (1) | ATE298248T1 (https=) |
| CA (1) | CA2328725A1 (https=) |
| DE (1) | DE69925909T2 (https=) |
| ES (1) | ES2246567T3 (https=) |
| WO (1) | WO1999052552A1 (https=) |
Cited By (82)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002012535A1 (en) * | 2000-08-07 | 2002-02-14 | Karolinska Innovations Ab | Use of anti-ceacam antibodies for stimulating b cells in the production of monoclonal antibodies or in immunotherapy |
| EP1400535A1 (en) * | 2002-09-11 | 2004-03-24 | The General Hospital Corporation doing business as Massachusetts General Hospital | Therapeutic anti-BGP (C-CAM1) antibodies and uses thereof |
| US6852320B2 (en) | 1998-04-15 | 2005-02-08 | The Brigham & Women's Hospital, Inc. | T cell inhibitory receptor compositions and uses thereof |
| WO2005058358A3 (en) * | 2003-12-17 | 2005-11-24 | Nalan Utku | Use of agents derived from ceacam1 for the treatment of inflammatory diseases |
| EP1780220A1 (en) * | 2005-11-01 | 2007-05-02 | Charité - Universitätsmedizin Berlin | Use of CEACAM8-specific substances for treating autoimmune diseases and a method for screening substances which induce apoptosis |
| EP1909827A4 (en) * | 2005-06-09 | 2010-03-10 | Gal Markel | MODULATION OF IMMUNITY AND CEACAM1 ACTIVITY |
| WO2013054331A1 (en) | 2011-10-11 | 2013-04-18 | Tel Hashomer Medical Research Infrastructure And Services Ltd. | Antibodies to carcinoembryonic antigen-related cell adhesion molecule (ceacam) |
| US8598322B2 (en) | 2009-04-30 | 2013-12-03 | Tel Hashomer Medical Research Infrastucture and Services Ltd. | Anti CEACAM1 antibodies and methods of using same |
| WO2014059251A1 (en) | 2012-10-12 | 2014-04-17 | The Brigham And Women's Hospital, Inc. | Enhancement of the immune response |
| WO2015075725A1 (en) | 2013-11-25 | 2015-05-28 | Ccam Biotherapeutics Ltd. | Compositions comprising anti-ceacam1 and anti-pd antibodies for cancer therapy |
| WO2015090230A1 (en) | 2013-12-19 | 2015-06-25 | Novartis Ag | Human mesothelin chimeric antigen receptors and uses thereof |
| WO2015138920A1 (en) | 2014-03-14 | 2015-09-17 | Novartis Ag | Antibody molecules to lag-3 and uses thereof |
| WO2015142675A2 (en) | 2014-03-15 | 2015-09-24 | Novartis Ag | Treatment of cancer using chimeric antigen receptor |
| WO2015157252A1 (en) | 2014-04-07 | 2015-10-15 | BROGDON, Jennifer | Treatment of cancer using anti-cd19 chimeric antigen receptor |
| WO2016014530A1 (en) | 2014-07-21 | 2016-01-28 | Novartis Ag | Combinations of low, immune enhancing. doses of mtor inhibitors and cars |
| WO2016014553A1 (en) | 2014-07-21 | 2016-01-28 | Novartis Ag | Sortase synthesized chimeric antigen receptors |
| WO2016025880A1 (en) | 2014-08-14 | 2016-02-18 | Novartis Ag | Treatment of cancer using gfr alpha-4 chimeric antigen receptor |
| WO2016040880A1 (en) | 2014-09-13 | 2016-03-17 | Novartis Ag | Combination therapies of alk inhibitors |
| WO2016044605A1 (en) | 2014-09-17 | 2016-03-24 | Beatty, Gregory | Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy |
| WO2016054555A2 (en) | 2014-10-03 | 2016-04-07 | Novartis Ag | Combination therapies |
| WO2016057705A1 (en) | 2014-10-08 | 2016-04-14 | Novartis Ag | Biomarkers predictive of therapeutic responsiveness to chimeric antigen receptor therapy and uses thereof |
| WO2016061142A1 (en) | 2014-10-14 | 2016-04-21 | Novartis Ag | Antibody molecules to pd-l1 and uses thereof |
| WO2016090034A2 (en) | 2014-12-03 | 2016-06-09 | Novartis Ag | Methods for b cell preconditioning in car therapy |
| WO2016100882A1 (en) | 2014-12-19 | 2016-06-23 | Novartis Ag | Combination therapies |
| WO2016126608A1 (en) | 2015-02-02 | 2016-08-11 | Novartis Ag | Car-expressing cells against multiple tumor antigens and uses thereof |
| WO2016164580A1 (en) | 2015-04-07 | 2016-10-13 | Novartis Ag | Combination of chimeric antigen receptor therapy and amino pyrimidine derivatives |
| WO2016168595A1 (en) | 2015-04-17 | 2016-10-20 | Barrett David Maxwell | Methods for improving the efficacy and expansion of chimeric antigen receptor-expressing cells |
| WO2016172583A1 (en) | 2015-04-23 | 2016-10-27 | Novartis Ag | Treatment of cancer using chimeric antigen receptor and protein kinase a blocker |
| WO2017015427A1 (en) | 2015-07-21 | 2017-01-26 | Novartis Ag | Methods for improving the efficacy and expansion of immune cells |
| US9556271B2 (en) | 2011-12-01 | 2017-01-31 | The Brigham And Women's Hospital, Inc. | Anti-CEACAM1 recombinant antibodies for cancer therapy |
| WO2017019894A1 (en) | 2015-07-29 | 2017-02-02 | Novartis Ag | Combination therapies comprising antibody molecules to lag-3 |
| WO2017019897A1 (en) | 2015-07-29 | 2017-02-02 | Novartis Ag | Combination therapies comprising antibody molecules to tim-3 |
| WO2017040930A2 (en) | 2015-09-03 | 2017-03-09 | The Trustees Of The University Of Pennsylvania | Biomarkers predictive of cytokine release syndrome |
| WO2017103895A1 (en) | 2015-12-18 | 2017-06-22 | Novartis Ag | Antibodies targeting cd32b and methods of use thereof |
| WO2017106630A1 (en) | 2015-12-18 | 2017-06-22 | The General Hospital Corporation | Polyacetal polymers, conjugates, particles and uses thereof |
| WO2017106656A1 (en) | 2015-12-17 | 2017-06-22 | Novartis Ag | Antibody molecules to pd-1 and uses thereof |
| WO2017112741A1 (en) | 2015-12-22 | 2017-06-29 | Novartis Ag | Mesothelin chimeric antigen receptor (car) and antibody against pd-l1 inhibitor for combined use in anticancer therapy |
| WO2017149515A1 (en) | 2016-03-04 | 2017-09-08 | Novartis Ag | Cells expressing multiple chimeric antigen receptor (car) molecules and uses therefore |
| WO2018067992A1 (en) | 2016-10-07 | 2018-04-12 | Novartis Ag | Chimeric antigen receptors for the treatment of cancer |
| WO2018102786A1 (en) | 2016-12-03 | 2018-06-07 | Juno Therapeutics, Inc. | Methods for modulation of car-t cells |
| WO2018106738A1 (en) | 2016-12-05 | 2018-06-14 | Massachusetts Institute Of Technology | Brush-arm star polymers, conjugates and particles, and uses thereof |
| WO2018201051A1 (en) | 2017-04-28 | 2018-11-01 | Novartis Ag | Bcma-targeting agent, and combination therapy with a gamma secretase inhibitor |
| WO2018201056A1 (en) | 2017-04-28 | 2018-11-01 | Novartis Ag | Cells expressing a bcma-targeting chimeric antigen receptor, and combination therapy with a gamma secretase inhibitor |
| WO2018223101A1 (en) | 2017-06-02 | 2018-12-06 | Juno Therapeutics, Inc. | Articles of manufacture and methods for treatment using adoptive cell therapy |
| WO2018229715A1 (en) | 2017-06-16 | 2018-12-20 | Novartis Ag | Compositions comprising anti-cd32b antibodies and methods of use thereof |
| WO2019006427A1 (en) | 2017-06-29 | 2019-01-03 | Juno Therapeutics, Inc. | WALL MODEL FOR ASSESSING TOXICITIES ASSOCIATED WITH IMMUNOTHERAPIES |
| WO2019081983A1 (en) | 2017-10-25 | 2019-05-02 | Novartis Ag | CD32B TARGETING ANTIBODIES AND METHODS OF USE |
| WO2019090003A1 (en) | 2017-11-01 | 2019-05-09 | Juno Therapeutics, Inc. | Chimeric antigen receptors specific for b-cell maturation antigen (bcma) |
| WO2019089969A2 (en) | 2017-11-01 | 2019-05-09 | Juno Therapeutics, Inc. | Antibodies and chimeric antigen receptors specific for b-cell maturation antigen |
| WO2019089858A2 (en) | 2017-11-01 | 2019-05-09 | Juno Therapeutics, Inc. | Methods of assessing or monitoring a response to a cell therapy |
| EP3487878A1 (en) | 2016-07-20 | 2019-05-29 | University of Utah Research Foundation | Cd229 car t cells and methods of use thereof |
| WO2019118937A1 (en) | 2017-12-15 | 2019-06-20 | Juno Therapeutics, Inc. | Anti-cct5 binding molecules and methods of use thereof |
| EP3514179A1 (en) | 2014-01-24 | 2019-07-24 | Dana-Farber Cancer Institute, Inc. | Antibody molecules to pd-1 and uses thereof |
| WO2019152743A1 (en) | 2018-01-31 | 2019-08-08 | Celgene Corporation | Combination therapy using adoptive cell therapy and checkpoint inhibitor |
| WO2019210153A1 (en) | 2018-04-27 | 2019-10-31 | Novartis Ag | Car t cell therapies with enhanced efficacy |
| WO2019213282A1 (en) | 2018-05-01 | 2019-11-07 | Novartis Ag | Biomarkers for evaluating car-t cells to predict clinical outcome |
| WO2019241426A1 (en) | 2018-06-13 | 2019-12-19 | Novartis Ag | Bcma chimeric antigen receptors and uses thereof |
| US10513540B2 (en) | 2012-07-31 | 2019-12-24 | The Brigham And Women's Hospital, Inc. | Modulation of the immune response |
| US10550196B2 (en) | 2014-04-27 | 2020-02-04 | Famewave Ltd. | Humanized antibodies against CEACAM1 |
| WO2020069405A1 (en) | 2018-09-28 | 2020-04-02 | Novartis Ag | Cd22 chimeric antigen receptor (car) therapies |
| WO2020069409A1 (en) | 2018-09-28 | 2020-04-02 | Novartis Ag | Cd19 chimeric antigen receptor (car) and cd22 car combination therapies |
| WO2020092848A2 (en) | 2018-11-01 | 2020-05-07 | Juno Therapeutics, Inc. | Methods for treatment using chimeric antigen receptors specific for b-cell maturation antigen |
| WO2020092854A2 (en) | 2018-11-01 | 2020-05-07 | Juno Therapeutics, Inc. | Chimeric antigen receptors specific for g protein-coupled receptor class c group 5 member d (gprc5d) |
| WO2020102770A1 (en) | 2018-11-16 | 2020-05-22 | Juno Therapeutics, Inc. | Methods of dosing engineered t cells for the treatment of b cell malignancies |
| EP3660042A1 (en) | 2014-07-31 | 2020-06-03 | Novartis AG | Subset-optimized chimeric antigen receptor-containing t-cells |
| WO2020113194A2 (en) | 2018-11-30 | 2020-06-04 | Juno Therapeutics, Inc. | Methods for treatment using adoptive cell therapy |
| WO2020160050A1 (en) | 2019-01-29 | 2020-08-06 | Juno Therapeutics, Inc. | Antibodies and chimeric antigen receptors specific for receptor tyrosine kinase like orphan receptor 1 (ror1) |
| EP3712171A1 (en) | 2014-08-19 | 2020-09-23 | Novartis AG | Treatment of cancer using a cd123 chimeric antigen receptor |
| EP3722316A1 (en) | 2014-07-21 | 2020-10-14 | Novartis AG | Treatment of cancer using a cd33 chimeric antigen receptor |
| WO2021108613A1 (en) | 2019-11-26 | 2021-06-03 | Novartis Ag | Cd19 and cd22 chimeric antigen receptors and uses thereof |
| WO2021207689A2 (en) | 2020-04-10 | 2021-10-14 | Juno Therapeutics, Inc. | Methods and uses related to cell therapy engineered with a chimeric antigen receptor targeting b-cell maturation antigen |
| EP3909601A1 (en) | 2020-05-11 | 2021-11-17 | LeukoCom GmbH | A novel antibody binding specifically to human ceacam1/3/5 and use thereof |
| WO2021236650A1 (en) | 2020-05-19 | 2021-11-25 | G1 Therapeutics, Inc. | Cyclin-dependent kinase inhibiting compounds for the treatment of medical disorders |
| WO2022066774A1 (en) | 2020-09-23 | 2022-03-31 | Achillion Pharmaceuticals, Inc. | Pharmaceutical compounds for the treatment of complement mediated disorders |
| US11427647B2 (en) | 2014-04-27 | 2022-08-30 | Famewave Ltd. | Polynucleotides encoding humanized antibodies against CEACAM1 |
| WO2022254337A1 (en) | 2021-06-01 | 2022-12-08 | Novartis Ag | Cd19 and cd22 chimeric antigen receptors and uses thereof |
| WO2023105528A1 (en) | 2021-12-12 | 2023-06-15 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Antibodies specific to ceacam1 |
| WO2023250400A1 (en) | 2022-06-22 | 2023-12-28 | Juno Therapeutics, Inc. | Treatment methods for second line therapy of cd19-targeted car t cells |
| WO2024031091A2 (en) | 2022-08-05 | 2024-02-08 | Juno Therapeutics, Inc. | Chimeric antigen receptors specific for gprc5d and bcma |
| EP4324518A2 (en) | 2014-01-31 | 2024-02-21 | Novartis AG | Antibody molecules to tim-3 and uses thereof |
| EP4378957A2 (en) | 2015-07-29 | 2024-06-05 | Novartis AG | Combination therapies comprising antibody molecules to pd-1 |
| WO2024129778A2 (en) | 2022-12-13 | 2024-06-20 | Juno Therapeutics, Inc. | Chimeric antigen receptors specific for baff-r and cd19 and methods and uses thereof |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060058257A1 (en) * | 2001-08-03 | 2006-03-16 | Christoph Wagener | Influencing angiogenesis using CD66a |
| AU2002367696A1 (en) * | 2001-10-12 | 2003-09-09 | Mcgill University | Enhanced immunization and suppression of oral tolerance |
| US20040047858A1 (en) * | 2002-09-11 | 2004-03-11 | Blumberg Richard S. | Therapeutic anti-BGP(C-CAM1) antibodies and uses thereof |
| JP2006517789A (ja) | 2003-01-10 | 2006-08-03 | アブリンクス エン.ヴェー. | 治療用ポリペプチド、その相同物、その断片、および血小板媒介凝集の調節での使用 |
| WO2008029271A2 (en) | 2006-02-27 | 2008-03-13 | Gal Markel | Ceacam based antibacterial agents |
| WO2009141679A2 (en) | 2007-11-05 | 2009-11-26 | Gal Markel | Ceacam1 based point-of-care cancer diagnostic |
| UY35468A (es) | 2013-03-16 | 2014-10-31 | Novartis Ag | Tratamiento de cáncer utilizando un receptor quimérico de antígeno anti-cd19 |
| WO2016120331A1 (de) * | 2015-01-28 | 2016-08-04 | Karl Sebastian Lang | Agonistische anti-cd66cd66 antikörper für die antiviralen therapie |
| JP6961490B2 (ja) | 2015-04-08 | 2021-11-05 | ノバルティス アーゲー | Cd20療法、cd22療法、およびcd19キメラ抗原受容体(car)発現細胞との併用療法 |
| EP3694552A1 (en) | 2017-10-10 | 2020-08-19 | Tilos Therapeutics, Inc. | Anti-lap antibodies and uses thereof |
| CN113164780A (zh) | 2018-10-10 | 2021-07-23 | 泰洛斯治疗公司 | 抗lap抗体变体及其用途 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5288854A (en) * | 1990-11-28 | 1994-02-22 | Center For Blood Research, Inc. | Functional derivatives of ICAM-1 which are substantially capable of binding to LFA-1 but are substantially incapable of binding to MAC-1 |
| US5688690A (en) * | 1994-09-16 | 1997-11-18 | The Wistar Institute Of Anatomy And Biology | Human cytotoxic lymphocyte signal transduction surface protein (P38) and monoclonal antibodies thereto |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2580812A1 (en) | 1991-06-27 | 1993-01-07 | Bristol-Myers Squibb Company | Ctla4 receptor, fusion proteins containing it and uses thereof |
| ES2246567T3 (es) | 1998-04-15 | 2006-02-16 | Brigham & Womens Hospital | Composiciones para receptores inhibidores de celulas t y usos de las mismas. |
| AU6940700A (en) | 1999-08-26 | 2001-03-19 | Amy P. N Skubitz | Peptides capable of modulating the function of cd66 (ceacam) family members |
-
1999
- 1999-04-15 ES ES99918627T patent/ES2246567T3/es not_active Expired - Lifetime
- 1999-04-15 AT AT99918627T patent/ATE298248T1/de not_active IP Right Cessation
- 1999-04-15 DE DE69925909T patent/DE69925909T2/de not_active Expired - Lifetime
- 1999-04-15 EP EP99918627A patent/EP1073465B1/en not_active Expired - Lifetime
- 1999-04-15 JP JP2000543162A patent/JP4843138B2/ja not_active Expired - Fee Related
- 1999-04-15 WO PCT/US1999/008430 patent/WO1999052552A1/en not_active Ceased
- 1999-04-15 CA CA002328725A patent/CA2328725A1/en not_active Abandoned
-
2001
- 2001-06-19 US US09/884,196 patent/US6852320B2/en not_active Expired - Fee Related
-
2005
- 2005-02-02 US US11/049,270 patent/US7132255B2/en not_active Expired - Fee Related
-
2006
- 2006-01-25 US US11/339,066 patent/US8110189B2/en not_active Expired - Fee Related
-
2011
- 2011-08-08 JP JP2011172944A patent/JP2012031172A/ja not_active Withdrawn
- 2011-10-24 US US13/279,567 patent/US20120141470A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5288854A (en) * | 1990-11-28 | 1994-02-22 | Center For Blood Research, Inc. | Functional derivatives of ICAM-1 which are substantially capable of binding to LFA-1 but are substantially incapable of binding to MAC-1 |
| US5688690A (en) * | 1994-09-16 | 1997-11-18 | The Wistar Institute Of Anatomy And Biology | Human cytotoxic lymphocyte signal transduction surface protein (P38) and monoclonal antibodies thereto |
Non-Patent Citations (7)
| Title |
|---|
| CICCONE E, GROSSI C E, VELARDI A: "OPPOSING FUNCTIONS OF ACTIVATORY T-CELL RECEPTORS AND INHIBITORY NK-CELL RECEPTORS ON CYTOTOXIC T CELLS", IMMUNOLOGY TODAY., ELSEVIER PUBLICATIONS, CAMBRIDGE., GB, vol. 17, 1 October 1996 (1996-10-01), GB, pages 450 - 453, XP002919696, ISSN: 0167-5699, DOI: 10.1016/0167-5699(96)30054-V * |
| EDLUND M, OBRINK B: "EVIDENCE FOR CALMODULIN BINDING TO THE CYTOPLASMIC DOMAINS OF TWO C-CAM ISOFORMS", FEBS LETTERS., ELSEVIER, AMSTERDAM., NL, vol. 327, no. 01, 1 July 1993 (1993-07-01), NL, pages 90 - 94, XP002919695, ISSN: 0014-5793, DOI: 10.1016/0014-5793(93)81046-3 * |
| LUENGPAILIN S, ET AL.: "DEMONSTRATION OF A BILIARY-ASSOCIATED GLYCOPROTEIN IN HUMAN SERUM", CLINICA CHIMICA ACTA, ELSEVIER BV, AMSTERDAM, NL, vol. 244, 1 January 1996 (1996-01-01), AMSTERDAM, NL, pages 237 - 240, XP002919697, ISSN: 0009-8981, DOI: 10.1016/0009-8981(95)06211-4 * |
| OIKAWA S, ET AL.: "HOMOTYPIC AND HETEROTYPIC CA++-INDEPENDENT CELL ADHESION ACTIVITIESOF BILIARY GLYCOPROTEIN, A MEMBER OF CARCINOEMBRYONIC ANTIGEN FAMILY, EXPRESSED ON CHO CELL SURFACE", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 186, no. 02, 31 July 1992 (1992-07-31), US, pages 881 - 887, XP002919701, ISSN: 0006-291X, DOI: 10.1016/0006-291X(92)90828-9 * |
| SOPP P, HOWARD C J: "CROSS-REACTIVITY OF MONOCLONAL ANTIBODIES TO DEFINED HUMAN LEUCOCYTE DIFFERENTIATION ANTIGENS WITH BOVINE CELLS", VETERINARY IMMUNOLOGY AND IMMUNOPATHOLOGY, ELSEVIER BV, AMSTERDAM, NL, vol. 56, 1 January 1997 (1997-01-01), Amsterdam, NL, pages 11 - 25, XP002919698, ISSN: 0165-2427, DOI: 10.1016/S0165-2427(96)05731-5 * |
| TEIXEIRA A M, ET AL.: "THE N-DOMAIN OF THE BILIARY CLYCOPROTEIN (BGP) ADHESION MOLECULE MEDIATES HOMOTYPIC BINDING: DOMAIN INTERACTIONS AND EPITOPE ANALYSIS OF BGPC", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 84, no. 01, 1 July 1994 (1994-07-01), US, pages 211 - 219, XP002919700, ISSN: 0006-4971 * |
| WATT S M, ET AL.: "CD66 IDENTIFIES THE BILIARY GLYCOPROTEIN (BGP) ADHESION MOLECULE: CLONING, EXPRESSION, AND ADHESION FUNCTIONS OF THE BGPC SPLICE VARIANT", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 84, no. 01, 1 July 1994 (1994-07-01), US, pages 200 - 210, XP002919699, ISSN: 0006-4971 * |
Cited By (129)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6852320B2 (en) | 1998-04-15 | 2005-02-08 | The Brigham & Women's Hospital, Inc. | T cell inhibitory receptor compositions and uses thereof |
| US7132255B2 (en) | 1998-04-15 | 2006-11-07 | The Brigham And Women's Hospital, Inc. | Identification of compounds that bind biliary glycoprotein and affect cytotoxic T lymphocyte activity |
| US8110189B2 (en) | 1998-04-15 | 2012-02-07 | The Brigham And Women's Hospital, Inc. | T cell inhibitory receptor compositions and uses thereof |
| WO2002012535A1 (en) * | 2000-08-07 | 2002-02-14 | Karolinska Innovations Ab | Use of anti-ceacam antibodies for stimulating b cells in the production of monoclonal antibodies or in immunotherapy |
| EP1400535A1 (en) * | 2002-09-11 | 2004-03-24 | The General Hospital Corporation doing business as Massachusetts General Hospital | Therapeutic anti-BGP (C-CAM1) antibodies and uses thereof |
| WO2005058358A3 (en) * | 2003-12-17 | 2005-11-24 | Nalan Utku | Use of agents derived from ceacam1 for the treatment of inflammatory diseases |
| US8815248B2 (en) | 2005-06-09 | 2014-08-26 | Gal Markel | Modulation of immunity and CEACAM1 activity |
| US10188760B2 (en) | 2005-06-09 | 2019-01-29 | Gal Markel | Modulation of immunity and CEACAM1 activity |
| EP1909827A4 (en) * | 2005-06-09 | 2010-03-10 | Gal Markel | MODULATION OF IMMUNITY AND CEACAM1 ACTIVITY |
| US11793894B2 (en) | 2005-06-09 | 2023-10-24 | Gal Markel | Modulation of immunity and CEACAM1 activity |
| EP1780220A1 (en) * | 2005-11-01 | 2007-05-02 | Charité - Universitätsmedizin Berlin | Use of CEACAM8-specific substances for treating autoimmune diseases and a method for screening substances which induce apoptosis |
| US8309091B2 (en) | 2005-11-01 | 2012-11-13 | Charite-Universitatsmedizin Berlin | CEACAM8-related method for treating autoimmune diseases |
| WO2007051805A3 (en) * | 2005-11-01 | 2007-06-28 | Charite Universitaetsmedizin | Use of ceacam8-specific substances for treating autoimmune diseases and a method for screening substances which induce apoptosis |
| US8598322B2 (en) | 2009-04-30 | 2013-12-03 | Tel Hashomer Medical Research Infrastucture and Services Ltd. | Anti CEACAM1 antibodies and methods of using same |
| US9261507B2 (en) | 2009-04-30 | 2016-02-16 | Tel Hashomer Medical Research Infrastructure And Services Ltd. | Anti CEACAM1 antibodies and methods of using same |
| EP2990421A1 (en) | 2009-04-30 | 2016-03-02 | Tel HaShomer Medical Research Infrastructure and Services Ltd. | Anti ceacam1 antibodies and methods of using same |
| US9771431B2 (en) | 2011-10-11 | 2017-09-26 | Ccam Biotherapeutics Ltd. | Antibodies to carcinoembryonic antigen-related cell adhesion molecule (CEACAM) |
| WO2013054331A1 (en) | 2011-10-11 | 2013-04-18 | Tel Hashomer Medical Research Infrastructure And Services Ltd. | Antibodies to carcinoembryonic antigen-related cell adhesion molecule (ceacam) |
| EP3360899A1 (en) | 2011-10-11 | 2018-08-15 | Tel HaShomer Medical Research Infrastructure and Services Ltd. | Antibodies to carcinoembryonic antigen-related cell adhesion molecule (ceacam) |
| US11891453B2 (en) | 2011-10-11 | 2024-02-06 | Famewave Ltd. | Antibodies to carcinoembryonic antigen-related cell adhesion molecule (CEACAM) |
| US9556271B2 (en) | 2011-12-01 | 2017-01-31 | The Brigham And Women's Hospital, Inc. | Anti-CEACAM1 recombinant antibodies for cancer therapy |
| US10513540B2 (en) | 2012-07-31 | 2019-12-24 | The Brigham And Women's Hospital, Inc. | Modulation of the immune response |
| EP3698809A1 (en) | 2012-07-31 | 2020-08-26 | The Brigham & Women's Hospital, Inc. | Modulation of the immune response using agents binding tim-3 and ceacam-1 |
| EP3679950A1 (en) | 2012-10-12 | 2020-07-15 | The Brigham and Women's Hospital, Inc. | Enhancement of the immune response |
| WO2014059251A1 (en) | 2012-10-12 | 2014-04-17 | The Brigham And Women's Hospital, Inc. | Enhancement of the immune response |
| EP3763387A1 (en) | 2013-11-25 | 2021-01-13 | FameWave Ltd | Compositions comprising anti-ceacam1 and anti-pd antibodies for cancer therapy |
| US10081679B2 (en) | 2013-11-25 | 2018-09-25 | Ccam Biotherapeutics Ltd. | Compositions comprising anti-CEACAM1 and anti-PD antibodies for cancer therapy |
| WO2015075725A1 (en) | 2013-11-25 | 2015-05-28 | Ccam Biotherapeutics Ltd. | Compositions comprising anti-ceacam1 and anti-pd antibodies for cancer therapy |
| EP4026909A1 (en) | 2013-12-19 | 2022-07-13 | Novartis AG | Human mesothelin chimeric antigen receptors and uses thereof |
| WO2015090230A1 (en) | 2013-12-19 | 2015-06-25 | Novartis Ag | Human mesothelin chimeric antigen receptors and uses thereof |
| EP4706773A2 (en) | 2013-12-19 | 2026-03-11 | Novartis AG | Human mesothelin chimeric antigen receptors and uses thereof |
| EP3514179A1 (en) | 2014-01-24 | 2019-07-24 | Dana-Farber Cancer Institute, Inc. | Antibody molecules to pd-1 and uses thereof |
| EP4324518A2 (en) | 2014-01-31 | 2024-02-21 | Novartis AG | Antibody molecules to tim-3 and uses thereof |
| EP3660050A1 (en) | 2014-03-14 | 2020-06-03 | Novartis AG | Antibody molecules to lag-3 and uses thereof |
| WO2015138920A1 (en) | 2014-03-14 | 2015-09-17 | Novartis Ag | Antibody molecules to lag-3 and uses thereof |
| WO2015142675A2 (en) | 2014-03-15 | 2015-09-24 | Novartis Ag | Treatment of cancer using chimeric antigen receptor |
| EP4406610A2 (en) | 2014-04-07 | 2024-07-31 | Novartis AG | Treatment of cancer using anti-cd19 chimeric antigen receptor |
| WO2015157252A1 (en) | 2014-04-07 | 2015-10-15 | BROGDON, Jennifer | Treatment of cancer using anti-cd19 chimeric antigen receptor |
| EP3888674A1 (en) | 2014-04-07 | 2021-10-06 | Novartis AG | Treatment of cancer using anti-cd19 chimeric antigen receptor |
| US11866509B2 (en) | 2014-04-27 | 2024-01-09 | Famewave Ltd. | Humanized antibodies against CEACAM1 |
| US11427647B2 (en) | 2014-04-27 | 2022-08-30 | Famewave Ltd. | Polynucleotides encoding humanized antibodies against CEACAM1 |
| US10550196B2 (en) | 2014-04-27 | 2020-02-04 | Famewave Ltd. | Humanized antibodies against CEACAM1 |
| WO2016014530A1 (en) | 2014-07-21 | 2016-01-28 | Novartis Ag | Combinations of low, immune enhancing. doses of mtor inhibitors and cars |
| EP3722316A1 (en) | 2014-07-21 | 2020-10-14 | Novartis AG | Treatment of cancer using a cd33 chimeric antigen receptor |
| WO2016014553A1 (en) | 2014-07-21 | 2016-01-28 | Novartis Ag | Sortase synthesized chimeric antigen receptors |
| EP4205749A1 (en) | 2014-07-31 | 2023-07-05 | Novartis AG | Subset-optimized chimeric antigen receptor-containing cells |
| EP3660042A1 (en) | 2014-07-31 | 2020-06-03 | Novartis AG | Subset-optimized chimeric antigen receptor-containing t-cells |
| WO2016025880A1 (en) | 2014-08-14 | 2016-02-18 | Novartis Ag | Treatment of cancer using gfr alpha-4 chimeric antigen receptor |
| EP3712171A1 (en) | 2014-08-19 | 2020-09-23 | Novartis AG | Treatment of cancer using a cd123 chimeric antigen receptor |
| EP3925622A1 (en) | 2014-09-13 | 2021-12-22 | Novartis AG | Combination therapies |
| EP3659621A1 (en) | 2014-09-13 | 2020-06-03 | Novartis AG | Combination therapies for cancer |
| WO2016040892A1 (en) | 2014-09-13 | 2016-03-17 | Novartis Ag | Combination therapies |
| WO2016040880A1 (en) | 2014-09-13 | 2016-03-17 | Novartis Ag | Combination therapies of alk inhibitors |
| EP3967709A1 (en) | 2014-09-17 | 2022-03-16 | Novartis AG | Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy |
| WO2016044605A1 (en) | 2014-09-17 | 2016-03-24 | Beatty, Gregory | Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy |
| EP3662903A2 (en) | 2014-10-03 | 2020-06-10 | Novartis AG | Combination therapies |
| WO2016054555A2 (en) | 2014-10-03 | 2016-04-07 | Novartis Ag | Combination therapies |
| WO2016057705A1 (en) | 2014-10-08 | 2016-04-14 | Novartis Ag | Biomarkers predictive of therapeutic responsiveness to chimeric antigen receptor therapy and uses thereof |
| EP4245376A2 (en) | 2014-10-14 | 2023-09-20 | Novartis AG | Antibody molecules to pd-l1 and uses thereof |
| WO2016061142A1 (en) | 2014-10-14 | 2016-04-21 | Novartis Ag | Antibody molecules to pd-l1 and uses thereof |
| WO2016090034A2 (en) | 2014-12-03 | 2016-06-09 | Novartis Ag | Methods for b cell preconditioning in car therapy |
| WO2016100882A1 (en) | 2014-12-19 | 2016-06-23 | Novartis Ag | Combination therapies |
| WO2016126608A1 (en) | 2015-02-02 | 2016-08-11 | Novartis Ag | Car-expressing cells against multiple tumor antigens and uses thereof |
| WO2016164580A1 (en) | 2015-04-07 | 2016-10-13 | Novartis Ag | Combination of chimeric antigen receptor therapy and amino pyrimidine derivatives |
| EP4234685A2 (en) | 2015-04-17 | 2023-08-30 | Novartis AG | Methods for improving the efficacy and expansion of chimeric antigen receptor-expressing cells |
| WO2016168595A1 (en) | 2015-04-17 | 2016-10-20 | Barrett David Maxwell | Methods for improving the efficacy and expansion of chimeric antigen receptor-expressing cells |
| WO2016172583A1 (en) | 2015-04-23 | 2016-10-27 | Novartis Ag | Treatment of cancer using chimeric antigen receptor and protein kinase a blocker |
| WO2017015427A1 (en) | 2015-07-21 | 2017-01-26 | Novartis Ag | Methods for improving the efficacy and expansion of immune cells |
| WO2017019897A1 (en) | 2015-07-29 | 2017-02-02 | Novartis Ag | Combination therapies comprising antibody molecules to tim-3 |
| EP4378957A2 (en) | 2015-07-29 | 2024-06-05 | Novartis AG | Combination therapies comprising antibody molecules to pd-1 |
| WO2017019894A1 (en) | 2015-07-29 | 2017-02-02 | Novartis Ag | Combination therapies comprising antibody molecules to lag-3 |
| EP3878465A1 (en) | 2015-07-29 | 2021-09-15 | Novartis AG | Combination therapies comprising antibody molecules to tim-3 |
| EP3964528A1 (en) | 2015-07-29 | 2022-03-09 | Novartis AG | Combination therapies comprising antibody molecules to lag-3 |
| WO2017040930A2 (en) | 2015-09-03 | 2017-03-09 | The Trustees Of The University Of Pennsylvania | Biomarkers predictive of cytokine release syndrome |
| EP4424322A2 (en) | 2015-12-17 | 2024-09-04 | Novartis AG | Antibody molecules to pd-1 and uses thereof |
| WO2017106656A1 (en) | 2015-12-17 | 2017-06-22 | Novartis Ag | Antibody molecules to pd-1 and uses thereof |
| WO2017103895A1 (en) | 2015-12-18 | 2017-06-22 | Novartis Ag | Antibodies targeting cd32b and methods of use thereof |
| WO2017106630A1 (en) | 2015-12-18 | 2017-06-22 | The General Hospital Corporation | Polyacetal polymers, conjugates, particles and uses thereof |
| WO2017112741A1 (en) | 2015-12-22 | 2017-06-29 | Novartis Ag | Mesothelin chimeric antigen receptor (car) and antibody against pd-l1 inhibitor for combined use in anticancer therapy |
| WO2017149515A1 (en) | 2016-03-04 | 2017-09-08 | Novartis Ag | Cells expressing multiple chimeric antigen receptor (car) molecules and uses therefore |
| US11365252B2 (en) | 2016-07-20 | 2022-06-21 | University Of Utah Research Foundation | CD229 CAR T cells and methods of use thereof |
| EP3487878A1 (en) | 2016-07-20 | 2019-05-29 | University of Utah Research Foundation | Cd229 car t cells and methods of use thereof |
| WO2018067992A1 (en) | 2016-10-07 | 2018-04-12 | Novartis Ag | Chimeric antigen receptors for the treatment of cancer |
| WO2018102786A1 (en) | 2016-12-03 | 2018-06-07 | Juno Therapeutics, Inc. | Methods for modulation of car-t cells |
| WO2018106738A1 (en) | 2016-12-05 | 2018-06-14 | Massachusetts Institute Of Technology | Brush-arm star polymers, conjugates and particles, and uses thereof |
| WO2018201056A1 (en) | 2017-04-28 | 2018-11-01 | Novartis Ag | Cells expressing a bcma-targeting chimeric antigen receptor, and combination therapy with a gamma secretase inhibitor |
| WO2018201051A1 (en) | 2017-04-28 | 2018-11-01 | Novartis Ag | Bcma-targeting agent, and combination therapy with a gamma secretase inhibitor |
| WO2018223101A1 (en) | 2017-06-02 | 2018-12-06 | Juno Therapeutics, Inc. | Articles of manufacture and methods for treatment using adoptive cell therapy |
| US12583904B2 (en) | 2017-06-02 | 2026-03-24 | Juno Therapeutics, Inc. | Articles of manufacture and methods for treatment using adoptive cell therapy |
| US11944647B2 (en) | 2017-06-02 | 2024-04-02 | Juno Therapeutics, Inc. | Articles of manufacture and methods for treatment using adoptive cell therapy |
| US11413310B2 (en) | 2017-06-02 | 2022-08-16 | Juno Therapeutics, Inc. | Articles of manufacture and methods for treatment using adoptive cell therapy |
| WO2018229715A1 (en) | 2017-06-16 | 2018-12-20 | Novartis Ag | Compositions comprising anti-cd32b antibodies and methods of use thereof |
| WO2019006427A1 (en) | 2017-06-29 | 2019-01-03 | Juno Therapeutics, Inc. | WALL MODEL FOR ASSESSING TOXICITIES ASSOCIATED WITH IMMUNOTHERAPIES |
| WO2019081983A1 (en) | 2017-10-25 | 2019-05-02 | Novartis Ag | CD32B TARGETING ANTIBODIES AND METHODS OF USE |
| US12428486B2 (en) | 2017-11-01 | 2025-09-30 | Juno Therapeutics, Inc. | Chimeric antigen receptors specific for B-cell maturation antigen and encoding polynucleotides |
| US12031975B2 (en) | 2017-11-01 | 2024-07-09 | Juno Therapeutics, Inc. | Methods of assessing or monitoring a response to a cell therapy |
| WO2019089969A2 (en) | 2017-11-01 | 2019-05-09 | Juno Therapeutics, Inc. | Antibodies and chimeric antigen receptors specific for b-cell maturation antigen |
| WO2019090003A1 (en) | 2017-11-01 | 2019-05-09 | Juno Therapeutics, Inc. | Chimeric antigen receptors specific for b-cell maturation antigen (bcma) |
| US11066475B2 (en) | 2017-11-01 | 2021-07-20 | Juno Therapeutics, Inc. | Chimeric antigen receptors specific for B-cell maturation antigen and encoding polynucleotides |
| WO2019089858A2 (en) | 2017-11-01 | 2019-05-09 | Juno Therapeutics, Inc. | Methods of assessing or monitoring a response to a cell therapy |
| US11623961B2 (en) | 2017-11-01 | 2023-04-11 | Juno Therapeutics, Inc. | Antibodies and chimeric antigen receptors specific for B-cell maturation antigen |
| WO2019118937A1 (en) | 2017-12-15 | 2019-06-20 | Juno Therapeutics, Inc. | Anti-cct5 binding molecules and methods of use thereof |
| US12006356B2 (en) | 2017-12-15 | 2024-06-11 | Juno Therapeutics, Inc. | Anti-CCT5 binding molecules and chimeric antigen receptors comprising the same |
| WO2019152743A1 (en) | 2018-01-31 | 2019-08-08 | Celgene Corporation | Combination therapy using adoptive cell therapy and checkpoint inhibitor |
| WO2019210153A1 (en) | 2018-04-27 | 2019-10-31 | Novartis Ag | Car t cell therapies with enhanced efficacy |
| WO2019213282A1 (en) | 2018-05-01 | 2019-11-07 | Novartis Ag | Biomarkers for evaluating car-t cells to predict clinical outcome |
| WO2019241426A1 (en) | 2018-06-13 | 2019-12-19 | Novartis Ag | Bcma chimeric antigen receptors and uses thereof |
| WO2020069409A1 (en) | 2018-09-28 | 2020-04-02 | Novartis Ag | Cd19 chimeric antigen receptor (car) and cd22 car combination therapies |
| WO2020069405A1 (en) | 2018-09-28 | 2020-04-02 | Novartis Ag | Cd22 chimeric antigen receptor (car) therapies |
| US12473345B2 (en) | 2018-11-01 | 2025-11-18 | Juno Therapeutics, Inc. | Methods for treatment using chimeric antigen receptors specific for B-cell maturation antigen |
| WO2020092848A2 (en) | 2018-11-01 | 2020-05-07 | Juno Therapeutics, Inc. | Methods for treatment using chimeric antigen receptors specific for b-cell maturation antigen |
| WO2020092854A2 (en) | 2018-11-01 | 2020-05-07 | Juno Therapeutics, Inc. | Chimeric antigen receptors specific for g protein-coupled receptor class c group 5 member d (gprc5d) |
| WO2020102770A1 (en) | 2018-11-16 | 2020-05-22 | Juno Therapeutics, Inc. | Methods of dosing engineered t cells for the treatment of b cell malignancies |
| WO2020113194A2 (en) | 2018-11-30 | 2020-06-04 | Juno Therapeutics, Inc. | Methods for treatment using adoptive cell therapy |
| EP4427810A2 (en) | 2018-11-30 | 2024-09-11 | Juno Therapeutics, Inc. | Methods for treatment using adoptive cell therapy |
| WO2020160050A1 (en) | 2019-01-29 | 2020-08-06 | Juno Therapeutics, Inc. | Antibodies and chimeric antigen receptors specific for receptor tyrosine kinase like orphan receptor 1 (ror1) |
| US12268741B2 (en) | 2019-01-29 | 2025-04-08 | Juno Therapeutics, Inc. | Antibodies and chimeric antigen receptors specific for receptor tyrosine kinase like orphan receptor 1 (ROR1) |
| WO2021108613A1 (en) | 2019-11-26 | 2021-06-03 | Novartis Ag | Cd19 and cd22 chimeric antigen receptors and uses thereof |
| WO2021207689A2 (en) | 2020-04-10 | 2021-10-14 | Juno Therapeutics, Inc. | Methods and uses related to cell therapy engineered with a chimeric antigen receptor targeting b-cell maturation antigen |
| WO2021228746A1 (en) | 2020-05-11 | 2021-11-18 | Leukocom Gmbh | A novel antibody binding specifically to human ceacam1/3/5 and use thereof |
| EP3909601A1 (en) | 2020-05-11 | 2021-11-17 | LeukoCom GmbH | A novel antibody binding specifically to human ceacam1/3/5 and use thereof |
| EP4652997A2 (en) | 2020-05-19 | 2025-11-26 | Pharmacosmos Holding A/s | Cyclin-dependent kinase inhibiting compounds for the treatment of medical disorders |
| WO2021236650A1 (en) | 2020-05-19 | 2021-11-25 | G1 Therapeutics, Inc. | Cyclin-dependent kinase inhibiting compounds for the treatment of medical disorders |
| WO2022066774A1 (en) | 2020-09-23 | 2022-03-31 | Achillion Pharmaceuticals, Inc. | Pharmaceutical compounds for the treatment of complement mediated disorders |
| WO2022254337A1 (en) | 2021-06-01 | 2022-12-08 | Novartis Ag | Cd19 and cd22 chimeric antigen receptors and uses thereof |
| WO2023105528A1 (en) | 2021-12-12 | 2023-06-15 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Antibodies specific to ceacam1 |
| WO2023250400A1 (en) | 2022-06-22 | 2023-12-28 | Juno Therapeutics, Inc. | Treatment methods for second line therapy of cd19-targeted car t cells |
| WO2024031091A2 (en) | 2022-08-05 | 2024-02-08 | Juno Therapeutics, Inc. | Chimeric antigen receptors specific for gprc5d and bcma |
| WO2024129778A2 (en) | 2022-12-13 | 2024-06-20 | Juno Therapeutics, Inc. | Chimeric antigen receptors specific for baff-r and cd19 and methods and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1073465B1 (en) | 2005-06-22 |
| DE69925909D1 (de) | 2005-07-28 |
| DE69925909T2 (de) | 2006-05-11 |
| JP4843138B2 (ja) | 2011-12-21 |
| JP2012031172A (ja) | 2012-02-16 |
| ATE298248T1 (de) | 2005-07-15 |
| EP1073465A1 (en) | 2001-02-07 |
| US20080102071A1 (en) | 2008-05-01 |
| US6852320B2 (en) | 2005-02-08 |
| EP1073465A4 (en) | 2003-03-26 |
| JP2002511424A (ja) | 2002-04-16 |
| US20050169922A1 (en) | 2005-08-04 |
| US7132255B2 (en) | 2006-11-07 |
| US20020028203A1 (en) | 2002-03-07 |
| CA2328725A1 (en) | 1999-10-21 |
| US8110189B2 (en) | 2012-02-07 |
| US20120141470A1 (en) | 2012-06-07 |
| ES2246567T3 (es) | 2006-02-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1073465B1 (en) | T cell inhibitory receptor compositions and uses thereof | |
| JP7605912B2 (ja) | Gprc5dキメラ抗原受容体及びそれを発現する細胞 | |
| CA2086325C (en) | Ligand for cd28 receptor on b cells and methods | |
| US5580756A (en) | B7Ig fusion protein | |
| Morales et al. | Regulation of human intestinal intraepithelial lymphocyte cytolytic function by biliary glycoprotein (CD66a) | |
| KR20190008171A (ko) | 항-bcma 폴리펩티드 및 단백질 | |
| US6830937B1 (en) | Method for generating and identifying antibodies directed against a B7 | |
| AU2667701A (en) | Novel triggering receptor involved in natural cytotoxicity mediated by human natural killer cells, and antibodies that identify the same | |
| AU676325B2 (en) | Receptors of interleukin-12 and antibodies | |
| US7138243B2 (en) | NTB-A, a surface molecule involved in natural killer cells activity | |
| US20030219446A1 (en) | Ligand for CD28 receptor on B cells and methods | |
| AU2002325333A1 (en) | NTB-A, a surface molecule involved in natural killer cells activity | |
| WO1998003551A1 (en) | Cd6 ligand | |
| CA2157500C (en) | Lo-cd2a antibody and uses thereof for inhibiting t-cell activation and proliferation | |
| WO1996034880A1 (en) | Cd6 ligand | |
| WO2023020471A1 (en) | Cd123-targetting antibodies and uses thereof in cancer therapies | |
| Cytolytic | Regulation of Human Intestinal |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): CA JP |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2328725 Country of ref document: CA Ref country code: CA Ref document number: 2328725 Kind code of ref document: A Format of ref document f/p: F |
|
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2000 543162 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1999918627 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1999918627 Country of ref document: EP |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1999918627 Country of ref document: EP |