WO1999028508A1 - Procede mettant en oeuvre des sequences antisens d'expression pour produire des cellules mutantes exprimees de maniere conditionnelle - Google Patents

Procede mettant en oeuvre des sequences antisens d'expression pour produire des cellules mutantes exprimees de maniere conditionnelle Download PDF

Info

Publication number
WO1999028508A1
WO1999028508A1 PCT/US1998/025808 US9825808W WO9928508A1 WO 1999028508 A1 WO1999028508 A1 WO 1999028508A1 US 9825808 W US9825808 W US 9825808W WO 9928508 A1 WO9928508 A1 WO 9928508A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
streptococcus
gene
inducible
antisense
Prior art date
Application number
PCT/US1998/025808
Other languages
English (en)
Inventor
Andrea Marra
Martin Rosenberg
Yinduo Ji
Original Assignee
Smithkline Beecham Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Smithkline Beecham Corporation filed Critical Smithkline Beecham Corporation
Priority to JP2000523383A priority Critical patent/JP2002503447A/ja
Priority to EP98962914A priority patent/EP1034308A4/fr
Publication of WO1999028508A1 publication Critical patent/WO1999028508A1/fr
Priority to US11/017,379 priority patent/US20050095643A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1079—Screening libraries by altering the phenotype or phenotypic trait of the host
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/027—New breeds of vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters

Definitions

  • the present invention provides a method for preparing conditionally expressed gene mutants, including conditional lethal mutants, and a method using such mutants to assess gene essentiality, and compositions useful in such methods.
  • gene targets most sensitive to inhibition can be selected for the development of new therapies against selected pathogens.
  • BACKGROUND OF THE INVENTION Identification, sequencing and characterization of genes is a major goal of modern scientific research. By identifying genes, determining their sequences and characterizing their biological function, it is possible to employ recombinant technology to produce large quantities of valuable gene products, e.g. proteins and peptides. Additionally, knowledge of gene sequences can provide a key to diagnosis, prognosis and treatment of a variety of disease states in plants and animals which are due to microbial pathogens and pathogenesis.
  • Transposon mutants have also been tested in live animal models of infection (Miller, et al., Infect. Immun., 1989, 57:2758; and Bolker, et al, Mol. Gen. Genet., 1994, 245:547-552).
  • comprehensive screening of bacterial genes is not possible due to the inability to identify mutants with attenuated virulence within pools of mutagenized bacteria and thus the huge number of mutants would require individual screening and large numbers of animals.
  • Hensel, et al have developed an insertional mutagenesis system that uses transposons carrying unique DNA sequence tags for the isolation of bacterial virulence genes (Science, 1995, 269:400-403).
  • each transposon mutant is tagged with a different DNA sequence.
  • STM signature-tagged mutagenesis
  • mutants in in vitro essential genes are lost in this system. This permits identification of bacteria recovered from hosts infected with a mixed population of mutants, as well as the negative selection of mutants with attenuated virulence. This method was used to identify virulence genes of Salmonella typhimurium in a murine model of typhoid fever. Further, Slauch, et al.
  • IVET a method referred to as IVET which provides a means for identifying transcripts which are essentially absent in vitro, but are on throughout, or during, various phases of infection.
  • these methods only provide information on the effect of the total absence or the specific up-regulation in vivo of the gene product in the organism and no information on gene essentiality.
  • Conditional lethal mutants may also be created to abolish gene expression and identify essential genes (de Lorenzo, V, et al., Gene 123: 17-24 (1993); Neuwald, A. F., et al., Gene 125: 69-73(1993); and Takiff, H. E. , et al., J. Bacteriol.
  • Ribozymes provide another way to lower gene expression levels by damaging a target gene or transcript.
  • designing ribozymes to knock out the expression of specific genes may involve significant research and development.
  • Antisense technology has been shown to be an effective means of down-regulating expression of specific genes. It has been widely used to interfere with eukaryotic gene expression through injection of synthetic oligonucleotides complementary to mRNA (Agrawal et al, Proc. Natl. Acad. Sci. USA, 1997, 94:2620-2625; and Zamecnik et al., Proc. Natl. Acad. Sci.
  • the identification of virulent and essential genes for bacterial survival in vivo is a powerful approach for studying molecular pathogenesis and determining molecular targets for antibiotic discovery.
  • the combination of an antisense strategy with a regulatory expression system may offer a useful method of studying the molecular pathogenesis of bacterial pathogens.
  • An aspect of the invention herein was to define novel virulence factors by inducing antisense RNA to decrease the expression of known genes during different stages of infection and to target essential genes in vitro and in vivo. Indeed, the Tn70- encoded tet repressor has been successfully used to regulate expression of specific genes not only in Bacillus subtilis (Geissendorfer et al, Appl.
  • xylltet chimeric promoter Geissendorfer et al., Appl. Microbiol. BiotechnoL, 1990, 33:657-663.
  • This promoter system employs elements of both the xylose and tetracycline systems and has been shown to be strongly inducible in B. subtilis using sub-inhibitory concentrations of tetracycline.
  • a tet regulatory system in Staphylococcus aureus was constructed and cloned an antisense hla fragment downstream of the inducible xyl/tet promoter-operator fusion to investigate whether this tet regulatory system can function in S. aureus in vitro and in vivo and whether inducible antisense hla downregulates expression of the chromosomal hla gene.
  • the present invention provides methods for creating libraries of conditionally expressed and conditional lethal mutant bacteria and other cells using an antisense strategy (for a description of antisense polynucleotides used in bacteria, see Kerndole, et al, Infection and Immunity 65(1): 179 (1997)). Methods are also provided which allow for the determination of whether a particular gene is essential to the growth or life of the organism being tested. Such genes are particularly useful as targets for screening for antimicrobial compounds.
  • the invention provides a method for determining gene essentiality comprising the steps of: transforming a host cell or group of host cells with a vector comprising an inducible gene control region expressibly linked to a library of random DNA fragments; inducing the inducible gene control region with an inducer; and detecting an alteration in the metabolism of the host cell or group of host cells due to antisense expression.
  • a method is also provided for determining gene essentiality comprising the steps of: transforming a host cell or group of host cells with a vector comprising an inducible gene control region expressibly linked to an antisense polynucleotide sequence; inducing the inducible gene control region with an inducer; and detecting an alteration in the metabolism of the host cell or group of host cells.
  • a method for determining gene essentiality comprising the steps of: transforming a host cell or group of host cells with a vector comprising an inducible gene control region expressibly linked to random antisense polynucleotide sequences; inducing the inducible gene control region with an inducer; and detecting killing or slowed growth of the host cell or group of host cells.
  • a method for determining gene essentiality comprising the steps of: transforming a host cell or group of host cells with a vector comprising an inducible gene control region expressibly linked to a library of random DNA fragments ; inducing the inducible gene control region with an inducer; detecting an alteration in the metabolism of the host cell or group of host cells; and isolating the full length gene that comprises the coding sequence of the selected polynucleotide sequence or comprises the coding sequence of the complementary sequence of the selected polynucleotide sequence.
  • the methods of the invention may comprise a host cell as defined elsewhere herein.
  • the methods may comprise an inducible promoter or an operator and inducible repressor.
  • the methods may also comprise a selected polynucleotide sequence that is an antisense sequence.
  • Selected polynucleotide sequences in the methods may be selected from an organism.
  • Preferred inducers of the invention comprise a chemical compound or electromagnetic radiation.
  • Such chemical compound inducers include, for example, IPTG, doxycycline, erythromycin, and tetracycline.
  • Such electromagnetic radiation includes, for example, X-rays, gamma rays, beta rays, UV light, and visible light, red visible light and green visible light. Methods are also provided wherein the alteration in the metabolism is slowed cell growth, cell death, or cell stasis.
  • Figure 1 shows a schematic of the tetracycline inducible shuttle vector pYJ90.
  • tetR tetracycline resistant repressor-encoding gene
  • PR the improved tetR promoter
  • ⁇ xylltetO the xyl-tet promoter-operator fusion
  • pUC19 ori and pE194 ori origins of replication from pUC19 and pE194, respectively, allowing plasmid replication in Gram-negative and Gram-positive host bacteria.
  • Figure 2 shows dependence of CAT activity on tetracycline concentration.
  • S . aureus YJ335 was incubated in TSB with 5ng/ml of Erm to early log phase and different doses of tetracycline were added to aliquotted cultures. Two milliliters of each culture were transferred into a new tube and the cells were harvested by centrifugation three hours after the addition of tetracycline. Crude protein preparations were used to anaylze CAT activity. Specific CAT activity is defined as units of CAT activity per milligram of total protein.
  • Figure 3 shows kinetics of tetracycline induction in S. aureus. Strain YJ335 was incubated to early log phase in TBS and 250ng/ml of tetracycline was added to the culture.
  • FIG. 4 shows construction of the tetracycline-inducible shuttle vector containing hla in the antisense and sense orientations.
  • a 621-bp fragment of hla containing the promoter region was inserted into the EcoRW site of plasmid pYJ335.
  • Two recombinants, pYJ318-7 and pYJ318-16, represent hla cloned in the antisense and sense hla orientations, respectively.
  • Figure 5 shows Northern blot analysis of sense hla and antisense hla transcription.
  • Digoxigenin-labeled single- stranded DNA oligonucleotide probes hybridized specifically with either induced sense hla RNA (YJ318-16 +Tc) or induced antisense hla RNA (YJ318-
  • Figure 6 shows Western blot analysis of ⁇ -hemolysin expressed in strain WCUH29 and its isogenic strains with or without tetracycline induction.
  • the molecular weight markers are biotinylated low molecular weight SDS-PAGE standards (Bio-Rad Lab., Hercules, CA).
  • Figure 7 shows RT-PCR analysis of transcription of cat (A) and hla (B) following in vivo induction with tetracycline. Plasmid DNA was used as a positive control (pYJ335 and pYJ318- 16). Negative controls were samples prepared without RT or template DNA.
  • Antisense polynucleotide means a polynucleotide sequence that is capable of hybridizing to or is complementary to, in whole or in part, another polynucleotide sequence.
  • “Expressibly linked” means a first polynucleotide sequence joined to a second polynucleotide sequence, such as by ligation, so that they act together to express a gene product, such as a DNA, an RNA or a protein.
  • “Host cell” is a cell which has been transformed or transfected, or is capable of transformation or transfection by an exogenous polynucleotide sequence and includes a cell or cells of a (i) prokaryote, including but not limited to, a member of the genus Streptococcus, Staphylococcus, Bordetella, Corynebacterium, Mycobacterium, Neisseria, Haemophilus, Actinomycetes, Streptomycetes, Nocardia, Enterobacter, Yersinia, Fancisella, Pasturella, Moraxella, Acinetobacter, Erysipelothrix, Branhamella, Actinobacillus, Streptobacillus, Listeria, Calymmatobacterium, Brucella, Bacillus, Clostridium, Treponema, Escherichia, Salmonella, Kleibsiella, Vibrio, Proteus, Erwinia, Borrelia,
  • inducer means a composition of matter or electromagnetic radiation to which an inducible gene control region responds by altering the expression of an expressibly linked polynucleotide.
  • inducers include those well known in the art, such as UV radiation and IPTG, as well as those disclosed herein.
  • “Inducible gene control region” means a polynucleotide sequence that responds to a composition of matter or electromagnetic radiation and alters the expression of an expressibly linked polynucleotide. Examples of such regions include inducible promoters or derepressible operator/promoters combinations, many of which are well known.
  • isolated means altered “by the hand of man” from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both.
  • a polynucleotide or a polypeptide naturally present in a living organism is not
  • isolated but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein.
  • Polynucleotide(s) generally refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • Polynucleotide(s) include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions or single-, double- and triple-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double- stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded, or triple-stranded regions, or a mixture of single- and double- stranded regions.
  • polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the strands in such regions may be from the same molecule or from different molecules.
  • the regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules.
  • One of the molecules of a triple-helical region often is an oligonucleotide.
  • the term "polynucleotide(s)” also includes DNAs or RNAs as described above that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotide(s)" as that term is intended herein.
  • DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art.
  • the term "polynucleotide(s)" as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including, for example, simple and complex cells. "Polynucleotide(s)” also embraces short polynucleotides often referred to as oligonucleotide(s).
  • Polypeptide(s) refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds.
  • Polypeptide(s) refers to both short chains, commonly referred to as peptides, oligopeptides and oligomers and to longer chains generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene encoded amino acids.
  • Polypeptide(s) include those modified either by natural processes, such as processing and other post-translational modifications, but also by chemical modification techniques. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and they are well known to those of skill in the art.
  • Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains, and the amino or carboxyl termini.
  • Modifications include, for example, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, ADP-ribosylation, selenoylation
  • Polypeptides may be branched or cyclic, with or without branching. Cyclic, branched and branched circular polypeptides may result from post-translational natural processes and may be made by entirely synthetic methods, as well.
  • Selected polynucleotide sequence means an isolated polynucleotide sequence that is complementary, in whole or part, to a target sequence, or is an isolated polynucleotide randomly selected from a pathogen polynucleotide sequence library.
  • Target means a polynucleotide, such as a gene, that is desired to be targeted to determine the effect of altering its expression level on the metabolism or reproduction of the cell comprising such target.
  • Gene knockout studies provide information on the effect of the total absence of a gene product.
  • antimicrobial therapies can rarely achieve the complete abolition of activity of a given gene product.
  • gene knockouts cannot be created (by simple insertion/deletion mutagenesis, for example) if the gene products are essential to viability in vitro.
  • the present invention was based, in part, on studies undertaken in order to develop a system whereby essential genes could be studied in vitro and in vivo in a pathogen, particularly a pathogenic bacterium or organism, such as 5. aureus.
  • antisense fragments to down-regulate gene expression has several advantages over other methods.
  • the use of antisense can be a powerful tool to aid in understanding a gene's function without necessarily completely eliminating its activity.
  • antisense technology allows one to very easily manipulate the expression of a gene in order to observe the consequences of a lethal mutation over time.
  • the ease with which such antisense fragments can be constructed can be directly contrasted with the tedium of constructing null mutations and promoter-down mutations.
  • the antisense technology was combined with an inducible promoter system to selectively induce expression of an antisense hla fragment as an illustrative example of an embodiment of the invention.
  • Tc 0.25nanograms/ml tetracycline
  • ⁇ -hemolysin is a well-characterized secreted protein with ample, accessible tools with which to study it.
  • ⁇ -toxin production can be screened on plates and its absence results in a defined effect, namely, attenuation of virulence in vivo.
  • ⁇ -hemolysin expression down-regulated by antisense under the control of its own promoter had been previously demonstrated and thus would be a good comparison for certain embodiments of the invention.
  • the inducible xyl/tet promoter used in this embodiment had been previously shown to be functional in B. subtilis (Geissendorfer et al, Appl. Microbiol. BiotechnoL, 1990, 33:657-663).
  • This promoter incorporates elements of both the xylose- and tetracycline- inducible systems, resulting in a tightly-regulated, strong promoter that is induced with low concentrations of tetracycline.
  • B. subtilis using 0.4 ⁇ g/ml of Tc, 100-fold induction was obtained within three hours. Results exemplified herein using this promoter construct in S. aureus compare with this earlier one: there was observed a 70-fold level of induction with 0.25ng/ml of Tc in the same time period, as shown by monitoring specific CAT activity over time.
  • This inducible promoter system was then used to selectively induce expression on a gene, ⁇ -hemolysin, during in vivo infection.
  • a murine model of hematogenous pyelonephritis was chosen to illustrate certain embodiments of the invention, as it results in a localized kidney infection from which bacteria are readily recovered. Results exemplified herein demonstrate that, using low levels of tetracycline given orally, one can effectively induce expression of ⁇ -hemolysin. This result will enable us to examine essential genes in this manner, using different concentrations of inducer to control the levels of antisense expressed, and thus down-regulate expression to different degrees.
  • this promoter system makes it possible to observe the effects of different levels of down-regulation of an essential gene without completely inactivating it.
  • This type of analysis can aid in the development of antimicrobial agents by decreasing levels of a target gene product and perhaps rendering cells more susceptible.
  • this technology may be applied to a more random approach, i.e. the development of a conditional-lethal screen for essential genes, under both in vitro and in vivo conditions.
  • the present invention provides a convenient, rapid and cost-effective method for the creation of mutants as a result of conditional gene down-regulation. Certain of these mutants are conditional lethal mutants.
  • the present invention also provides a method for determining pathogen sensitivity to varying levels of reduction of a gene product and is applicable to genes essential in vitro since reduction in levels of the gene product only occurs under conditions of induction. The decrease in gene expression for a selected target can be monitored and correlated with the progression of the infection and/or viable counts recovered from infected tissue. Using this method, genes from a selected pathogen which are most sensitive to inhibition in vivo can be identified and selected as targets for the development of new intervention therapies.
  • a conditional lethal method is also provided for identifying essential genes using antisense technology.
  • Preferred methods are also provided for using an inducible promoter(s) to selectively express antisense library clones. Colonies that fail to grow under these conditions are likely to be carrying plasmids comprising insert DNA which, when expressed, produce an antisense RNA fragment that inhibits translation of an essential gene transcript. This strategy facilitates identification of such essential genes as they can be readily identified by sequencing the plasmid inserts. In addition, this strategy can be used to screen for both in vitro and in vivo essential genes.
  • Preferred methods of the invention comprise inducible promoter(s), examples of which are set forth elsewhere herein.
  • Preferred methods of the invention also comprise shuttle plasmids which can replicate in both Escherichia coli and Staphylococcus aureus.
  • a library of DNA fragments may be cloned into the shuttle plasmids of the invention.
  • An example of a library of DNA fragments useful in the methods and/or in the plasmids of the invention preferably comprise 600 to 1000 base pair fragments.
  • the methods of the invention (i) allow for evaluation of partial gene repression, (ii) facilitate identification of essential genes as the cloned antisense fragment can be used as a probe for the full-length gene sequence, (iii) pools of mutants can be examined en masse in vivo, (iv) after infection, clones which are not recovered (identified by subtractive hybridization) are likely to contain antisense fragments corresponding to in vivo essential genes, (v) antisense effect can be measured directly, by determining levels of antisense expression and correlating with degree of in vivo attenuation, and (vi) can possibly also identify genes for which a partial down regulation is lethal by varying levels of inducer.
  • pathogen it is meant any organism which is capable of infecting an animal or plant and replicating its nucleic acid sequences in the cells or tissue of the animal or plant. Such a pathogen is generally associated with a disease condition in the infected animal or plant. Such pathogens may include, but are not limited to, viruses, which replicate intra- or extra-cellularly, or other organisms such as bacteria, fungi or parasites, which generally infect tissues or the blood. Certain pathogens are known to exist in sequential and distinguishable stages of development, e.g., infection initiation, latent stages, infective stages, and stages which cause symptomatic diseases. In these different states, the pathogen is anticipated to rely upon different genes as essential for survival and pathogenesis. Preferred host cells of the invention are pathogens. The methods of the invention may comprise a host cell as described elsewhere herein.
  • a method whereby total genomic DNA of a pathogen or host cell is isolated. Random fragments of the size 0.6 - 1 kb are expressibly linked to an inducible expression control sequence. This method will allow for the determination of whether the expression of a sequence, or gene comprising the sequence, is essential for the cell's growth or survival. This essentiality may be tested under various conditions as described herein. Optimization of the expression of the antisense RNA to inhibit target gene expression may be first carried out in vitro using a standard controllable promoter such as pSpac, TetR, etc., induced by IPTG and tetracycline, respectively.
  • a standard controllable promoter such as pSpac, TetR, etc.
  • controllable and inducible promoters known in the art, as well as others taught herein, may also be used for this purpose.
  • Promoters specifically induced by the in vitro environment i.e., the acetyl-CoA-acyltransferase promoters, may also be used for this purpose.
  • the expression vector may then be introduced into the selected pathogen using standard techniques.
  • Introduction of the vector carrying the antisense polynucleotide sequence construct into the selected pathogen should not affect growth or expression of the target gene in vitro when the antisense expression construct is uninduced.
  • This target will be a preferred target for antimicrobial compound screening.
  • RNA expression can be monitored by RT-PCR of total mRNA isolated from infected tissue at various times during the infection and correlated with housekeeping gene controls and viable cell counts. Reduction in target mRNA is correlated with infection progression including disease pathology. Luminescence in thin tissue sections allows determination of the numbers of metabolically active pathogens and viable cell counts allow for the prioritization of gene targets for development of therapeutic agents.
  • genes and gene products identified according to the method of the present invention may then be used in the design of therapeutic and diagnostic agents.
  • genes identified in accordance with this method as essential to a selected pathogen in the infection process and proteins encoded thereby may serve as targets for the screening and development of natural or synthetic chemical compounds which have utility as therapeutic drugs for the treatment of infection by this pathogen.
  • a compound capable of binding to such protein encoded by such gene and inhibiting its biological activity may be useful as a drug component preventing diseases or disorders resulting from the growth of a particular organism.
  • compounds which inhibit expression or reduce expression of an essential gene are also believed to be useful therapeutically.
  • a method for identifying compounds which specifically bind to or inhibit proteins encoded by these gene sequences can include simply the steps of contacting a selected protein or gene product with a test compound to permit binding of the test compound to the protein; and determining the amount of test compound, if any, which is bound to the protein. Such a method may involve the incubation of the test compound and the protein immobilized on a solid support. Still other conventional methods of drug screening can involve employing a suitable computer program to determine compounds having similar or complementary structure to that of the gene product or portions thereof and screening those compounds for competitive binding to the protein. Such compounds may be incorporated into an appropriate therapeutic formulation, alone or in combination with other active ingredients. Methods of formulating such therapeutic compositions, as well as suitable pharmaceutical carriers, and the like are well known to those of skill in the art.
  • the present invention is believed to provide targets for screening compounds capable of interacting with these genes, or encoded proteins or fragments thereof, and either enhancing or decreasing the biological activity, as desired.
  • Such compounds are also encompassed by this invention.
  • the invention also provides a method for determining gene essentiality comprising the steps of: transforming a host cell or group of host cells with a vector comprising an inducible gene control region expressibly linked to a random polynucleotide sequence; inducing the inducible gene control region with an inducer; and detecting an alteration in the metabolism of the host cell or group of host cells.
  • a method for determining gene essentiality comprising the steps of: transforming a host cell or a group of host cells with a vector comprising an inducible gene control region expressibly linked to a random antisense polynucleotide sequence; inducing the inducible gene control region with an inducer; and detecting an alteration in the metabolism of the host cell or group of host cells.
  • the detection step may be carried out by observing alterations in metabolism in the form of killing or slowed growth of the host cell or group of host cells, as the case may be.
  • Sequences whose lowered expression alters the metabolism of the cell are useful candidate targets for antimicrobial compound screening. In view of this, these sequences, and any full length gene coding sequence comprising such sequences, may be isolated using methods well known to the skilled artisan. These methods include, among others, PCR, cloning, sequencing.
  • the structure of the vectors useful in the methods of the invention may take many forms.
  • the vectors may comprise an inducible promoter or an operator and inducible repressor. Using these gene expression control regions one may regulate the level of expression of the antisense transcription unit.
  • Further particularly preferred vector embodiments comprise two inducible gene control regions, each expressibly linked to each terminus of an inserted DNA fragment. Such insertional vectors allow for the insertion of two inducible gene control regions transcribing in opposite directions. These vectors having two promoters and an inserted element are also useful to obtain antisense expression regardless of the insert direction. Whole libraries may be screened using vectors comprising such dual inducible gene expression control regions in the methods of the invention.
  • random fragments of genomic DNA from the selected pathogen are expressibly linked between the two inducible gene expression control regions.
  • the inducible gene expression control regions are each induced by a different inducer.
  • These expression constructs are then randomly ligated into a vector and the vector is introduced into a pool of pathogen host cells. These cells are replica plated on a first medium comprising an inducer for the first inducible gene control region, on a second medium comprising an inducer for the second inducible gene control region, and on a third medium lacking any inducer.
  • Colonies which fail to grow on the first and/or second media but grow on the third medium contain an essential polynucleotide sequence (e.g., a gene or transcript) corresponding to the antisense polynucleotide sequence of the cloned polynucleotide sequence.
  • an essential polynucleotide sequence e.g., a gene or transcript
  • Vectors used in the methods of the invention include, for example, any polynucleotide that may be introduced into a pathogen cell, including polynucleotides stably introduced into the host cell's genome.
  • preferred vectors of the invention include shuttle plasmids, which can replicate in both gram (-) and gram (+) hosts to facilitate cloning and library construction.
  • Gene expression elements may be engineered into theses vectors in preferred embodiments
  • particularly preferred embodiments comprise two inducible gene control regions It is preferred that one such region is expressibly linked to each terminus of the cloned polynucleotide sequence
  • Vectors useful in the invention may comprise transc ⁇ ptional or translational terminators ligated upstream or downstream of the antisense polynucleotide in order to keep gene expression off until specific induction is desired
  • Both eukaryotic and prokaryotic terminators are known in the art
  • Vectors of the invention may contain random sequences or may be used to introduce a sequence that has been partially characterized, such as by RT-PCR data This targeted approach may be used to complement known methods for carrying out gene essentiality analyses, such as STM and RT-PCR This approach would allow the skilled artisan to examine a limited number of clones in vivo, thereby reducing the complexity of the library being
  • Inducers of the inventions may be any compound or EMR that can induce gene expression driven by a polynucleotide sequence, preferably driven by a promoter
  • Preferred inducers of the invention comprise a chemical compound or electromagnetic radiation
  • host cells can be genetically engineered to incorporate expression systems or portions thereof or polynucleotides of the invention
  • Introduction of a polynucleotide into the host cell can be effected by methods described in many standard laboratory manuals, such as Davis et al , BASIC METHODS IN MOLECULAR BIOLOGY, (1986) and Sambrook et al , MOLECULAR CLONING A LABORATORY MANUAL, 2nd Ed , Cold Spring Harbor Laboratory Press, Cold Sp ⁇ ng Harbor, N Y (1989), such as, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic pid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction and infection
  • bactenal cells preferably streptococci, staphylococci, enterococci E coli, streptomyces and Bacillus subtilis cells
  • fungal cells such as yeast cells and Asperg ⁇ lus cells
  • insect cells such as Drosoph ⁇ a S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells
  • pathogens such as bactenal cells, preferably streptococci, staphylococci, enterococci E coli, streptomyces and Bacillus subtilis cells
  • fungal cells such as yeast cells and Asperg ⁇ lus cells
  • insect cells such as Drosoph ⁇ a S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells
  • Such vectors include, among others, chromosomal, episomal and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from genetic elements, such as cosmids and phagemids.
  • the expression system constructs may contain control regions that regulate as well as engender expression.
  • any system or vector suitable to maintain, propagate or express polynucleotides and/or to express a polypeptide in a host may be used for expression in this regard.
  • the appropriate DNA sequence may be inserted into the expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al, MOLECULAR CLONING, A LABORATORY MANUAL, (supra).
  • pCUl Gram-negative to Gram-positive shuttle vector
  • pWM401 Gram-negative to Gram-positive shuttle vector
  • pHV33 Gram- negative to Gram-positive shuttle vector
  • pHV1431 Gram-negative to Gram-positive shuttle vector
  • pNZ12 Gram-negative to Gram-positive shuttle vector
  • pMH109 contains multiple cloning sites Hudson et al., Gene, 1986, 48:93- upstream of the cat gene 100
  • pWH353 contains the tet regulatory Geissendorfer et al., Appl. elements including the tetR gene Microbiol. BiotechnoL, 1990, and its promoter with a poly-A 33:657-663 block, and the xyl/tet promoter- operator fusion pYJ82 contains the cat gene cloned into Yanisch-Perron et al., Gene, 1985, the Ec ⁇ RI and BamHl sites of 33: 103-119 pUC19 pYJ90 contais the origin of replication Horinouchi et al., J.
  • BacterioL from plasmids pE194 and pUC19, 1982, 150:804-814 which allows replication in Gram- positive and Gram-negative bacteria; contains Erm and Ap resistance markers and a multiple cloning site pYJ 101 contains the tet regulatory element Described herein inserted into the Cla ⁇ and Hind ⁇ ll sites of pBluescript II KS (Stratagene, La Jolla, CA) pYJ 103 contains the cat gene cloned into Described herein
  • EcoRl and Pstl sites of pYJIOl pYJ335 contains the tet regulatory element Described herein and the cat gene cloned into the Sail site of pYJ90 pYJ318-7 contains a 621 -bp hla fragment in Described herein the antisense orientation cloned into the Smal site of pYJ335 pYJ318- 16 contains the hla fragment in the Described herein sense orientation cloned into the Smal site of pYJ335
  • Inducible promoters useful in the methods of the invention may be any inducible promoter, for example, a doxycycline inducible promoter (see Kistner et al, PNAS USA 93: 10933 (1996)), erythromycin resistance promoter (see Ross et al, Gene 183: 143 (1996)), a macrolide resistance promoter (see Shuwsei et al, Antimicrobial Agents and Chemotherapy 41(3): 530 (1997), or a tetracycline resistance promoter (see Geissendorfer et al, Appl.
  • a doxycycline inducible promoter see Kistner et al, PNAS USA 93: 10933 (1996)
  • erythromycin resistance promoter see Ross et al, Gene 183: 143 (1996)
  • a macrolide resistance promoter see Shuwsei et al, Antimicrobial Agents and Chemotherapy 41(3): 530 (1997), or a tetracycline resistance
  • Termination sequences useful in the invention include, for example, rho-dependent termination signal, S. aureus and S. pneumoniae termination signals, rho-independent termination.
  • the invention further relates to packs and kits comprising one or more containers, preferably rigid, filled with one or more of the ingredients of the aforementioned compositions, such as the vectors, of the invention.
  • antisense RNA can be a useful tool for studying molecular pathogenesis.
  • a tet regulatory expression system was constructed in a shuttle vector.
  • this regulatory system showed a 70-fold level of induction in vitro and very strong dose dependence; it also functioned in vivo in a murine model of hematogenous pyelonephritis in combination with induction by oral administration of tetracycline.
  • S. aureus RN4220 was derived from chemical mutagenesis of S.aureus 8325-4 and is able to accept heterologous DNA (R.P. Novick, Molecular Biology of the Staphylococci. VCH Publishers, New York, NY, 1990, 1-40).
  • S. aureus WCUH29 is a virulent alpha-toxin producing clinical isolate.
  • S. aureus strains were cultured in tryptic soy broth (TSB; BBL) or TSB-agar medium. To maintain selection of plasmid pYJ90, S. aureus was grown in culture medium containing erythromycin (Erm 5 ⁇ g/ml).
  • Escherichia coli strains were grown in Luria-Bertani broth (LB) containing chloramphenicol (Cm 20 ⁇ g/ml), Erm (300 ⁇ g/ml), or ampicillin (Ap lOO ⁇ g/ml) as appropriate.
  • LB Luria-Bertani broth
  • plasmids pUC19 (Yanisch-Perron et al., Gene, 1985, 33:103-1 19) and pE194 (Horinouchi et al., J. BacterioL, 1982, 150:804- 814) were digested with Ndel, purified, ligated, and transformed into E.coli DH5- ⁇ by electroporation. Transformants were selected on LB-agar containing Ap (lOO ⁇ g/ml) and Erm (300 ⁇ g/ml). One recombinant, pYJ90, was confirmed by restriction enzyme digestion and electroporated into S.
  • aureus RN4220 as previously described (Kraemer et al., Cur. Microbiol., 1990, 21 :373-376 and R.P. Novick, Molecular Biology of the Staphylococci. VCH Publishers, New York, NY, 1990, 1 -40). Transformants were selected on TSA containing Erm (5 ⁇ g/ml). The stability of plasmid pYJ90 in S. aureus was determined by passaging a culture six times in medium lacking antibiotics and analyzing plasmid DNA in the bacterial culture.
  • the Clal - Hin ⁇ lll fragment containing the tetR gene (which encodes the tet repressor), its promoter (PR), and the strong xyl/tet promoter-operator fusion ⁇ P ⁇ yl/tet ⁇ ) was excised from plasmid pWH353, and cloned into plasmid pBluescript II KS (Stratagene. La Jolla, CA).
  • the resulting plasmid, pYJIOl was digested with EcoRl and Pstl and ligated to the £c ⁇ RI - Pstl fragment of pYJ82 containing a promoterless cat gene followed by a transcriptional terminator.
  • This new construct was named pYJ103 and the fragment containing the tetR/P /P ⁇ yl/tetO' cat re gi° n was cloned into pYJ90 via the Sail site.
  • the resulting plasmid, PYJ335, was confirmed by restriction enzyme digestion and DNA sequencing, and then electroporated into S. aureus RN4220.
  • One of transformants, YJSB335 was confirmed and used to make phage lysates using S. aureus phage ⁇ 1 1.
  • a 621 bp hla fragment was generated by PCR amplification using primers hla ⁇ or64 (5' GGGGGGCCCGGGTATGTCTTTTCCTTGTTTCA 3')[SEQ ID NO: l] and W ⁇ Rev684 (5'GGGGGGCCCGGGATCAGGTAGTTGCAACTG 3') [SEQ ID NO:2] corresponding to nucleotides 64 - 83 and 684 - 701 , respectively.
  • Boldface nucleotides correspond to the Smal restriction enzyme recognition site and underlined nucleotides correspond to the hla coding sequence (Gray et al., Infect. Immun., 1984, 46:615-618).
  • the amplified hla fragment contains the hla promoter region.
  • the PCR product was digested with Smal and ligated downstream of the xyl/tetO promoter-operator fusion of pYJ335.
  • the resulting plasmids, pYJ318-7 and pYJ318- 16, which contain hla in the antisense and sense orientations, respectively, were separately electroporated into S. aureus.
  • plasmids pYJ318-6 and pJY318-16 were introduced into this strain by phage transduction.
  • Phage ⁇ l 1 was used to make phage lysates by infecting S.aureus YJSB335, YJSB318-7, and YJSB318-16 grown in top agar (TSB containing 0.7%agar and 5mMCaCl2).
  • the phage lysates were sterilized by passing each through a 0.45 ⁇ m pore size filter and titered on S. aureus RN4220.
  • Transductions were performed by incubating 5 x 10 ⁇ CFU of WCUH29 cells with lOO ⁇ l of phage lysate (10 9 -10 10 pfu) and 5mM CaCl 2 at 37° C for 30 minutes.
  • lOO ⁇ l of phage lysate 10 9 -10 10 pfu
  • 5mM CaCl 2 5mM CaCl 2 at 37° C for 30 minutes.
  • One milliliter of ice-cold 20mM sodium citrate was added to the above mixture to block phage adsorption.
  • the bacterial cells were spun down and resuspended in 500 ⁇ l of 20mM sodium citrate.
  • Transductants were selected on TSB-agar containing 500 ⁇ g/ml of sodium citrate and 5 ⁇ g/ml of Erm, and transductants YJ335, YJ318-7, and YJ318-16 containing plasmids pYJ335, pYJ318-7, and pYJ318- 16, respectively, were confirmed by restriction enzyme digestion.
  • the 621-bp hla fragment was generated by PCR using /j/ ⁇ -specific primers.
  • the antisense hla and sense hla orientations in plasmids pYJ318-7 and pYJ318-16, respectively, were confirmed by PCR using the plasmid-specific primer ret/?Forl 399 (5' CAATACATTGTAGGCTGC 3 [SEQ ID NO:3] corresponding to nucleotides 1399-1416 and j/ ⁇ -specific primers z/ ⁇ Rev684 (reverse) and hlaFor64 (forward).
  • the reaction conditions for all PCR's were 0.2mM dNTPs, 2.5mM MgCl2, 50 pmol of each primer, and 2.5 U of Taq polymerase in buffer supplied by the manufacturer (Gibco-BRL, Cockeysville, MD).
  • the primers were tetRFor ⁇ 399 and hlaFor64, and tetRFor ⁇ 394 and /?/ ⁇ Rev684, respectively, using the same annealing temperature of 48° C.
  • bacterial RNA was isolated from infected tissue samples using FastRNA reagents (BIO101 , Vista, CA) and treated with RNase-free DNasel (GeneHunter Corp., Nashville, TN ) to remove DNA. Single-stranded cDNA was synthesized by incubating Dnase-treated RNA with reverse transcriptase in reaction buffer supplied by the manufacturer (Gibco-BRL, Gaithersburg, MD).
  • cDNA was used as the template for PCR using the tgtR-c ⁇ f-specific primers, tetRFor] 399 and c ⁇ tRev768 (5' GGCAGGTTAGTGACATTAG 3 ⁇ [SEQ ID NO:4], and the hla gene-specific primers, hlaFor64 and hlaRev684.
  • DNA sequencing was performed to further confirm the tet regulatory elements in pYJ335, and the antisense hla and sense hla orientations in pYJ318-7 and pYJ318-16, respectively.
  • CAT activity was determined spectrophotometrically as described by Shaw (W.V.
  • the bacterial cells were harvested by centrifugation and washed once with 25mM Tris pH 7.8, lOmM EDTA (TE) buffer. Crude protein extracts were prepared by centrifugation after the bacterial cells had been suspended in 200 ⁇ l of TE buffer containing 0.2mg/ml of lysostaphin (Sigma, St. Louis, MO) and incubated at 37°C for 10 minutes. The total protein concentration was determined by using the Bio-Rad protein microassay (Bio-Rad Lab., Hercules, CA). Specific CAT activity was calculated as the number of units of CAT activity per mg total protein. Experiments were performed in triplicate at lease twice and similar results were obtained.
  • Tc was added to 10-ml cultures of S. aureus WCUH29, YJ318-7 and YJ318-16 to a final concentration of 250ng/ml and incubated with shaking at 37°C for 8 hours. Supernatants were collected after centrifugation and transferred into tubes containing an equal volume of ethanol and incubated overnight at 4°C. Extracellular proteins were precipitated by centrifugation at 15,000 x g at 4°C for 30 minutes. SDS-PAGE and Western blotting methods used were performed as previously described (U.K. Laemmli, Nature, 1970, 227:680-685). Equal amounts of protein were loaded into each lane of a 12.5% SDS-PAGE gel. Standard ⁇ - hemolysin and anti-rabbit antibody alkaline phosphatase conjugate were from Sigma (St.
  • Murine hematogenous pyelonephritis infection model Murine hematogenous pyelonephritis infection model.
  • CD- 1 female mice obtained from Charles River Laboratories were used for in vivo assays.
  • S. aureus YJ335 and YJ318-16 were harvested from 1 ml of stationary phase culture, washed once with 1 ml of PBS, and diluted to an A 00 of 0.2. These bacterial suspensions were diluted and plated onto TSB-agar plates for determination of viable CFU.
  • Three mice per group were infected with about 10 ' CFU of bacteria via an intravenous injection of 0.2 ml of bacterial suspension into the tail vein using a tuberculin syringe. Different doses of Tc were given orally in 0.2ml doses to infected mice on days 1, 2, and 3 after infection.
  • mice were sacrificed by carbon dioxide overdose 2 hours after the last dose of Tc induction. Kidneys were aseptically removed and each pair was cleaved in half; one half was snap-frozen in cryovials in liquid nitrogen, and the other half was homogenized in 1ml of PBS for enumeration of viable bacteria. The frozen samples were subsequently used for RT-PCR analysis.
  • the Tn/0-encoded tet regulatory element was used as an inducible expression system in S. aureus.
  • This system consists of the tetR gene, the tetR promoter, and the strong xyl/tet promoter-operator fusion to direct expression of the cat gene as a reporter to monitor the level of induction (Fig. 1).
  • the tet regulatory elements and the cat gene were cloned into the E. coli-S. aureus shuttle vector pYJ90 as described elsewhere herein.
  • the resulting plasmid, pYJ335, was found to be stably maintained in S. aureus following multiple passages in the absence of selection (data not shown).
  • strain YJ335 was determined in vitro following induction with tetracycline.
  • the effect of Tc on the expression of cat in strain YJ335 was measured 3 hours after incubation with different doses of Tc in log phase cultures. The results of this experiment are shown in Figure 2.
  • strain YJ335 showed a basal level of cat activity and could not grow on TSB-agar plates containing Cm (l ⁇ g/ml). However, cat expression was induced efficiently when Tc was added to the culture medium.
  • Example 14 Construction of isogenic strains producing sense and antisense hla transcripts in 5. aureus WCUH29.
  • RNA In order to determine whether induced antisense RNA can down-regulate expression of chromosomal genes efficiently in S. aureus, a 621-bp fragment of the hla gene containing the promoter region was inserted into the Smal site downstream of the xyl/tet promoter-operator fusion in the shuttle vector pYJ335 (Fig. 4). The orientation of the hla insertion was ascertained by PCR using the plasmid-specific primer ter/?Forl399 and two M ⁇ -specific primers Z ⁇ / For64 and Z./ Rev684.
  • Transformants were selected by Erm resistance and plasmids were confirmed using restriction enzyme digestion
  • the resulting isogenic strains, YJSB 18-7 and YJSB318-16, were used to make phage lysates for transduction as described elswhere herein
  • the resulting transductants were used to characterize hla antisense function in vitro and in vivo
  • RNA from YJ318-7 and YJ318- 16 grown in the presence and absence of 250ng/ml Tc were electrophoresed on an agarose-formaldehyde gel, blotted onto a nylon membrane, and hybridized to different DIG-labeled single-stranded DNA oligonucleotide probes specific for antisense hla RNA and sense hla RNA (Fig 5)
  • the blot showed that RNA from strain YJ318-7 after Tc induction contained an antisense hla RNA transcript that hybridized to the antisense DNA probe, in contrast, RNA from strain YJ318-7 without Tc induction did not show the antisense hla RNA transcript
  • RNA prepared from YJ318-16 with Tc induction nor RNA from YJ318-16 without induction contained

Abstract

La présente invention concerne un procédé qui permet de déterminer la sensibilité d'un agent pathogène à différents niveaux de réduction d'un produit génique au moyen d'un système vecteur d'expression possédant un promoteur essentiellement hors in vitro et apparaissant sélectivement pendant le processus d'infection in vivo. On décrit des gènes et des produits géniques identifiés par ce procédé comme étant essentiels pour le développement infectieux d'un agent pathogène spécialisé. On décrit en outre des compositions thérapeutiques conçues pour cibler les gènes identifiés selon le procédé de l'invention.
PCT/US1998/025808 1997-12-04 1998-12-04 Procede mettant en oeuvre des sequences antisens d'expression pour produire des cellules mutantes exprimees de maniere conditionnelle WO1999028508A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2000523383A JP2002503447A (ja) 1997-12-04 1998-12-04 発現可能なアンチセンス配列を用いる条件発現変異細胞の取得方法
EP98962914A EP1034308A4 (fr) 1997-12-04 1998-12-04 Procede mettant en oeuvre des sequences antisens d'expression pour produire des cellules mutantes exprimees de maniere conditionnelle
US11/017,379 US20050095643A1 (en) 1997-12-04 2004-12-20 Method of generating conditionally expressed mutant cells using expressible antisense sequences

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US6744697P 1997-12-04 1997-12-04
US8253498P 1998-04-20 1998-04-20
US10516198P 1998-10-21 1998-10-21
US60/105,161 1998-10-21
US60/082,534 1998-10-21
US60/067,446 1998-10-21

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US09581479 A-371-Of-International 2000-05-25
US10/099,198 Continuation US20030124507A1 (en) 1997-12-04 2002-03-13 Method of generating conditionally expressed mutant cells using expressible antisense sequences

Publications (1)

Publication Number Publication Date
WO1999028508A1 true WO1999028508A1 (fr) 1999-06-10

Family

ID=27371157

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/025808 WO1999028508A1 (fr) 1997-12-04 1998-12-04 Procede mettant en oeuvre des sequences antisens d'expression pour produire des cellules mutantes exprimees de maniere conditionnelle

Country Status (3)

Country Link
EP (1) EP1034308A4 (fr)
JP (1) JP2002503447A (fr)
WO (1) WO1999028508A1 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1047453A1 (fr) * 1998-01-21 2000-11-02 Smithkline Beecham Corporation Procede servant a determiner le caractere essentiel d'un gene chez un pathogene
US6228579B1 (en) 1997-11-14 2001-05-08 San Diego State University Foundation Method for identifying microbial proliferation genes
WO2002051982A2 (fr) * 2000-12-27 2002-07-04 Elitra Pharmaceuticals, Inc. Promoteurs bacteriens et leurs procedes d'utilisation
WO2002083940A2 (fr) * 2001-04-06 2002-10-24 Creatogen Aktiengesellschaft Methode de criblage pour cibles medicamenteuses antimicrobiennes par mutagenese a saturation du genome
US6720139B1 (en) 1999-01-27 2004-04-13 Elitra Pharmaceuticals, Inc. Genes identified as required for proliferation in Escherichia coli
WO2004101757A2 (fr) 2003-05-07 2004-11-25 E.I. Dupont De Nemours And Company Production d'acides gras polyinsatures dans des levures oleagineuses
WO2005047480A2 (fr) 2003-11-12 2005-05-26 E.I. Dupont De Nemours And Company $g(d)-15 desaturases appropriees pour modifier les niveaux d'acides gras polyinsatures dans des plantes a graines oleagineuses et de la levure oleagineuse
WO2006052870A2 (fr) 2004-11-04 2006-05-18 E.I. Dupont De Nemours And Company Souches produisant de l'acide eicosapentanoique de yarrowia lipolytica
WO2010080388A1 (fr) 2008-12-18 2010-07-15 E. I. Du Pont De Nemours And Company Réduction des sous-produits malonates formés dans un procédé de fermentation
WO2012134978A2 (fr) 2011-04-01 2012-10-04 Ice House America, Llc Appareil et procédés d'ensachage de glace
CN105018528A (zh) * 2015-08-20 2015-11-04 重庆大学 热休克蛋白基因启动子和四环素基因启动子控制的多基因表达和沉默系统

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5639595A (en) * 1990-05-01 1997-06-17 Isis Phamaceuticals, Inc. Identification of novel drugs and reagents

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998021366A1 (fr) * 1996-11-13 1998-05-22 Qbi Enterprises, Ltd. Procede d'identification de genes
AU732321B2 (en) * 1997-11-21 2001-04-12 Yale University Method for identifying and inhibiting functional nucleic acid molecules in cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5639595A (en) * 1990-05-01 1997-06-17 Isis Phamaceuticals, Inc. Identification of novel drugs and reagents

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP1034308A4 *

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6924101B2 (en) 1997-11-14 2005-08-02 San Diego State University Foundation Methods for identifying anti-microbial agents
US6228579B1 (en) 1997-11-14 2001-05-08 San Diego State University Foundation Method for identifying microbial proliferation genes
EP1047453A4 (fr) * 1998-01-21 2002-08-28 Smithkline Beecham Corp Procede servant a determiner le caractere essentiel d'un gene chez un pathogene
EP1047453A1 (fr) * 1998-01-21 2000-11-02 Smithkline Beecham Corporation Procede servant a determiner le caractere essentiel d'un gene chez un pathogene
US6720139B1 (en) 1999-01-27 2004-04-13 Elitra Pharmaceuticals, Inc. Genes identified as required for proliferation in Escherichia coli
WO2002051982A2 (fr) * 2000-12-27 2002-07-04 Elitra Pharmaceuticals, Inc. Promoteurs bacteriens et leurs procedes d'utilisation
WO2002051982A3 (fr) * 2000-12-27 2009-08-06 Elitra Pharmaceuticals Inc Promoteurs bacteriens et leurs procedes d'utilisation
WO2002083940A3 (fr) * 2001-04-06 2004-02-19 Creatogen Ag Methode de criblage pour cibles medicamenteuses antimicrobiennes par mutagenese a saturation du genome
US7390620B2 (en) 2001-04-06 2008-06-24 Creatogen Laboratories Gmbh Screening method for anti-microbial drug targets by genome-saturating mutagenesis (GSM)
WO2002083940A2 (fr) * 2001-04-06 2002-10-24 Creatogen Aktiengesellschaft Methode de criblage pour cibles medicamenteuses antimicrobiennes par mutagenese a saturation du genome
EP2392664A2 (fr) 2003-05-07 2011-12-07 E. I. du Pont de Nemours and Company Production d'acides gras polyinsaturés dans des levures oléagineuses
WO2004101757A2 (fr) 2003-05-07 2004-11-25 E.I. Dupont De Nemours And Company Production d'acides gras polyinsatures dans des levures oleagineuses
EP2402448A2 (fr) 2003-05-07 2012-01-04 E. I. du Pont de Nemours and Company Production d'acides gras polyinsaturés dans des levures oléagineuses
EP2392665A2 (fr) 2003-05-07 2011-12-07 E. I. du Pont de Nemours and Company Production d'acides gras polyinsaturés dans des levures oléagineuses
WO2005047479A2 (fr) 2003-11-12 2005-05-26 E.I. Dupont De Nemours And Company $g(d)-15 desaturases appropriees pour modifier les niveaux d'acides gras polyinsatures dans des plantes a graines oleagineuses et de la levure oleagineuse
WO2005047480A2 (fr) 2003-11-12 2005-05-26 E.I. Dupont De Nemours And Company $g(d)-15 desaturases appropriees pour modifier les niveaux d'acides gras polyinsatures dans des plantes a graines oleagineuses et de la levure oleagineuse
WO2006052870A2 (fr) 2004-11-04 2006-05-18 E.I. Dupont De Nemours And Company Souches produisant de l'acide eicosapentanoique de yarrowia lipolytica
EP2458000A1 (fr) 2004-11-04 2012-05-30 E. I. du Pont de Nemours and Company Souches de Yarrowia Lipolytica produisant de grandes quantités d'acide arachidonique
EP2649887A2 (fr) 2004-11-04 2013-10-16 E. I. du Pont de Nemours and Company Souches productrices à forte teneur en acide eicosapentaénoique de Yarrowia lipolytique
WO2010080388A1 (fr) 2008-12-18 2010-07-15 E. I. Du Pont De Nemours And Company Réduction des sous-produits malonates formés dans un procédé de fermentation
WO2012134978A2 (fr) 2011-04-01 2012-10-04 Ice House America, Llc Appareil et procédés d'ensachage de glace
CN105018528A (zh) * 2015-08-20 2015-11-04 重庆大学 热休克蛋白基因启动子和四环素基因启动子控制的多基因表达和沉默系统

Also Published As

Publication number Publication date
EP1034308A4 (fr) 2002-04-03
EP1034308A1 (fr) 2000-09-13
JP2002503447A (ja) 2002-02-05

Similar Documents

Publication Publication Date Title
Zighelboim et al. Penicillin-binding proteins of multiply antibiotic-resistant South African strains of Streptococcus pneumoniae
Dunny et al. Transmissible toxin (hemolysin) plasmid in Streptococcus faecalis and its mobilization of a noninfectious drug resistance plasmid
US5434065A (en) In vivo selection of microbial virulence genes
KR20170121291A (ko) 감소된 창자 염증 및/또는 강화된 창자 점막 장벽으로부터 이익을 얻는 질병을 치료하기 위해 공학처리된 박테리아
WO1999050402A1 (fr) IDENTIFICATION SYSTEMATIQUE DE GENES ESSENTIELS PAR MUTAGENESE DE TRANSPOSONS $i(IN VITRO)
Li et al. Myxococcus xanthus viability depends on groEL supplied by either of two genes, but the paralogs have different functions during heat shock, predation, and development
US20200109395A1 (en) Genetic systems that defend against foreign dna and uses thereof
US6436694B1 (en) Regulable gene expression in gram-positive bacteria
WO1999028508A1 (fr) Procede mettant en oeuvre des sequences antisens d'expression pour produire des cellules mutantes exprimees de maniere conditionnelle
Jackson et al. A widely conserved bacterial cytoskeletal component influences unique helical shape and motility of the spirochete Leptospira biflexa
CA2223519A1 (fr) Procedes d'evaluation de cibles antimicrobiennes
US7056728B2 (en) Compositions and methods for use thereof in modifying the genomes of microorganisms
JP2010539965A (ja) 転写因子デコイ、組成物および方法
Dubail et al. Identification of an essential gene of Listeria monocytogenes involved in teichoic acid biogenesis
US20230022575A1 (en) Bacterial conjugative system and therapeutic uses thereof
US20050095643A1 (en) Method of generating conditionally expressed mutant cells using expressible antisense sequences
WO1999037330A1 (fr) Procede servant a determiner le caractere essentiel d'un gene chez un pathogene
US20050032093A1 (en) Novel genes involved in the escherichia coli biofilm formation and uses thereof
JPH10191990A (ja) 病原体に必須の遺伝子の測定法
Ma et al. Point mutations in a peptidoglycan biosynthesis gene cause competence induction in Haemophilus influenzae
Coque Evolutionary biology of pathogenic enterococci
JP2021524230A (ja) アッカーマンシア種の遺伝子操作のためのシステムおよび方法
Cvitkovitch et al. Tn 917 transposon mutagenesis and marker rescue of interrupted genes of Streptococcus mutans
US6309817B1 (en) Identification of virulence determinants activators in prokaryotic pathogens
Blinkowa et al. Physiological properties of cold-sensitive suppressor mutations of a temperature-sensitive dnaZ mutant of Escherichia coli

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 1998962914

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09581479

Country of ref document: US

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 523383

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1998962914

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1998962914

Country of ref document: EP