WO1999037812A1 - Polymorphismes d'un nucleotide du gene de la proteine decouplante 2 (ucp2) - Google Patents

Polymorphismes d'un nucleotide du gene de la proteine decouplante 2 (ucp2) Download PDF

Info

Publication number
WO1999037812A1
WO1999037812A1 PCT/US1999/001198 US9901198W WO9937812A1 WO 1999037812 A1 WO1999037812 A1 WO 1999037812A1 US 9901198 W US9901198 W US 9901198W WO 9937812 A1 WO9937812 A1 WO 9937812A1
Authority
WO
WIPO (PCT)
Prior art keywords
ucp2
polymo
nucleic acid
oligonucleotide
target polynucleotide
Prior art date
Application number
PCT/US1999/001198
Other languages
English (en)
Other versions
WO1999037812A9 (fr
Inventor
Leslie Picoult Vrolijk
Original Assignee
Orchid Biosciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Orchid Biosciences, Inc. filed Critical Orchid Biosciences, Inc.
Priority to AU24613/99A priority Critical patent/AU2461399A/en
Publication of WO1999037812A1 publication Critical patent/WO1999037812A1/fr
Publication of WO1999037812A9 publication Critical patent/WO1999037812A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the invention relates to gene mutations that predispose an individual to obesity, to non- insulin-dependent diabetes mellitus and to disorders related to mutations in the uncoupling protein-2 (UCP2) gene, or to aberrant expression of that gene.
  • the invention relates to polymorphisms in UCP2, and to methods and agents for identifying polymorphisms in UCP2.
  • the invention further concerns methods and agents for prognosing or diagnosing obesity, non- insulin-dependent diabetes mellitus or other UCP2-related disorders.
  • the mitochondrial uncoupling protein (UCP) in the mitochondrial inner membrane of mammalian brown adipose tissue generates heat by uncoupling oxidative phosphorylation (Nichols, D.G. and Locke, R.M. Physiol. Rev. 64, 1-64 (1984), herein incorporated by reference). This process is known to protect against cold (Forster, D.O. and Frydman, M.L. Can. J. Physiol. Pharmacol. 57, 257-270 (1979), herein incorporated by reference), and also regulates energy balance (Rothwell, NJ. and Stock, MJ. Nature 281, 31-35 (1979), herein incorporated by reference).
  • thermogenesis can also be an effective strategy for treating obesity (Champigny, O. et al., Proc. Natl. Acad. Sci. USA 88, 10774-10777 (1991), Himrna- Hagen J. et al., Am J. Physiol 266, R1371-R1382 (1994), Kozak, L.P. et al., Genes Dev. 5, 2256-2264 (1991), Lowell, B.B. et al., Nature 366, 740-742 (1993).
  • the role of UCP in the regulation of body mass by targeted inactivation of the UCP-1 gene encoding UCP has been determined by Enerback et al.
  • UCP-deficient mice have been found to consume less oxygen after treatment with beta 3 adrenergic-receptor agonist and that they are sensitive to cold, indicating that their thermoregulation is defective. It was also found that the deficiency caused neither hyperphagia nor obesity in mice fed on either standard or a high fat diet.
  • U.S. Patent No. 5,453,270 (Bills), herein incorporated by reference concerns a pharmaceutical composition and method for hypermetabolic weight loss.
  • the invention relates to a device, a pharmaceutical composition and methods for metabolizing fatty acids into water, carbon dioxide and heat, thereby reducing an individual's white adipose tissue mass without affecting the muscle mass.
  • the pharmaceutical composition comprises a culture of brown fat cells or UCP transfected cells having a cDNA sequence encoding a mammalian UCP sequence in combination with appropriate regulatory and promoter sequences encapsulated in a porous growth matrix and having a semipermeable membrane encapsulating the porous growth matrix.
  • Introduction of the pharmaceutical composition into host cells results in expression of the UCP polypeptide in vivo thereby causing an uncoupling of the oxidative metabolism.
  • the invention also provides a method for effecting weight loss of white adipose tissue of an individual with minimal loss of muscle mass.
  • UCP3 another mitochondrial uncoupling protein
  • Vidal-Puig et al. Biochem. Biophys. Res. Comm. 235, 79-82 (1997)) and by Boss et al. (FEBS Letters 408, 39-42 (1997)), both of which are herein incorporated by reference.
  • UCP3 exists in both the long, UCP3 L and short, UCP3 S forms, respectively.
  • UCP3 L contains six predicted transmembrane domains. Potential purine nucleotide binding domains extend between amino acid residues 279-301 in UCP3L (Boss et al., FEBS Letters 408, 39-42 (1997)).
  • UCP3 S lacks the sixth potential transmembrane region and the purine nucleotide binding domain implicated in the control of coupling efficiency of UCP1 (Boss et al. FEBS Letters 408, 39-42 (1997)).
  • UCP3 mRNA tissue distribution is restricted to skeletal muscle and heart, although it is much lower in the latter. This provides evidence of a new member of the UCP family for a candidate gene possibly involved in the uncoupling of oxidative phosphorylation specifically in skeletal muscle, which is an important site of non-shivering thermogenesis in humans (Boss et al. (FEBS Letters 408, 39-42 (1997); Vidal-Puig et al. Biochem. Biophys. Res. Comm. 235, 79-82 (1997)).
  • UCP2 Mitochondrial Uncoupling Protein 2
  • UCP2 a newly discovered homologue of UCP.
  • UCP1 is present only in brown adipose tissue
  • UCP2 is ubiquitously expressed in tissues of both humans and rodents. This gene is also ubiquitously expressed and is induced in the brown fat of UCP-deficient mice.
  • UCP in mammals exists specifically to produce heat. This function provides a mechanism for controlling energy expenditure under conditions of either reduced or enhanced caloric intake and is supported by complex regulation from the central nervous system through neurohormones that modulate feeding behavior as well as brown-fat thermogenesis (Billington, C. J. et al, Am. J. Physiol 266, R 1765- 1770 (1991), herein incorporated by reference).
  • thermogeneisis does not cause obesity, it is known that genetic alterations that enhance the levels of UCP (Kopecky, J. et al., J. Clin. Invest 96, 2914-2923 (1995); Cummings, D. E. et al. Nature 382, 622-626 (1996), both herein incorporated by reference) or futile cycling (Kozak, L.P. et al., Genes Dev. 5, 2256-2264 ( 1991), herein incorporated by reference) prevent obesity when mice are either fed a high fat diet or carry an 'obesity' gene.
  • Thermogenesis in brown adipose tissue occurs in response to cold and overeating (diet induced)((Rothwell, NJ. and Stock, MJ. Nature 281, 31-35 (1979); Brooks, S.L. et al, Nature 286, 274-276 (1980); Glick, Z. et al, Science 213, 1 125-1 127 (1981), all of which are herein incorporated by reference), and there is an inverse relationship between diet induced thermogenesis and obesity both in humans (Jung, R.T. et al, Nature 279, 322-323 (1979), herein incorporated by reference) and in animal models (Hamann, A.
  • the amino acid sequence of human UCP2 is 59% identical to human UCPl and consists of 309 amino acids with a molecular weight of 33.218 Daltons and an isoelectric point of 10.0.
  • Several protein motifs are conserved between UCPl and UCP2. Both proteins exhibit three mitochondrial carrier protein motifs, consistent with roles as ion transporters of the inner membrane, and the amino acids essential for ATP binding are also conserved (Fleury, C. et al. Nature Genetics 15, 269-272 (1997), herein incorporated by reference).
  • Comparison of mitochondrial carrier protein with UCP2 revealed that UCP2 bears closest similarity to UCPl; the degree of homology between UCP2 and mitochondrial carriers other than UCPl is about 30%.
  • UCP2 tissue distribution is markedly different from that of UCPl; a 1.6-kb UCP2 mRNA is present in skeletal muscle, lung, heart, placenta and kidney (Fleury, C. et al. Nature Genetics 15, 269-272 (1997)). Probing of human mRNA with UCP2 reveals that it is expressed at high levels in spleen, thymus, leukocytes, macrophage. bone marrow and stomach, whereas only low levels of UCP2 mRNA expression occur in liver and brain (Fleury, C. et al. Nature Genetics 15, 269-272 (1997)).
  • UCP2 is expressed in a wide range of tissues is consistent with the idea that it may play an important role in establishing basal metabolic rate.
  • the expression of UCP2 throughout the immune system suggests a putative role for this protein in the immunity and/or thermoregulatory responses to infection (fever).
  • Human UCP2 has been localized to chromosome 1 lql3 (DeBry, R.W. and Seldin, M.F.
  • Genomics 33, 337-351 (1996), herein incorporated by reference).
  • Chromosomal mapping of UCP2 is co-incident with quantitative trait loci (QTLs) for obesity from at least three independent mouse models, one congeneic strain and human insulin dependent diabetes locus-4 (IDDM4) (Warden, CH. et al, J. Clin. Invest. 95, 1545-1552 (1995); West, D.B. et al, J. Clin. Invest 94, 1410-1416 (1994); Seldin, M.F. et al, J. Clin. Invest. 94, 269-276 (1994), all of which are herein incorporated by reference).
  • QTLs quantitative trait loci
  • UCP2 functions at least in part like UCPl: (i) The sequence similarity between brown fat UCPl and UCP2 is comparable to that between yeast and mammalian ADP/ ATP translocators; (ii) The effects of UCP2 and UCPl on yeast growth are similar; and (iii) UCP2 is active at the mitochondrial level. Both UCPl and UCP2 alter mitochondrial membrane potential in isolated yeast mitochondria and in vivo, with the same range of fluorescence values recorded for both proteins.
  • UCP2 to control the redox state and oxidative stress of the cell would depend on the level of UCP2 expression and/or the appropriate activity that could be linked to the cell metabolism (i.e., the intracellular content of nucleotides) and genetic background of the individual. It is believed that UCP2 plays a role in chronic inflammation and associated disorders.
  • Uncoupling protein-2 (UCP2) is thought to play a role as a regulator in the cellular pathways involving free radicals generated by mitochondria, energy balance, body weight regulation, obesity, non-insulin dependent diabetes mellitus and thermoregulation in humans and rodents (Negre-Salvayre et al, FASEB J. 11, 809-815, (1997); Fleury, C, et al Nature Genetics 15, 269-272 (1997); Harper, Clin. Invest. Med.
  • UCP2 gene may in part be responsible for diseases linked to reduced activity for the UCP2 gene product.
  • the analysis of these polymorphic sites may have prognostic, diagnostic value, as well as treatment value for obesity, non-insulin dependent diabetes mellitus and other UCP2 related conditions.
  • UCP2 in modulating a variety of physiological functions, there is a need in the art for improved methods to identify these polymorphism ' s and to correlate the identity of these polymorphisms with the other functions of UCP2.
  • the present invention addresses these needs and more by providing information about polymorphisms, mutations, and methods useful for the diagnosis and prognosis of obesity, non-insulin-dependent diabetes mellitus and other UCP2-related diseases.
  • the present invention provides the identification and analysis of polymorphic sites of the UCP2 gene which may have value as diagnostic agents, prognostic agents, therapeutic agents and methods for diagnosis, prognosis, therapy of obesity, non-insulin-dependent diabetes mellitus and other UCP2-related diseases.
  • the present invention is directed to variations in the UCP2 gene useful in identifying and diagnosing clinically relevant disease states or predisposition to disease.
  • the present invention is also useful for determining the identity of one or more polymorphic sites in UCP2.
  • the invention is also directed to methods for determining the identity of one or more polymorphic sites in UCP2.
  • the invention is directed to agents and methods useful for determining the identity of one or more polymo ⁇ hic sites in the UCP2 gene and correlating the identity of such sites with a genetic predisposition for a disease.
  • the invention is particularly concerned with a genetic predisposition for obesity, non-insulin dependent diabetes mellitus, and other UCP2-related diseases.
  • the invention also provides a kit, suitable for genetic testing.
  • a kit contains primers for amplifying regions of a UCP2 nucleic acid molecule encompassing regions where at least one of polymo ⁇ hic site within the UCP2 nucleic acid molecule is found.
  • the kit also contains oligonucleotides, specific for both mutant and wild-type alleles of a nucleic acid molecule encoding UCP2 or fragment thereof.
  • the kit may also contain sources of "control" target polynucleotides, as positive and negative controls. Such sources may be in the form of synthetic polynucleotides, patient nucleic acid samples, cloned target polynucleotides, plasmids or bacterial strains carrying positive and negative control DNA.
  • the invention provides an oligonucleotide for determining the identity of a polymo ⁇ hic site of a nucleic acid molecule encoding UCP2 or fragment thereof, wherein:
  • the nucleic acid molecule comprises a segment of a UCP2 molecule
  • the segment comprises the polymo ⁇ hic site; and (c) the oligonucleotide is complementary to the segment.
  • the invention further provides an oligonucleotide, wherein the oligonucleotide is complementary to the target polynucleotide at a region adjacent to or comprising nucleotide position 164 of a coding region of the UCP2 gene.
  • the invention concerns the embodiment in which a chain-terminating nucleotide is labeled with a label selected from the group consisting of: radiolabel, fluorescent label, bioluminescent label, chemilumin ⁇ scent label, nucleic acid, hapt ⁇ n, and enzyme label.
  • a label selected from the group consisting of: radiolabel, fluorescent label, bioluminescent label, chemilumin ⁇ scent label, nucleic acid, hapt ⁇ n, and enzyme label.
  • the invention further concerns the embodiment in which such oligonucleotide is labeled with a label selected from the group consisting of: radiolabel, fluorescent label, bioluminescent label, chemiluminescent label, nucleic acid, hapten, and enzyme label.
  • the invention further provides a primer oligonucleotide for amplifying a region of a target polynucleotide, the region comprising a polymo ⁇ hic site of a nucleic acid molecule encoding UCP2 or fragment thereof (especially one comprising nucleotide position 164 of a coding region of the UCP2 nucleic acid molecule), wherein the primer oligonucleotide is substantially complementary to the target polynucleotide, thereby permitting the amplification of the region of the target polynucleotide.
  • the invention further provides a method for classifying a nucleic acid molecule encoding
  • UCP2 or fragment thereof of an individual for diagnostic or prognostic pu ⁇ oses comprising:
  • the invention further provides a method for classifying a nucleic acid molecule encoding UCP2 or fragment thereof of an individual for diagnostic or prognostic pu ⁇ oses, comprising:
  • the invention particularly concerns the embodiment, wherein the diagnostic and prognostic pu ⁇ oses are (1) the determination of risk for the development of diseases selected from the group consisting of: obesity, non-insulin dependent diabetes mellitus and other UCP2- related diseases and/or (2) the prediction of the clinical course of a disease selected from the group consisting of: obesity, non-insulin dependent diabetes mellitus and other UCP2-related diseases
  • the invention concerns a method for diagnosing obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases in a patient which comprises the steps:
  • the present invention provides a method for diagnosing obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases in a patient which comprises detecting a polymo ⁇ hism in a UCP2 molecule. .
  • the invention further provides a kit for detecting polymo ⁇ hisms in a nucleic acid molecule encoding UCP2 or fragment thereof that comprises:
  • A a first container containing amplification primers for amplifying regions of a nucleic acid molecule encoding UCP2 or fragment thereof; and (B) a second container containing detection oligonucleotides for detecting the polymo ⁇ hisms.
  • Figure 1 provides the amino acid sequence of the UCP2 gene (SEQ ID NOS: 1-3).
  • Figure 2 provides the nucleotide sequence of UCP2 (SEQ JJD NO: 4) described by Boss.
  • Figure 3 provides the location and nucleotide sequence change highlighted in bold associated with the UCP2 polymo ⁇ hism located at nucleotide position 164.
  • Figure 4 shows the GBA analysis of the UCP2 polymo ⁇ hism at nucleotide position 164.
  • Figure 5 shows the scatter plot of diabetic samples at nucleotide position 164.
  • Figure 6 provides the nucleotide sequence of UCP2 gene (SEQ LD NO: 5) described by
  • Figure 7 provides the nucleotide sequence of UCP2 gene (SEQ ID NO: 6) described by Gimeno.
  • Figures 8-13 provide the results of ABI sequencing of UCP2 polymo ⁇ hisms.
  • UCP2 nucleic acid molecule is intended to refer to nucleic acid molecules (either DNA or RNA, and either containing or lacking intervening sequences (introns)) that encodes either a normal UCP2 protein or a mutant (including mutant proteins having an altered amino acid relative to the normal UCP2 protein, or truncated fragments of such normal or mutant proteins).
  • UCP2 nucleic acid molecule polymo ⁇ hisms refers to the polymo ⁇ hisms in the nucleic acid sequence of a UCP2 molecule.
  • GenBank Accession No. 6278763 (herein inco ⁇ orated by reference) is an example of a wild-type UCP2 molecule gene sequence.
  • the first nucleotide of the start codon of the coding region (the adenine of the ATG in a DNA molecule and the adenine of the AUG in an RNA molecule) of the UCP2 gene is considered nucleotide "1.”
  • the first amino acid of the translated protein product (the methionine) is considered amino acid "1.”
  • the term “UCP2 protein molecule” is intended to refer to the wild-type or mutant UCP2 protein or fragments thereof.
  • the term “UCP2 molecule” is used generically to refer to the term UCP2 nucleic acid molecule and the term UCP2 protein molecule.
  • nucleic acid molecules may be double- stranded molecules and that reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand.
  • reference to an adenine, a thymine (uridine), a cytosine, or a guanine at a particular site on one strand of a nucleic acid molecule is also intended to include the thymine (uridine), adenine, guanine, or cytosine (respectively) at the corresponding site on a complementary strand of the nucleic acid molecule.
  • an oligonucleotide may be designed to hybridize to either strand.
  • An example of a preferred polymo ⁇ hism and polymo ⁇ hic site in a gene for a UCP2 molecule includes the following:
  • Wild-type UCP2 nucleotide sequences generally comprise a cytosine at nucleotide 164.
  • Wild-type UCP2 protein sequences generally comprise an alanine at amino acid 55.
  • the term "obesity” has its art recognized meaning, and includes, without limitation, chronic obesity.
  • the term “non-insulin dependent diabetes mellitus” has its art recognized meaning.
  • the methods of the present invention are particularly relevant to the diagnosis of obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases.
  • the methods of the present invention are also particularly relevant to the prognosis of obesity, non-insulin- dependent diabetes mellitus or other UCP2-related diseases.
  • UCP2 -related diseases is meant to include, without limitation, such diseases as atheriosclerosis, hyperinsulinemia, chronic inflammation and associated disorders, diseases relating to thermogenic responses to inflammatory stimuli, diseases relating to thermogenesis, apoptosis, and cachexia.
  • a disease or condition is said to be related to obesity, no ⁇ -insulin dependent diabetes mellitus or other UCP2-related diseases if it possesses or exhibits a symptom of UCP2- related disease.
  • the preferred agents of the present invention are discussed in detail below.
  • the agents of the present invention are capable of being used to diagnose the presence or severity of obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases in a patient suffering from obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases.
  • the agents of the present invention are also capable of being used to prognose the presence or severity of obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases in a person not yet suffering from any clinical manifestations of obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases.
  • Such agents may be either naturally occurring or non-naturally occurring.
  • a naturally occurring agent may be "substantially purified,” if desired, such that one or more agents that is or may be present in a naturally occurring preparation containing that agent will have been removed or will be present at a lower concentration than that at which it would normally be found.
  • the term wild-type "UCP2 protein” refers to a protein having the amino acid sequence of SEQ ID NO: 1.
  • the "agents" of the present invention comprise nucleic acid molecules, proteins, and organic molecules. Where one or more of the agents is a nucleic acid molecule, such nucleic acid molecule may be sense, antisense or triplex oligonucleotides corresponding to any part of the UCP2 cDNA, UCP2 promoter, UCP2 intron, UCP2 exon or UCP2 gene.
  • UCP2 gene refers to the region of DNA involved in producing a UCP2 protein (such as that of SEQ ID NO: 1 or a mutant UCP2 protein); it includes, without limitation, regions preceeding and following the coding region as well as intervening sequences between individual coding regions.
  • wild-type UCP2 gene refers to the nucleic acid sequence of SEQ ID NO:4.
  • UCP2 exon refers to any interrupted region of the UCP2 gene that serves as a template for a mature UCP2 mRNA molecule.
  • UCP2 intron refers to a region of the UCP2 gene which is non-coding and serves as a template for a UCP2 mRNA molecule...
  • UCP2 coding region has been isolated from a non-UCP2-related disease individual and sequenced.
  • the UCP2 coding sequence is set forth in SEQ ID NO: 2.
  • Sequence comparisons of the coding region of a non-UCP2-related disease individual and individuals with UCP2-related disease can identify a number of mutations in individuals with UCP2-related disease.
  • An example of a possible mutation is illustrated in Figure 1.
  • UCPlmtl is the result of the replacement of a cytosine with a thymine at position 164 of the coding region of UCP2 (compare SEQ ID NO: 5 and SEQ ID NO: 6).
  • UCPlmtl can be homozygous or heterozygous.
  • a preferred class of agents of the present invention comprises nucleic acid molecules that encode all or a fragment of UCP2 cDNA or flanking gene sequences, including the UCP2 promoter, and the UCP2 3' non-translated region.
  • UCP2 promoter or “promoter” are used in an expansive sense to refer to the regulatory sequence(s) that control mRNA production. Such sequences include RNA polymerase binding sites, UCP2 response elements, enhancers, etc. All such UCP2 nucleic acid molecules may be used to diagnose the presence and severity of obesity, non-insulin-dependent diabetes mellitus, or other UCP2-related diseases.
  • Such nucleic acid molecules may be either DNA or RNA.
  • Fragment nucleic acid molecules may comprise and encode significant portion(s) of, or indeed most of SEQ ID NOS: 4-6.
  • the fragments may comprise smaller oligonucleotides (having from about 15 to about 250 nucleotide residues, and more preferably, about 15 to about 30 nucleotide residues).
  • Such oligonucleotides include SEQ ID NO: 7-13.
  • UCP2 nucleic acid molecules may be employed to obtain other UCP2 nucleic acid molecules.
  • Such molecules include the UCP2-encoding nucleic acid molecule of non-human animals (particularly, cats, monkeys, rodents and dogs), fragments thereof, as well as their promoters and flanking sequences.
  • Such molecules can be readily obtained by using the above-described primers to screen cDNA or genomic libraries obtained from non-human species. Methods for forming such libraries are well known in the art.
  • Such analogs may differ in their nucleotide sequences from that of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, etc.
  • the UCP2 nucleic acid molecules of the present invention therefore also include molecules that, although capable of specifically hybridizing with UCP2 nucleic acid molecules, may lack "complete complementarity.”
  • SEQ ID NO: 6 SEQ ID NO: 7, SEQ ID NO: 8, etc. may be used to synthesize all or any portion of the amino acids
  • Automated nucleic acid synthesizers may be employed for this pu ⁇ ose.
  • the disclosed SEQ ID NOS:4-6 may be used to define a pair of primers that can be used with the polymerase chain reaction (Mullis, K. et al, Cold Spring Harbor Symp. Quant. Biol. 51, 263-273 (1986); Erlich H. et al, EP 50,424; EP 84,796, EP 258,017, EP 237,362; Mullis, K., EP 201,184; Mullis K. et al, US 4,683.202; Erlich, H., US 4,582,788; and Saiki, R. et al.. US 4,683,194), all of which are herein inco ⁇ orated by reference) to amplify and obtain any desired UCP2 gene DNA molecule or fragment.
  • the UCP2 cDNA, UCP2 promoter sequence(s) and UCP2 flanking sequences can also be obtained by incubating oligonucleotide probes with members of genomic human libraries and recovering clones that hybridize to the probes.
  • methods of "chromosome walking," or 3' or 5' RACE may be used (Frohman, M.A. et al, Proc. Natl. Acad. Sci. (U.S.A.) 85, 8998-9002 (1988). herein inco ⁇ orated by reference); Ohara, O. et al, Proc. Natl. Acad. Sci. (U.S.A.) 86, 5673-5677 (1989), herein inco ⁇ orated by reference) to obtain such sequences.
  • a particularly desired use of the present invention relates to the diagnosis of obesity, non- insulin dependent diabetes mellitus or other UCP2-related diseases.
  • Another particularly desired use of the present invention relates to the prognosis of obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases.
  • Conventional methods for diagnosing or prognosing obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases suffer from inaccuracy, or often require multiple examinations.
  • the agents of the present invention may be used to define superior assays for obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases.
  • the present invention may be employed to diagnose or predict obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases.
  • the agents of the present invention are used to determine whether an individual has a mutation affecting the level (i.e., the concentration of UCP2 mRNA or UCP2 protein in a sample, etc.) or pattern (i.e., the kinetics of expression, rate of decomposition, stability profile, Km, Vmax, etc.) of the UCP2 expression (collectively, the "UCP2 response" of a cell or bodily fluid) (for example, a mutation in the UCP2 gene, or in a regulatory region(s) or other gene(s) that control or affect the expression of UCP2), and being predictive of individuals who would be predisposed to obesity, non-insulin dependent diabetes mellitus or other UCP2- related diseases (prognosis).
  • level i.e., the concentration of UCP2 mRNA or UCP2 protein in a sample, etc.
  • pattern i.e., the kinetics of expression, rate of decomposition, stability profile, Km, Vmax, etc.
  • the UCP2 response
  • the UCP2 response manifested by a cell or bodily fluid is said to be "altered” if it differs from the UCP2 response of cells or of bodily fluids of normal individuals. Such alteration may be manifested by either abnormally increased or abnormally diminished UCP2 response.
  • the UCP2 response manifested by the cell or bodily fluid of the patient is compared with that of a similar cell sample (or bodily fluid sample) of normal individuals.
  • such an analysis is conducted by determining the presence and/or identity of polymo ⁇ hism(s) in the UCP2 gene or its flanking regions which are associated with obesity, non-insulin dependent diabetes mellitus or other UCP2-related diseases, or a predisposition (prognosis) to obesity, non-insulin dependent diabetes mellitus or other UCP2- related diseases.
  • the term "UCP2 flanking regions” refers to those regions which are located either upstream or downstream of the UCP2 coding region.
  • SEQ ID NO: 4 SEQ ID NO: 5
  • SEQ ID NO: 6 SEQ ID NO: 7
  • SEQ ID NO: 8, etc. may be employed as a marker nucleic acid molecule to identify such polymo ⁇ hism(s).
  • polymo ⁇ hisms can be detected through the use of a marker nucleic acid molecule or a marker protein that is genetically linked to (i.e.. a polynucleotide that co- segregates with) such polymo ⁇ hism(s).
  • a marker nucleic acid molecule or a marker protein that is genetically linked to i.e.. a polynucleotide that co- segregates with
  • the UCP2 gene and/or a sequence or sequences that specifically hybridize to the UCP2 gene have been mapped to chromosome 1 l q 13.
  • a marker nucleic acid molecule will have the nucleotide sequence of a polynucleotide that is closely genetically linked to such polymo ⁇ hism(s) (examples of such markers are D1 1 S916 and D1 1S91 1 (WI-1672 and WI- 13873, Whitehead Institute Center for Genome Research radiation hybrid panel), located at chromosome l l ql3).
  • a "polymo ⁇ hism" in the UCP2 gene or its flanking regions is a variation or difference in the sequence of the UCP2 gene or its flanking regions that arises in some of the members of a species.
  • the variant sequence and the "wild-type" sequence co-exist in the species' population. In some instances, such co-existence is in stable or quasi-stable equilibrium.
  • a polymo ⁇ hism is thus said to be "allelic,” in that, due to the existence of the polymo ⁇ hism, some members of a species may have the wild-type sequence (i.e. the wild-type "allele") whereas other members may have the variant sequence (i.e. the variant "allele”).
  • the polymo ⁇ hism is thus said to be di- allelic.
  • the species' population may contain multiple alleles, and the polymo ⁇ hism is termed tri-allelic, etc.
  • a single gene may have multiple different unrelated polymo ⁇ hisms. For example, it may have a di-allelic polymo ⁇ hism at one site, and a multi- allelic polymo ⁇ hism at another site.
  • the variation that defines the polymo ⁇ hism may range from a single nucleotide variation to the insertion or deletion of extended regions within a gene.
  • the DNA sequence variations are in regions of the genome that are characterized by short tandem repeats (STRs) that include tandem di- or tri-nucleotide repeated motifs of nucleotides.
  • STRs short tandem repeats
  • Polymo ⁇ hisms characterized by such tandem repeats are referred to as "variable number tandem repeat" ("VNTR") polymo ⁇ hisms.
  • VNTRs have been -used in identity and paternity analysis (Weber, J.L.. U.S. Patent 5,075,217; Armour, J.A.L. et al, FEBS Lett.
  • oligonucleotide as used herein is defined as a polynucleotide molecule comprised of less than about 100 nucleotides. Preferably, oligonucleotides are between 10 and 35 nucleotides in length. Most preferably, oligonucleotides are 15 to 30 nucleotides in length.
  • oligonucleotide length will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. Short primer oligonucleotides generally require lower temperatures to form sufficiently stable hybrid complexes with the template.
  • Oligonucleotides such as primer oligonucleotides are preferably single stranded, but may alternatively be double stranded. If double stranded, the oligonucleotide is generally first treated to separate its strands before being used for hybridization pu ⁇ oses or being used to prepare extension products. Preferably, the oligonucleotide is an oligodeoxyribonucleotide. Alternatively, the oligonucleotide may be PNA, RNA or a combination thereof. Oligonucleotides may be synthesized chemically by any suitable means known in the art or derived from a biological sample, as for example, by restriction digestion.
  • oligonucleotides may be labeled, according to any technique known in the art, such as with radiolabels, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags, etc.
  • the term "nucleotide” as used herein is intended to refer to ribonucleotides, deoxyribonucleotides, acyclic derivatives of nucleotides, and functional equivalents thereof, of any phosphorylation state.
  • Functional equivalents of nucleotides are those that act as a substrates for a polymerase as, for example, in an amplification method.
  • Functional equivalents of nucleotides are also those that may be formed into a polynucleotide that retains the ability to hybridize in a sequence specific manner to a target polynucleotide.
  • oligonucleotides may be used as probes of a nucleic acid sample, such as genomic DNA, mRNA, or other suitable sources of nucleic acid.
  • a nucleic acid sample such as genomic DNA, mRNA, or other suitable sources of nucleic acid.
  • the oligonucleotides must be capable of specifically hybridizing to a target polynucleotide or UCP2 nucleic acid molecule * .
  • nucleic acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double- stranded nucleic acid structure under hybridizing conditions, whereas they are substantially unable to form a double-stranded .structure when incubated with a non-UCP2 nucleic acid molecule under the same conditions.
  • a nucleic acid molecule is said to be the "complement” of another nucleic acid molecule if it exhibits complete complementarity.
  • molecules are said to exhibit "complete complementarity" when every nucleotide of one of the molecules is complementary to a nucleotide of the other.
  • Two molecules are said to be “substantially complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low-stringency” conditions.
  • the molecules are said to be “complementary * " if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency” conditions.
  • Conventional stringency conditions are described, for example, by Sambrook, J., et al, (In: Molecular Cloning, a Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, New York (1989)), and by Haymes, B.D., et al. (In: Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985)).
  • a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand.
  • non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the strand to hybridize therewith for the pu ⁇ oses employed.
  • the primers typically have exact complementarity to obtain the best results.
  • an oligonucleotide is generally complementary in sequence and able to form a stable double-stranded structure with a target polynucleotide under the particular environmental conditions employed.
  • the term "oligonucleotide” also refers to an oligonucleotide that is able to hybridize to a region of a target polynucleotide that is either adjacent to or spans the sequence, mutation, or polymo ⁇ hism being detected and is substantially unable to hybridize to a corresponding region of a target polynucleotide that either does not contain the sequence, mutation, or polymo ⁇ hism being detected or contains an altered sequence, mutation, or polymo ⁇ hism.
  • oligonucleotides may be employed for each target polynucleotide.
  • oligonucleotides will be completely complementary to the target polynucleotide. However, departures from complete complementarity are permissible.
  • oligonucleotide In order for an oligonucleotide to serve as a primer oligonucleotide, however, it typically need only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular environmental conditions employed. Establishing environmental conditions typically involves selection of solvent and salt concentration, incubation temperatures, and incubation times.
  • primer or "primer oligonucleotide” as used herein refer to an oligonucleotide as defined herein, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, as for example, in a PCR reaction.
  • primer oligonucleotides may be labeled, according to any technique known in the art, such as with radiolabels, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags, etc.
  • the oligonucleotides or the target polynucleotide may be either in solution or affixed to a solid support.
  • oligonucleotides will be attached to a solid support, though in certain embodiments of the present invention oligonucleotides may be in solution.
  • the target polynucleotide is preferably bound to a solid support. In those embodiments where the oligonucleotides or the target polynucleotides are attached to a solid support, attachment may be either covalent or non-covalent.
  • Attachment may be mediated, for example, by antibody-antigen- type interactions, poly-L-Lys, streptavidin or avidin-biotin, salt-bridges, hydrophobic interactions, chemical linkages, UV cross-linking, baking, etc.
  • oligonucleotides may be synthesized directly on a solid support or attached to the solid support subsequent to synthesis.
  • oligonucleotides are affixed a solid support such that a free 3'-OH is available for polymerase-mediated primer extension.
  • Suitable solid supports for the present invention include substrates constructed of silicon, glass, plastic (polystyrene, nylon, polypropylene, etc.), paper, etc. Solid supports may be formed, for example, into wells (as in 96-well dishes), plates, slides, sheets, membranes, fibers, chips, dishes, and beads.
  • the solid support is treated, coated, or derivatized so as to facilitate the immobilization of an oligonucleotide or a target polynucleotide.
  • Preferred treatments include coating, treating, or derivatizing with poly-L-Lys, streptavidin, antibodies, silane derivatives, low salt, or acid.
  • the agents of the present invention are most preferably used in the diagnosis and prognosis of obesity, non-insulin-dependent diabetes mellitus. and other UCP2-related diseases.
  • the identity of at least one polymo ⁇ hic site in a nucleic acid molecule encoding UCP2 or fragment thereof is determined.
  • the identity of more than one polymo ⁇ hic site is determined.
  • the identity of between about two and about six polymo ⁇ hic sites are determined, though the identification of other numbers of sites is also possible.
  • at least one polymo ⁇ hism in a nucleic acid molecule encoding UCP2 or fragment thereof is identified.
  • the agents of the present invention are utilized in determining the identity of at least one polymo ⁇ hic site of a nucleic acid molecule encoding UCP2 or fragment thereof and using that identity as a predictor for the development of, or the clinical course of, at least one disease selected from the group consisting of: obesity, non-insulin-dependent diabetes mellitus. and other UCP2-related diseases.
  • the polymo ⁇ hisms of the present invention may be characterized using any of a variety of suitable methods. Suitable methods comprise direct or indirect sequencing methods (including primer extension), restriction site analysis, hybridization methods, nucleic acid amplification methods, gel migration methods, the use of antibodies that are specific for the proteins encoded by the different alleles of the polymo ⁇ hism, or by other suitable means. Alternatively, many such methods are well known in the art and are described, for example in T. Maniatis et al. Molecular Cloning, a Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, New York (1989), J.W. Zyskind et al, Recombinant DNA Laboratory Manual, Academic Press, Inc.. New York (1988), and in R. Elles, Molecular Diagnosis of Genetic Diseases, Humana Press, Totowa, New Jersey (1996), all of which are herein inco ⁇ orated by reference.
  • Identification methods may be of either a positive-type or a negative-type. Positive-type methods determine the identity of a nucleotide contained in a polymo ⁇ hic site, whereas negative-type methods determine the identity of a nucleotide not present in a polymo ⁇ hic site.
  • a wild-type site may be identified either as wild-type or not mutant. For example, at a biallelic polymo ⁇ hic site where the. wild-type allele contains an adenine and the mutant allele contains a cytosine. a site may be positively determined to be either adenine or cytosine or negatively determined to be not adenine (and thus cytosine) or not cytosine (and thus adenine).
  • a target polynucleotide containing a mutated site may be identified positively by hybridizing to an oligonucleotide containing the mutated site or negatively, by failing to hybridize to a wild-type oligonucleotide.
  • a restriction site may be determined to be present or lacking.
  • Direct sequencing by methods such as dideoxynucleotide sequencing (Sanger), cycle sequencing, or Maxam-Gilbert sequencing are examples of suitable methods for determining the identity of a nucleotide at a polymo ⁇ hic site of a target polynucleotide. Such methods are widely known in the art and are discussed at length, in the above-cited texts.
  • Both the dideoxy-mediated method and the Maxam-Gilbert method of DNA sequencing require the prior isolation of the DNA molecule which is to be sequenced.
  • the sequence information is obtained by subjecting the reaction products to electrophoretic analysis (typically using polyacrylamide gels).
  • electrophoretic analysis typically using polyacrylamide gels.
  • a sample is applied to a lane of a gel, and the various species of nested fragments are separated from one another by their migration velocity through the gel.
  • the number of nested fragments which can be separated in a single lane is approximately 200- 300 regardless of whether the Sanger or the Maxam-Gilbert method is used.
  • extraneous sequence information is typically produced.
  • the chief advantage of direct sequencing lies in its utility for locating previously unidentified polymo ⁇ hic sites.
  • Restriction enzymes are specific for a particular nucleotide sequence.
  • the identity of a nucleotide at a polymo ⁇ hic site is determined by the presence or absence of a restriction enzyme site.
  • restriction enzymes A large number of restriction enzymes are known in the art and, taken together, they are capable of recognizing at least one allele of many polymo ⁇ hisms. This feature of restriction enzymes may be utilized in a variety of methods for identifying a polymo ⁇ hic site.
  • Restriction fragment length polymo ⁇ hism (RFLP) analysis is an example of a suitable method for identifying a polymo ⁇ hic site with restriction enzymes (Lentes et al, Nucleic-Acids Res. 16, 2359 (1988); and C.K. McQuitty et al, Hum.
  • At least one target polynucleotide is digested with at least one restriction enzyme and the resultant
  • restriction fragments are separated based on mobility in a gel. Typically, smaller fragments migrate faster than larger fragments. Consequently, a target polynucleotide that contains a particular restriction enzyme recognition site will be digested into two or more smaller fragments, which will migrate faster than a larger fragment lacking the restriction enzyme site.
  • oligonucleotides are utilized in performing such hybridization-based methods.
  • oligonucleotides are chosen that are capable of specifically hybridizing to only one allele of a UCP2 nucleic acid molecule at a region comprising a polymo ⁇ hic site.
  • sets of oligonucleotides are preferably chosen that have melting temperatures within 5°C of each other when hybridizing to their complete complement. Most preferably, such sets of oligonucleotides are chosen so as to have melting temperatures within 2°C of each other.
  • hybridization methods are described in standard manuals such as Molecular Cloning. A Laboratory Manual (2nd Ed., Sambrook, Fritsch and Maniatis, Cold Spring Harbor); and Current Protocols in Molecular Biology (Eds. Ausubel, Brent, Kingston, More, Feidman, Smith and Sea, Greene Publ. Assoc, Wiley-Interscience, N.Y., N.Y., 1992) or that are otherwise known in the art.
  • preferred hybridization methods include Southern, northern, and dot blot hybridizations, oligonucleotide hybridizations (Hall et al, The Lancet 345. 1213-1214 (1995)), reverse dot blot hybridizations (Sakai et al, Nucl. Acids. Res. 86, 6230- 6234 (1989)), DNA chip hybridizations (Drmanac et al, U.S. Patent 5,202,231), and hybridizations to oligonucleotides.
  • Macevicz (U.S. Patent 5,002,867), for example, describes a method for deriving nucleic acid sequence information via hybridization with multiple mixtures of oligonucleotide probes.
  • the sequence of a target polynucleotide is determined by permitting the target to sequentially hybridize with sets of probes having an invariant nucleotide at one position, and a variant nucleotides at other positions.
  • the Macevicz method determines the nucleotide sequence of the target by hybridizing the target with a set of probes, and then determining the number of sites that at least one member of the set is capable of hybridizing to the target (i.e. the number of "matches"). This procedure is repeated until each member of a sets of probes has been tested.
  • a marker nucleic acid will be used that is capable of specifically detecting UCPlmtl or. UCPlmtl, or a combination of these mutations.
  • Methods to detect base(s) substitutions, base(s) deletions and base(s) additions are known in the art (i.e. methods to genotype an individual).
  • GAA Genetic Bit Analysis
  • Goelet, P. et al, (WO 92/15712. herein inco ⁇ orated by reference) is a preferred method for determining the identity of a nucleotide at a predetermined polymo ⁇ hic site in a target polynucleotide.
  • GBA is a method of polymo ⁇ hic site interrogation in which the nucleotide sequence information surrounding the site of variation in a target DNA sequence is used to design an oligonucleotide primer that is complementary to the region immediately adjacent to, but not including, the variable nucleotide in the target DNA.
  • the target DNA template is selected from the biological sample and hybridized to the interrogating primer.
  • This primer is extended by a single labeled dideoxynucleotide using DNA polymerase in the presence of two, and preferably all four chain terminating nucleoside triphosphate precursors.
  • Delayed extraction PinPoint MALDI-TOF mass spectrometry is another method capable of determining the identity of the inco ⁇ orated non-extendible nucleotide by the change in mass of the extended primer (Haff. L. A. et al., Genome Methods 7:378-388 (1997), herein inco ⁇ orated by reference).
  • the detection of polymo ⁇ hic sites in a sample of DNA may be facilitated through the use of nucleic acid amplification methods. Such methods specifically increase the concentration of polynucleotides that span the polymo ⁇ hic site, or include that site and sequences located either distal or proximal to it. Such amplified molecules can be readily detected by gel electrophoresis or other means.
  • a non-extendible nucleotide may be labeled, preferably with 35 S or a florescent molecule.
  • Other labels suitable for the present invention include, but are not limited to, biotin, iminobiotin, hapten, an antigen, a cofactor, dintrophenol, lipoic acid, an olefinic compound, a detectable polypeptide, a molecule that is electron dense, an enzyme capable of depositing an insoluble reaction product.
  • Florescent molecules suitable for the present invention include, but are not limited to. fluorescein. rhodamine.
  • Electron dense indicator molecules suitable for the present invention include, but are not limited to, ferritin, hemocyanin and colloidal gold.
  • the detectable polypeptide may be indirectly detectable by specifically complexing the detectable polypeptide with a second polypeptide covarridin, and the second polypeptide is preferably selected from the group consisting of biotin and iminobiotin.
  • the detection of polymo ⁇ hic sites in a sample of DNA may be facilitated through the use of DNA amplification methods. Such methods specifically increase the concentration of sequences that span the polymo ⁇ hic site, or include that site and sequences located either distal or proximal to it. Such amplified molecules can be readily detected by gel electrophoresis or other means.
  • PCR polymerase chain reaction
  • the amplified region is 100-300 base pair, however it is understood that sequences well in excess of 1 kb and even 10 kb may be amplified using PCR.
  • LCR Ligase Chain Reaction
  • LCR can be performed with oligonucleotides having the proximal and distal sequences of the same strand of a polymo ⁇ hic site.
  • either oligonucleotide will be designed to include the actual polymo ⁇ hic site of the polymo ⁇ hism.
  • the reaction conditions are selected such that the oligonucleotides can be ligated together only if the target molecule either contains or lacks the specific nucleotide that is complementary to the polymo ⁇ hic site present on the oligonucleotide.
  • the oligonucleotides may be selected such that they do not include the polymo ⁇ hic site (see, Segev, D., PCT Application WO 90/01069).
  • OLA Oligonucleotide Ligation Assay
  • Nickerson, D.A. et al have described a nucleic acid detection assay that combines attributes of PCR and OLA (Nickerson, D.A. et al, Proc. Natl. Acad. Sci. (U.S.A.) 87, 8923- 8927 ( 1990). In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA.
  • nucleic acid amplification procedures such as allele-specific oligomers, branched DNA technology, transcription-based amplification systems, or isothermal amplification methods may also be used to amplify and analyze such polymo ⁇ hisms (Malek, L.T. et al, U.S. Patent 5,130,238; Davey, C. et al, European Patent Application 329,822; Schuster et al, U.S. Patent 5,169,766; Miller, H.I. et al, PCT appln. WO 89/06700; Kwoh, D. et al, Proc. Natl. Acad. Sci.
  • the identification of a polymo ⁇ hism in the UPC2 molecule can be determined in a variety of ways. By correlating the presence or absence of UCP2-related disease in an individual with the presence or absence of a polymo ⁇ hism in a UCP2 nucleic acid molecule or its flanking regions, it is possible to diagnose the predisposition (prognosis) of an asymptomatic patient to UCP2-related disease.
  • a polymo ⁇ hism creates or destroys a restriction endonuclease cleavage site, or if it results in the loss or insertion of DNA (e.g., a VNTR polymo ⁇ hism)
  • it will alter the size or profile of the DNA fragments that are generated by digestion with that restriction endonuclease.
  • individuals that possess a variant sequence can be distinguished from those having the wild-type sequence by restriction fragment analysis.
  • Polymo ⁇ hisms that can be identified in this manner are termed "restriction fragment length polymo ⁇ hisms" ("RFLPs").
  • RFLPs have been widely used in human and animal genetic analyses (Glassberg, J., UK patent Application 2135774; Skolnick, M.H.
  • a preferred method of achieving such identification employs the single-strand conformational polymo ⁇ hism (SSCP) approach.
  • the SSCP technique is a method capable of identifying most sequence variations in a single strand of DNA, typically between 150 and 250 nucleotides in length (Elles, In: Methods in Molecular Medicine: Molecular Diagnosis of Genetic Diseases, Humana Press (1996), herein inco ⁇ orated by reference); Orita et al, Genomics 5, 874-879 (1989), herein inco ⁇ orated by reference). Under denaturing conditions a single strand of DNA will adopt a conformation that is uniquely dependent on its sequence conformation. This conformation usually will be different, even if only a single base is changed.
  • a sample nucleic acid molecule is obtained from a patient's cells.
  • the nucleic acid molecule sample is obtained from the patient's blood.
  • any source of nucleic acid molecule from the patient may be used.
  • the nucleic acid molecule can be subjected to restriction endonuclease digestion.
  • UCP2 * is used as a probe in accordance with the above-described RFLP methods. By comparing the RFLP pattern of the UCP2 gene obtained from normal and UCP2-related disease patients, one can determine a patient's predisposition (prognosis) to UCP2-related disease.
  • the polymo ⁇ hism obtained in this approach can then be cloned to identify the mutation at the coding region which alters the protein's structure or regulatory region of the gene which affects its expression level. Changes involving promoter interactions with other regulatory proteins can be identified by, for example, gel shift assays using cell extracts, serum, etc. Interactions of UCP2 protein in UCP2 related disease cell -extracts, serum, etc. can be compared to control samples to
  • One aspect of the present invention concerns antibodies, single-chain antigen binding molecules, or other proteins that specifically bind to one or more of the protein or peptide molecules of the present invention and their homologues. Such antibodies may be used to quantitatively or qualitatively detect the protein or peptide molecules of the present invention. As used herein, an antibody or peptide is said to "specifically bind" to a protein or peptide molecule of the present invention if such binding is not competitively inhibited by the presence of non-related molecules.
  • Nucleic acid molecules that encode all or part of the protein of the present invention can be expressed, via recombinant means, to yield protein or peptides that can in turn be used to elicit antibodies that are capable of binding the expressed protein or peptide. Such antibodies may be used in immunoassays for that protein.
  • Such protein-encoding molecules, or their fragments may be a "fusion" molecule (i.e., a part of a larger nucleic acid molecule) such that, upon expression, a fusion protein is produced. It is understood that any of the nucleic acid molecules of the present invention may be expressed, via recombinant means, to yield proteins or peptides encoded by these nucleic acid molecules.
  • polymo ⁇ hisms may be identified through such methods. Examples of such classes include: (1) polymo ⁇ hisms present in the UCP2 cDNA of different individuals; (2) polymo ⁇ hisms in non-translated UCP2 gene sequences, including the promoter or other regulatory regions of the UCP2 gene; (3) polymo ⁇ hisms in genes whose products interact with UCP2 regulatory sequences; and (4) polymo ⁇ hisms in gene sequences whose products interact with the UCP2 protein, or to which the UCP2 protein binds.
  • the evaluation is conducted using oligonucleotide
  • probes whose sequence is complementary to that of a portion of SEQ SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7. SEQ ID NO: 8, etc.. Such molecules are then incubated with cell extracts of a patient under conditions sufficient to permit nucleic acid hybridization.
  • the agents of the present invention can be formulated according to known methods to prepare pharmacologically acceptable compositions, whereby these materials, or their functional derivatives, having the desired degree of purity are combined in admixture with a physiologically acceptable carrier, excipient. or stabilizer. Such materials are non-toxic to recipients at the dosages and concentrations employed.
  • the active component of such compositions may be agents, analogs or mimetics of such molecules. Where nucleic acid molecules are employed, such molecules may be sense, antisense or triplex oligonucleotides of the UCP2 promoter, UCP2 cDNA, UCP2 intron, UCP2 exon or UCP2 gene.
  • a composition is said to be "pharmacologically acceptable” if its administration can be tolerated by a recipient patient.
  • An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient.
  • Suitable vehicles and their formulation, inclusive of other human proteins, e.g., human serum albumin, are described, for example, in Remington's Pharmaceutical Sciences.
  • the composition is to be water soluble, it may be formulated in a buffer such as phosphate or other organic acid salt preferably at a pH of about 7 to 8.
  • composition is only partially soluble in water, it may be prepared as a microemulsion by formulating it with a nonionic surfactant such as polyoxyethylenesorbitan (Tween), Pluronics, or PEG, e.g., Tween 80, in an amount of, for example, 0.04-0.05% (w/v), to increase its solubility.
  • a nonionic surfactant such as polyoxyethylenesorbitan (Tween), Pluronics, or PEG, e.g., Tween 80, in an amount of, for example, 0.04-0.05% (w/v), to increase its solubility.
  • Tween 80 polyoxyethylenesorbitan
  • water soluble as applied to the polysaccharides and polyethylene glycols is meant to include colloidal solutions and dispersions.
  • the solubility of the cellulose derivatives is determined by the degree of substitution of ether groups, and the stabilizing derivatives useful herein should have a sufficient quantity of such ether groups per anhydroglucose unit in the cellulose chain to render the derivatives water soluble.
  • a degree of ether substitution of at least 0.35 ether groups per anhydroglucose unit is generally sufficient.
  • the cellulose derivatives may be in the form of alkali metal salts, for example, the Li, Na, K or Cs salts.
  • antioxidants e.g., ascorbic acid
  • low molecular weight less than about ten residues polypeptides, e.g., polyarginine or tripeptides
  • proteins such as serum albumin, gelatin, or immunoglobulins: hydrophilic polymers such as polyvinyl pyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, mannose, or dextrins; chelating agents such as EDTA; and sugar alcohols such as mannitol or sorbitol.
  • antioxidants e.g., ascorbic acid
  • low molecular weight less than about ten residues polypeptides, e.g., polyarginine or tripeptides
  • proteins such as serum albumin, gelatin, or immunoglobulins: hydrophilic polymers such as polyvinyl pyrrolidon
  • Controlled or sustained release preparations may be achieved through the use of polymers to complex or absorb the UCP2 agent(s) of the composition.
  • the controlled delivery may be exercised by selecting appropriate macromolecules (for example polyesters, polyamino acids, polyvinyl pyrrolidone, ethylenevinylacetate, methylcellulose, carboxymethylcellulose, or protamine sulfate) and the concentration of macromolecules as well as the methods of inco ⁇ oration in order to control release.
  • Sustained release formulations may also be prepared, and include the formation of microcapsular particles and implantable articles.
  • the UCP2 agent(s) of the composition is preferably inco ⁇ orated into a biodegradable matrix or microcapsule.
  • a suitable material for this pu ⁇ ose is a polylactide, although other polymers of poly-(a-hydroxycarboxylic acids), such as poly-D-(-)-3-hydroxybutyric acid (EP 133,988 A), can be used.
  • Other biodegradable polymers include poly(lactones), poly(orthoesters), polyamino acids, hydrogels, or poly(o ⁇ thocarbonates) poly(acetals).
  • the polymeric material may also comprise polyesters, poly(lactic acid) or ethylene vinylacetate copolymers.
  • sustained release compositions see U.S. Patent No. 3,773.919, EP 58,481 A, U.S. Patent No. 3.887,699, EP 158,277 A, Canadian Patent No. 1 176565, Sidman. U. et al. Biopolymers 22, 547 ( 1983), and Langer. R. et al, Chem. Tech. 12, 98 (1982), all of which are herein inco ⁇ orated by reference.
  • microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethvlcellulose or gelatine-microcapsules and poly(methylmethacylate) microcapsules, respectively, or in colloidal drug delivery systems, for example, liposomes, albumin microspheres, microemulsions, nanoparticles. and nanocapsules or in macroemulsions.
  • coacervation techniques for example, hydroxymethvlcellulose or gelatine-microcapsules and poly(methylmethacylate) microcapsules, respectively
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nanoparticles. and nanocapsules or in macroemulsions.
  • liposome formulations and methods that permit intracellular uptake of the molecule will be employed. Suitable methods are known in the art, see. for example, Chicz, R.M. et al. (PCT Application WO 94/04557), Jaysena, S.D. et al. (PCT Application WO93/12234), Yarosh. D.B. (U.S. Patent No. 5,190,762), Callahan, M.V. et al. (U.S. Patent No. 5,270.052) and Gonzalezro, R.J. (PCT Application 91/05771), all of which are herein inco ⁇ orated by reference.
  • PCR primers are designed such that the 3' ends of the hybridized primers are positioned in unique regions not homologous with sequences of the related genes UCPl and UCP3. This is done to insure specific amplification of the targeted region within the UCP2 gene without co- amplification of related sequences.
  • the oligonucleotides are ordered from Midland Co. (Midland, Texas). The oligonucleotides are desalted, OPC (cartridge) purified and diluted to 200 ⁇ M.
  • One PCR primer contains four protective phosphorothioated bases at the 5' ends enabling selective digestion of the unprotected strand by T7 gene 6 exonuclease during subsequent TargExTM treatment (Nikiforov et al, PCR Methods Appl 3, 285-291 (1994); T. Nikiforov, U. S. Patent No. 5,518,900).
  • the GBA primer is designed to capture the single-stranded PCR product by hybridization. Selection of the target strand and GBA primer are based on evaluations of PCR product and GBA primer secondary structure stabilities (measured in -kcal/mol).
  • the GBA primer, 27 bp in length, is designed such that the 3' end is immediately adjacent to the polymo ⁇ hism of interest (Table 2).
  • Target polynucleotide is amplified from the patient genomic DNA by PCR, using primers sufficient for amplifying regions comprising nucleotide 164 of a UCP2 molecule. Primers are chosen such that amplified products are each about 100-200 nucleotides in length.
  • Synthetic DNA templates (30 bp), complimentary to the GBA primer, are designed to mimic the single-stranded PCR product and are used as PCR-independent positive controls (Table 2).
  • the primers and synthetic templates used for the UCP2 site 164 polymo ⁇ hism are as shown in Table 2. Sequences for forward and reverse PCR primers, the GBA capture primer and synthetic templates (ST) are given. The two X's in the GBA capture primer sequence refer to c3 linkers in place of base analogs. This reduces template independent noise. Synthetic template controls are denoted by the signal expected in GBA (i.e. ST-T is a synthetic template with an "A" (bolded) at the polymo ⁇ hic site of interest giving a "T” signal during primer extension). GBA extension for UCP2-164 yields a "C" wild-type signal and a "T” mutant extension signal.
  • the first four bases of the reverse PCR primer are phoshorothioated (4P) at the 5' end for protection against exonuclease digestion during TargEx treatment, prior to hybridization of the template strand to the GBA primer.
  • the strand opposite of the GBA primer is phosphorothioated.
  • PCR reactions are assembled in 96-well polycarbonate plates (Corning Costar, Corning. NY) using standard and multi-channel pipetmen. Reactions are overlaid with 30 ⁇ l of mineral oil using a Multidrop (ICN Instruments, Costa Mesa CA) and are amplified in a BioTherm III thermocycler (6 plate capacity; Sun BioScience, Branford, CT). The final concentration of each reaction is 400mM each dNTP, 50mM KCL, lOmM Tris-HCL (pH 8.5), 1.5mM MgCl 2 , 0.5 ⁇ M each PCR primer. 75 ng genomic DNA.
  • GBA primers Attachment of GBA primers to microtiter plates (Immulon 4; Dynatech, Chantilly, VA) is accomplished by non-specific adso ⁇ tion of the oligonucleotides to the plastic surface facilitated by the cationic detergent N,N-dimethyloctylamine (ODA; Aldrich, Milwaukee, WI).
  • ODA cationic detergent
  • the GBA primer is diluted to 200nM in a 50mM ODA solution titrated to pH 7.5 with concentrated HC1. Fifty microliters (lOpmol/well) of diluted GBA primer are added to each well of the microtiter plates and incubated overnight at 37 °C. Plates are then washed three times with lx TNTw (10 mM Tris-HCl, pH 7.5; 150 mM NaCl; 0.05% Tween 20) before use.
  • lx TNTw 10 mM Tris-HCl, pH 7.5; 150 mM NaCl
  • Samples of unknown ethnicity or UCP2-related conditions are prepared according to standard phenol/chloroform extraction and ethanol precipitation procedures (See, Maniatis, T., In: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989).
  • An additional set of 10 samples from diabetic patients, (nine type II diabetics and one type I diabetic) are also amplified and genotyped at site 164 as described for the random samples.
  • Oligonucleotides are prepared by solid-phase synthesis according to the methods of Skerra, Vosberg et al, and Noronha et al. (A. Skerra, Nucl. Acids Res. 20, 3551-3554 (1992); H.P. Vosberg et al, Biochem. 16, 3633 (1977); de Noronha, C. M. et al, PCR Methods Appl. 2, 131-6 (1992); T. Nikiforov, U. S. Patent No. 5,518,900).
  • PCR products are converted to single-stranded templates by selective digestion with T7 Gene 6 exonuclease (USB, Cleveland, OH; Nikiforov et al, PCR
  • the exonuclease (40 U/ ⁇ l) is diluted to a final concentration of 3 U/ ⁇ l in a buffer containing 5mM Tris-HCl, pH 7.5, O. lmM dithiothreitol and 5 ⁇ g/ml acetylated bovine serum albumin (BSA; Sigma, St. Louis, MO). Eighteen units of the exonuclease are then added to each 30 ⁇ l PCR reaction (0.6 U/ ⁇ l final concentration) and allowed to incubate at either room temperature for 60 minutes, or at 37 °C for 30 minutes. The template strand to be assayed is protected from digestion by four phosphorothioate bonds at the 5' end of the modified PCR primer as described above.
  • BSA bovine serum albumin
  • Hybridization salts are added to the exonuclease-treated PCR products (final concentration of 1.5mM NaCl/lOmM EDTA) before transfer of the products to GBA plates.
  • Hybridization of the product/salts to the GBA primers is carried out at room temperature for 1 hour with intermittent vibration. Following the incubation, the plates are washed three times with I x TNTw.
  • polymerase extension mix containing one fluorescein labeled ddNTP (ddCTP), one biotin labeled ddNTP (ddTTP) and two unlabeled ddNTPs (ddATP and ddGTP) are .added.
  • the polymerase extension mixes contained final concentrations of 1.5uM of each ddNTP, 20mM Tris-HCl (pH 8.0), O.lmM EDTA (pH 8.0), 25mM NaCl, l OmM MgCl 2 , lOmM MnCl and 15mM sodium isocitrate.
  • Extension reactions are performed at room temperature for 15 minutes using 0.6 units of Klenow fragment of DNA polymerase I (exonuclease-free) per well. Following primer extension, reactions are quenched with 30 ⁇ l per well of 0.2M EDTA (pH 8.0) and the plates are washed three times with lx TNTw. The template strand is then stripped from the extended GBA primer by washing with 100 ⁇ l per well of 0.1N NaOH followed by three more washes with lx TNTw.
  • each well is incubated for 30 minutes with 30 ⁇ l of a predetermined dilution of anti-fluorescein-alkaline phosphatase (Boehringer Manheim, Indianapolis, IN) in 1 x TNTw / 1 % BSA for detection of fluoresceinated nucleotides.
  • a predetermined dilution of anti-fluorescein-alkaline phosphatase Boehringer Manheim, Indianapolis, IN
  • 1 x TNTw / 1 % BSA for detection of fluoresceinated nucleotides.
  • 100 ml of the substrate p-nitrophenyl phosphate Moss. Pasadena, MD
  • Raw data optical densities are collected by a standard microtiter plate reader (ICN, Costa Mesa, CA) at 405 nm following a 24 minute substrate incubation. Plates are washed three times with 1 x TNTw to prepare for biotin detection. Each well is then incubated for 30 minutes with 30 ⁇ l of a pre-determined dilution of anti-biotin-horse radish peroxidase conjugate (Zymed, San Francisco. CA) in l x TNTw / 1 % BSA for detection of biotinylated nucleotides.
  • the raw OD data are captured for each microtiter plate by a standard plate reader (ICN, Costa Mesa, CA) and analyzed by the Molecular Tool software program GenoMatic which uses cluster analyses of the raw OD signals to determine sample genotypes (MacKay, D. Neural Computation 6, 415-447, 448-472, 590-604, 720-736 (1992)). Each genotype call is automatically assigned a confidence measure according to the most likely or probable cluster in which a data point was assigned. Automated genotype calls are corroborated by visual inspection of the data.
  • Eighty test samples 70 random (20 in duplicate), 10 diabetic samples, and 4 negative PCR controls (water) are assembled and amplified in 96-well plates. The 70 random samples and the 10 diabetic samples are run in independent assays. Following amplification, TargEx treatment and hybridization salt addition, the single-stranded templates are transferred to GBA plates using a multichannel pipetmen. Additionally, 6 negative GBA controls (GBA primer only) and 6 positive synthetic template controls (representing both homozygous genotypes and heterozygous genotypes), specific for the GBA primer (400fmol per well), are added to assigned wells (Table 3).
  • the positive and negative control wells are evaluated by average optical density (OD) signal strengths (Table 3).
  • the average positive control signal strengths measured approximately 2.5 OD units (Table 3).
  • Negative control wells are clean, giving average background signals of 0.05 to 0.15 OD (Table 3). Samples are evaluated based on the relevant data from the control wells.
  • raw 405 nm data fluoroscein readings
  • raw 620 nm data biological readings
  • three clusters of genotypes may be observed: XX and YY homozygous samples cluster along the x and y axes and heterozygous samples cluster along the diagonal.
  • the data for UCP2-164 shows robust signals of 2.3 to 3.3 OD units for the test samples.
  • GenoMatic cluster analysis of the unknown samples relative to the positive and negative controls yield 3 genotype groups; CC homozygotes, TC heterozygotes and TT homozygotes.
  • Theoretical and observed genotype frequencies are calculated and are presented in Table 4.
  • the allele frequency of the 50 unique samples tested was 0.67 C / 0.33 T.
  • the genotype frequency of the population shows an abundance of heterozygous samples and fewer than expected T-homozygous samples.
  • the rare homozygote TT in this sample set may be indicative of a disease carrying gene.
  • the allele frequency from this 10-person study is 0.60 C / 0.40 T.
  • Three individuals from the Example I GBA population study are sequenced on an ABI 373 model by standard dye terminator sequencing methods (Perkin Elmer Applied Biosystems DNA sequencing kit, dye terminator cycle sequencing with AmpliTaq DNA polymerase, FS, part 402079. Great Britain).
  • One set of primers is used for PCR and the sequencing reactions.
  • the forward primer sequence is 5' AGCTGCCTGCATCGCAGATC and the reverse primer sequence is 5' CGGACAGAGGCAAAGCTCATTTG.
  • These primers amplify around the polymo ⁇ hism at nucleotide 164 and are designed to avoid co-amplification of the related genes UCPl and UCP3 as described previously in Example I.
  • the amplicon is approximately 350 bp in length and contains an intronic region.
  • Cycle sequencing is done in a Perkin-Elmer Cetus DNA Thermal Cycler (Perkin Elmer, Norwalk, CT). by the following steps: 96°C, 1 minute initial denaturation; 96°C. 30 seconds; 45°C, 15 seconds: 60°C, 4 minutes, for 25 cycles.
  • Figures 8-13 shows the forward and reverse strand sequencing results for the polymorphism at nucleotide 164.
  • the traces from Figures 8 and 9, respectively, show the forward and reverse sequences, respectively, for a homozygous wild type individual (nucleotide 164 is marked with a yellow arrow).
  • Figures 10 and 1 1 respectively, show the results from a heterozygous individual at nucleotide 164 and Figures 12 and 13. respectively, show forward and reverse traces of an individual homozygous for the mutation.

Abstract

La présente invention concerne les polymorphismes d'une molécule d'UCP2 ou d'un fragment de cette dernière. L'invention se rapporte également aux polymorphismes d'une molécule d'acide nucléique codant l'UCP2 ou un fragment de celle-ci. L'invention concerne des agents et des procédés permettant de détecter ces polymorphismes, ainsi que l'utilisation de ces agents et de ces procédés dans le diagnostic, le pronostic et le choix d'un traitement contre l'obésité, contre le diabète non-insulino dépendant et contre d'autres affections associées à l'UCP2.
PCT/US1999/001198 1998-01-23 1999-01-21 Polymorphismes d'un nucleotide du gene de la proteine decouplante 2 (ucp2) WO1999037812A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU24613/99A AU2461399A (en) 1998-01-23 1999-01-21 Single nucleotide polymorphisms of the uncoupling protein 2 (ucp2) gene

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US1221898A 1998-01-23 1998-01-23
US09/012,218 1998-01-23

Publications (2)

Publication Number Publication Date
WO1999037812A1 true WO1999037812A1 (fr) 1999-07-29
WO1999037812A9 WO1999037812A9 (fr) 1999-10-14

Family

ID=21753916

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/001198 WO1999037812A1 (fr) 1998-01-23 1999-01-21 Polymorphismes d'un nucleotide du gene de la proteine decouplante 2 (ucp2)

Country Status (2)

Country Link
AU (1) AU2461399A (fr)
WO (1) WO1999037812A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002036829A2 (fr) * 2000-11-01 2002-05-10 Agy Therapeutics, Inc. Procedes de diagnostic de prevention et de traitement de troubles neurologiques et de lesions neuronales
WO2002038808A2 (fr) * 2000-11-08 2002-05-16 Hybaid Limited Unite d'hybridation de lames
US6632641B1 (en) 1999-10-08 2003-10-14 Metrigen, Inc. Method and apparatus for performing large numbers of reactions using array assembly with releasable primers
EP1825002A2 (fr) * 2004-12-09 2007-08-29 Perlegen Sciences, Inc. Marqueurs du syndrome metabolique, de l'obesite et de la resistance a l'insuline

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BOSS O, ET AL.: "TISSUE-DEPENDENT UPREGULATION OF RAT UNCOUPLING PROTEIN-2 EXPRESSION IN RESPONSE TO FASTING OR COLD", FEBS LETTERS., ELSEVIER, AMSTERDAM., NL, vol. 412, 1 January 1997 (1997-01-01), NL, pages 111 - 114, XP002918758, ISSN: 0014-5793, DOI: 10.1016/S0014-5793(97)00755-2 *
ENERBACK S, ET AL.: "MICE LACKING MITOCHONDRIAL UNCOUPLING PROTEIN ARE COLD-SENSITIVE BUT NOT OBESE", NATURE, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 387, 1 May 1997 (1997-05-01), United Kingdom, pages 90 - 93, XP002918757, ISSN: 0028-0836, DOI: 10.1038/387090a0 *
THOMAS S A, PALMITER R D: "THEROMOREGULATORY AND METABOLLE PHENOTYPES OF MICE LACKING NORADRENALINE AND ADRENALINE", NATURE, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 387, 1 May 1997 (1997-05-01), United Kingdom, pages 94 - 97, XP002918756, ISSN: 0028-0836, DOI: 10.1038/387094a0 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6632641B1 (en) 1999-10-08 2003-10-14 Metrigen, Inc. Method and apparatus for performing large numbers of reactions using array assembly with releasable primers
WO2002036829A2 (fr) * 2000-11-01 2002-05-10 Agy Therapeutics, Inc. Procedes de diagnostic de prevention et de traitement de troubles neurologiques et de lesions neuronales
WO2002036829A3 (fr) * 2000-11-01 2003-03-13 Agy Therapeutics Inc Procedes de diagnostic de prevention et de traitement de troubles neurologiques et de lesions neuronales
WO2002038808A2 (fr) * 2000-11-08 2002-05-16 Hybaid Limited Unite d'hybridation de lames
WO2002038808A3 (fr) * 2000-11-08 2003-10-02 Hybaid Ltd Unite d'hybridation de lames
EP1825002A2 (fr) * 2004-12-09 2007-08-29 Perlegen Sciences, Inc. Marqueurs du syndrome metabolique, de l'obesite et de la resistance a l'insuline
EP1825002A4 (fr) * 2004-12-09 2008-04-09 Perlegen Sciences Inc Marqueurs du syndrome metabolique, de l'obesite et de la resistance a l'insuline

Also Published As

Publication number Publication date
WO1999037812A9 (fr) 1999-10-14
AU2461399A (en) 1999-08-09

Similar Documents

Publication Publication Date Title
Tiso et al. Identification of mutations in the cardiac ryanodine receptor gene in families affected with arrhythmogenic right ventricular cardiomyopathy type 2 (ARVD2)
JP4492849B2 (ja) 転写および炎症性疾患および感染症に対する感受性に影響するインターロイキン−１遺伝子座の機能的多型
AU779477B2 (en) Alterations in the long QT syndrome genes KVLQT1 and SCN5A and methods for detecting same
US20040132021A1 (en) Osteolevin gene polymorphisms
CA2507927C (fr) Determination du gene et de la mutation responsables de la degenerescence progressive des cellules a cone et des cellules a batonnet chez le chien et methode d'essai connexe
JP2004504802A (ja) 骨粗鬆症の診断および療法
US20020090622A1 (en) Chemical compounds
CA2414403A1 (fr) Procede destine au diagnostic et au traitement de troubles mentaux
US7125667B2 (en) Polymorphic markers of the LSR gene
EP1203827B1 (fr) Polymorphismes dans le gène humain de KDR
US20050233321A1 (en) Identification of novel polymorphic sites in the human mglur8 gene and uses thereof
EP2162554A1 (fr) Marqueurs de diagnostic pour une spondylarthrite ankylosante et leurs utilisations
US20080311581A1 (en) Functional polymorphisms of the interleukin-1 locus affecting transcription and susceptibility to inflammatory and infectious diseases
KR100924468B1 (ko) Ｉｌ-1 유전자 집단 및 관련된 염증성 다형성과 일배체형
US20030054345A1 (en) Compositions and methods for the diagnosis and treatment of neuropsychiatric disorders, including schizophrenia
US6417342B1 (en) Macular degeneration diagnostics and therapeutics
WO1999037812A1 (fr) Polymorphismes d'un nucleotide du gene de la proteine decouplante 2 (ucp2)
US20030032099A1 (en) Methods for predicting susceptibility to obesity and obesity-associated health problems
US20030175797A1 (en) Association of protein kinase C zeta polymorphisms with diabetes
CA2528692C (fr) Mutations dans le gene slc40a1 associees a l'homeostasie du fer alteree
WO2003042226A2 (fr) Presence de polymorphismes a nucleotide unique dans une hormone de croissance gh-1
JP4502570B2 (ja) 遺伝子多型解析を用いたＩｇＡ腎症診断およびＩｇＡ腎症診断用キット
JP2004512842A (ja) インスリン遺伝子の５’隣接領域におけるアリル変異および体脂肪に基づく、インスリン非依存型糖尿病のリスク評価方法
WO2002054939A2 (fr) Procedes et compositions permettant le diagnostic et le traitement de troubles neuropsychiatriques tels que la schizophrenie
US20050118579A1 (en) Chemical compounds

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA IL JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: C2

Designated state(s): AU CA IL JP

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

COP Corrected version of pamphlet

Free format text: PAGES 1/14-14/14, DRAWINGS, REPLACED BY NEW PAGES 1/15-15/15; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase