WO1998044151A1 - Method of nucleic acid amplification - Google Patents
Method of nucleic acid amplification Download PDFInfo
- Publication number
- WO1998044151A1 WO1998044151A1 PCT/GB1998/000961 GB9800961W WO9844151A1 WO 1998044151 A1 WO1998044151 A1 WO 1998044151A1 GB 9800961 W GB9800961 W GB 9800961W WO 9844151 A1 WO9844151 A1 WO 9844151A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- primers
- immobilised
- dna
- colonies
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1065—Preparation or screening of tagged libraries, e.g. tagged microorganisms by STM-mutagenesis, tagged polynucleotides, gene tags
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
Definitions
- This invention relates, inter alia, to the amplification of nucleic acids .
- nucleic acids of interest e.g., genomic or mitochondrial DNA or messenger RNA (mRNA)
- mRNA messenger RNA
- nucleic acids of interest it is necessary to isolate the nucleic acids of interest from the mixture of all nucleic acids and usually, to amplify these nucleic acids to obtain quantities suitable for their characterisation and/or detection. Isolating the nucleic fragments has been considered necessary even when one is interested in a representative but random set of all of the different nucleic acids, for instance, a representative set of all the mRNAs present in a cell or of all the fragments obtained after genomic DNA has been cut randomly into small pieces .
- DNA ligases Several methods can be used to amplify DNA with biological means and are well known by those skilled in the art. Generally, the fragments of DNA are first inserted into vectors with the use of restriction enzymes and DNA ligases . A vector containing a fragment of interest can then be introduced into a biological host and amplified by means of well established protocols. Usually hosts are randomly spread over a growth medium (e.g. agar plates). They can then replicate to provide colonies that originated from individual host cells.
- a growth medium e.g. agar plates
- Another option is to transfer by sterile technique individually each colony into a container (e.g., 96 well plates) where further host cell replication can occur so that more DNA can be obtained from the colonies. Amplified nucleic acids can be recovered from the host cells with an appropriate purification process.
- a container e.g., 96 well plates
- Amplified nucleic acids can be recovered from the host cells with an appropriate purification process.
- Such a procedure is generally time and labour consuming, and difficult to automate .
- PCR polymerase chain reaction
- Amplification occurs during the PCR cycling, which includes a step during which double stranded DNA molecules are denatured (typically a reaction mix is heated, e.g. to 95°C in order to separate double stranded DNA molecules into two single stranded fragments) , an annealing step (where the reaction mix is brought to e.g., 45°C in order to allow the primers to anneal to the single stranded templates) and an elongation step (DNA complementary to the single stranded fragment is synthesised via sequential nucleotide incorporation at the ends of the primers with the DNA polymerase enzyme) .
- a reaction mix is heated, e.g. to 95°C in order to separate double stranded DNA molecules into two single stranded fragments
- an annealing step where the reaction mix is brought to e.g., 45°C in order to allow the primers to anneal to the single stranded templates
- an elongation step DNA complementary to the
- the amplification is generally performed in containers (e.g., in 96 well format plates) in such a way that each container contains the PCR product (s) of one reaction.
- containers e.g., in 96 well format plates
- PCR product s
- some of the PCR product become grafted to a surface of the container having primers therein which has been in contact with the reactant during the PCR cycling.
- the grafting to the surface simplifies subsequent assays and allows efficient automation.
- Arraying of DNA samples is more classically performed on membranes (e.g., nylon or nitro-cellulose membranes).
- membranes e.g., nylon or nitro-cellulose membranes.
- suitable robotics e.g., Q-bot m , Genetix ltd, Dorset BH23 3TG UK
- the DNA is covalently linked to a membrane by physicochemical means (e.g., UV irradiation) .
- physicochemical means e.g., UV irradiation
- New approaches based on pre-arrayed glass slides arrays of reactive areas obtained by ink-jet technology (Blanchard, A. P. and L. Hood, Oligonucleotide array synthesis using ink jets, Microbial and Comparative Genomics, 1:225 (1996)) or arrays of reactive polyacrylamide gels (Yershov, G. et al . , DNA analysis and diagnostics on oligonucleotide microchips, Proceedings of the Na tional Academy of Science, USA, 93:4913-4918 (1996)) allow the arraying of up to 100 samples/mm 2 . With these technologies, only probe (oligonucleotide) grafting has been reported. Reported number of samples/mm 2 are still fairly low (25 to 64) .
- DNA chips which can be arrays of oligonucleotides covalently bound to a surface and can be obtained with the use of micro-lithographic techniques (Fodor, S.P.A. et al., Light directed, spatially addressable parallel chemical synthesis, Science 251:767(1991)).
- chips with 625 probes/mm 2 are used in applications for molecular biology (Lockhart, D.J. et al., Expression monitoring by hybridisation to high-density oligonucleotide arrays, Nature Biotechnology 14:1675 (1996)).
- Probe densities of up to 250 000 samples/cm 2 are claimed to be achievable (Chee, M.
- the present invention aims to overcome or at least alleviate some of the disadvantages of prior art methods of nucleic acid amplification.
- a method of nucleic acid amplification comprising the steps of: A. providing a plurality of primers that are immobilised but that have one end exposed to allow primer extension;
- step D allowing the extended immobilised nucleic acid strand to anneal to one of said plurality of primers referred to in step A) and then extending that primer using the extended immobilised nucleic acid strand as a template, so as to provide another extended immobilised nucleic acid strand; and optionally,
- the method also comprises the step of:
- step F repeating step F) one or more times.
- the single-stranded target nucleic acid sequence is provided by a method in which said single-stranded target nucleic acid is produced by providing a given nucleic acid sequence to be amplified (which sequence may be known or unknown) and adding thereto a first nucleic acid sequence and a second nucleic acid sequence; wherein said first nucleic acid sequence hybridises to one of said plurality of primers and said second nucleic acid sequence is complementary to a sequence which hybridises to one of said plurality of primers.
- the second nucleic acid sequence may be a sequence that is the same as the sequence of one of the plurality of primers.
- the single- stranded target nucleic acid squence may be provided by a method in which said single-stranded target nucleic acid is produced by providing a given nucleic acid sequence to be amplified (which sequence may be known or unknown) and adding thereto a first nucleic acid sequence and a second nucleic acid sequence; wherein said first nucleic acid sequence hybridises to one of said plurality of primers and said second nucleic acid sequence is the same as the sequence of one of said plurality of primers.
- the first and second nucleic acid sequences may be provided at first and second ends of said single-stranded target nucleic acid, although this is not essential.
- a tag may be provided to enable amplification products of a given nucleic acid sequence to be identified.
- the method of the present invention allows one or more distinct areas to be provided, each distinct area comprising a plurality of immobilised nucleic acid strands (hereafter called "colonies") .
- These areas can contain large numbers of amplified nucleic acid molecules.
- These molecules may be DNA and/or RNA molecules and may be provided in single or double stranded form. Both a given strand and its complementary strand can be provided in amplified form in a single colony.
- Colonies of any particular size can be provided.
- preferred colonies measure from lOnm to lOOum across their longest dimension, more preferably from lOOnm to lO ⁇ m across their longest dimension. Desirably a majority of the colonies present on a surface (i.e. at least 50% thereof) have sizes within the ranges given above.
- Colonies can be arranged in a predetermined manner or can be randomly arranged. Two or three dimensional colony configurations are possible. The configurations may be regular (e.g. having a polygonal outline or having a generally circular outline) or they may be irregular. Colonies can be provided at high densities. Densities of over one colony/mm 2 of surface can be achieved. Indeed densities of over 10 2 , over 10 3 or even over 10 4 colonies/mm 2 are achievable using the present invention. In preferred embodiments, the present invention provides colony densities of 10 4"5 colonies/mm 2 , more preferably densities of 10 6"7 colonies/mm 2 , thus offering an improvement of 3 to 4 orders of magnitude relative to densities achievable using many of the prior art methods. It is this property of the invention that allows a great advantage over prior art, since the high density of DNA colonies allows a large number of diverse DNA templates (up to 10 6"7 colonies/mm 2 , to be randomly arrayed and amplified.
- the immobilised primers for use in the present invention can be provided by any suitable means, as long as a free 3' -OH end is available for primer extension. Where many different nucleic acid molecules are to be amplified, many different primers may be provided. Alternatively "universal" primers may be used, whereby only one or two different types of primer (depending upon the embodiment of the invention) can be used to amplify the different nucleic acid molecules. Universal primers can be used where the molecules to be amplified comprise first and second sequences, as described previously. The provision of universal primers is advantageous over methods such as those disclosed in WO96/04404 (Mosaic Technologies, Inc.) where specific primers must be prepared for each particular sequence to be amplified.
- Synthetic oligodeoxynucleotide primers are available commercially from many suppliers (e.g. Microsynth, Switzerland, Eurogentech, Belgium) .
- Non covalent grafting of primers at the interface between an aqueous phase and a hydrophobic phase through an hydrophobic anchor is also possible for the present invention.
- Such anchoring is commonly used for bio-macromolecules in general (S. Terrettaz et al. : Protein binding to supported lipid membranes, Langmuir 9,1361 (1993)).
- Preferred forms of such interfaces would be liposomes, lipidic vesicles, emulsions, patterned bilayers, Langmuir or Langmuir- Blodgett films.
- the patterns may be obtained by directed pattering on templates, e.g., silicon chips patterned through micro-lithographic methods (Goves, J.T. et al .
- the patterns may also be obtained by due to the self-assembly properties of "colloids", e.g., emulsions or latex particles (Larsen, A.E. and D.G. Grier, Like charge attractions in metastable colloidal crystallites, Nature 385,230 (1997)).
- "colloids” e.g., emulsions or latex particles
- one, two or more different primers can be grafted onto a surface.
- the primers can be grafted homogeneously and simultaneously over the surface.
- microlithographic methods it is possible to provide immobilised primers in a controlled manner. If direct synthesis of oligonucleotides onto a solid support with a free 3' -OH end is desired, then micro-lithographic methods can be used to simultaneously synthesise many different oligonucleotide primers (Pirrung, M.C. and Bradley, J.C. Comparison of methods for photochemical phosphoramidite-based DNA- synthesis. Journal Of Organic Chemistry 60 (20) : 6270-6276, 1995). These may be provided in distinct areas that may correspond in configuration to colonies to be formed, (e.g. they may be several nanometers or micrometers across). Within each area, only a single type of primer oligonucleotide need be provided. Alternatively a mixture comprising a plurality of different primers may be provided. In either case, primers can be homogeneously distributed within each area. They may be provided in the form of a regular array.
- areas initially comprise only one type of immobilised primer they may be modified, if desired, to carry two or more different types of primer.
- One way to achieve this is to use molecules as templates for primer extension that have 3' ends that hybridise with a single type of primer initially present and that have 5' ends extending beyond the 3' ends of said primers.
- primer extension of one type of primer using the mixture of such templates followed by strand separation will result in different modified primers.
- the modified primers are referred to herein as "extended" primers in order to distinguish from the "primary" primers initially present on a surface) .
- One, two or more different types of extended primer can be provided in this manner at any area where primary primers are initially located. Substantially equal portions of different templates can be used, if desired, in order to provide substantially equal proportions of different types of immobilised extended primer over a given area. If different proportions of different immobilised extended primers are desired, then this can be achieved by adjusting the proportions of different template molecules initially used accordingly.
- a restriction endonuclease cleavage site may be located within the primer.
- a primer may also be provided with a restriction endonuclease recognition site which directs DNA cleavage several bases distant (Type II restriction endonucleases) . (For the avoidance of doubt, such sites are deemed to be present even if the primer and its complement are required to be present in a double stranded molecule for recognition and/or cleavage to occur.)
- a cleavage site and/or a recognition site may be produced when a primer is extended.
- restriction endonucleases can be useful in allowing an immobilised nucleic acid molecule within a colony to be cleaved so as to release at least a part thereof.
- ribozymes can be used to release at least parts of nucleic acid molecules from a surface (when such molecules are RNA molecules) .
- Other methods are possible. For example if a covalent bond is used to link a primer to a surface this bond may be broken (e.g. by chemical, physical or enzymatic means) .
- Primers for use in the present invention are preferably at least five bases long. Normally they will be less than 100 or less than 50 bases long. However this is not essential. Naturally occurring and/or non-naturally occurring bases may be present in the primers .
- target nucleic acid molecules also referred to herein as “templates” for use in the method of the present invention
- a target molecule (when in single-stranded form) comprises a first part having a sequence that can anneal with a first primer and a second part having a sequence complementary to a sequence that can anneal with a second primer.
- the second part has the same sequence as the second primer.
- the second primer may have a sequence that is the same as, or different from, the sequence of the first primer.
- the first and second parts of the target nucleic acid molecules are preferably located at the 3' and at the 5' ends respectively thereof. However this is not essential.
- the target molecule will usually also comprise a third part located between the first and second parts.
- This part of the molecule comprises a particular sequence to be replicated. It can be from any desired source and may have a known or unknown (sometimes referred to as "anonymous") sequence. It may be derived from random fractionation by mechanical means or by limited restriction enzyme digestion of a nucleic acid sample, for example .
- Further parts of the target molecules may be provided if desired. For example parts designed to act as tags may be provided.
- a "tag' is defined by its function of enabling a particular nucleic acid molecule (or its complement) to be identified.
- target nucleic acid molecules can be provided by techniques known to those skilled in the art of nucleic acid manipulation. For example, two or more parts can be joined together by ligation. If necessary, prior to ligation appropriate modifications can be made to provide molecules in a form ready for ligation. For example if blunt end ligation is desired then a single-strand specific exonuclease such as SI nuclease could be used to remove single stranded portions of molecules prior to ligation.
- Linkers and/or adapters may also be used in nucleic acid manipulation. (Techniques useful for nucleic acid manipulation are disclosed in Sambrook et al , Molecular Cloning, 2 nd Edition, Cold Spring Harbor Laboratory Press (1989), for example.)
- a template molecule Once a template molecule has been synthesised it can be cloned into a vector and can be amplified in a suitable host before being used in the present invention. It may alternatively be amplified by PCR. As a further alternative, batches of template molecules can be synthesised chemically using automated DNA synthesisers (e.g. from Perkin-Elmer/Applied Biosystems, Foster City, CA) .
- the present invention allows large numbers of nucleic acid molecules identical in sequence to be provided in a colony arising from a single molecule of template. Furthermore, the template can be re-used to generate further colonies. Thus it is not essential to provide large numbers of template molecules to be used in colony formation.
- the template can be of any desired length provided that it can participate in the method of the present invention. Preferably it is at least 10, more preferably at least 20 bases long. More preferably it is at least 100 or at least 1000 bases long. As is the case for primers for use in the present invention, templates may comprise naturally occurring and/or non-naturally occurring bases . Reaction Conditions
- reaction conditions suitable for the method of the present invention uses repeated steps of annealing of primers to templates, primer extension and separation of extended primers from templates. These steps can generally be performed using reagents and conditions known to those skilled in PCR (or reverse transcriptase plus PCR) techniques. PCR techniques are disclosed, for example, in “PCR: Clinical Diagnostics and Research", published in 1992 by Springer- Verlag.
- nucleic acid polymerase can be used together with a supply of nucleoside triphosphate molecules (or other molecules that function as precursors of nucleotides present in DNA/RNA, such as modified nucleoside triphosphates) to extend primers in the presence of a suitable template.
- deoxyribonucleoside triphosphates are desirably provided.
- Preferred deoxyribonucleoside triphosphates are abbreviated; dTTP (deoxythymidine nucleoside triphosphate) , dATP (deoxyadenosine nucleoside triphosphate) , dCTP (deoxycytosine nucleoside triphosphate) and dGTP (deoxyguanosine nucleoside triphosphate) .
- Preferred ribonucleoside triphosphates are UTP, ATP, CTP and GTP. However alternatives are possible. These may be naturally or non- naturally occurring.
- a buffer of the type generally used in PCR reactions may also be provided.
- a nucleic acid polymerase used to incorporate nucleotides during primer extension is preferably stable under the pertaining reaction conditions in order that it can be used several times. (This is particularly useful in automated amplification procedures.)
- the nucleic acid polymerase is preferably heat stable at the temperature used.
- heat stable polymerases are known to those skilled in the art. They are obtainable from thermophilic micro-organisms . They include the DNA dependent DNA polymerase known as Taq polymerase and also thermostable derivatives thereof.
- the nucleic acid polymerase need not however be DNA dependent . It may be RNA dependent . Thus it may be a reverse transcriptase - i.e. an RNA dependent DNA polymerase.
- annealing of a primer to its template takes place at a temperature of 25 to 90°C. Such a temperature range will normally be maintained during primer extension. Once sufficient time has elapsed to allow annealing and also to allow a desired degree of primer extension to occur, the temperature can be increased, if desired, to allow strand separation. At this stage the temperature will typically be increased to a temperature of 60 to 100°C. [High temperatures can also be used to reduce non-specific priming problems prior to annealing. They can be used to control the timing of colony initiation, e.g.
- the strands maybe separated by treatment with a solution of low salt and high pH (> 12) or by using a chaotropic salt (e.g. guanidinium hydrochloride) or by an organic solvent (e.g. formamide) .
- a chaotropic salt e.g. guanidinium hydrochloride
- an organic solvent e.g. formamide
- a washing step will be performed.
- the washing step can be omitted between initial rounds of annealing, primer extension and strand separation, if it is desired to maintain the same templates in the vicinity of immobilised primers. This allows templates to be used several times to initiate colony formation. (It is preferable to provide a high concentration of template molecules initially so that many colonies are initiated at one stage.)
- the size of colonies can be controlled, e.g. by controlling the number of cycles of annealing, primer extension and strand separation that occur. Other factors which affect the size of colonies can also be controlled. These include the number and arrangement on a surface of immobilised primers, the conformation of a support onto which the primers are immobilised, the length and stiffness of template and/or primer molecules, temperature and the ionic strength and viscosity of a fluid in which the above-mentioned cycles can be performed.
- colonies Once colonies have been formed they can be used for any desired purpose .
- colonies may be modified to provide different colonies (referred to herein as "secondary colonies” in order to distinguish from the "primary colonies” initially formed) .
- a surface comprising immobilised nucleic acid strands in the form of colonies of single stranded nucleic acid molecules is also within the scope of the present invention.
- each immobilised nucleic acid strand within a colony will be located on the surface so that an immobilised and complementary nucleic acid strand thereto is located on the surface within a distance of the length of said immobilised nucleic acid strand (i.e. within the length of one molecule) .
- This allows very high densities of nucleic acid strands and their complements to be provided in immobilised form.
- a nucleic acid strand and its complement will preferably be substantially homogeneously distributed within the colony.
- Such surfaces are also within the scope of the present invention. Normally, such surfaces are obtained after treating primary colonies, e.g., by partial digestion by restriction enzymes or by partial digestion after strand separation (e.g., after heating) by an enzyme which digests single stranded DNA) , or by chemical or physical means, (e.g., by irradiating with light colonies which have been stained by an intercalating dye e.g., ethidium bromide) .
- an intercalating dye e.g., ethidium bromide
- single stranded colonies can be used to provide double stranded molecules. This can be done, for example, by providing a suitable primer (preferably in solution) that hybridises to the 3' ends of single stranded immobilised molecules and then extending that primer using a nucleic acid polymerase and a supply of nucleoside triphosphates (or other nucleotide precursors) .
- a suitable primer preferably in solution
- non-bridged is used here to indicate that the molecules are not in the form of the bridge-like structures shown in e.g. figure lh.
- small colonies can be provided that contain large numbers of nucleic acid molecules (whether single or double stranded) . Many colonies can therefore be located on a surface having a small area. Colony densities that can be obtained may therefore be very high, as discussed supra .
- Different colonies will generally be comprised of different amplified nucleic acid strands and amplified complementary strands thereto.
- the present invention allows many different populations of amplified nucleic acid molecules and their complements to be located on a single surface having a relatively small surface area.
- the surface will usually be planar, although this is not essential.
- the present invention also provides an apparatus for providing a surface comprising colonies of the immobilised nucleic acid molecules discussed supra .
- Such an apparatus can include one or more of the following: a) means for immobilising primers on a surface (although this is not needed if immobilised primers are already provided) ;
- a supply of precursors of the nucleotides to be incorporated into a nucleic acid e.g. a supply of nucleoside triphosphates
- control means for co-ordinating the different steps required for the method of the present invention.
- immobilised nucleic acids produced via the method of the present invention can include a source of reactants and detecting means for detecting a signal that may be generated once one or more reactants have been applied to the immobilised nucleic acid molecules. They may also be provided with a surface comprising immobilised nucleic acid molecules in the form of colonies, as described supra .
- the means for detecting a signal has sufficient resolution to enable it to distinguish between signals generated from different colonies .
- Apparatuses of the present invention are preferably provided in automated form so that once they are activated, individual process steps can be repeated automatically.
- FIGURE 1 illustrates a method for the simultaneous amplification and immobilisation of nucleic acid molecules using a single type of primer.
- FIGURE 2 illustrates how colony growth using a method of the present invention can occur.
- FIGURE 3 illustrates the principle of the method used to produce DNA colonies using the present invention. It also illustrates the annealing, elongation and denaturing steps that are used to provide such colonies.
- FIGURE 4 is an example of DNA colonies formed by amplification of a specific template with single primers grafted onto a surface.
- FIGURE 5 illustrates a method for the simultaneous amplification and immobilisation of nucleic acid molecules using two types of primer.
- FIGURE 6 shows actual DNA colonies produced via the present invention.
- FIGURE 7 illustrates a method of the simultaneous amplification and immobilisation of nucleic acid molecules when a target molecule is used as a template having internal sequences that anneal with primers.
- Figure 8 illustrates a method to synthesise additional copies of the original nucleic acid strands using nucleic acid strands present in colonies . The newly synthesised strands are shown in solution but can be provided in immobilised form if desired.
- Figure 9 shows the PCR amplification of DNA from DNA found in the pre-formed DNA colonies.
- FIGURE 10 illustrates how secondary primers can be generated from DNA colonies .
- FIGURE 11 illustrates how secondary DNA colonies can be generated from secondary primers .
- FIGURE 12 illustrates how primers with different sequences can be generated from a surface functionalised with existing primers .
- FIGURE 13 depicts methods of preparing DNA fragments suitable for generating DNA colonies .
- FIGURE 14 illustrates a method for synthesising cRNA using the DNA colony as a substrate for RNA polymerase.
- FIGURE 15 illustrates a preferable method to determine the DNA sequence of DNA present in individual colonies.
- FIGURE 16 illustrates a method of determining the sequence of a DNA colony, de novo .
- FIGURE 17 illustrates the utility of secondary DNA colonies in the assay of mRNA expression levels.
- FIGURES 18 and 19 illustrates the use of the secondary DNA colonies in the isolation and identification of novel and rare expressed genes.
- a surface having attached thereto a plurality of primers (only one primer is shown for simplicity) .
- Each primer (1) is attached to the surface by a linkage indicated by a dark block. This may be a covalent or a non-covalent linkage but should be sufficiently strong to keep a primer in place on the surface.
- the primers are shown having a short nucleotide sequence (5' -ATT). In practice however longer sequences would generally be provided.
- Figure lb shows a target molecule (II) that has annealed to a primer.
- the target molecule comprises at its 3' end a sequence (5'- ATT) that is complementary to the primer sequence (5' -ATT).
- the target molecule comprises a sequence (5' -ATT) that is the same as the primer sequence (although exact identity is not required) .
- any sequence to be amplified (or the complement of any sequence to be amplified) can be provided.
- part of the sequence to be amplified has been shown as 5' -CCG.
- primer extension is shown.
- a DNA polymerase is used together with dATP, dTTP, dGTP and dCTP to extend the primer (5' -ATT) from its 3' end, using the target molecule as a template.
- an extended immobilised strand (III) is provided that is complementary to the target molecule.
- the target molecule can then be separated from the extended immobilised strand (e.g. by heating, as shown in Figure le) ) .
- This separation step frees the extended, immobilised strand so that it can then be used to initiate a subsequent round of primer extension, as shown in Figures If) and lg)
- the extended, immobilised strand bends over so that one end of that strand (having the terminal sequence 5' -AAT) anneals with another primer (2, 5'-ATT), as shown in Figure If). That primer provides a 3' end from which primer extension can occur, this time using the extended, immobilised strand as a template.
- Primer extension is shown occurring in Figure lg) and is shown completed in Figure lh) .
- Figure li shows the two extended immobilised strands that were shown in Figure lh) after separation from one another (e.g. by heating) . Each of these strands can then themselves be used as templates in further rounds of primer extension initiated from new primers (3 and 4), as shown in Figures 1j ) and Ik).
- Four single stranded, immobilised strands can be provided after two rounds of amplification followed by a strand separation step (e.g. by heating), as shown in Figure 11) . Two of these have sequences corresponding to the sequence of the target molecule originally used as a template. The other two have sequences complementary to the sequence of the target molecule originally used as a template. (In practice a given immobilised strand and its immobilised complement may anneal once.)
- each extended immobilised molecule will be located at a surface within one molecule length of another extended immobilised molecule.
- position 3 shown in Figure 11 is within one molecule length of position 1; position 1 is within one molecule length of position 2; and position 2 is within one molecule length of position 4.
- Figure 2 is provided to illustrate how colony growth can occur (using the method described with reference to Figure 1 and to Figure 6 or any other method of the present invention for providing immobilised nucleic acid molecules) .
- a flat plate is shown schematically in plan view having primers immobilised thereon in a square grid pattern (the primers are indicated by small dots) .
- a regular grid is used solely for simplicity: in many real cases, the positions of the primers might indeed be less ordered or random.
- a template molecule has annealed to a primer and an initial bout of primer extension has occurred to provide an immobilised, extended nucleic acid strand.
- an end of that strand becomes free to anneal to further primers so that additional immobilised, extended nucleic acid strands can be produced.
- This is shown having occurred sequentially at positions indicated by the letter Y.
- the primer chosen for annealing is positioned next to the primer carrying the nucleic acid strand: in real cases, the nucleic acid strand could anneal with a primer which is not its next nearest neighbour. However, this primer will obviously be within a distance equal to the length of the nucleic acid strand.
- FIG. 3 shows a simplified version of the annealing, elongation and denaturing cycle. It also depicts the typical observations that can be made, as can be seen on the examples shown in figures 4 and 6.
- the simultaneous amplification and immobilisation of nucleic acids using solid phase primers has been successfully achieved using the procedure described in Examples 1, 2 and 3 below:
- Oligonucleotides phosphorylated at their 5' -termini (Microsynth GmbH, Switzerland) , were grafted onto Nucleolink plastic microtitre wells (Nunc, Roskilde, Denmark) .
- the sequence of the oligonucleotide p57 corresponds to the sequence 5' -TTTTTTCACCAACCCAAACCAACCCAAACC and p58 corresponds to the sequence 5 ' -TTTTTTAGAAGGAGAAGGAAAGGGAAAGGG .
- Microtitre wells with p57 or p58 were prepared as follows.
- Colony generation was initiated in each well with 15 ⁇ l of priming mix; 1 nanogram template DNA (where the template DNA began with the sequence 5' -AGAAGGAGAAGGAAAGGGAAAGGG and terminated at the 3 '-end with the sequence CCCTTTCCCTTTCCTTCTCCTTCT-3' ) , the four dNTPs (0.2 mM) , 0.1% BSA (bovine serum albumin, Boehringer-Mannheim, Germany), 0.1% Tween 20, 8% DMSO (dimethylsulfoxide, Fluka Chemicals, Switzerland), IX Amplitaq PCR buffer and 0.025 units/ ⁇ l of AmpliTaq DNA polymerase (Perkin Elmer, Foster City, CA) .
- the priming reaction was a single round of PCR under the following conditions; 94 °C for 4 minutes, 60°C for 30 seconds and 72°C for 45 seconds in a thermocycler (PTC 200, MJ Research, Watertown, MA) . Then 100 ⁇ l TE buffer (lOmM trisHCl, pH 7.5, ImM EDTA) was used in three successive one minute long washes at 94 C C. The DNA colonies were then formed by adding to each well, 20 ⁇ l of polymerisation mix, which was identical to the priming mix but lacking the template DNA.
- the wells were then placed in the PTC 200 thermocycler and colony growing was performed by incubating the sealed wells 4 minutes at 94 °C and cycling for 50 repetitions the following conditions: 94 °C for 45 seconds, 65°C for 2 minutes, 72°C for 45 seconds. After completion of this program, the wells were kept at 8°C until further use.
- a 640 base pair fragment corresponding to the central sequence of the template was amplified by PCR.
- the isolated fragment was labelled with biotin- N 4 -dCTP (NEN Life Sciences, Boston, MA) and a trace of [ ⁇ - 32 P]dCTP (Amersham, UK) using the Prime-it II labelling kit (Stratagene, San Diego, CA) to generate a biotinylated probe.
- the biotinylated probe was diluted in to a concentration of 2.5 nM in EasyHyb (Boehringer-Mannheim, Germany) and 15 ⁇ l was hybridized to each sample with the following temperature scheme (PTC 200 thermocycler): 94°C for 5 minutes, followed by 500 steps of 0.1°C decrease in temperature every 12 seconds (in other words, the temperature is decreased down to 45 °C in 100 minutes) .
- PTC 200 thermocycler 94°C for 5 minutes, followed by 500 steps of 0.1°C decrease in temperature every 12 seconds (in other words, the temperature is decreased down to 45 °C in 100 minutes) .
- the samples are then washed as follows; 1 time with 2X SSC/0.1% SDS (2X SSC; 0.3M NaCl/0.03M sodium citrate pH7.0/0.001 mg/ml sodium dodecyl sulfate) at room temperature, once with 2X SSC/0.1% SDS at 37°C and once with 0.2X SSC/0.1% SDS at 50°C.
- the wells are then incubated for 30 minutes with 50 ⁇ l of red fluorescent, Neutravidin-coated, 40 nm FluoSpheres (R) (580 nm excitation and 605 nm emission, Molecular Probes Inc., Eugene, OR) in TNT/0.1% BSA.
- the solution of microspheres is made from a dilution of 2 ⁇ l of the stock solution of microspheres into 1ml of TNT/0.1% BSA, which is then sonicated for 5 minutes in a 50 W ultra-sound water-bath (Elgasonic, Switzerland) , followed by filtration through a 0.22 ⁇ m filter (Millex GV4). The wells are then counted (Cherenkov) on a Microbeta plate scintillation counter (WALLAC, Turku, Finland) . Excess FluoSpheres ⁇ R) are removed by washing for 30 min in TNT/0.1%BSA at room temperature.
- Images of the stained samples are observed using a 20X objective on an inverted microscope (Axiovert S100TV, Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512x768 CCD camera (Princeton instruments, Trenton, NJ) through a XF43 filter set (PB546/FT580/LP590, Omega Optical, Brattleboro, VT) with a 5 second exposure.
- a 20X objective on an inverted microscope (Axiovert S100TV, Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512x768 CCD camera (Princeton instruments, Trenton, NJ) through a XF43 filter set (PB546/FT580/LP590, Omega Optical, Brattleboro, VT) with a 5 second exposure.
- PB546/FT580/LP590 Omega Optical, Brattleboro, VT
- Figure 4 shows the hybridisation results for colony generation on tubes functionalised with either; (a) oligonucleotide p57 or (b) oligonucleotide p58.
- the control reaction shows very few fluorescent spots, since the sequence of the flanking regions on the template do not correspond to the primer sequences grafted onto the well.
- figure 4b shows the number of fluorescent spots detected when the primers grafted to the wells match the flanking sequences on the initiating DNA template. Calculating the number of fluorescent spots detected and taking into consideration the magnification, we can estimate that there are between 3 and 5 x 10 7 colonies/cm 2 .
- the photos are generated by the program, Winview 1.6.2 (Princeton Instruments, Trenton, NJ) with backgrounds and intensities normalised to the same values.
- the target molecule shown is provided with a nucleotide sequence at its 3' end (AAT-3' ) that is complementary to the sequence of a first primer, (5'-ATT, I), which is grafted on the surface, so that annealing with that primer can occur.
- the sequence (5' -GGT) at the 5' end of the target molecule, III corresponds to the sequence (5' -GGT) of a second primer, II, which is also grafted to the surface, so that the sequence which is complementary to the sequence at the 5' end can anneal with that said second primer.
- said complementary sequence (5' -ACC) is chosen so that it will not anneal with the first primer (5' -ATT).
- a template has been cloned in a vector (pBlueScript Skminus, Stratagene Inc, San Diego, CA) with the appropriate DNA sequence at the cloning site (i.e., corresponding to PI and P2 at position 621 and 794 respectively) , and 174 bp long linear double stranded DNA template has been obtained by PCR amplification, using PI and P2.
- the template PCR product has been purified on Qiagen Qia-quick columns (Qiagen GmbH, Hilden, Germany) in order to remove the nucleotides and the primers used during the PCR amplification.
- the purified template in 50 ⁇ l solution containing IX PCR buffer (Perkin Elmer, Foster City, CA) with the four deoxyribonucleoside triphosphates (dNTPs) at 0.2 mM, (Pharmacia, Uppsala, Sweden) and 2.5 units of AmpliTaq Gold DNA polymerase (Perkin Elmer, Foster City, CA) ) has been spread on the support, i.e. on the Nucleolink plates grafted with PI and P2 (the plates have been rinsed with a solution containing 100 mM TRIS-HC1 (pH 7.5), 150 mM NaCl and 0.1% Tween 20 (Fluka, Switzerland) at room temperature for 15 min) .
- IX PCR buffer Perkin Elmer, Foster City, CA
- dNTPs deoxyribonucleoside triphosphates
- AmpliTaq Gold DNA polymerase Perkin Elmer, Foster City, CA
- This solution has been incubated at 93°C for 9 minutes to activate the DNA polymerase and then 60 cycles (94°C/30 sec.,48°C/30 sec.,72°C/30 sec.) have been performed on a PTC 200 thermocycler.
- 60 cycles 94°C/30 sec.,48°C/30 sec.,72°C/30 sec.
- concentrations of PCR template have been tested (approximately 1, 0.5, 0.25, 0.125, 0.0625 ng/ ⁇ l) and for each sample a control reaction carried out without Taq polymerase has been performed (same conditions as above but without DNA polymerase) .
- YO-PRO Molecular Probes, Portland OR
- YO-PRO Molecular Probes, Portland OR
- the resulting products have been observed on a confocal microscope using a 40X objective (LSM 410, Carl Zeiss AG, Oberkochen, Germany) with appropriate excitation (an 488 argon laser) and detection filters (510 low pass filter) (note: the bottom of each well is flat and allows observation with an inverted fluorescence microscope) .
- control well (without added DNA template, panel a) shows only rare objects which can be observed on a blank surface
- Oligonucleotides (Microsynth GmbH, Switzerland) were grafted onto Nucleolink wells (Nunc, Denmark) .
- Oligonucleotide PI corresponds to the sequence 5' -TTTTTTCTCACTATAGGGCGAATTGG and oligonucleotide P2 corresponds to 5' -TTTTTTCTCACTAAAGGGAACAAAAGCTGG.
- a 45 ⁇ l of 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals, St. Louis, MO) solution containing 360 fmol of PI and 360 fmol of P2 was added.
- SI and S2 are 704 base pair and 658bp fragments, respectively, which have been cloned into pBlueScript Skminus plasmids and subsequently amplified through a PCR using PI and P2 as primers. The fragments were purified on Qiagen Qia-quick columns (QIAGEN GmbH, Germany) in order to remove the nucleotides and the primers .
- a 640base pair fragment corresponding to the central sequence of the SI fragment, but not including the PI or P2 sequence was amplified by PCR as previously described.
- the probe was labelled with biotin-16- dUTP (Boehringer-Mannheim, Germany) using the Prime-it II random primer labelling kit (Stratagene, San Diego, CA) according to the manufacturers instructions .
- the biotinylated probes were hybridized to the samples in EasyHyb buffer (Boehringer-Mannheim, Germany) , using the following temperature scheme (in the PTC 200 thermocycler) : 94°C for 5 minutes, followed by 68 steps of 0.5°C decrease in temperature every 30 seconds (in other words, the temperature is decreased down to 60 °C in 34 minutes), using sealed wells.
- the samples are then washed 3 times with 200 ⁇ l of TNT at room temperature.
- the wells are then incubated for 30 minutes with 50 ⁇ l TNT containing 0.1 mg/ l BSA.
- the wells are incubated 5 minutes with 15 ⁇ l of solution of red fluorescent, Neutravidin-coated, 40 nm FluoS ⁇ heres (R) (580 nm excitation and 605 nm emission, Molecular Probes, Portland, OR) .
- the solution of microspheres is made of 2 ⁇ l of the stock solution of microspheres, which have been sonicated for 5 minutes in a 50 W ultra-sound water-bath (Elgasonic, Bienne, Switzerland) , diluted in 1 ml of TNT solution containing 0.1 mg/ml BSA and filtered with Millex GV4 0.22 ⁇ m pore size filter (Millipore, Bedford, MA).
- the stained samples are observed using an inverted Axiovert 10 microscope using a 20X objective (Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512x768 CCD camera (Princeton Instruments, Trenton, NJ) , using a XF43 filter set (PB546/FT580/LP590, Omega Optical, Brattleboro, VT) , and 10 seconds of light collection.
- the files are converted to TIFF format and processed in the suitable software (PhotoPaint, Corel Corp., Ottawa, Canada).
- the processing consisted in inversion and linear contrast enhancement, in order to provide a picture suitable for black and white print-out on a laser printer.
- the figure 6B shows the results for 3 different ratios of the S1/S2 templates used in the initiating reaction: i) the S1/S2 is 1/0, many spots can be observed, ii) the S1/S2 is 1/10, and the number of spots is approximately 1/10 of the number of spots which can be observed in the i) image, as expected, and iii) the S1/S2 is 0/1, and only a few rare spots can be seen.
- Figure 7 is provided to show that the sequences shown at the 5' and 3' ends of the target molecule illustrated in Figures 1 and 5 need not be located at the ends of a target molecule.
- a target nucleic acid molecule (II) may have a sequence at each (or either) end that is neither involved in annealing with a primer nor in acting as a template to provide a complementary sequence that anneals with a primer (sequence 5'-AAA and sequence 5'-CCC).
- One of the internal sequences (5' -AAT) is used as a template to synthesise a complementary sequence, III, thereto (5' -TTT), as is clear from figures 7(a) to 7(e).
- the sequence 5' -TTT is not however itself used to provide a sequence complementary thereto, as is clear from figures 7(f) to 7(k). It can be seen from Figure 7(1) that only one of the four immobilised strands shown after two rounds of primer extension and a strand separation step comprises the additional sequence 5' -TTT and that no strand comprising a complementary sequence (5' -AAA) to this sequence is present (i.e. only one strand significantly larger than the others is present) . After several rounds of amplification the strand comprising the sequence 5' -TTT will represent an insignificant proportion of the total number of extended, immobilised nucleic acid molecules present.
- Amplified, single stranded nucleic acid molecules present in colonies provided by the present invention can themselves be used as templates to synthesise additional nucleic acid strands.
- Figure 8 illustrates one method of synthesising additional nucleic acids using immobilised nucleic acids as a starting point.
- Colonies will usually comprise both a given nucleic acid strand and its complement in immobilised form (figure 8a) . Thus they can be used to provide additional copies not only of a given nucleic acid strand but also of its complement.
- One way of doing this is to provide one or more primers (primers TTA and TGG) in solution that anneal to amplified, immobilised nucleic acid strands present in colonies (figure 8c) provided by the present invention.
- primers may be the same as primers initially used to provide the immobilised colonies, apart from being provided in free rather than immobilised form.
- the original DNA colony is denatured by heat to it single-stranded form (figure 8b) ,, allowing primers TTA and TGG to anneal to the available 3' end of each DNA strand.
- Primer extension using AmpliTaq DNA polymerase and the four deoxyribonucleoside triphosphates (labelled or unlabeled) can then be used to synthesise complementary strands to immobilised nucleic acid strands or at least to parts thereof (step (iii)).
- strands synthesised in this manner after separation from the immobilised strands, can, if desired, be annealed to one another (i.e. a given strand and its complement can anneal) to provide double-stranded nucleic acid molecules in solution. Alternatively they can be separated from one another to provide homogenous populations of single-stranded nucleic acid molecules in solution.
- nucleic acid strands in different colonies have different sequences
- primers can be provided to allow several or all of the colonies to be used as templates.
- Such primers may be a mixture of many different primers (e.g. a mixture of all of the primers originally used to provide all of the colonies, but with the primers being provided in solution rather than in immobilised form) .
- Oligonucleotides (Microsynth GmbH Balgach, Switzerland) were grafted onto Nucleolink wells (Nunc, Denmark) .
- Oligonucleotide PI corresponds to the sequence 5' -TTTTTTTTTTCACCAACCCAAACCAACCCAAACC and oligonucleotide P2 corresponds to 5'-
- TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG In each Nucleolink well, a 45 ⁇ l of 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals) solution containing 360 fmol of PI and 360 fmol of P2 was added. To each well, 15 ⁇ l of 40 mM l-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-imidazole, was added to the solution of oligonucleotides. The wells were then sealed and incubated at 50 °C for 16 hours.
- initiation mix IX PCR buffer, 0.2 mM dNTPs and 0.75 units of AmpliTaq DNA polymerase, 20 nanograms of template DNA, where the template DNA was either SI DNA or S2 DNA or a 1/1 mixture of SI DNA and S2 DNA, as indicated in discussion to Example 3.
- SI and S2 are 658 base pair and 704 b.p. fragments, respectively, which have been prepared as described in EXAMPLE 3.
- set A was left untreated, set B has been incubated for 10 minutes with BAL-31 exonuclease (New England Biolabs, Beverly, MA) at 37°C in BAL-31 buffer (BAL-31 essentially digests double stranded DNA which has both ends free) , set C has been incubated for 10 minutes with SI nuclease (Pharmacia, Uppsala, Sweden) at 37 °C in SI buffer (SI nuclease essentially digests single stranded DNA) , set D, E and F have been incubated with both BAL-31 and SI nucleases. Reactions were stopped by rinsing the wells with TNT buffer.
- BAL-31 exonuclease New England Biolabs, Beverly, MA
- P70 and P71 are suited for the amplification of both SI and S2, since primer P70 contains the sequence of primer PI and p71 contains P2.
- PCR has been performed with a set of forward (P150, 5' -GGTGCTGGTCCTCAGTCTGT) and reverse (P151, 5'- CCCGCTTACCAGTTTCCATT) primers which are within SI and not within S2 so as to produce a 321 bp PCR product
- PCR has been performed with a set of forward (P152, 5'- CTGGCCTTATCCCTAACAGC) and reverse (P153, 5' -CGATCTTGGCTCATCACAAT) primers which are within S2 and not within Si so as to produce a 390 bp PCR product.
- initially formed colonies it is also possible to modify initially formed colonies to provide different colonies (i.e. to provide colonies comprising immobilised nucleic acid molecules with different sequences from those molecules present in the initially formed colonies) .
- initially formed colonies are referred to as “primary colonies” and the later formed colonies as “secondary colonies”.
- primary colonies and the later formed colonies as “secondary colonies”.
- secondary colonies A preliminary procedure is necessary to turn the primary colonies into “secondary primers" which will be suitable for secondary colony generation.
- Figure 10 shows how Secondary primers' are generated using existing primary colonies.
- the primary colony (figure 10a) is left in the fully hybridised, double-stranded form.
- a single-strand specific DNA exonuclease might be used to remove all primers which have not been elongated.
- the DNA molecules forming the colonies can be cleaved by using endonucleases.
- endonucleases For example, a restriction enzyme that recognises a specific site within the colony (depicted by the 'RE' arrow in figure 10c) and cleaves the DNA colony (step (ii) , figure 10) .
- the enzymatically cleaved colony (figure lOd) can then be partially digested with a 3' to 5' double-strand specific exonuclease (e.g. E . coli exonuclease III, depicted by 'N' , step (iii) , figure lOd) .
- the secondary primers are available after denaturation (e.g., by heat) and washing (figure lOe) .
- the double stranded DNA forming the colonies can be digested with the double-strand specific 3' -5' exonuclease, which digest only one strand of double stranded DNA.
- An important case is when the exonuclease digests only a few bases of the DNA molecule before being released in solution, and when digestion can proceed when another enzyme binds to the DNA molecule (figure lOg) .
- Templates useful for secondary colony growing may include molecules having known sequences (or complements of such sequences) .
- templates may be derived from unsequenced molecules (e.g. random fragments). In either event the templates should be provided with one or more regions for annealing with nucleic acid strands present in the primary colonies.
- Figure 11 a-e show how a secondary colony can be generated when an appropriate template (TP, figure 11a) is provided for a second round of DNA colony generation on a support for secondary colony growing, holding secondary primers.
- treatment of the primary colony as described above has generated the secondary primers, SP1 and SP2 (figure 11a) .
- the template TP will hybridise to its complementary secondary primer, SP1, and following an extension reaction using a DNA polymerase as described, will be extended as depicted (figure 12b) .
- a replica of the original primary colony will be formed (figure lie) .
- the maximum size of a secondary colony provided by this embodiment of the present invention is restricted by the size of the primary colony onto which it grows.
- Several secondary growing processes can be used sequentially to create colonies for specific applications (i.e. a first colony can be replaced with a second colony, the second colony can be replaced with a third colony, etc.)
- Figure 12 shows how extended primers can be generated on an array of oligonucleotides. The same procedure could be applied to a support covered with colonies or secondary primers as described in section E.
- a support having a plurality of immobilised primers shown thereon. Different immobilised primers are shown present in different regions of the support (represented by squares). Primers having the sequence 5' -AAA are present in one square and primers having the sequence 5' -GGG are present in another square.
- Figures 12b) to 12d) show how the initial primers present (initial primers) are modified to give different primers (extended primers) .
- those initial primers having the sequence 5' -AAA are modified to produce two different types of extended primers, having the sequences 5'-AAAGCC and 5'-AAATAC respectively. This is achieved by the hybridisation of oligonucleotide templates, 5'-GTATTT and 5'- GGCTTT to the primary primers immobilised on the surface (figure 12b) , followed by DNA polymerase reaction.
- Those initial primers having the sequence 5' -GGG are modified to produce two different types of extended primers, having the sequences 5'-GGGTAT and 5'- GGGTAA (figure 12d) in a similar manner.
- the technique of producing extended primers is useful for transforming immobilised oligonucleotides provided on a DNA chip or other surface into immobilised primers useful in amplifying a particular target nucleic acid sequence and/or in amplifying a complementary strand thereto.
- the DNA of interest is first extracted from the biological sample and cut randomly into "small" pieces (e.g., 50 to 10,000 bases long, but preferentially 500 to 1000 base pairs in length, represented by bar 'I', figure 13a). (This can be done e.g., by a phenol-chloroform extraction followed by ultrasound treatment, mechanical shearing, by partial digestion with frequent cutter restriction endonucleases or other methods known by those skilled in the art) .
- the extracted and cut DNA fragments can be size-fractionated, e.g., by agarose gel electrophoresis, sucrose gradient centrifugation or gel chromatography. Fragments obtained within a single fraction can be used in providing templates in order to reduce the variability in size of the templates.
- the extracted, cut and (optionally) sorted template DNA fragments can be ligated with oligonucleotide linkers (Ila and lib, figure 13a) containing the sequence of the primer (s) which have previously been grafted onto a support. This can be achieved, for instance, using "blunt-end" ligation.
- the template DNA fragments can be inserted into a biological vector at a site that is flanked by the sequence of the primers that are grafted on the support. This cloned DNA can be amplified within a biological host and extracted. Obviously, if one is working with a single primer grafted to the solid support for DNA colony formation, purifying fragments containing both PI and P2 primers does not pose a problem.
- DNA fragments obtained after such a suitable process are designated by the expression : "prepared genomic DNA” (III, figure 13a) .
- the procedure is the same as that described in the previous section except that in this case, the oligonucleotide linkers used to tail the randomly cut genomic DNA fragments are now made of two parts; the sequence of the primers grafted onto the surface (PI and P2, figure 13b) and a "tag" sequence which is different for each sample and which will be used for identifying the origin of the DNA colony.
- the tag may not be unique, but a plurality of tags could be used.
- we will designate the DNA fragments obtained after such a suitable process by the expression : "tagged genomic DNA" (III, Figure 13b) .
- This tagging procedure can be used for providing colonies carrying a means of identification which is independent from the sequence carried by the template itself. This could also be useful when some colonies are to be recovered specifically (using the procedure given in section D) . This could also be useful in the case the recovered colonies are further processed, e.g., by creating new primary colonies and a cross reference between the original colonies and the new colonies is desired.
- the DNA of interest can first be extracted from a biological sample by any means known by those skilled in the art (as mentioned supra) . Then the specific sequences of interest can be amplified with PCR
- step (i), figure 13d) The procedure is the same as in the previous section except that in this case the DNA primers (Ila and lib) used to perform the PCR amplification (step (i), figure 13d) are now made of three parts; 1) the sequence of the primers grafted onto the surface (PI and P2), 2) a "tag" sequence which is different for each sample and which will be used for the identifying the origin of the DNA colony and 3) primer sequences surrounding the specific sequence of interest (SI and S2) . Note that for each sample, a plurality of tags might be used, as in (ii) supra .
- the procedure is similar to the procedures described for preparing DNA fragments in the previous sections except that the starting point is to extract mRNA by any means known to those skilled in the art (e.g., by use of commercially available mRNA preparation kits).
- the mRNA can be copied into double-stranded cDNA by any means known to those skilled in the art (e.g. by using a reverse transcriptase and a DNA polymerase) .
- the tags and primers described supra can be used in conjunction with the process of double-stranded cDNA synthesis to allow their incorporation into the templates.
- we will designate the mRNA fragments obtained after such suitable processes by the expressions: "prepared total mRNA" (cf.
- labels may be used to provide detectable signals.
- Examples include: a) a fluorescent group or a energy-transfer based fluorescence system.
- colonies can be incubated with streptavidin labelled with a fluorescent group or an enzyme (e.g. fluorescent latex beads coated with streptavidin; streptavidin labelled with fluorescent groups; enzymes for use with the corresponding fluorescence assay) .
- colonies can be incubated with antibodies (e.g. specific for a hapten) .
- the antibodies can be labelled with a fluorescent group or with an enzyme (e.g. fluorescent latex beads coated with the antibody; antibodies labelled with fluorescent groups; antibodies linked to an enzyme for use with a corresponding fluorescence or luminescence assay, etc.).
- a radio-label e.g. incorporated by using a 5' -polynucleotide kinase and [ ⁇ - 32 P] adenosine triphosphate or a DNA polymerase and [oc- 32 P or ⁇ - 33 P] deoxyribonucleoside triphosphates to add a radioactive phosphate group (s) to a nucleic acid).
- colonies can be incubated with a scintillation liquid.
- a dye or other staining agent e.g. incorporated by using a 5' -polynucleotide kinase and [ ⁇ - 32 P] adenosine triphosphate or a DNA polymerase and [oc- 32 P
- Labels for use in the present invention are preferably attached a) to nucleic acids b) to proteins which bind specifically to double stranded DNA (e.g., histones, repressors, enhancers) and/or c) to proteins which bind specifically to single stranded DNA (e . g. single-stranded nucleic acid binding protein) .
- Labelled colonies are preferably detected by: a) measuring fluorescence. b) measuring luminescence. c) measuring radioactivity d) measuring flow or electric field induced fluorescence anisotropy. and/or e) measuring the polymer layer thickness.
- Staining agents can be used in the present invention.
- DNA colonies can be incubated with a suitable DNA-specific staining agent, such as the intercalating dyes, ethidium bromide, YO-YO, YO- PRO (Molecular Probes, Eugene, OR) .
- a suitable DNA-specific staining agent such as the intercalating dyes, ethidium bromide, YO-YO, YO- PRO (Molecular Probes, Eugene, OR) .
- DNA colonies are first prepared for hybridisation. Then they are hybridised with a probe (labelled or unlabelled) . If required, the hybridised probed is assayed, and the result is observed. This can be done with an apparatus of the present invention (e.g. as described supra) .
- colonies are treated with a DNA restriction endonuclease which is specific either for a sequence provided by a double stranded form of one of the primers originally grafted onto the surface where colonies are formed or for another sequence present in a template DNA molecule (see e.g. figure 16c) .
- the colonies can be heated to a temperature high enough for double stranded DNA molecules to be separated. After this thermal denaturing step, the colonies can be washed to remove the non-hybridised, detached single-stranded DNA strands, leaving a remaining attached single-strand DNA.
- the colonies can be partially digested with a double-strandspecific 3' to 5' DNA exonuclease (see section E, figure lOf) which removes one strand of DNA duplexes starting from the 3' end, thus leaving a part of a DNA molecule in single stranded form.
- a double-strandspecific 3' to 5' DNA exonuclease see section E, figure lOf
- DNA in colonies can first be heat denatured and then partially digested with an single-strand specific 3' to 5' DNA exonuclease which digests single stranded DNA starting from the 3' end.
- a further alternative is simply to heat denature DNA in the colonies.
- Single-stranded nucleic acid probes (labelled or unlabelled) can be hybridised to single-stranded DNA in colonies at the appropriate temperature and buffer conditions (which depends on the sequence of each probe, and can be determined using protocols known to those skilled in the art) .
- a hybridised probe provided initially in unlabelled form can be used as a primer for the incorporation of the different (or a subset of the different) labelled (or a mix of labelled and unlabelled) deoxyribonucleoside triphosphates with a DNA polymerase.
- the incorporated labelled nucleotides can then be detected as described supra .
- the DNA colonies can be prepared for hybridisation by the methods described supra . Then they can be hybridised with a probe (labelled or initially unlabelled) . If required, hybridised labelled probes are assayed and the result is observed with an apparatus as described previously. The probe may then be removed by heat denaturing and a probe specific for a second DNA sequence may be hybridised and detected. These steps maybe repeated with new probes as many times as desired.
- the probes can be assayed as described supra for unlabelled probes, except that only a subset (preferably 1 only) of the different (labelled or unlabelled) nucleotides are used at each cycle.
- the colonies can then be assayed for monitoring the incorporation of the nucleotides. This second process can be repeated until a sequence of a desired length has been determined.
- DNA colonies can be used as templates for in si tu RNA synthesis as depicted in figure 14.
- DNA colonies can be generated from templates and primers, such that a RNA polymerase promoter sequence is positioned at one end of the double-stranded DNA in the colony.
- DNA colonies can then be incubated with RNA polymerase and the newly synthesised RNA (cRNA) can be assayed as desired. The detection can be done non-specifically (e.g., staining) or in a sequence dependent way (e.g., hybridisation).
- the DNA template (I, figure 14a) to be amplified into a colony is generated by PCR reaction using primers (Ila and lib) which have the following four parts; 1) sequence identical to the sequences of the primers grafted onto the surface ( ⁇ P1' and ⁇ P2'), 2) a "tag" sequence which is different for each sample , a sequence corresponding to a RNA polymerase promoter, ie. the T3, T7 and SP6 RNA promoters, ( ⁇ RPP' , figure 14a) and 4) primer sequences surrounding the specific sequence of interest ( ⁇ S1' and ⁇ S2' ) .
- primers Ila and lib
- cRNA thus synthesised can be isolated and used as hybridisation probes, as messenger RNA (mRNA) templates for in vi tro protein synthesis or as templates for in situ RNA sequence analysis.
- mRNA messenger RNA
- colonies can be analysed in order to determine sequences of nucleic acid molecules which form the colonies. Since very large numbers of the same nucleic acid molecules can be provided within each colony the reliability of the sequencing data obtained is likely to be very high.
- sequences determined may be full or partial. Sequences can be determined for nucleic acids present in one or more colonies. A plurality of sequences may be determined at the same time.
- sequence of a complementary strand to a nucleic acid strand to be sequenced may be obtained initially.
- this sequence can be converted using base-pairing rules to provide the desired sequence (or a part thereof) .
- This conversion can be done via a computer or via a person. It can be done after each step of primer extension or can be done at a later stage.
- Sequencing can be done by various methods . For example methods relying on sequential restriction endonuclease digestion and linker ligation can be used. One such method is disclosed in WO95/27080 for example. This method comprises the steps of: ligating a probe to an end of a polynucleotide, the probe having a nuclease recognition site; identifying one or more nucleotides at the end of the polynucleotide; and cleaving the polynucleotide with a nuclease recognising the nuclease recognition site of the probe such that the polynucleotide is shortened by one or more nucleotides.
- amplified nucleic acid molecules are sequenced by allowing primers to hybridise with the nucleic acid molecules, extending the primers and detecting the nucleotides used in primer extension.
- primers Preferably, after extending a primer by a single nucleotide, the nucleotide is detected before a further nucleotide is used in primer extension (step-by-step sequencing) .
- label is used in its broad sense to indicate any moiety that can be identified using an appropriate detection system.
- the label is not present in naturally- occurring nucleotides.
- labels are non-radioactive, such as fluorophores. However radioactive labels can be used.
- nucleotides are provided in labelled form the labels may be the same for different nucleotides. If the same label is used each nucleotide incorporation can be used to provide a cumulative increase of the same signal (e.g. of a signal detected at a particular wavelength) . Alternatively different labels may be used for each type of nucleotide (which may be detected at different wavelengths) .
- dATP dATP
- dTTP dTTP
- dCTP dCTP
- dGTP dGTP
- ATP adenosine triphosphate
- UTP adenosine triphosphate
- CTP adenosine triphosphate
- GTP adenosine triphosphate
- a mixture of labelled and unlabelled nucleotides may be provided, as will be described in greater detail later on.
- the sequencing of nucleic acid molecules present in at least 2 different colonies is performed simultaneously. More preferably, sequencing of nucleic acid molecules present in over 10, over 100, over 1000 or even over 1,000,000 different colonies is performed simultaneously. Thus if colonies having different nucleic acids molecules are provided, many different sequences (full or partial) can be determined simultaneously - i.e. over 10, over 100, over 1000 or even over 1,000,000 different sequences may be determined simultaneously.
- controls may be provided, whereby a plurality of colonies comprising the same nucleic acid molecules are provided. By determining whether or not the same sequences are obtained for nucleic acid molecules in these colonies it can be ascertained whether or not the sequencing procedure is reliable.
- FIG 17 is entitled “ in si tu sequencing”.
- cyclic addition of the individual deoxyribonucleoside triphosphates and DNA polymerase will allow the determination of the DNA sequence immediately 3' to the sequencing primer.
- the addition of dGTP allows the determination of colony 1 to contain a 'G' .
- addition of dATP is detected in both colonies, determining that both colonies have an 'A' in the next position.
- sequences of at least 10, at least 20, at least 50 or at least 100 bases may be determined.
- colonies are provided initially in a form comprising double- stranded molecules the colonies can be processed to provide single- stranded molecules for use in sequencing as described above.
- double stranded molecules can be used for sequencing without such processing.
- a double stranded DNA molecule can be provided with a promoter sequence and step-by- step sequencing can then be performed using an RNA polymerase and labelled ribonucleotides (cf Figure 16 d) ) .
- Another alternative is for a nick to be introduced in a double stranded DNA molecule so that nick translation can be performed using labelled deoxyribonucleotides . and a DNA polymerase with 5' to 3' exonuclease activity.
- double-stranded immobilised molecules present in a colony are cleaved and this is followed by a denaturing step.
- a denaturing step could be used initially and could be followed by a cleavage step
- cleavage is carried out enzymatically.
- other means of cleavage are possible, such as chemical cleavage.
- Denaturing can be performed by any suitable means. For example it may be performed by heating and / or by changing the ionic strength of a medium in the vicinity of the nucleic acid molecules.
- primers for primer extension can be hybridised thereto.
- Oligonucleotides are preferred as primers. These are nucleic acid molecules that are typically 6 to 60, e.g. 15 to 25 nucleotides long. They may comprise naturally and / or non-naturally occurring nucleotides. (However other molecules, e.g. longer nucleic acid strands may alternatively be used as primers, if desired. )
- the primers for use in sequencing preferably hybridise to the same sequences present in amplified nucleic acid molecules as do primers that were used to provide said amplified nucleic acids. (Primers having the same / similar sequences can be used for both amplification and sequencing purposes) .
- annealing conditions prevent non-specific hybridisation.
- These may be stringent conditions. Such conditions would typically be annealing temperatures close to a primer's Tm (melting temperature) at a given salt concentration (e.g. 50 nM primer in 200 mM NaCl buffer at 55 °C for a 20-mer oligonucleotide with 50% GC content) .
- salt concentration e.g. 50 nM primer in 200 mM NaCl buffer at 55 °C for a 20-mer oligonucleotide with 50% GC content
- primer extension need not be provided in solution, since they can be provided in immobilised form. In this embodiment the primers should be provided in the vicinity of the immobilised molecules to which they are to be annealed. (Such primers may indeed already be present as excess immobilised primers that were not used in amplifying nucleic acid molecules during the formation of colonies. )
- the nucleic acid molecules present in colonies to be sequenced will include a sequence that hybridises to the primers to be used in sequencing (preferably under "stringent" conditions) .
- This portion can be added to a given molecule prior to amplification (which molecule may have a totally / partially unknown sequence) using techniques known to those skilled in the art. For example it can be synthesised artificially and can be added to a given molecule using a ligase.
- RNA or DNA polymerases can be used.
- DNA polymerases are however the enzymes of choice for preferred embodiments. Several of these are commercially available. Polymerases which lack 3' to 5' exonuclease activity can be used, such as T7 DNA polymerase or the small (Klenow) fragment of DNA polymerase I may be used [e.g. the modified T7 DNA polymerase SequenaseTM 2.0 (Amersham) or Klenow fragment (3' to 5' exo-, New England Biolabs)]. However it is not essential to use such polymerases.
- thermostable polymerases such as ThermoSequenaseTM (Amersham) or TaquenaseTM (ScienTech, St Louis, MO) . Any nucleotides may be used for primer extension reactions (whether naturally occurring or non- naturally occurring) .
- Preferred nucleotides are deoxyribonucleotides ⁇ dATP, dTTP, dGTP and dCTP (although for some applications the dTTP analogue dUTP is preferred) or ribonucleotides ATP, UTP, GTP and CTP; at least some of which are provided in labelled form.
- a washing step is preferably incorporated after each primer extension step in order to remove unincorporated nucleotides that may interfere with subsequent steps.
- the preferred washing solution should be compatible with polymerase activity and have a salt concentration that does not interfere with the annealing of primer molecules to the nucleic acid molecules to be sequenced. (In less preferred embodiments, the washing solution may interfere with polymerase activity. Here the washing solution would need to be removed before further primer extension.
- a combination of labelled and non- labelled nucleotides can be used.
- the number of labels incorporated in each colony during primer extension can be sufficient to be detected by a detection device.
- the ratio of labelled to non-labelled nucleotides may be chosen so that, on average, labelled nucleotides are used in primer extension less than 50%, less than 20%, less than 10% or even less than 1% of the time (i.e. on average in a given primer extension step a nucleotide is incorporated in labelled form in less than 50%, less than 20%, less than 10 %, or less than 1% of the extended primers.
- Steps b) and c) may be repeated one or more times.
- a plurality of different colonies are provided and several different sequences are determined simultaneously.
- This further embodiment of the present invention can be used to reduce costs, since relatively few labelled nucleotides are needed. It can also be used to reduce quenching effects.
- nucleotides for primer extension or to use a major portion thereof (eg. over 50 %, over 70% or over 90% of the nucleotides used may be labelled) .
- labels may be removed or neutralised at various stages should quenching effects become problematic (e.g. laser bleaching of fluorophores may be performed).
- this can increase the number of steps required and it is therefore preferred that labels are not removed (or at least that they are not removed after each nucleotide has been incorporated but are only removed periodically) .
- the primer itself and its extension product may be removed and replaced with another primer.
- a plurality of labelled bases are incorporated into an extended primer during sequencing. This is advantageous in that it can speed up the sequencing procedure relative to methods in which, once a labelled base has been incorporated into an extended primer, the label must be removed before a further labelled base can be incorporated.
- the plurality of labelled bases may be in the form of one or more contiguous stretches, although this is not essential.
- the present invention therefore also includes within its scope a method for sequencing nucleic acid molecules, comprising the steps of:
- each colony with a nucleic acid polymerase and a given labelled nucleotide under conditions that allow extension of the primers if a complementary base or if a plurality of such bases is present at the appropriate position in the single stranded nucleic acid molecules;
- sequences of the nucleic acid molecules present at said first and said locations are different from one another - i.e. a plurality of colonies comprising different nucleic acid molecules are sequenced
- Various detection systems can be used to detect labels used in sequencing in these methods (although in certain embodiments detection may be possible simply by eye, so that no detection system is needed) .
- a preferred detection system for fluorescent labels is a Charge-Coupled-Device (CCD) camera, which can optionally be coupled to a magnifying device. Any other device allowing detection and, preferably, also quantification of fluorescence on a surface may be used. Devices such as fluorescent imagers or confocal microscopes may be chosen.
- the labels may be radioactive and a radioactivity detection device would then be required. Ideally such devices would be real-time radioactivity imaging systems. Also less preferred are other devices relying on phosphor screens (Moleculal Dynamics) or autoradiography films for detection.
- a scanning system may be preferred for data collection.
- a detector may move relative to a plurality of colonies to be analysed. This is useful when all the colonies providing signals are not within the field of view of a detector.
- the detector may be maintained in a fixed position and colonies to be analysed may be moved into the field of view of the detector (e.g. by means of a movable platform). Alternatively the colonies may be maintained in fixed position and the detection device may be moved to bring them into its field of view.
- the detection system is preferably used in combination with an analysis system in order to determine the number (and preferably also the nature) of bases incorporated by primer extension at each colony after each step. This analysis may be performed immediately after each step or later on, using recorded data. The sequence of nucleic acid molecules present within a given colony can then be deduced from the number and type of nucleotides added after each step.
- the detection system is part of an apparatus comprising other components .
- the present invention includes an apparatus comprising a plurality of labelled nucleotides, a nucleic acid polymerase and detection means for detecting labelled nucleotides when incorporated into a nucleic acid molecule by primer extension, the detection means being adapted to distinguish between signals provided by labelled nucleotides incorporated at different colonies.
- the apparatus may also include temperature control, solvent delivery and washing means. It may be automated.
- nucleic acid molecules which are to be sequenced to check if one or more differences relative to a known sequence are present (e.g. identification of polymorphisms). This is sometimes referred to as "re-sequencing”.
- the order of nucleotides applied to a given location can be chosen as desired. For example one may choose the sequential addition of nucleotides dATP, dTTP, dGTP, dCTP; dATP, dTTP, dGTP, dCTP; and so on. (Generally a single order of four nucleotides would be repeated, although this is not essential.)
- the order of nucleotides to be added at each step is preferably chosen according to a known sequence.
- Re-sequencing may be of particular interest for the analysis of a large number of similar template molecules in order to detect and identify sequence differences (e.g. for the analysis of recombinant plasmids in candidate clones after site directed mutagenesis or more importantly, for polymorphism screening in a population) .
- Differences from a given sequence can be detected by the lack of incorporation of one or more nucleotides present in the given sequence at particular stages of primer extension.
- the present method allows for detection of any type of mutation such as point mutations, insertions or deletions.
- not only known existing mutations, but also previously unidentified mutations can be characterised by the provision of sequence information.
- long nucleic acid molecules may have to be sequenced by several sequencing reactions, each one allowing for determination of part of the complete sequence. These reactions may be carried out at different colonies (where the different colonies are each provided with the same nucleic acid molecules to be sequenced but different primers), or in successive cycles applied at the same colony (where between each cycles the primers and extension products are washed off and replaced by different primers) .
- This embodiment of the present invention aims to solve the problem of screening a large population for the identification of given features of given genes, such as the detection of single nucleotide polymorphisms .
- it consists in generating tagged genomic DNA (see section G(ii) supra) . (Thus each sample originating from a given individual sample has been labelled with a unique tag) .
- This tagged DNA can be used for generating primary colonies on an appropriate surface comprising immobilised primers. Several successive probe hybridisation assays to the colonies can then be performed. Between each assay the preceding probe can be removed, e.g. by thermal denaturation and washing.
- a PCR amplification can be performed to specifically amplify the gene of interest and to link a tag and a colony generating primer (refer to section G(iv), preparation of "tagged DNA").
- Another advantage of using the present invention lies in the fact that it overcomes the problem arising with individuals who have heterozygous mutations for a given gene. While this problem may be addressed by existing sequencing methods to determine allelic polymorphisms, current high throughput mutation detection methods based on oligonucleotide probe hybridisation may lead to difficulties in the interpretation of results due to an unequal hybridisation of probes in cases of allelic polymorphisms and therefore errors can occur.
- each colony arises from a single copy of an amplified gene of interest. If an average of 10 colonies are generated for each individual locus, there will be an average of 5 colonies corresponding to one version of a gene and 5 colonies corresponding to the other version of the gene. Thus heterozygotic mutations can be scored by the number of times a single allele is detected per individual genome sample.
- This embodiment of the present invention provides a solution to the problem of identifying and characterising novel allelic polymorphisms within known genes in a large population of biological samples.
- the DNA sequence 3' to a specific probe may be determined directly by in si tu sequencing' (section I (iii), Methods of sequencing).
- the present invention can allow the whole screening experiment to be performed in approximately one day, with one apparatus. This can be compared to the most powerful systems operational at the present time.
- Genomic DNA can be prepared, either directly from the total DNA of an organism of interest or from a vector into which DNA has been inserted.
- the prepared genomic DNA (from whatever source) can be used to generate DNA colonies.
- the DNA colonies can then be digested with a rare- cutting restriction enzyme, whose site is included in the linker, denatured and sequenced.
- Figure 16 depicts an example of de novo DNA sequencing.
- genomic DNA is fragmented into pieces of 100 to 2000 base pairs (see preparation of random DNA fragments, section G(i)). These fragments will be ligated to oligonucleotide linkers (Ila and lib, figure 16a) which include sequences specific for the grafted primers on the surface ( 'PI' and 'P2' ) , a sequence which is recognised by a rare-cutting restriction nuclease ( 'RE' ) and a sequence corresponding to a sequencing primer ( 'SP' ) , resulting in templates (III, figure 16b) .
- oligonucleotide linkers Ila and lib, figure 16a
- oligonucleotide linkers include sequences specific for the grafted primers on the surface ( 'PI' and 'P2' ) , a sequence which is recognised by a rare-cutting restriction nuclease ( 'RE' ) and a
- the throughput obtainable can be at least 400 times higher than presently available methods.
- This embodiment of our invention means to solve the problem of monitoring the expression of a large number of genes simultaneously.
- the DNA used for this preparation is 'prepared genomic DNA' or 'tagged genomic DNA', as described in section G(i) and G(iii), respectively, and where the DNA is either from the whole genome of one (or several) organism(s) or from a subset thereof (e.g., from a library of previously isolated genes) .
- the uppercase letters, "A", "B” and “D” represent colonies which have arisen from genes which exhibit high, medium and low expression levels, respectively, and "E” represents colonies arising from non- expressed genes (in real cases, all these situations may not necessarily be present simultaneously) .
- the colonies are treated to turn then into supports (i.e. secondary primers) for secondary colony growing (step i in figure 17a), as described in section E.
- the treated colonies are represented by underlined characters (A, B, D, or E) .
- this support for secondary colony growing is used to regenerate colonies from mRNA (or cDNA) templates extracted from a biological sample, as described in section C. If the template is mRNA, the priming step of colony regeneration will be performed with a reverse transcriptase.
- step iii in figure 17c additional cycles of colony growing are performed (preferably 2 to 50), and the colonies which have not been totally regenerated during the previous steps finally become totally regenerated, "b" becomes “B”, “d” becomes “D” (figure 17d) : the colonies corresponding to genes with high and medium expression levels are all regenerated “A” and “B” or “B”; the colonies corresponding to genes with low levels of expression are not all regenerated “D” and “D”; the colonies corresponding to non-expressed sequences are not regenerated at all "E”.
- the relative levels of expression of the genes can be obtained by the following preferred methods:
- levels of expression can be monitored by counting, for each gene, the number of colonies which have been regenerated and comparing this number to the total number of colonies corresponding to that gene. These measurements will generally give access to the relative expression levels of the genes represented by the colonies.
- the identification of the colonies is preferably performed by fingerprinting, in a manner essentially similar to embodiment, section I(iv). Note that encoding the DNA samples is not required, but can be considered as an alternative to the direct identification of the DNA in the colonies.
- This embodiment of our invention has many advantages if compared to current state of the art including: a very high throughput; no requirement for prior amplification of the mRNA (even though prior amplification is compatible with or invention) ; small amounts of samples and reactants are required due to the high density of samples with our invention; the presence of highly expressed genes has no incidence on the ability to monitor genes with low levels of expression; the ability to simultaneously monitor low and high levels of expression within the set of genes of interest.
- this embodiment When the initial DNA in the generation of the primary DNA colony is made from the DNA of a whole genome, this embodiment also provides the following features: there is no interference between genes expressed at high level and at low level even though one has not performed specific amplification of the genes of interest.
- the ability of our invention to perform this type of mRNA expression monitoring is due to the fact that when the primary colonies are prepared, statistically, each piece of the initial genome will be represented by the same number of colonies. Thus, frequent and rare DNA will initiate the same number of colonies (e.g., one colony per added genome molecule) . Quantitative information might be obtained both from frequent and rare mRNAs by monitoring the growing rate of the colonies.
- This embodiment of our invention means to solve the problem of isolating the genes which are specifically induced under given conditions, e.g., in specific tissues, different strains of a given species or under specific activation.
- a practical example is the identification of genes which are up or down regulated after drug administration.
- target sample a specific or activated biological sample which are up-regulated compared with a reference biological sample (hereafter called reference sample) is depicted in figure 18.
- the DNA used for this preparation is prepared genomic DNA or tagged genomic DNA, as described in sections G(i) and G(ii), respectively, where the DNA is either from the whole genome of one (or several) organism(s) or from a subset thereof (e.g., from a library of previously isolated genes) , and where both the primers used for colony generation (hereafter called Pi and P2) contain a endonuclease restriction site.
- step ii in figure 21b the secondary primers are used to regenerate colonies using mRNA or cDNA (represented by "mA + mB") extracted from the biological reference sample as a template, as described in G(v). If the template is mRNA, the first elongation step of colony regeneration will be performed with a reverse transcriptase. After enough colony growing cycles, preferably 5 to 100, only the colonies corresponding to genes expressed in the reference sample ("A" and "B") will be regenerated, as depicted in (figure 18c) .
- step (iii) the colonies are digested with a restriction enzyme (represented by RE) which recognises a site in the flanking primer sequences, PI and P2, which are grafted on the support and which were the basis of primary colony generation.
- RE restriction enzyme
- the colonies which have been regenerated during step (ii) will be digested. This is because the support for secondary colony growth is made of single stranded DNA molecules, which can not be digested by the restriction enzyme. Only the regenerated colonies are present in a double stranded form, and are digested. After digestion, the situation is the one depicted in figure 18d.
- the colonies corresponding to the genes expressed in the reference sample have totally disappeared, i.e., they are not even present as a support for secondary colony growth, and the colonies corresponding to genes expressed only in the target sample "C” and the colonies corresponding to non-expressed genes "D" are still present as a support for secondary colony generation.
- step (iv) mRNA (or cDNA) (represented by "mA + mC") extracted from the target sample is used to generate secondary colonies. Because colonies corresponding to mA and mB no longer exist, only the colonies corresponding to mC can be regenerated (ie. Only the mRNA specifically expressed in the target sample) . After sufficient number of colony growing cycles (preferably 5 to 100), the situation is such that only the colonies corresponding to genes expressed specifically in the target sample are regenerated ("C", figure 18e) .
- step (v) the regenerated colonies "C" are used to generate copies of the DNA that they contain by performing several (preferably 1 to 20) colony growing cycles in the presence of the primers PI and P2, as described in section D of the present invention.
- a PCR amplification is then performed using PI and P2 in solution (described in section D) and the amplified DNA characterised by classical methods.
- step (ii) the mRNA used is the one extracted from the target biological sample ("mA + mC") instead of the mRNA extracted form the reference biological sample ("mA + mB")
- step (iv) the mRNA used is the one extracted from the reference biological sample ("mA + mB") instead of the one extracted from the target sample ("mA + mC”) .
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Saccharide Compounds (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (12)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP54130898A JP2002503954A (en) | 1997-04-01 | 1998-04-01 | Nucleic acid amplification method |
DE69837913T DE69837913T2 (en) | 1997-04-01 | 1998-04-01 | PROCESS FOR THE MAKING OF NUCLEIC ACID |
AU68466/98A AU6846698A (en) | 1997-04-01 | 1998-04-01 | Method of nucleic acid amplification |
EP98913952A EP0972081B1 (en) | 1997-04-01 | 1998-04-01 | Method of nucleic acid amplification |
US10/449,010 US7985565B2 (en) | 1997-04-01 | 2003-06-02 | Method of nucleic acid amplification |
US12/148,133 US8476044B2 (en) | 1997-04-01 | 2008-04-16 | Method of nucleic acid amplification |
US12/771,324 US8143008B2 (en) | 1997-04-01 | 2010-04-30 | Method of nucleic acid amplification |
US13/828,047 US8993271B2 (en) | 1997-04-01 | 2013-03-14 | Method of nucleic acid amplification |
US13/886,234 US9902951B2 (en) | 1997-04-01 | 2013-05-02 | Method of nucleic acid amplification |
US14/465,685 US20140371100A1 (en) | 1997-04-01 | 2014-08-21 | Method of nucleic acid amplification |
US14/555,036 US20150087531A1 (en) | 1997-04-01 | 2014-11-26 | Method of nucleic acid amplification |
US14/601,013 US9593328B2 (en) | 1997-04-01 | 2015-01-20 | Method of nucleic acid amplification |
Applications Claiming Priority (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GBGB9706528.8A GB9706528D0 (en) | 1997-04-01 | 1997-04-01 | Invention |
GBGB9706529.6A GB9706529D0 (en) | 1997-04-01 | 1997-04-01 | Invention |
GB9706529.6 | 1997-06-23 | ||
GBGB9713236.9A GB9713236D0 (en) | 1997-06-23 | 1997-06-23 | Invention |
GBGB9713238.5A GB9713238D0 (en) | 1997-06-23 | 1997-06-23 | Invention |
GB9706528.8 | 1997-06-23 | ||
GB9713238.5 | 1997-06-23 | ||
GB9713236.9 | 1997-06-23 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09402277 A-371-Of-International | 1998-04-01 | ||
US10/449,010 Continuation US7985565B2 (en) | 1997-04-01 | 2003-06-02 | Method of nucleic acid amplification |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1998044151A1 true WO1998044151A1 (en) | 1998-10-08 |
Family
ID=27451621
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/GB1998/000961 WO1998044151A1 (en) | 1997-04-01 | 1998-04-01 | Method of nucleic acid amplification |
Country Status (9)
Country | Link |
---|---|
US (8) | US7985565B2 (en) |
EP (4) | EP0972081B1 (en) |
JP (1) | JP2002503954A (en) |
AT (2) | ATE364718T1 (en) |
AU (1) | AU6846698A (en) |
DE (1) | DE69837913T2 (en) |
ES (1) | ES2563643T3 (en) |
HK (1) | HK1155784A1 (en) |
WO (1) | WO1998044151A1 (en) |
Cited By (362)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000018957A1 (en) * | 1998-09-30 | 2000-04-06 | Applied Research Systems Ars Holding N.V. | Methods of nucleic acid amplification and sequencing |
WO2000023616A3 (en) * | 1998-10-21 | 2000-08-17 | Noxxon Pharma Ag | Method for the exponential amplification of molecular matrices |
WO2000075374A1 (en) * | 1999-06-04 | 2000-12-14 | Mosaic Technologies | Solid phase methods for amplifying multiple nucleic acids |
WO2001032935A2 (en) * | 1999-11-02 | 2001-05-10 | Celine Hu | Molecular microarrays and methods for production and use thereof |
WO2001048242A2 (en) * | 1999-12-29 | 2001-07-05 | Mergen Ltd. | Methods for amplifying and detecting multiple polynucleotides on a solid phase support |
US6274320B1 (en) | 1999-09-16 | 2001-08-14 | Curagen Corporation | Method of sequencing a nucleic acid |
WO2001062064A2 (en) * | 2000-02-25 | 2001-08-30 | Epigenomics Ag | Method for detecting cytosine methylation in dna samples |
WO2001062982A2 (en) * | 2000-02-25 | 2001-08-30 | Mosaic Technologies, Inc. | Methods for multi-stage solid phase amplification of nucleic acids |
WO2001062960A2 (en) * | 2000-02-25 | 2001-08-30 | Epigenomics Ag | Method for detecting cytosine methylation in dna samples |
WO2001068921A2 (en) * | 2000-03-14 | 2001-09-20 | Investigen | Compositions and methods for simultaneous detection of multiple biological entities |
WO2001092568A2 (en) * | 2000-06-02 | 2001-12-06 | Axaron Bioscience Ag | Method for producing dna-arrays |
WO2002046456A1 (en) * | 2000-12-08 | 2002-06-13 | Applied Research Systems Ars Holding N.V. | Isothermal amplification of nucleic acids on a solid support |
WO2002061126A2 (en) * | 2001-01-30 | 2002-08-08 | Solexa Ltd. | The preparation of polynucleotide arrays |
US6432360B1 (en) | 1997-10-10 | 2002-08-13 | President And Fellows Of Harvard College | Replica amplification of nucleic acid arrays |
WO2002072879A2 (en) * | 2001-02-09 | 2002-09-19 | Axaron Bioscience Ag | Production and use of random arrangements of clonal nuclear acid islands on a surface |
WO2002081743A2 (en) * | 2001-04-02 | 2002-10-17 | Point-2-Point Genomics Ltd. | Polynucleotide analysis using combinatorial pcr |
EP1256632A2 (en) * | 2001-05-07 | 2002-11-13 | Smithkline Beecham Corporation | High throughput polymorphism screening |
US6485944B1 (en) | 1997-10-10 | 2002-11-26 | President And Fellows Of Harvard College | Replica amplification of nucleic acid arrays |
WO2004067759A2 (en) * | 2003-01-29 | 2004-08-12 | Cranfield University | Replication of nucleic acid arrays |
WO2005068656A1 (en) * | 2004-01-12 | 2005-07-28 | Solexa Limited | Nucleic acid characterisation |
WO2005078130A1 (en) * | 2004-02-10 | 2005-08-25 | Solexa Limited | Arrayed polynucleotides |
WO2007060456A1 (en) | 2005-11-25 | 2007-05-31 | Solexa Limited | Preparation of nucleic acid templates for solid phase amplification |
WO2007123744A2 (en) | 2006-03-31 | 2007-11-01 | Solexa, Inc. | Systems and devices for sequence by synthesis analysis |
WO2009034181A2 (en) * | 2007-09-14 | 2009-03-19 | Twof, Inc. | Methods for the preparation of dna microarrays with linear high density probes |
FR2936246A1 (en) * | 2008-09-24 | 2010-03-26 | Haploys | New compound comprising a duplicable nucleic acid (amplified fragment), where compound comprises a means of locking of polymerization (loop linkage), useful e.g. in complex for diagnosing the amplification of the nucleic acids |
EP2189540A1 (en) | 2005-07-20 | 2010-05-26 | Illumina Cambridge Limited | Methods for sequencing a polynucleotide template |
WO2010062775A2 (en) | 2008-11-03 | 2010-06-03 | The Regents Of The University Of California | Methods for detecting modification resistant nucleic acids |
US7741463B2 (en) | 2005-11-01 | 2010-06-22 | Illumina Cambridge Limited | Method of preparing libraries of template polynucleotides |
EP2201021A1 (en) * | 2007-08-29 | 2010-06-30 | Applied Biosystems, LLC | Alternative nucleic acid sequencing methods |
US7754429B2 (en) | 2006-10-06 | 2010-07-13 | Illumina Cambridge Limited | Method for pair-wise sequencing a plurity of target polynucleotides |
US7771946B2 (en) | 2001-03-09 | 2010-08-10 | Nugen Technologies, Inc. | Methods, kits and compositions for single primer linear isothermal amplification of nucleic acid sequences |
US7771934B2 (en) | 2000-12-13 | 2010-08-10 | Nugen Technologies, Inc. | Methods and compositions for generation of multiple copies of nucleic acid sequences and methods of detection thereof |
US7785790B1 (en) | 1997-10-10 | 2010-08-31 | President And Fellows Of Harvard College | Replica amplification of nucleic acid arrays |
EP2248914A1 (en) | 2009-05-05 | 2010-11-10 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | The use of class IIB restriction endonucleases in 2nd generation sequencing applications |
US7846733B2 (en) | 2000-06-26 | 2010-12-07 | Nugen Technologies, Inc. | Methods and compositions for transcription-based nucleic acid amplification |
US7846666B2 (en) | 2008-03-21 | 2010-12-07 | Nugen Technologies, Inc. | Methods of RNA amplification in the presence of DNA |
EP2298930A1 (en) | 2005-07-20 | 2011-03-23 | Illumina Cambridge Limited | Preparation of templates for nucleic acid sequencing |
WO2011034690A2 (en) * | 2009-09-15 | 2011-03-24 | Illumina Cambridge, Ltd. | Centroid markers for image analysis of high density clusters in complex polynucleotide sequencing |
US7939258B2 (en) | 2005-09-07 | 2011-05-10 | Nugen Technologies, Inc. | Nucleic acid amplification procedure using RNA and DNA composite primers |
WO2011071923A2 (en) | 2009-12-07 | 2011-06-16 | Illumina, Inc. | Multi-sample indexing for multiplex genotyping |
US7985565B2 (en) | 1997-04-01 | 2011-07-26 | Illumina, Inc. | Method of nucleic acid amplification |
WO2011090559A1 (en) | 2010-01-19 | 2011-07-28 | Verinata Health, Inc. | Sequencing methods and compositions for prenatal diagnoses |
WO2011091046A1 (en) | 2010-01-19 | 2011-07-28 | Verinata Health, Inc. | Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing |
US8017335B2 (en) | 2005-07-20 | 2011-09-13 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
US8034568B2 (en) | 2008-02-12 | 2011-10-11 | Nugen Technologies, Inc. | Isothermal nucleic acid amplification methods and compositions |
US8039817B2 (en) | 2008-05-05 | 2011-10-18 | Illumina, Inc. | Compensator for multiple surface imaging |
WO2012025250A1 (en) | 2010-08-27 | 2012-03-01 | Illumina Cambridge Ltd. | Methods for paired - end sequencing of polynucleotides |
EP2431481A1 (en) * | 2003-10-20 | 2012-03-21 | Kalim Mir | Parallel polymer sequencing methods |
WO2012050920A1 (en) | 2010-09-29 | 2012-04-19 | Illumina, Inc. | Compositions and methods for sequencing nucleic acids |
WO2012055929A1 (en) | 2010-10-26 | 2012-05-03 | Illumina, Inc. | Sequencing methods |
WO2012061036A1 (en) | 2010-11-03 | 2012-05-10 | Illumina, Inc. | Reducing adapter dimer formation |
US8192930B2 (en) | 2006-02-08 | 2012-06-05 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
EP2470669A1 (en) * | 2009-08-25 | 2012-07-04 | Illumina, Inc. | Methods for selecting and amplifying polynucleotides |
WO2012096703A1 (en) | 2011-01-10 | 2012-07-19 | Illumina, Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
EP2159285B1 (en) * | 2003-01-29 | 2012-09-26 | 454 Life Sciences Corporation | Methods of amplifying and sequencing nucleic acids |
US8318430B2 (en) | 2010-01-23 | 2012-11-27 | Verinata Health, Inc. | Methods of fetal abnormality detection |
WO2013044018A1 (en) | 2011-09-23 | 2013-03-28 | Illumina, Inc. | Methods and compositions for nucleic acid sequencing |
WO2013049135A1 (en) | 2011-09-26 | 2013-04-04 | Gen-Probe Incorporated | Algorithms for sequence determinations |
US8465950B2 (en) | 2003-04-14 | 2013-06-18 | Nugen Technologies, Inc. | Global amplification using a randomly primed composite primer |
WO2013117595A2 (en) | 2012-02-07 | 2013-08-15 | Illumina Cambridge Limited | Targeted enrichment and amplification of nucleic acids on a support |
WO2013123442A1 (en) | 2012-02-17 | 2013-08-22 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
US8532936B2 (en) | 2011-04-14 | 2013-09-10 | Verinata Health, Inc. | Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies |
WO2013131962A1 (en) | 2012-03-06 | 2013-09-12 | Illumina Cambridge Limited | Improved methods of nucleic acid sequencing |
WO2013148970A1 (en) | 2012-03-30 | 2013-10-03 | Illumina, Inc. | Methods and systems for determining fetal chromosomal abnormalities |
US8563477B2 (en) | 2004-01-07 | 2013-10-22 | Illumina Cambridge Limited | Modified molecular arrays |
US8568979B2 (en) | 2006-10-10 | 2013-10-29 | Illumina, Inc. | Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization |
US20130344540A1 (en) * | 2011-02-03 | 2013-12-26 | Mark T. Reed | Methods for minimizing sequence specific bias |
WO2013191775A2 (en) | 2012-06-18 | 2013-12-27 | Nugen Technologies, Inc. | Compositions and methods for negative selection of non-desired nucleic acid sequences |
US8617816B2 (en) | 2007-03-16 | 2013-12-31 | 454 Life Sciences, A Roche Company | System and method for detection of HIV drug resistant variants |
WO2014008448A1 (en) | 2012-07-03 | 2014-01-09 | Sloan Kettering Institute For Cancer Research | Quantitative assessment of human t-cell repertoire recovery after allogeneic hematopoietic stem cell transplantation |
WO2014013218A1 (en) | 2012-07-18 | 2014-01-23 | Illumina Cambridge Limited | Methods and systems for determining haplotypes and phasing of haplotypes |
US20140024027A1 (en) * | 1999-06-23 | 2014-01-23 | Catalyst Assets Llc | Methods of enriching for and identifying polymorphisms |
US8728764B2 (en) | 2008-10-02 | 2014-05-20 | Illumina Cambridge Limited | Nucleic acid sample enrichment for sequencing applications |
GB2497912B (en) * | 2010-10-08 | 2014-06-04 | Harvard College | High-throughput single cell barcoding |
WO2014108850A2 (en) | 2013-01-09 | 2014-07-17 | Yeda Research And Development Co. Ltd. | High throughput transcriptome analysis |
US8812422B2 (en) | 2012-04-09 | 2014-08-19 | Good Start Genetics, Inc. | Variant database |
WO2014135221A1 (en) | 2013-03-08 | 2014-09-12 | Illumina Cambridge Ltd | Polymethine compounds and their use as fluorescent labels |
WO2014135223A1 (en) | 2013-03-08 | 2014-09-12 | Illumina Cambridge Ltd | Rhodamine compounds and their use as fluorescent labels |
WO2014150435A1 (en) | 2013-03-15 | 2014-09-25 | Illumina, Inc. | METHODS FOR PRODUCING STRANDED cDNA LIBRARIES |
WO2014108810A3 (en) * | 2013-01-09 | 2014-12-04 | Illumina Cambridge Limited | Sample preparation on a solid support |
US8921073B2 (en) | 2006-06-23 | 2014-12-30 | Illumina, Inc. | Devices and systems for creation of DNA cluster arrays |
WO2015013465A2 (en) | 2013-07-25 | 2015-01-29 | Dch Molecular Diagnostics, Inc. | Methods and compositions for detecting bacterial contamination |
US8951939B2 (en) | 2011-07-12 | 2015-02-10 | Bio-Rad Laboratories, Inc. | Digital assays with multiplexed detection of two or more targets in the same optical channel |
US8986958B2 (en) | 2009-03-30 | 2015-03-24 | Life Technologies Corporation | Methods for generating target specific probes for solution based capture |
US20150099642A1 (en) * | 2011-07-21 | 2015-04-09 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Methods and devices for dna sequencing and molecular diagnostics |
US9012022B2 (en) | 2012-06-08 | 2015-04-21 | Illumina, Inc. | Polymer coatings |
WO2015103225A1 (en) | 2013-12-31 | 2015-07-09 | Illumina, Inc. | Addressable flow cell using patterned electrodes |
WO2015108663A1 (en) | 2014-01-16 | 2015-07-23 | Illumina, Inc. | Amplicon preparation and sequencing on solid supports |
US9089844B2 (en) | 2010-11-01 | 2015-07-28 | Bio-Rad Laboratories, Inc. | System for forming emulsions |
US9092401B2 (en) | 2012-10-31 | 2015-07-28 | Counsyl, Inc. | System and methods for detecting genetic variation |
US9115163B2 (en) | 2007-10-19 | 2015-08-25 | The Trustees Of Columbia University In The City Of New York | DNA sequence with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators |
US9115401B2 (en) | 2010-01-19 | 2015-08-25 | Verinata Health, Inc. | Partition defined detection methods |
US9115387B2 (en) | 2013-03-14 | 2015-08-25 | Good Start Genetics, Inc. | Methods for analyzing nucleic acids |
US9126160B2 (en) | 2008-09-23 | 2015-09-08 | Bio-Rad Laboratories, Inc. | System for forming an array of emulsions |
US9132394B2 (en) | 2008-09-23 | 2015-09-15 | Bio-Rad Laboratories, Inc. | System for detection of spaced droplets |
US9133511B2 (en) | 2000-10-06 | 2015-09-15 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
EP2921556A1 (en) | 2014-03-21 | 2015-09-23 | Lexogen GmbH | Copy number preserving RNA analysis method |
US9150905B2 (en) | 2012-05-08 | 2015-10-06 | Adaptive Biotechnologies Corporation | Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions |
US9175342B2 (en) | 2007-10-19 | 2015-11-03 | The Trustees Of Columbia University In The City Of New York | Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis |
US9181590B2 (en) | 2011-10-21 | 2015-11-10 | Adaptive Biotechnologies Corporation | Quantification of adaptive immune cell genomes in a complex mixture of cells |
US9194861B2 (en) | 2009-09-02 | 2015-11-24 | Bio-Rad Laboratories, Inc. | Method of mixing fluids by coalescence of multiple emulsions |
US9206418B2 (en) | 2011-10-19 | 2015-12-08 | Nugen Technologies, Inc. | Compositions and methods for directional nucleic acid amplification and sequencing |
WO2015189637A1 (en) * | 2014-06-14 | 2015-12-17 | Illumina Cambridge Limited | Methods of increasing sequencing accuracy |
US9222128B2 (en) | 2011-03-18 | 2015-12-29 | Bio-Rad Laboratories, Inc. | Multiplexed digital assays with combinatorial use of signals |
US9228233B2 (en) | 2011-10-17 | 2016-01-05 | Good Start Genetics, Inc. | Analysis methods |
US9260745B2 (en) | 2010-01-19 | 2016-02-16 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US9284604B2 (en) | 2010-11-22 | 2016-03-15 | The Regents Of The University Of California | Methods of identifying a cellular nascent RNA transcript |
US9309566B2 (en) | 2010-12-17 | 2016-04-12 | Life Technologies Corporation | Methods, compositions, systems, apparatuses and kits for nucleic acid amplification |
US9309557B2 (en) | 2010-12-17 | 2016-04-12 | Life Technologies Corporation | Nucleic acid amplification |
US9322057B2 (en) | 2001-04-20 | 2016-04-26 | The Penn State Research Foundation | Methods for nucleic acid manipulation |
US9323888B2 (en) | 2010-01-19 | 2016-04-26 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US9334531B2 (en) | 2010-12-17 | 2016-05-10 | Life Technologies Corporation | Nucleic acid amplification |
US9347099B2 (en) | 2008-11-07 | 2016-05-24 | Adaptive Biotechnologies Corp. | Single cell analysis by polymerase cycling assembly |
US9347059B2 (en) | 2011-04-25 | 2016-05-24 | Bio-Rad Laboratories, Inc. | Methods and compositions for nucleic acid analysis |
US9365901B2 (en) | 2008-11-07 | 2016-06-14 | Adaptive Biotechnologies Corp. | Monitoring immunoglobulin heavy chain evolution in B-cell acute lymphoblastic leukemia |
US9393560B2 (en) | 2010-03-25 | 2016-07-19 | Bio-Rad Laboratories, Inc. | Droplet transport system for detection |
US9399215B2 (en) | 2012-04-13 | 2016-07-26 | Bio-Rad Laboratories, Inc. | Sample holder with a well having a wicking promoter |
US9411937B2 (en) | 2011-04-15 | 2016-08-09 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US9416420B2 (en) | 2008-11-07 | 2016-08-16 | Adaptive Biotechnologies Corp. | Monitoring health and disease status using clonotype profiles |
US9417190B2 (en) | 2008-09-23 | 2016-08-16 | Bio-Rad Laboratories, Inc. | Calibrations and controls for droplet-based assays |
US9447453B2 (en) | 2011-04-12 | 2016-09-20 | Verinata Health, Inc. | Resolving genome fractions using polymorphism counts |
EP1907583B1 (en) | 2005-06-15 | 2016-10-05 | Complete Genomics Inc. | Single molecule arrays for genetic and chemical analysis |
WO2016156845A1 (en) * | 2015-03-31 | 2016-10-06 | Illumina Cambridge Limited | Surface concatamerization of templates |
US9476080B2 (en) | 2010-12-17 | 2016-10-25 | Life Technologies Corporation | Clonal amplification of nucleic acid on solid surface with template walking |
US9493828B2 (en) | 2010-01-19 | 2016-11-15 | Verinata Health, Inc. | Methods for determining fraction of fetal nucleic acids in maternal samples |
US9492797B2 (en) | 2008-09-23 | 2016-11-15 | Bio-Rad Laboratories, Inc. | System for detection of spaced droplets |
US9500664B2 (en) | 2010-03-25 | 2016-11-22 | Bio-Rad Laboratories, Inc. | Droplet generation for droplet-based assays |
US9499865B2 (en) | 2011-12-13 | 2016-11-22 | Adaptive Biotechnologies Corp. | Detection and measurement of tissue-infiltrating lymphocytes |
US9506119B2 (en) | 2008-11-07 | 2016-11-29 | Adaptive Biotechnologies Corp. | Method of sequence determination using sequence tags |
EP3098324A1 (en) | 2015-05-29 | 2016-11-30 | Molecular Cloning Laboratories (MCLAB) LLC | Compositions and methods for preparing sequencing libraries |
US9512487B2 (en) | 2008-11-07 | 2016-12-06 | Adaptive Biotechnologies Corp. | Monitoring health and disease status using clonotype profiles |
US9512478B2 (en) | 2007-02-02 | 2016-12-06 | Illumina Cambridge Limited | Methods for indexing samples and sequencing multiple polynucleotide templates |
US9528160B2 (en) | 2008-11-07 | 2016-12-27 | Adaptive Biotechnolgies Corp. | Rare clonotypes and uses thereof |
US9528151B2 (en) | 2006-12-01 | 2016-12-27 | The Trustees Of Columbia University In The City Of New York | Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators |
US9535920B2 (en) | 2013-06-03 | 2017-01-03 | Good Start Genetics, Inc. | Methods and systems for storing sequence read data |
DE102015011970A1 (en) | 2015-09-09 | 2017-03-09 | Scienion Ag | Dispenser and dispensing method |
US9598725B2 (en) | 2010-03-02 | 2017-03-21 | Bio-Rad Laboratories, Inc. | Emulsion chemistry for encapsulated droplets |
US9650628B2 (en) | 2012-01-26 | 2017-05-16 | Nugen Technologies, Inc. | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library regeneration |
WO2017096322A1 (en) | 2015-12-03 | 2017-06-08 | Accuragen Holdings Limited | Methods and compositions for forming ligation products |
US9708657B2 (en) | 2013-07-01 | 2017-07-18 | Adaptive Biotechnologies Corp. | Method for generating clonotype profiles using sequence tags |
US9708358B2 (en) | 2000-10-06 | 2017-07-18 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US9745614B2 (en) | 2014-02-28 | 2017-08-29 | Nugen Technologies, Inc. | Reduced representation bisulfite sequencing with diversity adaptors |
US9764322B2 (en) | 2008-09-23 | 2017-09-19 | Bio-Rad Laboratories, Inc. | System for generating droplets with pressure monitoring |
US9783847B2 (en) | 2009-04-30 | 2017-10-10 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
WO2017182578A1 (en) | 2016-04-20 | 2017-10-26 | Qiagen Gmbh | Method for generating a stranded rna library |
US9809813B2 (en) | 2009-06-25 | 2017-11-07 | Fred Hutchinson Cancer Research Center | Method of measuring adaptive immunity |
US9816088B2 (en) | 2013-03-15 | 2017-11-14 | Abvitro Llc | Single cell bar-coding for antibody discovery |
EP3243937A1 (en) | 2012-07-17 | 2017-11-15 | Counsyl, Inc. | System and methods for detecting genetic variation |
US9822408B2 (en) | 2013-03-15 | 2017-11-21 | Nugen Technologies, Inc. | Sequential sequencing |
US9824179B2 (en) | 2011-12-09 | 2017-11-21 | Adaptive Biotechnologies Corp. | Diagnosis of lymphoid malignancies and minimal residual disease detection |
US9868982B2 (en) | 2007-02-07 | 2018-01-16 | Illumina Cambridge Limited | Preparation of templates for methylation analysis |
WO2018018008A1 (en) | 2016-07-22 | 2018-01-25 | Oregon Health & Science University | Single cell whole genome libraries and combinatorial indexing methods of making thereof |
WO2018060482A1 (en) | 2016-09-30 | 2018-04-05 | Illumina Cambridge Limited | New fluorescent dyes and their uses as biomarkers |
US9951384B2 (en) | 2012-01-13 | 2018-04-24 | Data2Bio | Genotyping by next-generation sequencing |
WO2018073435A1 (en) | 2016-10-21 | 2018-04-26 | Gna Biosolutions Gmbh | Method for carrying out a polymerase chain reaction and device for carrying out the method |
WO2018114710A1 (en) | 2016-12-22 | 2018-06-28 | Illumina Cambridge Limited | Coumarin compounds and their uses as fluorescent labels |
US10036063B2 (en) | 2009-07-24 | 2018-07-31 | Illumina, Inc. | Method for sequencing a polynucleotide template |
WO2018148723A1 (en) | 2017-02-13 | 2018-08-16 | Qiagen Waltham Inc. | Polymerase enzyme from pyrococcus abyssi |
WO2018148724A1 (en) | 2017-02-13 | 2018-08-16 | Qiagen Waltham Inc. | Polymerase enzyme from pyrococcus furiosus |
WO2018148727A1 (en) | 2017-02-13 | 2018-08-16 | Qiagen Waltham Inc. | Polymerase enzyme from 9°n |
WO2018148726A1 (en) | 2017-02-13 | 2018-08-16 | Qiagen Waltham Inc. | Polymerase enzyme from phage t4 |
US10066259B2 (en) | 2015-01-06 | 2018-09-04 | Good Start Genetics, Inc. | Screening for structural variants |
US10066265B2 (en) | 2014-04-01 | 2018-09-04 | Adaptive Biotechnologies Corp. | Determining antigen-specific t-cells |
US10077478B2 (en) | 2012-03-05 | 2018-09-18 | Adaptive Biotechnologies Corp. | Determining paired immune receptor chains from frequency matched subunits |
US10102337B2 (en) | 2014-08-06 | 2018-10-16 | Nugen Technologies, Inc. | Digital measurements from targeted sequencing |
WO2018197945A1 (en) | 2017-04-23 | 2018-11-01 | Illumina Cambridge Limited | Compositions and methods for improving sample identification in indexed nucleic acid libraries |
WO2018197950A1 (en) | 2017-04-23 | 2018-11-01 | Illumina Cambridge Limited | Compositions and methods for improving sample identification in indexed nucleic acid libraries |
WO2018200380A1 (en) | 2017-04-23 | 2018-11-01 | Illumina, Inc. | Compositions and methods for improving sample identification in indexed nucleic acid libraries |
WO2018200386A1 (en) | 2017-04-23 | 2018-11-01 | Illumina, Inc. | Compositions and methods for improving sample identification in indexed nucleic acid libraries |
WO2018204423A1 (en) | 2017-05-01 | 2018-11-08 | Illumina, Inc. | Optimal index sequences for multiplex massively parallel sequencing |
WO2018208699A1 (en) | 2017-05-08 | 2018-11-15 | Illumina, Inc. | Universal short adapters for indexing of polynucleotide samples |
WO2018213803A1 (en) | 2017-05-19 | 2018-11-22 | Neon Therapeutics, Inc. | Immunogenic neoantigen identification |
US10150996B2 (en) | 2012-10-19 | 2018-12-11 | Adaptive Biotechnologies Corp. | Quantification of adaptive immune cell genomes in a complex mixture of cells |
WO2018226708A1 (en) | 2017-06-07 | 2018-12-13 | Oregon Health & Science University | Single cell whole genome libraries for methylation sequencing |
US10155980B2 (en) | 2016-08-15 | 2018-12-18 | Accuragen Holdings Limited | Compositions and methods for detecting rare sequence variants |
WO2019027767A1 (en) | 2017-07-31 | 2019-02-07 | Illumina Inc. | Sequencing system with multiplexed biological sample aggregation |
WO2019028047A1 (en) | 2017-08-01 | 2019-02-07 | Illumina, Inc | Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells |
EP3447153A1 (en) | 2017-08-24 | 2019-02-27 | Marian Grendár | Method for determining the qualification of a sample for fetal aneuploidy status determination in non-invasive prenatal testing |
US10221461B2 (en) | 2012-10-01 | 2019-03-05 | Adaptive Biotechnologies Corp. | Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization |
US10227635B2 (en) | 2012-04-16 | 2019-03-12 | Molecular Loop Biosolutions, Llc | Capture reactions |
US10227647B2 (en) | 2015-02-17 | 2019-03-12 | Complete Genomics, Inc. | DNA sequencing using controlled strand displacement |
WO2019055715A1 (en) | 2017-09-15 | 2019-03-21 | Illumina, Inc. | Universal short adapters with variable length non-random unique molecular identifiers |
US10239909B2 (en) | 2015-05-22 | 2019-03-26 | Illumina Cambridge Limited | Polymethine compounds with long stokes shifts and their use as fluorescent labels |
US10246746B2 (en) | 2013-12-20 | 2019-04-02 | Illumina, Inc. | Preserving genomic connectivity information in fragmented genomic DNA samples |
US10246701B2 (en) | 2014-11-14 | 2019-04-02 | Adaptive Biotechnologies Corp. | Multiplexed digital quantitation of rearranged lymphoid receptors in a complex mixture |
US10246705B2 (en) | 2011-02-10 | 2019-04-02 | Ilumina, Inc. | Linking sequence reads using paired code tags |
CN109790575A (en) * | 2016-07-20 | 2019-05-21 | 吉纳普赛斯股份有限公司 | System and method for nucleic acid sequencing |
US10308982B2 (en) | 2010-04-05 | 2019-06-04 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
EP3495506A1 (en) | 2013-12-11 | 2019-06-12 | AccuraGen Holdings Limited | Methods for detecting rare sequence variants |
US10323276B2 (en) | 2009-01-15 | 2019-06-18 | Adaptive Biotechnologies Corporation | Adaptive immunity profiling and methods for generation of monoclonal antibodies |
US10385335B2 (en) * | 2013-12-05 | 2019-08-20 | Centrillion Technology Holdings Corporation | Modified surfaces |
US10388403B2 (en) | 2010-01-19 | 2019-08-20 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
US10385475B2 (en) | 2011-09-12 | 2019-08-20 | Adaptive Biotechnologies Corp. | Random array sequencing of low-complexity libraries |
US10392663B2 (en) | 2014-10-29 | 2019-08-27 | Adaptive Biotechnologies Corp. | Highly-multiplexed simultaneous detection of nucleic acids encoding paired adaptive immune receptor heterodimers from a large number of samples |
US10391467B2 (en) | 2013-12-05 | 2019-08-27 | Centrillion Technology Holdings Corporation | Fabrication of patterned arrays |
US10429399B2 (en) | 2014-09-24 | 2019-10-01 | Good Start Genetics, Inc. | Process control for increased robustness of genetic assays |
US10428325B1 (en) | 2016-09-21 | 2019-10-01 | Adaptive Biotechnologies Corporation | Identification of antigen-specific B cell receptors |
WO2019195225A1 (en) | 2018-04-02 | 2019-10-10 | Illumina, Inc. | Compositions and methods for making controls for sequence-based genetic testing |
US10457936B2 (en) | 2011-02-02 | 2019-10-29 | University Of Washington Through Its Center For Commercialization | Massively parallel contiguity mapping |
WO2019222264A1 (en) | 2018-05-15 | 2019-11-21 | Illumina, Inc. | Compositions and methods for chemical cleavage and deprotection of surface-bound oligonucleotides |
US10486153B2 (en) | 2013-09-27 | 2019-11-26 | Illumina, Inc. | Method to produce chemical pattern in micro-fluidic structure |
US10512910B2 (en) | 2008-09-23 | 2019-12-24 | Bio-Rad Laboratories, Inc. | Droplet-based analysis method |
US10526648B2 (en) | 2017-07-12 | 2020-01-07 | Illumina Cambridge Limited | Short pendant arm linkers for nucleotides in sequencing applications |
US10557133B2 (en) | 2013-03-13 | 2020-02-11 | Illumina, Inc. | Methods and compositions for nucleic acid sequencing |
WO2020036991A1 (en) | 2018-08-15 | 2020-02-20 | Illumina, Inc. | Compositions and methods for improving library enrichment |
US10570448B2 (en) | 2013-11-13 | 2020-02-25 | Tecan Genomics | Compositions and methods for identification of a duplicate sequencing read |
US10577601B2 (en) | 2008-09-12 | 2020-03-03 | University Of Washington | Error detection in sequence tag directed subassemblies of short sequencing reads |
US10590483B2 (en) | 2014-09-15 | 2020-03-17 | Abvitro Llc | High-throughput nucleotide library sequencing |
US10597715B2 (en) | 2013-12-05 | 2020-03-24 | Centrillion Technology Holdings | Methods for sequencing nucleic acids |
US10604799B2 (en) | 2012-04-04 | 2020-03-31 | Molecular Loop Biosolutions, Llc | Sequence assembly |
EP3663290A1 (en) | 2015-09-25 | 2020-06-10 | Illumina Cambridge Limited | Polymethine compounds and their use as fluorescent labels |
WO2020114918A1 (en) | 2018-12-05 | 2020-06-11 | Illumina Cambridge Limited | Methods and compositions for cluster generation by bridge amplification |
WO2020120179A1 (en) | 2018-12-14 | 2020-06-18 | Illumina Cambridge Limited | Decreasing phasing with unlabeled nucleotides during sequencing |
WO2020126593A1 (en) | 2018-12-17 | 2020-06-25 | Illumina Cambridge Limited | Compositions for use in polyunucleotide sequencing |
WO2020126602A1 (en) | 2018-12-18 | 2020-06-25 | Illumina Cambridge Limited | Methods and compositions for paired end sequencing using a single surface primer |
WO2020126595A1 (en) | 2018-12-17 | 2020-06-25 | Illumina Cambridge Limited | Primer oligonucleotide for sequencing |
WO2020132103A1 (en) | 2018-12-19 | 2020-06-25 | Illumina, Inc. | Methods for improving polynucleotide cluster clonality priority |
WO2020136170A2 (en) | 2018-12-26 | 2020-07-02 | Illumina Cambridge Limited | Nucleosides and nucleotides with 3'-hydroxy blocking groups |
US10752942B2 (en) | 2015-10-09 | 2020-08-25 | Accuragen Holdings Limited | Methods and compositions for enrichment of amplification products |
WO2020169635A1 (en) | 2019-02-20 | 2020-08-27 | Grendar Marian | Method for determining the uncertainty of the degree of placental mosaicism of a sample in non-invasive prenatal screening |
WO2020178165A1 (en) | 2019-03-01 | 2020-09-10 | Illumina Cambridge Limited | Tertiary amine substituted coumarin compounds and their uses as fluorescent labels |
WO2020178162A1 (en) | 2019-03-01 | 2020-09-10 | Illumina Cambridge Limited | Exocyclic amine-substituted coumarin compounds and their uses as fluorescent labels |
WO2020178231A1 (en) | 2019-03-01 | 2020-09-10 | Illumina, Inc. | Multiplexed fluorescent detection of analytes |
WO2020180778A1 (en) | 2019-03-01 | 2020-09-10 | Illumina, Inc. | High-throughput single-nuclei and single-cell libraries and methods of making and of using |
US10774374B2 (en) | 2015-04-10 | 2020-09-15 | Spatial Transcriptomics AB and Illumina, Inc. | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
US10774372B2 (en) | 2013-06-25 | 2020-09-15 | Prognosy s Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
NL2023327B1 (en) | 2019-03-01 | 2020-09-17 | Illumina Inc | Multiplexed fluorescent detection of analytes |
WO2020191389A1 (en) | 2019-03-21 | 2020-09-24 | Illumina, Inc. | Training data generation for artificial intelligence-based sequencing |
NL2023316B1 (en) | 2019-03-21 | 2020-09-28 | Illumina Inc | Artificial intelligence-based sequencing |
NL2023310B1 (en) | 2019-03-21 | 2020-09-28 | Illumina Inc | Training data generation for artificial intelligence-based sequencing |
NL2023311B1 (en) | 2019-03-21 | 2020-09-28 | Illumina Inc | Artificial intelligence-based generation of sequencing metadata |
US10787701B2 (en) | 2010-04-05 | 2020-09-29 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
WO2020193765A1 (en) | 2019-03-28 | 2020-10-01 | Illumina Cambridge Limited | Methods and compositions for nucleic acid sequencing using photoswitchable labels |
US10844428B2 (en) | 2015-04-28 | 2020-11-24 | Illumina, Inc. | Error suppression in sequenced DNA fragments using redundant reads with unique molecular indices (UMIS) |
US10844429B2 (en) | 2017-01-18 | 2020-11-24 | Illumina, Inc. | Methods and systems for generation and error-correction of unique molecular index sets with heterogeneous molecular lengths |
US10851414B2 (en) | 2013-10-18 | 2020-12-01 | Good Start Genetics, Inc. | Methods for determining carrier status |
US10858696B2 (en) | 2014-06-02 | 2020-12-08 | Illumina Cambridge Limited | Methods of reducing density-dependent GC bias in amplification |
EP3143161B1 (en) * | 2014-05-16 | 2021-04-21 | Illumina, Inc. | Nucleic acid synthesis techniques |
EP3828167A1 (en) | 2014-05-07 | 2021-06-02 | Illumina Cambridge Limited | Polymethine compounds and their use as fluorescent labels |
WO2021104845A1 (en) | 2019-11-27 | 2021-06-03 | Illumina Cambridge Limited | Cyclooctatetraene containing dyes and compositions |
US11028430B2 (en) | 2012-07-09 | 2021-06-08 | Nugen Technologies, Inc. | Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing |
US11041203B2 (en) | 2013-10-18 | 2021-06-22 | Molecular Loop Biosolutions, Inc. | Methods for assessing a genomic region of a subject |
US11041202B2 (en) | 2015-04-01 | 2021-06-22 | Adaptive Biotechnologies Corporation | Method of identifying human compatible T cell receptors specific for an antigenic target |
US11041851B2 (en) | 2010-12-23 | 2021-06-22 | Molecular Loop Biosciences, Inc. | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
WO2021127436A2 (en) | 2019-12-19 | 2021-06-24 | Illumina, Inc. | High-throughput single-cell libraries and methods of making and of using |
US11047008B2 (en) | 2015-02-24 | 2021-06-29 | Adaptive Biotechnologies Corporation | Methods for diagnosing infectious disease and determining HLA status using immune repertoire sequencing |
WO2021128441A1 (en) | 2019-12-23 | 2021-07-01 | Mgi Tech Co.,Ltd. | Controlled strand-displacement for paired-end sequencing |
US11053548B2 (en) | 2014-05-12 | 2021-07-06 | Good Start Genetics, Inc. | Methods for detecting aneuploidy |
US11060139B2 (en) | 2014-03-28 | 2021-07-13 | Centrillion Technology Holdings Corporation | Methods for sequencing nucleic acids |
US11066705B2 (en) | 2014-11-25 | 2021-07-20 | Adaptive Biotechnologies Corporation | Characterization of adaptive immune response to vaccination or infection using immune repertoire sequencing |
US11098356B2 (en) | 2008-01-28 | 2021-08-24 | Complete Genomics, Inc. | Methods and compositions for nucleic acid sequencing |
US11099202B2 (en) | 2017-10-20 | 2021-08-24 | Tecan Genomics, Inc. | Reagent delivery system |
US11111544B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US11111545B2 (en) | 2010-05-18 | 2021-09-07 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11111543B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
WO2021180724A1 (en) | 2020-03-09 | 2021-09-16 | Illumina, Inc. | Improvements in nucleic acid sequencing |
WO2021180733A1 (en) | 2020-03-09 | 2021-09-16 | Illumina, Inc. | Methods for sequencing polynucleotides |
US11130128B2 (en) | 2008-09-23 | 2021-09-28 | Bio-Rad Laboratories, Inc. | Detection method for a target nucleic acid |
WO2021231477A2 (en) | 2020-05-12 | 2021-11-18 | Illumina, Inc. | Generating nucleic acids with modified bases using recombinant terminal deoxynucleotidyl transferase |
US11186863B2 (en) | 2019-04-02 | 2021-11-30 | Progenity, Inc. | Methods, systems, and compositions for counting nucleic acid molecules |
WO2021252617A1 (en) | 2020-06-09 | 2021-12-16 | Illumina, Inc. | Methods for increasing yield of sequencing libraries |
US11203782B2 (en) | 2018-03-29 | 2021-12-21 | Accuragen Holdings Limited | Compositions and methods comprising asymmetric barcoding |
WO2021259881A1 (en) | 2020-06-22 | 2021-12-30 | Illumina Cambridge Limited | Nucleosides and nucleotides with 3' acetal blocking group |
WO2022006081A1 (en) | 2020-06-30 | 2022-01-06 | Illumina, Inc. | Catalytically controlled sequencing by synthesis to produce scarless dna |
WO2022006495A1 (en) | 2020-07-02 | 2022-01-06 | Illumina, Inc. | A method to calibrate nucleic acid library seeding efficiency in flowcells |
US11220707B1 (en) | 2021-06-17 | 2022-01-11 | Element Biosciences, Inc. | Compositions and methods for pairwise sequencing |
WO2022010965A1 (en) | 2020-07-08 | 2022-01-13 | Illumina, Inc. | Beads as transposome carriers |
US11230731B2 (en) | 2018-04-02 | 2022-01-25 | Progenity, Inc. | Methods, systems, and compositions for counting nucleic acid molecules |
WO2022023353A1 (en) | 2020-07-28 | 2022-02-03 | Illumina Cambridge Limited | Substituted coumarin dyes and uses as fluorescent labels |
US11248253B2 (en) | 2014-03-05 | 2022-02-15 | Adaptive Biotechnologies Corporation | Methods using randomer-containing synthetic molecules |
US11254980B1 (en) | 2017-11-29 | 2022-02-22 | Adaptive Biotechnologies Corporation | Methods of profiling targeted polynucleotides while mitigating sequencing depth requirements |
US11286519B2 (en) | 2013-12-11 | 2022-03-29 | Accuragen Holdings Limited | Methods and compositions for enrichment of amplification products |
US11286522B2 (en) | 2011-12-01 | 2022-03-29 | Genapsys, Inc. | Systems and methods for high efficiency electronic sequencing and detection |
US11286530B2 (en) | 2010-05-18 | 2022-03-29 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11306359B2 (en) | 2005-11-26 | 2022-04-19 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US11306357B2 (en) | 2010-05-18 | 2022-04-19 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11319596B2 (en) | 2014-04-21 | 2022-05-03 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11322224B2 (en) | 2010-05-18 | 2022-05-03 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11326208B2 (en) | 2010-05-18 | 2022-05-10 | Natera, Inc. | Methods for nested PCR amplification of cell-free DNA |
US11332793B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11332785B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11332774B2 (en) | 2010-10-26 | 2022-05-17 | Verinata Health, Inc. | Method for determining copy number variations |
US11339429B2 (en) | 2010-05-18 | 2022-05-24 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
EP4006150A1 (en) | 2015-09-09 | 2022-06-01 | QIAGEN GmbH | Polymerase enzyme |
US11352659B2 (en) | 2011-04-13 | 2022-06-07 | Spatial Transcriptomics Ab | Methods of detecting analytes |
WO2022129437A1 (en) | 2020-12-17 | 2022-06-23 | Illumina Cambridge Limited | Long stokes shift chromenoquinoline dyes and uses in sequencing applications |
WO2022129930A1 (en) | 2020-12-17 | 2022-06-23 | Illumina Cambridge Limited | Alkylpyridinium coumarin dyes and uses in sequencing applications |
WO2022129439A1 (en) | 2020-12-17 | 2022-06-23 | Illumina Cambridge Limited | Methods, systems and compositions for nucleic acid sequencing |
WO2022136402A1 (en) | 2020-12-22 | 2022-06-30 | Illumina Cambridge Limited | Methods and compositions for nucleic acid sequencing |
US11390916B2 (en) | 2014-04-21 | 2022-07-19 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11390619B2 (en) | 2017-10-16 | 2022-07-19 | Illumina Cambridge Limited | Secondary amine-substituted coumarin compounds and their uses as fluorescent labels |
WO2022165188A1 (en) | 2021-01-29 | 2022-08-04 | Illumina, Inc. | Methods, compositions and kits to improve seeding efficiency of flow cells with polynucleotides |
US11408024B2 (en) | 2014-09-10 | 2022-08-09 | Molecular Loop Biosciences, Inc. | Methods for selectively suppressing non-target sequences |
US11408031B2 (en) | 2010-05-18 | 2022-08-09 | Natera, Inc. | Methods for non-invasive prenatal paternity testing |
US11427866B2 (en) | 2016-05-16 | 2022-08-30 | Accuragen Holdings Limited | Method of improved sequencing by strand identification |
WO2022204032A1 (en) | 2021-03-22 | 2022-09-29 | Illumina Cambridge Limited | Methods for improving nucleic acid cluster clonality |
US11479812B2 (en) | 2015-05-11 | 2022-10-25 | Natera, Inc. | Methods and compositions for determining ploidy |
US11485996B2 (en) | 2016-10-04 | 2022-11-01 | Natera, Inc. | Methods for characterizing copy number variation using proximity-litigation sequencing |
WO2022233795A1 (en) | 2021-05-05 | 2022-11-10 | Illumina Cambridge Limited | Fluorescent dyes containing bis-boron fused heterocycles and uses in sequencing |
WO2022243480A1 (en) | 2021-05-20 | 2022-11-24 | Illumina, Inc. | Compositions and methods for sequencing by synthesis |
US11519028B2 (en) | 2016-12-07 | 2022-12-06 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
US11525159B2 (en) | 2018-07-03 | 2022-12-13 | Natera, Inc. | Methods for detection of donor-derived cell-free DNA |
WO2022272260A1 (en) | 2021-06-23 | 2022-12-29 | Illumina, Inc. | Compositions, methods, kits, cartridges, and systems for sequencing reagents |
WO2023278608A1 (en) | 2021-06-29 | 2023-01-05 | Illumina, Inc. | Self-learned base caller, trained using oligo sequences |
WO2023003757A1 (en) | 2021-07-19 | 2023-01-26 | Illumina Software, Inc. | Intensity extraction with interpolation and adaptation for base calling |
WO2023009758A1 (en) | 2021-07-28 | 2023-02-02 | Illumina, Inc. | Quality score calibration of basecalling systems |
WO2023014741A1 (en) | 2021-08-03 | 2023-02-09 | Illumina Software, Inc. | Base calling using multiple base caller models |
US11584958B2 (en) | 2017-03-31 | 2023-02-21 | Grail, Llc | Library preparation and use thereof for sequencing based error correction and/or variant identification |
US11618897B2 (en) | 2020-12-21 | 2023-04-04 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
WO2023052427A1 (en) | 2021-09-30 | 2023-04-06 | Illumina Cambridge Limited | Polynucleotide sequencing |
WO2023114397A1 (en) | 2021-12-16 | 2023-06-22 | Illumina, Inc. | Hybrid clustering |
WO2023114394A1 (en) | 2021-12-17 | 2023-06-22 | Illumina, Inc. | Orthogonal hybridization |
WO2023114896A1 (en) | 2021-12-16 | 2023-06-22 | Illumina Cambridge Limited | Methods for metal directed cleavage of surface-bound polynucleotides |
WO2023122491A1 (en) | 2021-12-20 | 2023-06-29 | Illumina Cambridge Limited | Periodate compositions and methods for chemical cleavage of surface-bound polynucleotides |
WO2023122499A1 (en) | 2021-12-20 | 2023-06-29 | Illumina Cambridge Limited | Periodate compositions and methods for chemical cleavage of surface-bound polynucleotides |
WO2023126457A1 (en) | 2021-12-29 | 2023-07-06 | Illumina Cambridge Ltd. | Methods of nucleic acid sequencing using surface-bound primers |
US11733238B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11753673B2 (en) | 2021-09-01 | 2023-09-12 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
US11761038B1 (en) | 2020-07-06 | 2023-09-19 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
WO2023175026A1 (en) | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Methods of determining sequence information |
WO2023175037A2 (en) | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Concurrent sequencing of forward and reverse complement strands on separate polynucleotides for methylation detection |
WO2023187061A1 (en) | 2022-03-31 | 2023-10-05 | Illumina Cambridge Limited | Paired-end re-synthesis using blocked p5 primers |
WO2023186815A1 (en) | 2022-03-28 | 2023-10-05 | Illumina Cambridge Limited | Labeled avidin and methods for sequencing |
WO2023186982A1 (en) | 2022-03-31 | 2023-10-05 | Illumina, Inc. | Compositions and methods for improving sequencing signals |
WO2023186872A1 (en) | 2022-03-30 | 2023-10-05 | Illumina Cambridge Limited | Methods for chemical cleavage of surface-bound polynucleotides |
WO2023192163A1 (en) | 2022-03-29 | 2023-10-05 | Illumina Cambridge Limited | Systems and methods of sequencing polynucleotides |
WO2023192900A1 (en) | 2022-03-31 | 2023-10-05 | Illumina Singapore Pte. Ltd. | Nucleosides and nucleotides with 3' vinyl blocking group useful in sequencing by synthesis |
WO2023196572A1 (en) | 2022-04-07 | 2023-10-12 | Illumina Singapore Pte. Ltd. | Altered cytidine deaminases and methods of use |
EP4269618A2 (en) | 2018-06-04 | 2023-11-01 | Illumina, Inc. | Methods of making high-throughput single-cell transcriptome libraries |
WO2023209606A1 (en) | 2022-04-29 | 2023-11-02 | Illumina Cambridge Limited | Methods and systems for encapsulating lyophilised microspheres |
EP3963104A4 (en) * | 2019-05-03 | 2023-11-08 | Ultima Genomics, Inc. | Fast-forward sequencing by synthesis methods |
EP4276769A2 (en) | 2019-03-21 | 2023-11-15 | Illumina, Inc. | Training data generation for artificial intelligence-based sequencing |
US11827935B1 (en) | 2020-11-19 | 2023-11-28 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification and detection probes |
WO2023232829A1 (en) | 2022-05-31 | 2023-12-07 | Illumina, Inc | Compositions and methods for nucleic acid sequencing |
US11840730B1 (en) | 2009-04-30 | 2023-12-12 | Molecular Loop Biosciences, Inc. | Methods and compositions for evaluating genetic markers |
US11859246B2 (en) | 2013-12-11 | 2024-01-02 | Accuragen Holdings Limited | Methods and compositions for enrichment of amplification products |
US11859241B2 (en) | 2021-06-17 | 2024-01-02 | Element Biosciences, Inc. | Compositions and methods for pairwise sequencing |
WO2024003087A1 (en) | 2022-06-28 | 2024-01-04 | Illumina, Inc. | Fluorescent dyes containing fused tetracyclic bis-boron heterocycle and uses in sequencing |
US11866741B2 (en) | 2017-02-13 | 2024-01-09 | IsoPlexis Corporation | Polymerase enzyme from 9°N |
US11873480B2 (en) | 2014-10-17 | 2024-01-16 | Illumina Cambridge Limited | Contiguity preserving transposition |
WO2024039516A1 (en) | 2022-08-19 | 2024-02-22 | Illumina, Inc. | Third dna base pair site-specific dna detection |
US11926822B1 (en) | 2020-09-23 | 2024-03-12 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
WO2024059852A1 (en) | 2022-09-16 | 2024-03-21 | Illumina, Inc. | Cluster segmentation and conditional base calling |
US11939634B2 (en) | 2010-05-18 | 2024-03-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11940413B2 (en) | 2007-02-05 | 2024-03-26 | IsoPlexis Corporation | Methods and devices for sequencing nucleic acids in smaller batches |
WO2024061799A1 (en) | 2022-09-19 | 2024-03-28 | Illumina, Inc. | Deformable polymers comprising immobilised primers |
WO2024068641A1 (en) | 2022-09-26 | 2024-04-04 | Illumina, Inc. | Resynthesis kits and methods |
WO2024073712A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Thermophilic compositions for nucleic acid amplification |
WO2024069581A1 (en) | 2022-09-30 | 2024-04-04 | Illumina Singapore Pte. Ltd. | Helicase-cytidine deaminase complexes and methods of use |
WO2024073713A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Mesophilic compositions for nucleic acid amplification |
WO2024068889A2 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Compositions and methods for reducing photo damage during sequencing |
WO2024073047A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Cytidine deaminases and methods of use in mapping modified cytosine nucleotides |
WO2024073663A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Amplification compositions and methods |
WO2024073043A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Methods of using cpg binding proteins in mapping modified cytosine nucleotides |
WO2024073714A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Methods of modulating clustering kinetics |
US11981958B1 (en) | 2020-08-20 | 2024-05-14 | 10X Genomics, Inc. | Methods for spatial analysis using DNA capture |
US11981960B1 (en) | 2020-07-06 | 2024-05-14 | 10X Genomics, Inc. | Spatial analysis utilizing degradable hydrogels |
US11981891B2 (en) | 2018-05-17 | 2024-05-14 | Illumina, Inc. | High-throughput single-cell sequencing with reduced amplification bias |
WO2024118903A1 (en) | 2022-11-30 | 2024-06-06 | Illumina, Inc. | Chemoenzymatic correction of false positive uracil transformations |
WO2024123866A1 (en) | 2022-12-09 | 2024-06-13 | Illumina, Inc. | Nucleosides and nucleotides with 3´ blocking groups and cleavable linkers |
WO2024123917A1 (en) | 2022-12-07 | 2024-06-13 | Illumina, Inc. | Monoclonal clustering using double stranded dna size exclusion with patterned seeding |
US12020778B2 (en) | 2019-03-22 | 2024-06-25 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
Families Citing this family (282)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2510166A1 (en) | 2002-12-20 | 2004-09-30 | Caliper Life Sciences, Inc. | Single molecule amplification and detection of dna |
US20060024681A1 (en) * | 2003-10-31 | 2006-02-02 | Agencourt Bioscience Corporation | Methods for producing a paired tag from a nucleic acid sequence and methods of use thereof |
JP4541731B2 (en) * | 2004-03-12 | 2010-09-08 | キヤノン株式会社 | Nucleic acid detection method |
US20060228721A1 (en) | 2005-04-12 | 2006-10-12 | Leamon John H | Methods for determining sequence variants using ultra-deep sequencing |
WO2006110855A2 (en) * | 2005-04-12 | 2006-10-19 | 454 Life Sciences Corporation | Methods for determining sequence variants using ultra-deep sequencing |
GB0514909D0 (en) * | 2005-07-20 | 2005-08-24 | Solexa Ltd | Methods of nucleic acid amplification and sequencing |
US7932029B1 (en) * | 2006-01-04 | 2011-04-26 | Si Lok | Methods for nucleic acid mapping and identification of fine-structural-variations in nucleic acids and utilities |
EP2021503A1 (en) * | 2006-03-17 | 2009-02-11 | Solexa Ltd. | Isothermal methods for creating clonal single molecule arrays |
KR20080113236A (en) * | 2006-03-21 | 2008-12-29 | 와이어쓰 | Methods and compositions for antagonism of rage |
US20070231823A1 (en) * | 2006-03-23 | 2007-10-04 | Mckernan Kevin J | Directed enrichment of genomic DNA for high-throughput sequencing |
EP2049682A2 (en) * | 2006-07-31 | 2009-04-22 | Illumina Cambridge Limited | Method of library preparation avoiding the formation of adaptor dimers |
JP5020734B2 (en) * | 2007-07-31 | 2012-09-05 | 株式会社日立ハイテクノロジーズ | Nucleic acid analysis method and apparatus |
US20090093378A1 (en) * | 2007-08-29 | 2009-04-09 | Helen Bignell | Method for sequencing a polynucleotide template |
WO2012044847A1 (en) | 2010-10-01 | 2012-04-05 | Life Technologies Corporation | Nucleic acid adaptors and uses thereof |
US8530197B2 (en) | 2008-01-09 | 2013-09-10 | Applied Biosystems, Llc | Method of making a paired tag library for nucleic acid sequencing |
US8202691B2 (en) * | 2008-01-25 | 2012-06-19 | Illumina, Inc. | Uniform fragmentation of DNA using binding proteins |
US20090226975A1 (en) * | 2008-03-10 | 2009-09-10 | Illumina, Inc. | Constant cluster seeding |
US20110105356A1 (en) * | 2008-05-07 | 2011-05-05 | Derosier Chad F | Compositions and methods for providing substances to and from an array |
GB2467691A (en) | 2008-09-05 | 2010-08-11 | Aueon Inc | Methods for stratifying and annotating cancer drug treatment options |
US20100087325A1 (en) * | 2008-10-07 | 2010-04-08 | Illumina, Inc. | Biological sample temperature control system and method |
US9394567B2 (en) | 2008-11-07 | 2016-07-19 | Adaptive Biotechnologies Corporation | Detection and quantification of sample contamination in immune repertoire analysis |
GB0821981D0 (en) * | 2008-12-02 | 2009-01-07 | Genome Res Ltd | Method for use in polynucleotide sequencing |
US8993230B2 (en) * | 2008-12-04 | 2015-03-31 | Pacific Biosciences of Californ, Inc. | Asynchronous sequencing of biological polymers |
US8236532B2 (en) * | 2008-12-23 | 2012-08-07 | Illumina, Inc. | Multibase delivery for long reads in sequencing by synthesis protocols |
EP2427572B1 (en) * | 2009-05-01 | 2013-08-28 | Illumina, Inc. | Sequencing methods |
US20110104693A1 (en) * | 2009-11-03 | 2011-05-05 | High Throughput Genomics, Inc. | QUANTITATIVE NUCLEASE PROTECTION SEQUENCING (qNPS) |
WO2011106368A2 (en) | 2010-02-23 | 2011-09-01 | Illumina, Inc. | Amplification methods to minimise sequence specific bias |
US8951940B2 (en) | 2010-04-01 | 2015-02-10 | Illumina, Inc. | Solid-phase clonal amplification and related methods |
ES2593614T3 (en) | 2010-05-06 | 2016-12-12 | Adaptive Biotechnologies Corporation | Health and disease status monitoring using clonotype profiles |
US8483969B2 (en) | 2010-09-17 | 2013-07-09 | Illuminia, Inc. | Variation analysis for multiple templates on a solid support |
WO2012040387A1 (en) * | 2010-09-24 | 2012-03-29 | The Board Of Trustees Of The Leland Stanford Junior University | Direct capture, amplification and sequencing of target dna using immobilized primers |
US9399217B2 (en) | 2010-10-04 | 2016-07-26 | Genapsys, Inc. | Chamber free nanoreactor system |
CN103328981B (en) | 2010-10-04 | 2017-04-12 | 吉纳普赛斯股份有限公司 | Systems and methods for automated reusable parallel biological reactions |
US9184099B2 (en) | 2010-10-04 | 2015-11-10 | The Board Of Trustees Of The Leland Stanford Junior University | Biosensor devices, systems and methods therefor |
US9096899B2 (en) | 2010-10-27 | 2015-08-04 | Illumina, Inc. | Microdevices and biosensor cartridges for biological or chemical analysis and systems and methods for the same |
AU2011323107B2 (en) | 2010-11-05 | 2015-09-10 | Illumina, Inc. | Linking sequence reads using paired code tags |
EP3907297A1 (en) | 2011-04-15 | 2021-11-10 | The Johns Hopkins University | Safe sequencing system |
CA2834976C (en) | 2011-05-04 | 2016-03-15 | Htg Molecular Diagnostics, Inc. | Quantitative nuclease protection assay (qnpa) and sequencing (qnps) improvements |
US8585973B2 (en) | 2011-05-27 | 2013-11-19 | The Board Of Trustees Of The Leland Stanford Junior University | Nano-sensor array |
US9926596B2 (en) | 2011-05-27 | 2018-03-27 | Genapsys, Inc. | Systems and methods for genetic and biological analysis |
AU2012281152B2 (en) | 2011-07-13 | 2017-09-07 | The Multiple Myeloma Research Foundation, Inc. | Methods for data collection and distribution |
GB2495909A (en) * | 2011-10-19 | 2013-05-01 | Genome Analysis Ct | Arrays comprising immobilized primer pair spots for amplifying target nucleic acids |
EP2776165A2 (en) | 2011-11-07 | 2014-09-17 | Illumina, Inc. | Integrated sequencing apparatuses and methods of use |
WO2013085710A2 (en) | 2011-12-09 | 2013-06-13 | Illumina, Inc. | Expanded radix for polymeric tags |
US9823246B2 (en) | 2011-12-28 | 2017-11-21 | The Board Of Trustees Of The Leland Stanford Junior University | Fluorescence enhancing plasmonic nanoscopic gold films and assays based thereon |
EP2828218B9 (en) | 2012-03-20 | 2021-04-07 | University Of Washington Through Its Center For Commercialization | Methods of lowering the error rate of massively parallel dna sequencing using duplex consensus sequencing |
US9444880B2 (en) | 2012-04-11 | 2016-09-13 | Illumina, Inc. | Cloud computing environment for biological data |
NL2017959B1 (en) | 2016-12-08 | 2018-06-19 | Illumina Inc | Cartridge assembly |
US9365896B2 (en) | 2012-10-19 | 2016-06-14 | Agilent Technologies, Inc. | Addition of an adaptor by invasive cleavage |
CA2889937C (en) | 2012-10-29 | 2020-12-29 | The Johns Hopkins University | Papanicolaou test for ovarian and endometrial cancers |
US9116139B2 (en) | 2012-11-05 | 2015-08-25 | Illumina, Inc. | Sequence scheduling and sample distribution techniques |
EP2746405B1 (en) | 2012-12-23 | 2015-11-04 | HS Diagnomics GmbH | Methods and primer sets for high throughput PCR sequencing |
US9805407B2 (en) | 2013-01-25 | 2017-10-31 | Illumina, Inc. | Methods and systems for using a cloud computing environment to configure and sell a biological sample preparation cartridge and share related data |
WO2014152625A1 (en) | 2013-03-15 | 2014-09-25 | Genapsys, Inc. | Systems and methods for biological analysis |
WO2014172288A2 (en) | 2013-04-19 | 2014-10-23 | Raindance Technologies, Inc. | Digital analyte analysis |
US10415083B2 (en) | 2013-10-28 | 2019-09-17 | The Translational Genomics Research Institute | Long insert-based whole genome sequencing |
US10540783B2 (en) * | 2013-11-01 | 2020-01-21 | Illumina, Inc. | Image analysis useful for patterned objects |
RS60736B1 (en) | 2013-12-03 | 2020-09-30 | Illumina Inc | Methods and systems for analyzing image data |
KR102374536B1 (en) | 2013-12-10 | 2022-03-14 | 일루미나, 인코포레이티드 | Biosensors for biological or chemical analysis and methods of manufacturing the same |
US10125393B2 (en) | 2013-12-11 | 2018-11-13 | Genapsys, Inc. | Systems and methods for biological analysis and computation |
US9944924B2 (en) | 2014-01-16 | 2018-04-17 | Illumina, Inc. | Polynucleotide modification on solid support |
US9677132B2 (en) | 2014-01-16 | 2017-06-13 | Illumina, Inc. | Polynucleotide modification on solid support |
CN110955371B (en) | 2014-02-13 | 2023-09-12 | Illumina公司 | Integrated consumer genome services |
PL3108009T3 (en) | 2014-02-18 | 2021-10-11 | Illumina, Inc. | Methods and compositions for dna profiling |
US9890365B2 (en) | 2014-03-09 | 2018-02-13 | The Trustees Of The University Of Pennsylvania | Compositions useful in treatment of ornithine transcarbamylase (OTC) deficiency |
US10767219B2 (en) | 2014-03-11 | 2020-09-08 | Illumina, Inc. | Disposable, integrated microfluidic cartridge and methods of making and using same |
US11390921B2 (en) | 2014-04-01 | 2022-07-19 | Adaptive Biotechnologies Corporation | Determining WT-1 specific T cells and WT-1 specific T cell receptors (TCRs) |
US9822401B2 (en) | 2014-04-18 | 2017-11-21 | Genapsys, Inc. | Methods and systems for nucleic acid amplification |
WO2015166768A1 (en) * | 2014-05-02 | 2015-11-05 | 国立大学法人金沢大学 | Method for analyzing nucleic acid derived from single cell |
EP3140428B1 (en) * | 2014-05-08 | 2021-07-28 | Fluidigm Corporation | Method of tagging nucleic acid sequences |
KR102231650B1 (en) | 2014-05-27 | 2021-03-23 | 일루미나, 인코포레이티드 | Systems and methods for biochemical analysis including a base instrument and a removable cartridge |
US20150353989A1 (en) | 2014-06-09 | 2015-12-10 | Illumina Cambridge Limited | Sample preparation for nucleic acid amplification |
GB201410420D0 (en) | 2014-06-11 | 2014-07-23 | Illumina Cambridge Ltd | Methods for estimating cluster numbers |
US10017759B2 (en) | 2014-06-26 | 2018-07-10 | Illumina, Inc. | Library preparation of tagged nucleic acid |
WO2016025332A1 (en) | 2014-08-12 | 2016-02-18 | President And Fellows Of Harvard College | System and method for monitoring health based on collected bodily fluid |
US10174383B2 (en) | 2014-08-13 | 2019-01-08 | Vanadis Diagnostics | Method of estimating the amount of a methylated locus in a sample |
WO2016040602A1 (en) | 2014-09-11 | 2016-03-17 | Epicentre Technologies Corporation | Reduced representation bisulfite sequencing using uracil n-glycosylase (ung) and endonuclease iv |
US9574991B2 (en) | 2014-10-14 | 2017-02-21 | Omnivision Technologies, Inc. | High-throughput fluorescence imaging system and device with sample heating capability, and associated methods |
US9897791B2 (en) | 2014-10-16 | 2018-02-20 | Illumina, Inc. | Optical scanning systems for in situ genetic analysis |
ES2768762T3 (en) | 2014-11-05 | 2020-06-23 | Illumina Cambridge Ltd | Reduction of DNA damage during sample preparation and sequencing using siderophore chelating agents |
GB201419731D0 (en) | 2014-11-05 | 2014-12-17 | Illumina Cambridge Ltd | Sequencing from multiple primers to increase data rate and density |
CN111024936A (en) | 2014-11-05 | 2020-04-17 | 纳迈达斯生物科技中心 | Metal composites for enhanced imaging |
ES2706531T3 (en) | 2014-11-11 | 2019-03-29 | Illumina Inc | Amplification of polynucleotides using CRISPR-Cas systems |
CN107208019B (en) | 2014-11-11 | 2021-01-01 | 伊鲁米纳剑桥有限公司 | Methods and arrays for the generation and sequencing of nucleic acid monoclonal clusters |
US11789906B2 (en) | 2014-11-19 | 2023-10-17 | Arc Bio, Llc | Systems and methods for genomic manipulations and analysis |
WO2016090266A1 (en) | 2014-12-05 | 2016-06-09 | Amyris, Inc. | High-throughput sequencing of polynucleotides |
CN116083546A (en) | 2015-02-10 | 2023-05-09 | 亿明达股份有限公司 | Methods and compositions for analyzing cellular components |
US10576471B2 (en) | 2015-03-20 | 2020-03-03 | Illumina, Inc. | Fluidics cartridge for use in the vertical or substantially vertical position |
EP3303584B1 (en) | 2015-05-29 | 2019-10-09 | Epicentre Technologies Corporation | Methods of analyzing nucleic acids |
AU2016269785B2 (en) | 2015-05-29 | 2019-02-28 | Illumina Cambridge Limited | Enhanced utilization of surface primers in clusters |
EP3653728B1 (en) | 2015-06-09 | 2023-02-01 | Life Technologies Corporation | Methods, systems, compositions, kits, apparatus and computer-readable media for molecular tagging |
US10941423B2 (en) * | 2015-06-26 | 2021-03-09 | Global Bioenergies | Method for the production of isoamyl alcohol |
CN115261468A (en) | 2015-07-06 | 2022-11-01 | 伊卢米纳剑桥有限公司 | Sample preparation for nucleic acid amplification |
CA3176469A1 (en) | 2015-07-27 | 2017-02-02 | Illumina, Inc. | Spatial mapping of nucleic acid sequence information |
CA2994406A1 (en) | 2015-08-06 | 2017-02-09 | Arc Bio, Llc | Systems and methods for genomic analysis |
US11286531B2 (en) | 2015-08-11 | 2022-03-29 | The Johns Hopkins University | Assaying ovarian cyst fluid |
MX2018001829A (en) | 2015-08-14 | 2018-05-28 | Illumina Inc | Systems and methods using magnetically-responsive sensors for determining a genetic characteristic. |
CN108474805A (en) | 2015-08-24 | 2018-08-31 | 亿明达股份有限公司 | For accumulator and flow control system in biological and chemical setting-out line road |
US10450598B2 (en) | 2015-09-11 | 2019-10-22 | Illumina, Inc. | Systems and methods for obtaining a droplet having a designated concentration of a substance-of-interest |
WO2017052300A1 (en) * | 2015-09-24 | 2017-03-30 | Seegene, Inc. . | Multiple dataset analysis for determining the presence or absence of target analyte |
US20180291413A1 (en) | 2015-10-06 | 2018-10-11 | Thermo Fisher Scientific Geneart Gmbh | Devices and methods for producing nucleic acids and proteins |
US10577643B2 (en) | 2015-10-07 | 2020-03-03 | Illumina, Inc. | Off-target capture reduction in sequencing techniques |
WO2017087724A1 (en) | 2015-11-17 | 2017-05-26 | Omniome, Inc. | Methods for determining sequence profiles |
CA3007635A1 (en) | 2015-12-07 | 2017-06-15 | Zymergen Inc. | Promoters from corynebacterium glutamicum |
CA3088654C (en) | 2015-12-07 | 2021-05-18 | Zymergen Inc. | Microbial strain improvement by a htp genomic engineering platform |
US9988624B2 (en) | 2015-12-07 | 2018-06-05 | Zymergen Inc. | Microbial strain improvement by a HTP genomic engineering platform |
US11208649B2 (en) | 2015-12-07 | 2021-12-28 | Zymergen Inc. | HTP genomic engineering platform |
EP3387152B1 (en) * | 2015-12-08 | 2022-01-26 | Twinstrand Biosciences, Inc. | Improved adapters, methods, and compositions for duplex sequencing |
CA3016077A1 (en) | 2016-03-22 | 2017-09-28 | Counsyl, Inc. | Combinatorial dna screening |
EP3442706A4 (en) | 2016-04-13 | 2020-02-19 | NextGen Jane, Inc. | Sample collection and preservation devices, systems and methods |
EP3656873A3 (en) | 2016-05-11 | 2020-07-29 | Illumina, Inc. | Polynucleotide enrichment and amplification using argonaute systems |
WO2017214557A1 (en) | 2016-06-10 | 2017-12-14 | Counsyl, Inc. | Nucleic acid sequencing adapters and uses thereof |
US10544390B2 (en) | 2016-06-30 | 2020-01-28 | Zymergen Inc. | Methods for generating a bacterial hemoglobin library and uses thereof |
KR102345898B1 (en) | 2016-06-30 | 2022-01-03 | 지머젠 인코포레이티드 | Methods for generating glucose permeabilization enzyme libraries and uses thereof |
CA3034739A1 (en) | 2016-08-22 | 2018-03-01 | Biolumic Limited | System, device and methods of seed treatment |
MX2019003344A (en) | 2016-09-22 | 2019-09-04 | Illumina Inc | Somatic copy number variation detection. |
RU2771563C2 (en) | 2016-10-14 | 2022-05-05 | Иллюмина, Инк. | Cartridge assembly |
US10650312B2 (en) | 2016-11-16 | 2020-05-12 | Catalog Technologies, Inc. | Nucleic acid-based data storage |
CA3043887A1 (en) | 2016-11-16 | 2018-05-24 | Catalog Technologies, Inc. | Nucleic acid-based data storage |
DK3566158T3 (en) | 2017-01-06 | 2022-07-18 | Illumina Inc | PHASE DIVISION CORRECTION |
CA3045498C (en) | 2017-01-17 | 2021-07-13 | Illumina, Inc. | Oncogenic splice variant determination |
AU2017394644B2 (en) | 2017-01-20 | 2020-02-06 | Pacific Biosciences Of California, Inc. | Allele-specific capture of nucleic acids |
AU2017394645B2 (en) | 2017-01-20 | 2020-01-23 | Pacific Biosciences Of California, Inc. | Genotyping by polymerase binding |
US10968447B2 (en) | 2017-01-31 | 2021-04-06 | Myriad Women's Health, Inc. | Methods and compositions for enrichment of target polynucleotides |
US10752946B2 (en) | 2017-01-31 | 2020-08-25 | Myriad Women's Health, Inc. | Methods and compositions for enrichment of target polynucleotides |
SI3589730T1 (en) | 2017-02-28 | 2024-04-30 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus (aav) clade f vector and uses therefor |
JOP20190200A1 (en) | 2017-02-28 | 2019-08-27 | Univ Pennsylvania | Compositions useful in treatment of spinal muscular atrophy |
EP3601611B1 (en) | 2017-03-24 | 2022-01-05 | Life Technologies Corporation | Polynucleotide adapters and methods of use thereof |
CA3061655A1 (en) | 2017-05-11 | 2018-11-15 | The Trustees Of The University Of Pennsylvania | Gene therapy for neuronal ceroid lipofuscinoses |
KR20200010285A (en) | 2017-05-19 | 2020-01-30 | 지머젠 인코포레이티드 | Genomic Engineering of Biosynthetic Pathways Inducing Increased NADPH |
ES2875579T3 (en) | 2017-06-06 | 2021-11-10 | Zymergen Inc | HTP genomic engineering platform to improve Escherichia coli |
JP2020524494A (en) | 2017-06-06 | 2020-08-20 | ザイマージェン インコーポレイテッド | High throughput transposon mutagenesis |
CN110719956A (en) | 2017-06-06 | 2020-01-21 | 齐默尔根公司 | High throughput genome engineering platform for improving fungal strains |
EP3635110A2 (en) | 2017-06-06 | 2020-04-15 | Zymergen, Inc. | A high-throughput (htp) genomic engineering platform for improving saccharopolyspora spinosa |
EP3642362A1 (en) | 2017-06-20 | 2020-04-29 | Illumina, Inc. | Methods and compositions for addressing inefficiencies in amplification reactions |
CN111094585A (en) | 2017-08-01 | 2020-05-01 | 伊鲁米纳公司 | Hydrogel beads for nucleotide sequencing |
JP6998404B2 (en) | 2017-08-01 | 2022-02-04 | 深▲セン▼恒特基因有限公司 | Method for enriching and determining the target nucleotide sequence |
WO2019038594A2 (en) | 2017-08-21 | 2019-02-28 | Biolumic Limited | High growth and high hardiness transgenic plants |
SG11202002516WA (en) | 2017-09-21 | 2020-04-29 | Genapsys Inc | Systems and methods for nucleic acid sequencing |
CA3067421C (en) | 2017-11-06 | 2023-08-15 | Illumina, Inc. | Nucleic acid indexing techniques |
WO2019094651A1 (en) | 2017-11-08 | 2019-05-16 | Twinstrand Biosciences, Inc. | Reagents and adapters for nucleic acid sequencing and methods for making such reagents and adapters |
EP3513280A4 (en) | 2017-11-13 | 2020-07-22 | The Multiple Myeloma Research Foundation, Inc. | Integrated, molecular, omics, immunotherapy, metabolic, epigenetic, and clinical database |
US20190156922A1 (en) | 2017-11-16 | 2019-05-23 | Illumina, Inc. | Systems and methods for determining microsatellite instability |
EP3718113A1 (en) | 2017-11-30 | 2020-10-07 | Illumina, Inc. | Validation methods and systems for sequence variant calls |
CA3065780A1 (en) | 2018-01-08 | 2019-07-11 | Illumina, Inc. | Systems and devices for high-throughput sequencing with semiconductor-based detection |
WO2019136376A1 (en) | 2018-01-08 | 2019-07-11 | Illumina, Inc. | High-throughput sequencing with semiconductor-based detection |
US11180752B2 (en) | 2018-02-13 | 2021-11-23 | Illumina, Inc. | DNA sequencing using hydrogel beads |
KR20200132921A (en) | 2018-03-16 | 2020-11-25 | 카탈로그 테크놀로지스, 인크. | Chemical methods for storing nucleic acid-based data |
CA3091228A1 (en) | 2018-03-20 | 2019-09-26 | Zymergen Inc. | A htp platform for the genetic engineering of chinese hamster ovary cells |
EP3553182A1 (en) | 2018-04-11 | 2019-10-16 | Université de Bourgogne | Detection method of somatic genetic anomalies, combination of capture probes and kit of detection |
AU2019257320B2 (en) | 2018-04-20 | 2022-04-07 | Illumina, Inc. | Methods of encapsulating single cells, the encapsulated cells and uses thereof |
EP3794598A1 (en) | 2018-05-16 | 2021-03-24 | Catalog Technologies, Inc. | Compositions and methods for nucleic acid-based data storage |
KR20210059694A (en) | 2018-07-12 | 2021-05-25 | 트윈스트랜드 바이오사이언시스, 인코포레이티드 | Methods and reagents for identifying genome editing, clonal expansion, and related fields |
US20210317517A1 (en) | 2018-08-28 | 2021-10-14 | Sophia Genetics S.A. | Methods for asymmetric dna library generation and optionally integrated duplex sequencing |
US11519033B2 (en) | 2018-08-28 | 2022-12-06 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
EP3844306A2 (en) | 2018-08-28 | 2021-07-07 | 10X Genomics, Inc. | Increasing spatial array resolution |
EP3844308A1 (en) | 2018-08-28 | 2021-07-07 | 10X Genomics, Inc. | Resolving spatial arrays |
WO2020060811A1 (en) | 2018-09-17 | 2020-03-26 | Omniome, Inc. | Engineered polymerases for improved sequencing |
JP2022503873A (en) | 2018-10-25 | 2022-01-12 | イルミナ インコーポレイテッド | Methods and compositions for identifying ligands on an array using indexes and barcodes |
EP3870721A1 (en) | 2018-10-26 | 2021-09-01 | Illumina Inc | Modulating polymer beads for dna processing |
NL2022043B1 (en) | 2018-11-21 | 2020-06-03 | Akershus Univ Hf | Tagmentation-Associated Multiplex PCR Enrichment Sequencing |
EP4293126A3 (en) | 2018-11-30 | 2024-01-17 | Illumina, Inc. | Analysis of multiple analytes using a single assay |
WO2020123319A2 (en) | 2018-12-10 | 2020-06-18 | 10X Genomics, Inc. | Methods of using master / copy arrays for spatial detection |
US11926867B2 (en) | 2019-01-06 | 2024-03-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
US11649485B2 (en) | 2019-01-06 | 2023-05-16 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
EP3908678A1 (en) | 2019-01-10 | 2021-11-17 | Iovance Biotherapeutics, Inc. | System and methods for monitoring adoptive cell therapy clonality and persistence |
EP3931354A1 (en) | 2019-02-28 | 2022-01-05 | 10X Genomics, Inc. | Profiling of biological analytes with spatially barcoded oligonucleotide arrays |
EP3938538A1 (en) | 2019-03-15 | 2022-01-19 | 10X Genomics, Inc. | Methods for using spatial arrays for single cell sequencing |
NL2023312B1 (en) | 2019-03-21 | 2020-09-28 | Illumina Inc | Artificial intelligence-based base calling |
EP3887542A1 (en) | 2019-03-22 | 2021-10-06 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
GB201905303D0 (en) | 2019-04-15 | 2019-05-29 | Thermo Fisher Scient Geneart Gmbh | Multiplex assembly of nucleic acid molecules |
KR20220017409A (en) | 2019-05-09 | 2022-02-11 | 카탈로그 테크놀로지스, 인크. | Data structures and behaviors for searching, computing, and indexing in DNA-based data stores. |
WO2020243579A1 (en) | 2019-05-30 | 2020-12-03 | 10X Genomics, Inc. | Methods of detecting spatial heterogeneity of a biological sample |
BR112021012755A2 (en) | 2019-07-12 | 2022-04-26 | Illumina Cambridge Ltd | Compositions and methods for preparing nucleic acid sequencing libraries using crispr/cas9 immobilized on a solid support |
JP2022549048A (en) | 2019-09-20 | 2022-11-24 | イルミナ インコーポレイテッド | Methods and compositions for identifying ligands on arrays using indices and barcodes |
WO2021061694A1 (en) | 2019-09-23 | 2021-04-01 | Zymergen Inc. | Method for counterselection in microorganisms |
US11514575B2 (en) | 2019-10-01 | 2022-11-29 | 10X Genomics, Inc. | Systems and methods for identifying morphological patterns in tissue samples |
KR20220080172A (en) | 2019-10-11 | 2022-06-14 | 카탈로그 테크놀로지스, 인크. | Nucleic Acid Security and Authentication |
EP4025711A2 (en) | 2019-11-08 | 2022-07-13 | 10X Genomics, Inc. | Enhancing specificity of analyte binding |
WO2021091611A1 (en) | 2019-11-08 | 2021-05-14 | 10X Genomics, Inc. | Spatially-tagged analyte capture agents for analyte multiplexing |
WO2021092431A1 (en) | 2019-11-08 | 2021-05-14 | Omniome, Inc. | Engineered polymerases for improved sequencing by binding |
CA3158888A1 (en) | 2019-11-21 | 2021-05-27 | Yifeng YIN | Spatial analysis of analytes |
EP4219754B1 (en) | 2019-12-23 | 2024-05-15 | 10X Genomics, Inc. | Methods for spatial analysis using rna-templated ligation |
US11702693B2 (en) | 2020-01-21 | 2023-07-18 | 10X Genomics, Inc. | Methods for printing cells and generating arrays of barcoded cells |
US11732299B2 (en) | 2020-01-21 | 2023-08-22 | 10X Genomics, Inc. | Spatial assays with perturbed cells |
US11821035B1 (en) | 2020-01-29 | 2023-11-21 | 10X Genomics, Inc. | Compositions and methods of making gene expression libraries |
US11898205B2 (en) | 2020-02-03 | 2024-02-13 | 10X Genomics, Inc. | Increasing capture efficiency of spatial assays |
US11732300B2 (en) | 2020-02-05 | 2023-08-22 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
US11835462B2 (en) | 2020-02-11 | 2023-12-05 | 10X Genomics, Inc. | Methods and compositions for partitioning a biological sample |
EP4103580A4 (en) | 2020-02-13 | 2024-03-06 | Zymergen Inc. | Metagenomic library and natural product discovery platform |
US20210254140A1 (en) | 2020-02-17 | 2021-08-19 | 10X Genomics, Inc. | Situ analysis of chromatin interaction |
CA3168202A1 (en) | 2020-02-21 | 2021-08-26 | Felice Alessio BAVA | Methods and compositions for integrated in situ spatial assay |
US11891654B2 (en) | 2020-02-24 | 2024-02-06 | 10X Genomics, Inc. | Methods of making gene expression libraries |
US11926863B1 (en) | 2020-02-27 | 2024-03-12 | 10X Genomics, Inc. | Solid state single cell method for analyzing fixed biological cells |
US11768175B1 (en) | 2020-03-04 | 2023-09-26 | 10X Genomics, Inc. | Electrophoretic methods for spatial analysis |
EP4139485B1 (en) | 2020-04-22 | 2023-09-06 | 10X Genomics, Inc. | Methods for spatial analysis using targeted rna depletion |
JP2023525470A (en) | 2020-05-08 | 2023-06-16 | イルミナ インコーポレイテッド | Genome sequencing and detection methods |
KR20230008877A (en) | 2020-05-11 | 2023-01-16 | 카탈로그 테크놀로지스, 인크. | Programs and functions of DNA-based data storage |
EP4153775A1 (en) | 2020-05-22 | 2023-03-29 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
AU2021275906A1 (en) | 2020-05-22 | 2022-12-22 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
WO2021242834A1 (en) | 2020-05-26 | 2021-12-02 | 10X Genomics, Inc. | Method for resetting an array |
WO2021247543A2 (en) | 2020-06-02 | 2021-12-09 | 10X Genomics, Inc. | Nucleic acid library methods |
EP4158054A1 (en) | 2020-06-02 | 2023-04-05 | 10X Genomics, Inc. | Spatial transcriptomics for antigen-receptors |
WO2021252499A1 (en) | 2020-06-08 | 2021-12-16 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
EP4165207A1 (en) | 2020-06-10 | 2023-04-19 | 10X Genomics, Inc. | Methods for determining a location of an analyte in a biological sample |
WO2021263111A1 (en) | 2020-06-25 | 2021-12-30 | 10X Genomics, Inc. | Spatial analysis of dna methylation |
IL300112A (en) | 2020-08-06 | 2023-03-01 | Illumina Inc | Preparation of rna and dna sequencing libraries using bead-linked transposomes |
EP4200416A1 (en) | 2020-08-18 | 2023-06-28 | Illumina, Inc. | Sequence-specific targeted transposition and selection and sorting of nucleic acids |
CN116323970A (en) | 2020-09-11 | 2023-06-23 | 伊鲁米纳剑桥有限公司 | Method for enriching target sequences from sequencing libraries using hairpin adaptors |
JP2023547366A (en) | 2020-10-21 | 2023-11-10 | イルミナ インコーポレイテッド | Sequencing templates containing multiple inserts and compositions and methods for improving sequencing throughput |
CA3179883A1 (en) | 2020-12-02 | 2022-06-09 | Illumina Software, Inc. | System and method for detection of genetic alterations |
EP4012046A1 (en) | 2020-12-11 | 2022-06-15 | 10X Genomics, Inc. | Methods and compositions for multimodal in situ analysis |
US20220228200A1 (en) | 2021-01-19 | 2022-07-21 | 10X Genomics, Inc. | Methods and compositions for internally controlled in situ assays |
US20220235403A1 (en) | 2021-01-26 | 2022-07-28 | 10X Genomics, Inc. | Nucleic acid analog probes for in situ analysis |
WO2022165313A1 (en) | 2021-02-01 | 2022-08-04 | Regenxbio Inc. | Gene therapy for neuronal ceroid lipofuscinoses |
CA3208854A1 (en) | 2021-02-04 | 2022-08-11 | Illumina, Inc. | Long indexed-linked read generation on transposome bound beads |
EP4301873A1 (en) | 2021-03-03 | 2024-01-10 | 10X Genomics, Inc. | Analyte detection in situ using nucleic acid origami |
AU2022238446A1 (en) | 2021-03-18 | 2023-09-07 | 10X Genomics, Inc. | Multiplex capture of gene and protein expression from a biological sample |
JP2024514430A (en) | 2021-03-24 | 2024-04-02 | カタログ テクノロジーズ, インコーポレイテッド | Fixed-point number representation and calculation circuit |
EP4314328A1 (en) | 2021-03-29 | 2024-02-07 | Illumina, Inc. | Compositions and methods for assessing dna damage in a library and normalizing amplicon size bias |
WO2022212269A1 (en) | 2021-03-29 | 2022-10-06 | Illumina, Inc. | Improved methods of library preparation |
WO2022212330A1 (en) | 2021-03-30 | 2022-10-06 | Illumina, Inc. | Improved methods of isothermal complementary dna and library preparation |
BR112023019154A2 (en) | 2021-03-31 | 2023-10-17 | Illumina Cambridge Ltd | NUCLEIC ACID LIBRARY SEQUENCING TECHNIQUES WITH ADAPTER DIMER DETECTION |
EP4314283A1 (en) | 2021-03-31 | 2024-02-07 | Illumina, Inc. | Methods of preparing directional tagmentation sequencing libraries using transposon-based technology with unique molecular identifiers for error correction |
JP2024512651A (en) | 2021-04-02 | 2024-03-19 | イルミナ インコーポレイテッド | Nucleotides for Sequencing - Machine Learning Model for Detecting Bubbles in Sample Slides |
KR20240004473A (en) | 2021-04-29 | 2024-01-11 | 일루미나, 인코포레이티드 | Amplification techniques for nucleic acid characterization |
CN113293205A (en) | 2021-05-24 | 2021-08-24 | 深圳市真迈生物科技有限公司 | Sequencing method |
EP4347877A1 (en) | 2021-06-01 | 2024-04-10 | 10X Genomics, Inc. | Methods and compositions for analyte detection and probe resolution |
WO2022256422A1 (en) | 2021-06-02 | 2022-12-08 | 10X Genomics, Inc. | Sample analysis using asymmetric circularizable probes |
US20220403450A1 (en) | 2021-06-03 | 2022-12-22 | Illumina Software, Inc. | Systems and methods for sequencing nucleotides using two optical channels |
WO2023278966A1 (en) | 2021-06-29 | 2023-01-05 | Illumina, Inc. | Machine-learning model for generating confidence classifications for genomic coordinates |
WO2023278184A1 (en) | 2021-06-29 | 2023-01-05 | Illumina, Inc. | Methods and systems to correct crosstalk in illumination emitted from reaction sites |
AU2022305321A1 (en) | 2021-06-29 | 2024-01-18 | Illumina, Inc. | Signal-to-noise-ratio metric for determining nucleotide-base calls and base-call quality |
US20230005253A1 (en) | 2021-07-01 | 2023-01-05 | Illumina, Inc. | Efficient artificial intelligence-based base calling of index sequences |
US20230027409A1 (en) | 2021-07-13 | 2023-01-26 | Illumina, Inc. | Methods and systems for real time extraction of crosstalk in illumination emitted from reaction sites |
US20230026886A1 (en) | 2021-07-13 | 2023-01-26 | 10X Genomics, Inc. | Methods for preparing polymerized matrix with controllable thickness |
US20230021577A1 (en) | 2021-07-23 | 2023-01-26 | Illumina Software, Inc. | Machine-learning model for recalibrating nucleotide-base calls |
US20230057571A1 (en) | 2021-08-03 | 2023-02-23 | 10X Genomics, Inc. | Nucleic acid concatemers and methods for stabilizing and/or compacting the same |
CN117858958A (en) | 2021-08-16 | 2024-04-09 | 10X基因组学有限公司 | Probes comprising segmented barcode regions and methods of use |
WO2023034079A1 (en) | 2021-09-01 | 2023-03-09 | Illumina Software, Inc. | Amplitude modulation for accelerated base calling |
CN117561573A (en) | 2021-09-17 | 2024-02-13 | 因美纳有限公司 | Automatic identification of the source of faults in nucleotide sequencing from base interpretation error patterns |
WO2023049558A1 (en) | 2021-09-21 | 2023-03-30 | Illumina, Inc. | A graph reference genome and base-calling approach using imputed haplotypes |
WO2023056328A2 (en) | 2021-09-30 | 2023-04-06 | Illumina, Inc. | Solid supports and methods for depleting and/or enriching library fragments prepared from biosamples |
CA3239214A1 (en) | 2021-11-19 | 2023-05-23 | Catalog Technologies, Inc. | Nucleic acid storage for blockchain and non-fungible tokens |
WO2023102118A2 (en) | 2021-12-01 | 2023-06-08 | 10X Genomics, Inc. | Methods, compositions, and systems for improved in situ detection of analytes and spatial analysis |
WO2023102354A1 (en) | 2021-12-02 | 2023-06-08 | Illumina Software, Inc. | Generating cluster-specific-signal corrections for determining nucleotide-base calls |
US20230183799A1 (en) | 2021-12-10 | 2023-06-15 | Illumina, Inc. | Parallel sample and index sequencing |
US20230193147A1 (en) | 2021-12-21 | 2023-06-22 | Illumina Cambridge Limited | Wax-microsphere matrix compositions and methods of making and using the same |
WO2023122363A1 (en) | 2021-12-23 | 2023-06-29 | Illumina Software, Inc. | Dynamic graphical status summaries for nucelotide sequencing |
US20230215515A1 (en) | 2021-12-23 | 2023-07-06 | Illumina Software, Inc. | Facilitating secure execution of external workflows for genomic sequencing diagnostics |
WO2023129898A2 (en) | 2021-12-27 | 2023-07-06 | 10X Genomics, Inc. | Methods and compositions for rolling circle amplification |
US20230207050A1 (en) | 2021-12-28 | 2023-06-29 | Illumina Software, Inc. | Machine learning model for recalibrating nucleotide base calls corresponding to target variants |
WO2023129764A1 (en) | 2021-12-29 | 2023-07-06 | Illumina Software, Inc. | Automatically switching variant analysis model versions for genomic analysis applications |
WO2023141588A1 (en) | 2022-01-21 | 2023-07-27 | 10X Genomics, Inc. | Multiple readout signals for analyzing a sample |
WO2023164570A1 (en) | 2022-02-23 | 2023-08-31 | Insitro, Inc. | Pooled optical screening and transcriptional measurements of cells comprising barcoded genetic perturbations |
WO2023164660A1 (en) | 2022-02-25 | 2023-08-31 | Illumina, Inc. | Calibration sequences for nucelotide sequencing |
WO2023164492A1 (en) | 2022-02-25 | 2023-08-31 | Illumina, Inc. | Machine-learning models for detecting and adjusting values for nucleotide methylation levels |
WO2023168085A1 (en) | 2022-03-04 | 2023-09-07 | Catalog Technologies, Inc. | Dna microarrays and component level sequencing for nucleic acid-based data storage and processing |
WO2023192616A1 (en) | 2022-04-01 | 2023-10-05 | 10X Genomics, Inc. | Compositions and methods for targeted masking of autofluorescence |
WO2023196526A1 (en) | 2022-04-06 | 2023-10-12 | 10X Genomics, Inc. | Methods for multiplex cell analysis |
CA3224264A1 (en) | 2022-04-08 | 2023-10-12 | Illumina, Inc. | Aptamer dynamic range compression and detection techniques |
US20230340571A1 (en) | 2022-04-26 | 2023-10-26 | Illumina, Inc. | Machine-learning models for selecting oligonucleotide probes for array technologies |
US20240002902A1 (en) | 2022-05-06 | 2024-01-04 | 10X Genomics, Inc. | Analysis of antigen and antigen receptor interactions |
WO2023220627A1 (en) | 2022-05-10 | 2023-11-16 | Illumina Software, Inc. | Adaptive neural network for nucelotide sequencing |
WO2023225095A1 (en) | 2022-05-18 | 2023-11-23 | Illumina Cambridge Limited | Preparation of size-controlled nucleic acid fragments |
US20240035071A1 (en) | 2022-06-17 | 2024-02-01 | 10X Genomics, Inc. | Catalytic de-crosslinking of samples for in situ analysis |
WO2023250504A1 (en) | 2022-06-24 | 2023-12-28 | Illumina Software, Inc. | Improving split-read alignment by intelligently identifying and scoring candidate split groups |
WO2024006705A1 (en) | 2022-06-27 | 2024-01-04 | Illumina Software, Inc. | Improved human leukocyte antigen (hla) genotyping |
WO2024006769A1 (en) | 2022-06-27 | 2024-01-04 | Illumina Software, Inc. | Generating and implementing a structural variation graph genome |
US20230420075A1 (en) | 2022-06-27 | 2023-12-28 | Illumina Software, Inc. | Accelerators for a genotype imputation model |
WO2024026356A1 (en) | 2022-07-26 | 2024-02-01 | Illumina, Inc. | Rapid single-cell multiomics processing using an executable file |
US20240101978A1 (en) | 2022-08-12 | 2024-03-28 | 10X Genomics, Inc. | Puma1 polymerases and uses thereof |
WO2024040060A1 (en) | 2022-08-16 | 2024-02-22 | 10X Genomics, Inc. | Ap50 polymerases and uses thereof |
US20240112753A1 (en) | 2022-09-29 | 2024-04-04 | Illumina, Inc. | Target-variant-reference panel for imputing target variants |
US20240120027A1 (en) | 2022-09-30 | 2024-04-11 | Illumina, Inc. | Machine-learning model for refining structural variant calls |
WO2024077096A1 (en) | 2022-10-05 | 2024-04-11 | Illumina, Inc. | Integrating variant calls from multiple sequencing pipelines utilizing a machine learning architecture |
US20240127906A1 (en) | 2022-10-11 | 2024-04-18 | Illumina, Inc. | Detecting and correcting methylation values from methylation sequencing assays |
US20240191297A1 (en) | 2022-10-14 | 2024-06-13 | 10X Genomics, Inc. | Methods, compositions, and systems for assessing biological sample quality |
GB202215624D0 (en) | 2022-10-21 | 2022-12-07 | Dnae Diagnostics Ltd | Clonal amplification |
US20240167081A1 (en) | 2022-11-08 | 2024-05-23 | 10X Genomics,Inc. | Immobilization methods and compositions for in situ detection |
WO2024107887A1 (en) | 2022-11-16 | 2024-05-23 | 10X Genomics, Inc. | Methods and compositions for assessing performance of in situ assays |
WO2024118791A1 (en) | 2022-11-30 | 2024-06-06 | Illumina, Inc. | Accurately predicting variants from methylation sequencing data |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1991006678A1 (en) * | 1989-10-26 | 1991-05-16 | Sri International | Dna sequencing |
WO1993004199A2 (en) * | 1991-08-20 | 1993-03-04 | Scientific Generics Limited | Methods of detecting or quantitating nucleic acids and of producing labelled immobilised nucleic acids |
EP0665293A2 (en) * | 1994-01-26 | 1995-08-02 | Hamamatsu Photonics K.K. | Method of determining base sequence of nucleic acid |
WO1996004404A1 (en) * | 1994-08-03 | 1996-02-15 | Mosaic Technologies, Inc. | Method and apparatus for performing amplification of nucleic acid on supports |
WO1996032504A2 (en) * | 1995-04-11 | 1996-10-17 | Trustees Of Boston University | Solid phase sequencing of biopolymers |
US5589332A (en) * | 1992-12-04 | 1996-12-31 | Innovir Laboratories, Inc. | Ribozyme amplified diagnostics |
Family Cites Families (101)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4957858A (en) | 1986-04-16 | 1990-09-18 | The Salk Instute For Biological Studies | Replicative RNA reporter systems |
EP0224126A3 (en) | 1985-11-25 | 1989-02-01 | The University of Calgary | Covalently linked complementary oligodeoxynucleotides as universal nucleic acid sequencing primer linkers |
IL86724A (en) | 1987-06-19 | 1995-01-24 | Siska Diagnostics Inc | Method and kits for the amplification and detection of nucleic acid sequences |
IE72468B1 (en) | 1987-07-31 | 1997-04-09 | Univ Leland Stanford Junior | Selective amplification of target polynucleotide sequences |
SE8801070D0 (en) * | 1988-03-23 | 1988-03-23 | Pharmacia Ab | METHOD FOR IMMOBILIZING A DNA SEQUENCE ON A SOLID SUPPORT |
US6107023A (en) * | 1988-06-17 | 2000-08-22 | Genelabs Technologies, Inc. | DNA amplification and subtraction techniques |
GB8818020D0 (en) | 1988-07-28 | 1988-09-01 | Ici Plc | Method for amplification of nucleotide sequences |
WO1990002205A1 (en) | 1988-08-25 | 1990-03-08 | Angenics, Inc. | Detection of nucleic acid sequences using particle agglutination |
GB8827160D0 (en) | 1988-11-21 | 1988-12-29 | Apothekernes Lab | Detection & quantitative determination of rna & dna |
US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
CA2004326A1 (en) | 1988-12-23 | 1990-06-23 | Nanibushan Dattagupta | Assay of sequences using amplified genes |
WO1990009455A1 (en) | 1989-02-13 | 1990-08-23 | Geneco Pty Ltd | Detection of a nucleic acid sequence or a change therein |
KR920700360A (en) | 1989-03-22 | 1992-02-19 | 하리크 프리드리히 | Sliding bearing |
US5629158A (en) * | 1989-03-22 | 1997-05-13 | Cemu Bitecknik Ab | Solid phase diagnosis of medical conditions |
US5547839A (en) * | 1989-06-07 | 1996-08-20 | Affymax Technologies N.V. | Sequencing of surface immobilized polymers utilizing microflourescence detection |
US5800992A (en) * | 1989-06-07 | 1998-09-01 | Fodor; Stephen P.A. | Method of detecting nucleic acids |
GB2233654A (en) | 1989-07-07 | 1991-01-16 | Nat Res Dev | Immobilised polynucleotides |
US5302509A (en) | 1989-08-14 | 1994-04-12 | Beckman Instruments, Inc. | Method for sequencing polynucleotides |
CA2036946C (en) * | 1990-04-06 | 2001-10-16 | Kenneth V. Deugau | Indexing linkers |
US5326692B1 (en) * | 1992-05-13 | 1996-04-30 | Molecular Probes Inc | Fluorescent microparticles with controllable enhanced stokes shift |
US5645994A (en) * | 1990-07-05 | 1997-07-08 | University Of Utah Research Foundation | Method and compositions for identification of species in a sample using type II topoisomerase sequences |
GB9019512D0 (en) | 1990-09-06 | 1990-10-24 | Ici Plc | Assay method |
CA2055755A1 (en) | 1990-11-22 | 1992-05-23 | Toshihiko Kishimoto | Method of immobilizing single-stranded dna on carrier at terminal |
JPH06509473A (en) * | 1991-08-10 | 1994-10-27 | メディカル・リサーチ・カウンシル | Processing of cell populations |
CA2077135A1 (en) | 1991-08-30 | 1993-03-01 | Joh-E Ikeda | A method of dna amplification |
US5474796A (en) * | 1991-09-04 | 1995-12-12 | Protogene Laboratories, Inc. | Method and apparatus for conducting an array of chemical reactions on a support surface |
PT534858E (en) | 1991-09-24 | 2000-09-29 | Keygene Nv | SELECTIVE AMPLIFICATION OF RESTRICTION FRAGMENTS A GENERAL METHOD FOR OBTAINING "DIGITAL IMPRESSIONS" OF DNA |
EP0656065A1 (en) * | 1991-10-31 | 1995-06-07 | University Of Pittsburgh | Reverse dot blot hybridization using tandem head-to-tail monomers containing probes synthesized by staggered complementary primers |
CA2122450C (en) | 1991-11-01 | 2004-07-13 | Charles Phillip Morris | Solid phase amplification process |
DE4141178A1 (en) | 1991-12-13 | 1993-06-17 | Europ Lab Molekularbiolog | New nucleic acid sequencing method - using one labelled nucleotide at one time in cycles comprising elongation, wash, label detection and removal of the label, then repeating |
DE69333650T2 (en) * | 1992-02-19 | 2006-01-12 | The Public Health Research Institute Of The City Of New York, Inc. | NEW ARRANGEMENT OF OLIGONUCLEOTIDES AND THEIR BENEFITS FOR SORTING, ISOLATING, SEQUENCING AND MANIPULATING NUCLEIC ACIDS |
GB9208733D0 (en) | 1992-04-22 | 1992-06-10 | Medical Res Council | Dna sequencing method |
GB9214873D0 (en) | 1992-07-13 | 1992-08-26 | Medical Res Council | Process for categorising nucleotide sequence populations |
DE69327326T2 (en) | 1992-07-24 | 2001-08-16 | Diatech Pty Ltd | REPLACEMENT AND DETECTION PROCESS |
US5639423A (en) | 1992-08-31 | 1997-06-17 | The Regents Of The University Of Calfornia | Microfabricated reactor |
RU2048522C1 (en) * | 1992-10-14 | 1995-11-20 | Институт белка РАН | Method of nucleic acid copying, method of their expression and a medium for their realization |
US5795714A (en) * | 1992-11-06 | 1998-08-18 | Trustees Of Boston University | Method for replicating an array of nucleic acid probes |
US5432065A (en) * | 1993-03-30 | 1995-07-11 | United States Biochemical Corporation | Cycle sequencing with non-thermostable DNA polymerases |
US5462854A (en) | 1993-04-19 | 1995-10-31 | Beckman Instruments, Inc. | Inverse linkage oligonucleotides for chemical and enzymatic processes |
ATE318910T1 (en) | 1993-05-05 | 2006-03-15 | Roche Diagnostics Gmbh | CHOLESTEROL OXIDASE FROM BREVIBACTERIUM STEROLICUM |
US5514539A (en) * | 1993-06-29 | 1996-05-07 | The United States Of America As Represented By The Department Of Health And Human Services | Nucleotide and deduced amino acid sequences of the envelope 1 gene of 51 isolates of hepatitis C virus and the use of reagents derived from these sequences in diagnostic methods and vaccines |
AU7320794A (en) | 1993-09-29 | 1995-04-18 | Miami Children's Hospital Research Institute, Inc. | Aspartoacylase gene, protein, and methods of screening for mutations associated with canavan disease |
US5645801A (en) * | 1993-10-21 | 1997-07-08 | Abbott Laboratories | Device and method for amplifying and detecting target nucleic acids |
CZ122696A3 (en) | 1993-11-02 | 1996-12-11 | Neurobiological Technologies | The use of crf corticotropin releasing factor or analogs thereof for preparing a therapeutical preparation |
CA2185902A1 (en) * | 1994-03-18 | 1995-09-28 | Federick Ausubel | Cleaved amplified rflp detection methods |
US5552278A (en) | 1994-04-04 | 1996-09-03 | Spectragen, Inc. | DNA sequencing by stepwise ligation and cleavage |
US6689561B1 (en) | 1994-04-14 | 2004-02-10 | The Regents Of The University Of California | Tumor suppressor gene and methods for detection of cancer, monitoring of tumor progression and cancer treatment |
ATE220424T1 (en) | 1994-05-28 | 2002-07-15 | Tepnel Medical Ltd | PRODUCTION OF NUCLEIC ACID COPIES |
US5589330A (en) | 1994-07-28 | 1996-12-31 | Genzyme Corporation | High-throughput screening method for sequence or genetic alterations in nucleic acids using elution and sequencing of complementary oligonucleotides |
US6468751B1 (en) * | 1994-08-03 | 2002-10-22 | Mosaic Technologies, Inc. | Method and apparatus for performing amplification of nucleic acid on supports |
US6060288A (en) | 1994-08-03 | 2000-05-09 | Mosaic Technologies | Method for performing amplification of nucleic acid on supports |
US6090592A (en) * | 1994-08-03 | 2000-07-18 | Mosaic Technologies, Inc. | Method for performing amplification of nucleic acid on supports |
JP3612092B2 (en) | 1994-09-07 | 2005-01-19 | 株式会社日立製作所 | DNA separation / sorting method and analysis method |
US5843660A (en) * | 1994-09-30 | 1998-12-01 | Promega Corporation | Multiplex amplification of short tandem repeat loci |
FR2726286B1 (en) | 1994-10-28 | 1997-01-17 | Genset Sa | SOLID PHASE NUCLEIC ACID AMPLIFICATION PROCESS AND REAGENT KIT USEFUL FOR CARRYING OUT SAID PROCESS |
US5512441A (en) * | 1994-11-15 | 1996-04-30 | American Health Foundation | Quantative method for early detection of mutant alleles and diagnostic kits for carrying out the method |
EP0804618B1 (en) | 1994-11-28 | 1999-01-27 | E.I. Du Pont De Nemours And Company | Compound microsatellite primers for the detection of genetic polymorphisms |
WO1996024688A1 (en) | 1995-02-07 | 1996-08-15 | Mosaic Technologies | Diagnostics based on dna duplex repair |
WO1996027025A1 (en) * | 1995-02-27 | 1996-09-06 | Ely Michael Rabani | Device, compounds, algorithms, and methods of molecular characterization and manipulation with molecular parallelism |
US5707807A (en) | 1995-03-28 | 1998-01-13 | Research Development Corporation Of Japan | Molecular indexing for expressed gene analysis |
US5750341A (en) | 1995-04-17 | 1998-05-12 | Lynx Therapeutics, Inc. | DNA sequencing by parallel oligonucleotide extensions |
DE19515552A1 (en) * | 1995-04-27 | 1996-10-31 | Europ Lab Molekularbiolog | Simultaneous sequencing of nucleic acids |
US5753439A (en) * | 1995-05-19 | 1998-05-19 | Trustees Of Boston University | Nucleic acid detection methods |
AU5797696A (en) * | 1995-05-19 | 1996-11-29 | Ely Michael Rabani | Parallel multiplex polynucleotide sequencing |
US5690894A (en) * | 1995-05-23 | 1997-11-25 | The Regents Of The University Of California | High density array fabrication and readout method for a fiber optic biosensor |
US5882856A (en) * | 1995-06-07 | 1999-03-16 | Genzyme Corporation | Universal primer sequence for multiplex DNA amplification |
AT402203B (en) | 1995-06-13 | 1997-03-25 | Himmler Gottfried Dipl Ing Dr | METHOD FOR TRANSCRIPTION-FREE AMPLIFICATION OF NUCLEIC ACIDS |
SE9504099D0 (en) | 1995-11-16 | 1995-11-16 | Pharmacia Biotech Ab | A method of sequencing |
WO1997019193A2 (en) | 1995-11-21 | 1997-05-29 | Yale University | Unimolecular segment amplification and detection |
WO1997029211A1 (en) | 1996-02-09 | 1997-08-14 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | RESTRICTION DISPLAY (RD-PCR) OF DIFFERENTIALLY EXPRESSED mRNAs |
US5759780A (en) | 1996-03-29 | 1998-06-02 | Pathogenesis Corporation | Methods for enriching target nucleic acid sequences |
US6458530B1 (en) | 1996-04-04 | 2002-10-01 | Affymetrix Inc. | Selecting tag nucleic acids |
US5955268A (en) | 1996-04-26 | 1999-09-21 | Abbott Laboratories | Method and reagent for detecting multiple nucleic acid sequences in a test sample |
AU730633B2 (en) | 1996-05-29 | 2001-03-08 | Phillip Belgrader | Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions |
US6203978B1 (en) | 1996-05-31 | 2001-03-20 | Du Vergier Ltd. | Capture of single stranded nucleic acids |
US5939291A (en) * | 1996-06-14 | 1999-08-17 | Sarnoff Corporation | Microfluidic method for nucleic acid amplification |
GB9620209D0 (en) | 1996-09-27 | 1996-11-13 | Cemu Bioteknik Ab | Method of sequencing DNA |
US5837466A (en) * | 1996-12-16 | 1998-11-17 | Vysis, Inc. | Devices and methods for detecting nucleic acid analytes in samples |
US5876936A (en) | 1997-01-15 | 1999-03-02 | Incyte Pharmaceuticals, Inc. | Nucleic acid sequencing with solid phase capturable terminators |
US6309824B1 (en) | 1997-01-16 | 2001-10-30 | Hyseq, Inc. | Methods for analyzing a target nucleic acid using immobilized heterogeneous mixtures of oligonucleotide probes |
DE69824716D1 (en) | 1997-04-01 | 2004-07-29 | Manteia S A | METHOD FOR SEQUENCING NUCLEIC ACIDS |
ES2563643T3 (en) | 1997-04-01 | 2016-03-15 | Illumina Cambridge Limited | Nucleic acid sequencing method |
WO1998045474A1 (en) | 1997-04-04 | 1998-10-15 | Innogenetics N.V. | Isothermal polymerase chain reaction by cycling the concentration of divalent metal ions |
US6235471B1 (en) * | 1997-04-04 | 2001-05-22 | Caliper Technologies Corp. | Closed-loop biochemical analyzers |
DK1801214T3 (en) | 1997-07-07 | 2011-01-24 | Medical Res Council | In vitro sorting procedure |
US6326489B1 (en) * | 1997-08-05 | 2001-12-04 | Howard Hughes Medical Institute | Surface-bound, bimolecular, double-stranded DNA arrays |
US6124120A (en) * | 1997-10-08 | 2000-09-26 | Yale University | Multiple displacement amplification |
US6511803B1 (en) * | 1997-10-10 | 2003-01-28 | President And Fellows Of Harvard College | Replica amplification of nucleic acid arrays |
CA2305449A1 (en) | 1997-10-10 | 1999-04-22 | President & Fellows Of Harvard College | Replica amplification of nucleic acid arrays |
US6248558B1 (en) * | 1998-03-31 | 2001-06-19 | Vanderbilt University | Sequence and method for genetic engineering of proteins with cell membrane translocating activity |
US5928875A (en) * | 1998-05-27 | 1999-07-27 | Betzdearborn Inc. | Primers for the detection of spore forming bacteria |
EP1098996A1 (en) * | 1998-07-20 | 2001-05-16 | Yale University | Method for detecting nucleic acids using target-mediated ligation of bipartite primers |
AR021833A1 (en) | 1998-09-30 | 2002-08-07 | Applied Research Systems | METHODS OF AMPLIFICATION AND SEQUENCING OF NUCLEIC ACID |
EP1149175A2 (en) | 1999-01-11 | 2001-10-31 | President And Fellows Of Harvard College | Isothermal amplification of dna |
US6300070B1 (en) | 1999-06-04 | 2001-10-09 | Mosaic Technologies, Inc. | Solid phase methods for amplifying multiple nucleic acids |
US20020119448A1 (en) | 1999-06-23 | 2002-08-29 | Joseph A. Sorge | Methods of enriching for and identifying polymorphisms |
US6107061A (en) | 1999-09-18 | 2000-08-22 | The Perkin-Elmer Corporation | Modified primer extension reactions for polynucleotide sequence detection |
US7078225B2 (en) * | 2000-06-02 | 2006-07-18 | Nippon Shokubai Co., Ltd. | Method for enzymatically producing an optically active cyanohydrin |
AR031640A1 (en) | 2000-12-08 | 2003-09-24 | Applied Research Systems | ISOTHERMAL AMPLIFICATION OF NUCLEIC ACIDS IN A SOLID SUPPORT |
DK2518162T3 (en) | 2006-11-15 | 2018-06-18 | Biospherex Llc | Multi-tag sequencing and ecogenomic analysis |
US7792820B2 (en) | 2007-09-25 | 2010-09-07 | International Business Machines Corporation | System for intelligent consumer earcons |
-
1998
- 1998-04-01 ES ES10011729.0T patent/ES2563643T3/en not_active Expired - Lifetime
- 1998-04-01 JP JP54130898A patent/JP2002503954A/en active Pending
- 1998-04-01 AU AU68466/98A patent/AU6846698A/en not_active Abandoned
- 1998-04-01 EP EP98913952A patent/EP0972081B1/en not_active Expired - Lifetime
- 1998-04-01 EP EP05012382A patent/EP1591541B1/en not_active Expired - Lifetime
- 1998-04-01 EP EP15195603.4A patent/EP3034626A1/en not_active Withdrawn
- 1998-04-01 AT AT98913952T patent/ATE364718T1/en not_active IP Right Cessation
- 1998-04-01 WO PCT/GB1998/000961 patent/WO1998044151A1/en active Search and Examination
- 1998-04-01 EP EP10011729.0A patent/EP2327797B1/en not_active Expired - Lifetime
- 1998-04-01 DE DE69837913T patent/DE69837913T2/en not_active Expired - Lifetime
- 1998-04-01 AT AT05012382T patent/ATE545710T1/en active
-
2003
- 2003-06-02 US US10/449,010 patent/US7985565B2/en not_active Expired - Fee Related
-
2008
- 2008-04-16 US US12/148,133 patent/US8476044B2/en not_active Expired - Fee Related
-
2010
- 2010-04-30 US US12/771,324 patent/US8143008B2/en not_active Expired - Fee Related
-
2011
- 2011-09-22 HK HK11110019.3A patent/HK1155784A1/en not_active IP Right Cessation
-
2013
- 2013-03-14 US US13/828,047 patent/US8993271B2/en not_active Expired - Fee Related
- 2013-05-02 US US13/886,234 patent/US9902951B2/en not_active Expired - Fee Related
-
2014
- 2014-08-21 US US14/465,685 patent/US20140371100A1/en not_active Abandoned
- 2014-11-26 US US14/555,036 patent/US20150087531A1/en not_active Abandoned
-
2015
- 2015-01-20 US US14/601,013 patent/US9593328B2/en not_active Expired - Fee Related
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1991006678A1 (en) * | 1989-10-26 | 1991-05-16 | Sri International | Dna sequencing |
WO1993004199A2 (en) * | 1991-08-20 | 1993-03-04 | Scientific Generics Limited | Methods of detecting or quantitating nucleic acids and of producing labelled immobilised nucleic acids |
US5589332A (en) * | 1992-12-04 | 1996-12-31 | Innovir Laboratories, Inc. | Ribozyme amplified diagnostics |
EP0665293A2 (en) * | 1994-01-26 | 1995-08-02 | Hamamatsu Photonics K.K. | Method of determining base sequence of nucleic acid |
WO1996004404A1 (en) * | 1994-08-03 | 1996-02-15 | Mosaic Technologies, Inc. | Method and apparatus for performing amplification of nucleic acid on supports |
WO1996032504A2 (en) * | 1995-04-11 | 1996-10-17 | Trustees Of Boston University | Solid phase sequencing of biopolymers |
Non-Patent Citations (4)
Title |
---|
FU D -J ET AL: "SEQUENCING DOUBLE-STRANDED DNA BY STRAND DISPLACEMENT", NUCLEIC ACIDS RESEARCH, vol. 25, no. 3, 1997, pages 677 - 679, XP000196977 * |
LOCKHART ET AL.: "EXPRESSION MONITORING BY HYBRIDIZATION TO HIGH-DENSITY OLIGONUCLEOTIDE ARRAYS", NATURE BIOTECHNOLOGY, vol. 14, 14 December 1996 (1996-12-14), pages 1675 - 1680, XP002074420 * |
OROSKAR ET AL.: "DETECTION OF IMMOBILIZED AMPLICONS BY ELISA-LIKE TECHNIQUES", CLIN.CHEM., vol. 42, no. 9, 1996, pages 1547 - 1555, XP002074418 * |
YERSHOV ET AL.: "DNA ANALYSIS AND DIAGNOSTIC ON OLIGONUCLEOTIDE MICROCHIPS", PNAS, vol. 93, May 1996 (1996-05-01), pages 4913 - 4918, XP002074419 * |
Cited By (847)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8143008B2 (en) | 1997-04-01 | 2012-03-27 | Illumina, Inc. | Method of nucleic acid amplification |
US8476044B2 (en) | 1997-04-01 | 2013-07-02 | Illumina, Inc. | Method of nucleic acid amplification |
US7985565B2 (en) | 1997-04-01 | 2011-07-26 | Illumina, Inc. | Method of nucleic acid amplification |
US9593328B2 (en) | 1997-04-01 | 2017-03-14 | Illumina, Inc. | Method of nucleic acid amplification |
US8993271B2 (en) | 1997-04-01 | 2015-03-31 | Illumina, Inc. | Method of nucleic acid amplification |
US9902951B2 (en) | 1997-04-01 | 2018-02-27 | Illumina, Inc. | Method of nucleic acid amplification |
US7785790B1 (en) | 1997-10-10 | 2010-08-31 | President And Fellows Of Harvard College | Replica amplification of nucleic acid arrays |
US6485944B1 (en) | 1997-10-10 | 2002-11-26 | President And Fellows Of Harvard College | Replica amplification of nucleic acid arrays |
US6432360B1 (en) | 1997-10-10 | 2002-08-13 | President And Fellows Of Harvard College | Replica amplification of nucleic acid arrays |
US10370652B2 (en) | 1998-09-30 | 2019-08-06 | Illumina, Inc. | Methods of nucleic acid amplification and sequencing |
AU771073B2 (en) * | 1998-09-30 | 2004-03-11 | Lynx Therapeutics, Inc. | Methods of nucleic acid amplification and sequencing |
EP1634963A1 (en) * | 1998-09-30 | 2006-03-15 | Solexa Ltd. | Methods of nucleic acid amplification and sequencing |
US7115400B1 (en) | 1998-09-30 | 2006-10-03 | Solexa Ltd. | Methods of nucleic acid amplification and sequencing |
WO2000018957A1 (en) * | 1998-09-30 | 2000-04-06 | Applied Research Systems Ars Holding N.V. | Methods of nucleic acid amplification and sequencing |
US8652810B2 (en) | 1998-09-30 | 2014-02-18 | Illumina, Inc. | Methods of nucleic acid amplification and sequencing |
US9297006B2 (en) | 1998-09-30 | 2016-03-29 | Illumina, Inc. | Methods of nucleic acid amplification and sequencing |
WO2000023616A3 (en) * | 1998-10-21 | 2000-08-17 | Noxxon Pharma Ag | Method for the exponential amplification of molecular matrices |
WO2000075374A1 (en) * | 1999-06-04 | 2000-12-14 | Mosaic Technologies | Solid phase methods for amplifying multiple nucleic acids |
US6300070B1 (en) | 1999-06-04 | 2001-10-09 | Mosaic Technologies, Inc. | Solid phase methods for amplifying multiple nucleic acids |
US20140031237A1 (en) * | 1999-06-23 | 2014-01-30 | Catalyst Assets Llc | Methods of enriching for and identifying polymorphisms |
US20140024027A1 (en) * | 1999-06-23 | 2014-01-23 | Catalyst Assets Llc | Methods of enriching for and identifying polymorphisms |
US6274320B1 (en) | 1999-09-16 | 2001-08-14 | Curagen Corporation | Method of sequencing a nucleic acid |
WO2001032935A3 (en) * | 1999-11-02 | 2002-05-02 | Celine Hu | Molecular microarrays and methods for production and use thereof |
WO2001032935A2 (en) * | 1999-11-02 | 2001-05-10 | Celine Hu | Molecular microarrays and methods for production and use thereof |
WO2001048242A3 (en) * | 1999-12-29 | 2002-07-18 | Mergen Ltd | Methods for amplifying and detecting multiple polynucleotides on a solid phase support |
WO2001048242A2 (en) * | 1999-12-29 | 2001-07-05 | Mergen Ltd. | Methods for amplifying and detecting multiple polynucleotides on a solid phase support |
JP4860869B2 (en) * | 1999-12-29 | 2012-01-25 | オックスフォード ジーン テクノロジー アイピー リミティド | Method for amplifying and detecting a plurality of polynucleotides on a solid support |
JP2003523183A (en) * | 1999-12-29 | 2003-08-05 | マーゲン リミティド | Method for amplifying and detecting a plurality of polynucleotides on a solid support |
WO2001062064A3 (en) * | 2000-02-25 | 2002-10-03 | Epigenomics Ag | Method for detecting cytosine methylation in dna samples |
US7824852B2 (en) | 2000-02-25 | 2010-11-02 | Epigenomics Ag | Method for detecting cytosine methylation in DNA samples |
US7524629B2 (en) | 2000-02-25 | 2009-04-28 | Epigenomics Ag | Method for detecting cytosine methylation in DNA samples |
WO2001062064A2 (en) * | 2000-02-25 | 2001-08-30 | Epigenomics Ag | Method for detecting cytosine methylation in dna samples |
EP1921171A1 (en) * | 2000-02-25 | 2008-05-14 | Epigenomics AG | Method for detecting cytosine methylation in DNA |
WO2001062982A3 (en) * | 2000-02-25 | 2002-09-19 | Mosaic Technologies Inc | Methods for multi-stage solid phase amplification of nucleic acids |
WO2001062960A3 (en) * | 2000-02-25 | 2002-08-29 | Epigenomics Ag | Method for detecting cytosine methylation in dna samples |
WO2001062982A2 (en) * | 2000-02-25 | 2001-08-30 | Mosaic Technologies, Inc. | Methods for multi-stage solid phase amplification of nucleic acids |
WO2001062960A2 (en) * | 2000-02-25 | 2001-08-30 | Epigenomics Ag | Method for detecting cytosine methylation in dna samples |
WO2001068921A2 (en) * | 2000-03-14 | 2001-09-20 | Investigen | Compositions and methods for simultaneous detection of multiple biological entities |
WO2001068921A3 (en) * | 2000-03-14 | 2003-01-23 | Investigen | Compositions and methods for simultaneous detection of multiple biological entities |
WO2001092568A2 (en) * | 2000-06-02 | 2001-12-06 | Axaron Bioscience Ag | Method for producing dna-arrays |
WO2001092568A3 (en) * | 2000-06-02 | 2003-06-05 | Axaron Bioscience Ag | Method for producing dna-arrays |
US7846733B2 (en) | 2000-06-26 | 2010-12-07 | Nugen Technologies, Inc. | Methods and compositions for transcription-based nucleic acid amplification |
US10669577B2 (en) | 2000-10-06 | 2020-06-02 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US10457984B2 (en) | 2000-10-06 | 2019-10-29 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US9708358B2 (en) | 2000-10-06 | 2017-07-18 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US10428380B2 (en) | 2000-10-06 | 2019-10-01 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US10648028B2 (en) | 2000-10-06 | 2020-05-12 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US9719139B2 (en) | 2000-10-06 | 2017-08-01 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US10662472B2 (en) | 2000-10-06 | 2020-05-26 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US9718852B2 (en) | 2000-10-06 | 2017-08-01 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US9725480B2 (en) | 2000-10-06 | 2017-08-08 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US9133511B2 (en) | 2000-10-06 | 2015-09-15 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US10407458B2 (en) | 2000-10-06 | 2019-09-10 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US10633700B2 (en) | 2000-10-06 | 2020-04-28 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US10669582B2 (en) | 2000-10-06 | 2020-06-02 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US10435742B2 (en) | 2000-10-06 | 2019-10-08 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US10577652B2 (en) | 2000-10-06 | 2020-03-03 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US10407459B2 (en) | 2000-10-06 | 2019-09-10 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US10570446B2 (en) | 2000-10-06 | 2020-02-25 | The Trustee Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US9868985B2 (en) | 2000-10-06 | 2018-01-16 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
US7790418B2 (en) | 2000-12-08 | 2010-09-07 | Illumina Cambridge Limited | Isothermal amplification of nucleic acids on a solid support |
WO2002046456A1 (en) * | 2000-12-08 | 2002-06-13 | Applied Research Systems Ars Holding N.V. | Isothermal amplification of nucleic acids on a solid support |
US7972820B2 (en) | 2000-12-08 | 2011-07-05 | Illumina Cambridge Limited | Isothermal amplification of nucleic acids on a solid support |
US7771934B2 (en) | 2000-12-13 | 2010-08-10 | Nugen Technologies, Inc. | Methods and compositions for generation of multiple copies of nucleic acid sequences and methods of detection thereof |
US8334116B2 (en) | 2000-12-13 | 2012-12-18 | Nugen Technologies, Inc. | Methods and compositions for generation of multiple copies of nucleic acid sequences and methods of detection thereof |
WO2002061126A2 (en) * | 2001-01-30 | 2002-08-08 | Solexa Ltd. | The preparation of polynucleotide arrays |
EP1808496A1 (en) * | 2001-01-30 | 2007-07-18 | Solexa Limited | Preparation of polynucleotide arrays |
WO2002061126A3 (en) * | 2001-01-30 | 2003-02-06 | Solexa Ltd | The preparation of polynucleotide arrays |
WO2002072879A2 (en) * | 2001-02-09 | 2002-09-19 | Axaron Bioscience Ag | Production and use of random arrangements of clonal nuclear acid islands on a surface |
WO2002072879A3 (en) * | 2001-02-09 | 2003-10-02 | Axaron Bioscience Ag | Production and use of random arrangements of clonal nuclear acid islands on a surface |
US7771946B2 (en) | 2001-03-09 | 2010-08-10 | Nugen Technologies, Inc. | Methods, kits and compositions for single primer linear isothermal amplification of nucleic acid sequences |
US9181582B2 (en) | 2001-03-09 | 2015-11-10 | Nugen Technologies, Inc. | Compositions for amplification of RNA sequences using composite primers |
US8071311B2 (en) | 2001-03-09 | 2011-12-06 | Nugen Technologies, Inc. | Methods and compositions for amplification of RNA sequences |
WO2002081743A3 (en) * | 2001-04-02 | 2003-04-03 | Brendan Hamill | Polynucleotide analysis using combinatorial pcr |
AU2002241168B2 (en) * | 2001-04-02 | 2007-10-25 | Point-2-Point Genomics Ltd. | Polynucleotide analysis using combinatorial PCR |
WO2002081743A2 (en) * | 2001-04-02 | 2002-10-17 | Point-2-Point Genomics Ltd. | Polynucleotide analysis using combinatorial pcr |
US7771975B2 (en) | 2001-04-02 | 2010-08-10 | Point-2-Point Genomics Limited | Polynucleotide analysis using combinatorial PCR |
US9562250B2 (en) | 2001-04-20 | 2017-02-07 | The Penn State Research Foundation | Methods for nucleic acid manipulation |
US10000781B2 (en) | 2001-04-20 | 2018-06-19 | The Penn State Research Foundation | Methods for nucleic acid manipulation |
US9322059B2 (en) | 2001-04-20 | 2016-04-26 | The Penn State Research Foundation | Methods for nucleic acid manipulation |
US9322057B2 (en) | 2001-04-20 | 2016-04-26 | The Penn State Research Foundation | Methods for nucleic acid manipulation |
US10017803B2 (en) | 2001-04-20 | 2018-07-10 | The Penn State Research Foundation | Methods for nucleic acid manipulation |
EP1256632A3 (en) * | 2001-05-07 | 2004-01-02 | Smithkline Beecham Corporation | High throughput polymorphism screening |
EP1256632A2 (en) * | 2001-05-07 | 2002-11-13 | Smithkline Beecham Corporation | High throughput polymorphism screening |
WO2004067759A3 (en) * | 2003-01-29 | 2004-11-18 | Univ Cranfield | Replication of nucleic acid arrays |
US10982274B2 (en) | 2003-01-29 | 2021-04-20 | Roche Molecular Systems, Inc. | Bead emulsion nucleic acid amplification |
GB2413555A (en) * | 2003-01-29 | 2005-11-02 | Univ Cranfield | Replication of nucleic acid arrays |
US10240192B2 (en) | 2003-01-29 | 2019-03-26 | 454 Life Sciences Corporation | Bead emulsion nucleic acid amplification |
WO2004067759A2 (en) * | 2003-01-29 | 2004-08-12 | Cranfield University | Replication of nucleic acid arrays |
US8765380B2 (en) | 2003-01-29 | 2014-07-01 | 454 Life Sciences Corporation | Bead emulsion nucleic acid amplification |
EP2159285B1 (en) * | 2003-01-29 | 2012-09-26 | 454 Life Sciences Corporation | Methods of amplifying and sequencing nucleic acids |
US9175325B2 (en) | 2003-04-14 | 2015-11-03 | Nugen Technologies, Inc. | Global amplification using a randomly primed composite primer |
US8465950B2 (en) | 2003-04-14 | 2013-06-18 | Nugen Technologies, Inc. | Global amplification using a randomly primed composite primer |
EP2431481A1 (en) * | 2003-10-20 | 2012-03-21 | Kalim Mir | Parallel polymer sequencing methods |
US8969258B2 (en) | 2004-01-07 | 2015-03-03 | Illumina Cambridge Limited | Methods of localizing nucleic acids to arrays |
US9376710B2 (en) | 2004-01-07 | 2016-06-28 | Illumina Cambridge Ltd. | Methods of localizing nucleic acids to arrays |
EP2789383A1 (en) | 2004-01-07 | 2014-10-15 | Illumina Cambridge Limited | Improvements in or relating to molecular arrays |
US11654411B2 (en) | 2004-01-07 | 2023-05-23 | Illumina Cambridge Limited | Methods and compositions of localizing nucleic acids to arrays |
US10953379B2 (en) | 2004-01-07 | 2021-03-23 | Illumina Cambridge Limited | Methods and compositions of localizing nucleic acids to arrays |
EP3175914A1 (en) | 2004-01-07 | 2017-06-07 | Illumina Cambridge Limited | Improvements in or relating to molecular arrays |
EP3673986A1 (en) | 2004-01-07 | 2020-07-01 | Illumina Cambridge Limited | Improvements in or relating to molecular arrays |
US8563477B2 (en) | 2004-01-07 | 2013-10-22 | Illumina Cambridge Limited | Modified molecular arrays |
US10525437B2 (en) | 2004-01-07 | 2020-01-07 | Illumina Cambridge Limited | Methods and compositions of localizing nucleic acids to arrays |
US9889422B2 (en) | 2004-01-07 | 2018-02-13 | Illumina Cambridge Limited | Methods of localizing nucleic acids to arrays |
WO2005068656A1 (en) * | 2004-01-12 | 2005-07-28 | Solexa Limited | Nucleic acid characterisation |
WO2005078130A1 (en) * | 2004-02-10 | 2005-08-25 | Solexa Limited | Arrayed polynucleotides |
EP1907583B2 (en) † | 2005-06-15 | 2019-10-23 | Complete Genomics Inc. | Single molecule arrays for genetic and chemical analysis |
EP1907583B1 (en) | 2005-06-15 | 2016-10-05 | Complete Genomics Inc. | Single molecule arrays for genetic and chemical analysis |
US10351909B2 (en) | 2005-06-15 | 2019-07-16 | Complete Genomics, Inc. | DNA sequencing from high density DNA arrays using asynchronous reactions |
EP2620510B1 (en) | 2005-06-15 | 2016-10-12 | Complete Genomics Inc. | Single molecule arrays for genetic and chemical analysis |
US9944984B2 (en) | 2005-06-15 | 2018-04-17 | Complete Genomics, Inc. | High density DNA array |
US9017945B2 (en) | 2005-07-20 | 2015-04-28 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
US10793904B2 (en) | 2005-07-20 | 2020-10-06 | Illumina Cambridge Limited | Methods for sequencing a polynucleotide template |
US9637786B2 (en) | 2005-07-20 | 2017-05-02 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
US9085802B2 (en) | 2005-07-20 | 2015-07-21 | Illumina Cambridge Limited | Preparation of templates for nucleic acid sequencing |
US10710046B2 (en) | 2005-07-20 | 2020-07-14 | Illumina Cambridge Limited | Preparation of templates for nucleic acid sequencing |
US9765391B2 (en) | 2005-07-20 | 2017-09-19 | Illumina Cambridge Limited | Methods for sequencing a polynucleotide template |
US10563256B2 (en) | 2005-07-20 | 2020-02-18 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
US11781184B2 (en) | 2005-07-20 | 2023-10-10 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
US9498763B2 (en) | 2005-07-20 | 2016-11-22 | Illumina Cambridge Limited | Preparation of templates for nucleic acid sequencing |
EP2189540A1 (en) | 2005-07-20 | 2010-05-26 | Illumina Cambridge Limited | Methods for sequencing a polynucleotide template |
US8017335B2 (en) | 2005-07-20 | 2011-09-13 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
US11542553B2 (en) | 2005-07-20 | 2023-01-03 | Illumina Cambridge Limited | Methods for sequencing a polynucleotide template |
US9999866B2 (en) | 2005-07-20 | 2018-06-19 | Illumina Cambridge Limited | Preparation of templates for nucleic acid sequencing |
EP2298930B2 (en) † | 2005-07-20 | 2022-06-29 | Illumina Cambridge Limited | Preparation of templates for nucleic acid sequencing |
US8715966B2 (en) | 2005-07-20 | 2014-05-06 | Illumina Cambridge Limited | Preparation of templates for nucleic acid sequencing |
US8247177B2 (en) | 2005-07-20 | 2012-08-21 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
US9297043B2 (en) | 2005-07-20 | 2016-03-29 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
EP2298930A1 (en) | 2005-07-20 | 2011-03-23 | Illumina Cambridge Limited | Preparation of templates for nucleic acid sequencing |
US11111543B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US11111544B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US8852867B2 (en) | 2005-09-07 | 2014-10-07 | Nugen Technologies, Inc. | Nucleic acid amplification procedure using RNA and DNA composite primers |
US7939258B2 (en) | 2005-09-07 | 2011-05-10 | Nugen Technologies, Inc. | Nucleic acid amplification procedure using RNA and DNA composite primers |
US10253359B2 (en) | 2005-11-01 | 2019-04-09 | Illumina Cambridge Limited | Method of preparing libraries of template polynucleotides |
EP3564394A1 (en) | 2005-11-01 | 2019-11-06 | Illumina Cambridge Limited | Method of preparing libraries of template polynucleotides |
US8563478B2 (en) | 2005-11-01 | 2013-10-22 | Illumina Cambridge Limited | Method of preparing libraries of template polynucleotides |
EP4249602A2 (en) | 2005-11-01 | 2023-09-27 | Illumina Cambridge Limited | Method of preparing libraries of template polynucleotides |
US9376678B2 (en) | 2005-11-01 | 2016-06-28 | Illumina Cambridge Limited | Method of preparing libraries of template polynucleotides |
US11142789B2 (en) | 2005-11-01 | 2021-10-12 | Illumina Cambridge Limited | Method of preparing libraries of template polynucleotides |
US7741463B2 (en) | 2005-11-01 | 2010-06-22 | Illumina Cambridge Limited | Method of preparing libraries of template polynucleotides |
EP2423325A1 (en) | 2005-11-01 | 2012-02-29 | Illumina Cambridge Limited | Method of preparing libraries of template polynucleotides |
EP1957668B1 (en) | 2005-11-25 | 2015-04-08 | Illumina Cambridge Limited | Preparation of nucleic acid templates for solid phase amplification |
EP2918686A1 (en) | 2005-11-25 | 2015-09-16 | Illumina Cambridge Limited | Preparation of nucleic acid templates for solid phase amplification |
US8168388B2 (en) | 2005-11-25 | 2012-05-01 | Illumina Cambridge Ltd | Preparation of nucleic acid templates for solid phase amplification |
WO2007060456A1 (en) | 2005-11-25 | 2007-05-31 | Solexa Limited | Preparation of nucleic acid templates for solid phase amplification |
US11306359B2 (en) | 2005-11-26 | 2022-04-19 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US8192930B2 (en) | 2006-02-08 | 2012-06-05 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
US8945835B2 (en) | 2006-02-08 | 2015-02-03 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
US9994896B2 (en) | 2006-02-08 | 2018-06-12 | Illumina Cambridge Limited | Method for sequencing a polynucelotide template |
US10876158B2 (en) | 2006-02-08 | 2020-12-29 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
EP3722409A1 (en) | 2006-03-31 | 2020-10-14 | Illumina, Inc. | Systems and devices for sequence by synthesis analysis |
EP4105644A2 (en) | 2006-03-31 | 2022-12-21 | Illumina, Inc. | Systems and devices for sequence by synthesis analysis |
WO2007123744A2 (en) | 2006-03-31 | 2007-11-01 | Solexa, Inc. | Systems and devices for sequence by synthesis analysis |
EP3373174A1 (en) | 2006-03-31 | 2018-09-12 | Illumina, Inc. | Systems and devices for sequence by synthesis analysis |
US8921073B2 (en) | 2006-06-23 | 2014-12-30 | Illumina, Inc. | Devices and systems for creation of DNA cluster arrays |
US9415368B2 (en) | 2006-06-23 | 2016-08-16 | Illumina, Inc. | Devices and systems for creation of DNA cluster arrays |
US8765381B2 (en) | 2006-10-06 | 2014-07-01 | Illumina Cambridge Limited | Method for pairwise sequencing of target polynucleotides |
US7960120B2 (en) | 2006-10-06 | 2011-06-14 | Illumina Cambridge Ltd. | Method for pair-wise sequencing a plurality of double stranded target polynucleotides |
US8236505B2 (en) | 2006-10-06 | 2012-08-07 | Illumina Cambridge Limited | Method for pairwise sequencing of target polynucleotides |
EP3670672A1 (en) | 2006-10-06 | 2020-06-24 | Illumina Cambridge Limited | Method for sequencing a polynucleotide template |
US10221452B2 (en) | 2006-10-06 | 2019-03-05 | Illumina Cambridge Limited | Method for pairwise sequencing of target polynucleotides |
US7754429B2 (en) | 2006-10-06 | 2010-07-13 | Illumina Cambridge Limited | Method for pair-wise sequencing a plurity of target polynucleotides |
US8105784B2 (en) | 2006-10-06 | 2012-01-31 | Illumina Cambridge Limited | Method for pairwise sequencing of target polynucleotides |
US8431348B2 (en) | 2006-10-06 | 2013-04-30 | Illumina Cambridge Limited | Method for pairwise sequencing of target polynucleotides |
US9267173B2 (en) | 2006-10-06 | 2016-02-23 | Illumina Cambridge Limited | Method for pairwise sequencing of target polynucleotides |
US8568979B2 (en) | 2006-10-10 | 2013-10-29 | Illumina, Inc. | Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization |
US10538759B2 (en) | 2006-10-10 | 2020-01-21 | Illumina, Inc. | Compounds and method for representational selection of nucleic acids from complex mixtures using hybridization |
US9139826B2 (en) | 2006-10-10 | 2015-09-22 | Illumina, Inc. | Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization |
US9587273B2 (en) | 2006-10-10 | 2017-03-07 | Illumina, Inc. | Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization |
US8916350B2 (en) | 2006-10-10 | 2014-12-23 | Illumina, Inc. | Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization |
US9340781B2 (en) | 2006-10-10 | 2016-05-17 | Illumina, Inc. | Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization |
US9528151B2 (en) | 2006-12-01 | 2016-12-27 | The Trustees Of Columbia University In The City Of New York | Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators |
US11098353B2 (en) | 2006-12-01 | 2021-08-24 | The Trustees Of Columbia University In The City Of New York | Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators |
US11939631B2 (en) | 2006-12-01 | 2024-03-26 | The Trustees Of Columbia University In The City Of New York | Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators |
US10457985B2 (en) | 2007-02-02 | 2019-10-29 | Illumina Cambridge Limited | Methods for indexing samples and sequencing multiple polynucleotide templates |
US10988806B2 (en) | 2007-02-02 | 2021-04-27 | Illumina Cambridge Limited | Methods for indexing samples and sequencing multiple polynucleotide templates |
US11634768B2 (en) | 2007-02-02 | 2023-04-25 | Illumina Cambridge Limited | Methods for indexing samples and sequencing multiple polynucleotide templates |
US9512478B2 (en) | 2007-02-02 | 2016-12-06 | Illumina Cambridge Limited | Methods for indexing samples and sequencing multiple polynucleotide templates |
US11940413B2 (en) | 2007-02-05 | 2024-03-26 | IsoPlexis Corporation | Methods and devices for sequencing nucleic acids in smaller batches |
US11827927B2 (en) | 2007-02-07 | 2023-11-28 | Illumina Cambridge Limited | Preparation of templates for methylation analysis |
US9868982B2 (en) | 2007-02-07 | 2018-01-16 | Illumina Cambridge Limited | Preparation of templates for methylation analysis |
US10954554B2 (en) | 2007-02-07 | 2021-03-23 | Illumina Cambridge Limited | Preparation of templates for methylation analysis |
US8617816B2 (en) | 2007-03-16 | 2013-12-31 | 454 Life Sciences, A Roche Company | System and method for detection of HIV drug resistant variants |
EP2201021A4 (en) * | 2007-08-29 | 2012-01-25 | Applied Biosystems Llc | Alternative nucleic acid sequencing methods |
EP2201021A1 (en) * | 2007-08-29 | 2010-06-30 | Applied Biosystems, LLC | Alternative nucleic acid sequencing methods |
EP2657869A2 (en) | 2007-08-29 | 2013-10-30 | Applied Biosystems, LLC | Alternative nucleic acid sequencing methods |
WO2009034181A2 (en) * | 2007-09-14 | 2009-03-19 | Twof, Inc. | Methods for the preparation of dna microarrays with linear high density probes |
WO2009034181A3 (en) * | 2007-09-14 | 2009-04-30 | Twof Inc | Methods for the preparation of dna microarrays with linear high density probes |
US10260094B2 (en) | 2007-10-19 | 2019-04-16 | The Trustees Of Columbia University In The City Of New York | DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators |
US10144961B2 (en) | 2007-10-19 | 2018-12-04 | The Trustees Of Columbia University In The City Of New York | Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis |
US11208691B2 (en) | 2007-10-19 | 2021-12-28 | The Trustees Of Columbia University In The City Of New York | Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis |
US9670539B2 (en) | 2007-10-19 | 2017-06-06 | The Trustees Of Columbia University In The City Of New York | Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis |
US11242561B2 (en) | 2007-10-19 | 2022-02-08 | The Trustees Of Columbia University In The City Of New York | DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators |
US9115163B2 (en) | 2007-10-19 | 2015-08-25 | The Trustees Of Columbia University In The City Of New York | DNA sequence with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators |
US9175342B2 (en) | 2007-10-19 | 2015-11-03 | The Trustees Of Columbia University In The City Of New York | Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis |
US11214832B2 (en) | 2008-01-28 | 2022-01-04 | Complete Genomics, Inc. | Methods and compositions for efficient base calling in sequencing reactions |
US11098356B2 (en) | 2008-01-28 | 2021-08-24 | Complete Genomics, Inc. | Methods and compositions for nucleic acid sequencing |
US8034568B2 (en) | 2008-02-12 | 2011-10-11 | Nugen Technologies, Inc. | Isothermal nucleic acid amplification methods and compositions |
US9624489B2 (en) | 2008-03-10 | 2017-04-18 | Illumina, Inc. | Methods for selecting and amplifying polynucleotides |
US10597653B2 (en) | 2008-03-10 | 2020-03-24 | Illumina, Inc. | Methods for selecting and amplifying polynucleotides |
US11142759B2 (en) | 2008-03-10 | 2021-10-12 | Illumina, Inc. | Method for selecting and amplifying polynucleotides |
US8999642B2 (en) | 2008-03-10 | 2015-04-07 | Illumina, Inc. | Methods for selecting and amplifying polynucleotides |
US7846666B2 (en) | 2008-03-21 | 2010-12-07 | Nugen Technologies, Inc. | Methods of RNA amplification in the presence of DNA |
USRE48219E1 (en) | 2008-05-05 | 2020-09-22 | Illumina, Inc. | Compensator for multiple surface imaging |
US8143599B2 (en) | 2008-05-05 | 2012-03-27 | Illumina, Inc. | Compensator for multiple surface imaging |
US8071962B1 (en) | 2008-05-05 | 2011-12-06 | Illumina, Inc. | Compensator for multiple surface imaging |
US8278630B1 (en) | 2008-05-05 | 2012-10-02 | Illumina, Inc. | Compensator for multiple surface imaging |
USRE48561E1 (en) | 2008-05-05 | 2021-05-18 | Illumina, Inc. | Compensator for multiple surface imaging |
US8586947B1 (en) | 2008-05-05 | 2013-11-19 | Illumina, Inc. | Compensator for multiple surface imaging |
US8039817B2 (en) | 2008-05-05 | 2011-10-18 | Illumina, Inc. | Compensator for multiple surface imaging |
USRE49884E1 (en) | 2008-05-05 | 2024-03-26 | Illumina, Inc. | Compensator for multiple surface imaging |
US9365898B2 (en) | 2008-05-05 | 2016-06-14 | Illumina, Inc. | Compensator for multiple surface imaging |
US8546772B2 (en) | 2008-05-05 | 2013-10-01 | Illumina, Inc. | Compensator for multiple surface imaging |
US8698102B2 (en) | 2008-05-05 | 2014-04-15 | Illumina, Inc. | Compensator for multiple surface imaging |
US8242463B2 (en) | 2008-05-05 | 2012-08-14 | Illumina, Inc. | Compensator for multiple surface imaging |
US9068220B2 (en) | 2008-05-05 | 2015-06-30 | Illumina, Inc. | Compensator for multiple surface imaging |
US11505795B2 (en) | 2008-09-12 | 2022-11-22 | University Of Washington | Error detection in sequence tag directed sequencing reads |
US10577601B2 (en) | 2008-09-12 | 2020-03-03 | University Of Washington | Error detection in sequence tag directed subassemblies of short sequencing reads |
US9243288B2 (en) | 2008-09-23 | 2016-01-26 | Bio-Rad Laboratories, Inc. | Cartridge with lysis chamber and droplet generator |
US9216392B2 (en) | 2008-09-23 | 2015-12-22 | Bio-Rad Laboratories, Inc. | System for forming an array of emulsions |
US11130134B2 (en) | 2008-09-23 | 2021-09-28 | Bio-Rad Laboratories, Inc. | Method of performing droplet-based assays |
US9417190B2 (en) | 2008-09-23 | 2016-08-16 | Bio-Rad Laboratories, Inc. | Calibrations and controls for droplet-based assays |
US9132394B2 (en) | 2008-09-23 | 2015-09-15 | Bio-Rad Laboratories, Inc. | System for detection of spaced droplets |
US9649635B2 (en) | 2008-09-23 | 2017-05-16 | Bio-Rad Laboratories, Inc. | System for generating droplets with push-back to remove oil |
US10279350B2 (en) | 2008-09-23 | 2019-05-07 | Bio-Rad Laboratories, Inc. | Method of generating droplets |
US9248417B2 (en) | 2008-09-23 | 2016-02-02 | Bio-Rad Laboratories, Inc. | System for droplet-based assays using an array of emulsions |
US11612892B2 (en) | 2008-09-23 | 2023-03-28 | Bio-Rad Laboratories, Inc. | Method of performing droplet-based assays |
US11130128B2 (en) | 2008-09-23 | 2021-09-28 | Bio-Rad Laboratories, Inc. | Detection method for a target nucleic acid |
US9636682B2 (en) | 2008-09-23 | 2017-05-02 | Bio-Rad Laboratories, Inc. | System for generating droplets—instruments and cassette |
US11633739B2 (en) | 2008-09-23 | 2023-04-25 | Bio-Rad Laboratories, Inc. | Droplet-based assay system |
US9492797B2 (en) | 2008-09-23 | 2016-11-15 | Bio-Rad Laboratories, Inc. | System for detection of spaced droplets |
US9126160B2 (en) | 2008-09-23 | 2015-09-08 | Bio-Rad Laboratories, Inc. | System for forming an array of emulsions |
US10512910B2 (en) | 2008-09-23 | 2019-12-24 | Bio-Rad Laboratories, Inc. | Droplet-based analysis method |
US10258989B2 (en) | 2008-09-23 | 2019-04-16 | Bio-Rad Laboratories, Inc. | Method of making a device for generating droplets |
US9623384B2 (en) | 2008-09-23 | 2017-04-18 | Bio-Rad Laboratories, Inc. | System for transporting emulsions from an array to a detector |
US9764322B2 (en) | 2008-09-23 | 2017-09-19 | Bio-Rad Laboratories, Inc. | System for generating droplets with pressure monitoring |
US10258988B2 (en) | 2008-09-23 | 2019-04-16 | Bio-Rad Laboratories, Inc. | Device for generating droplets |
US9156010B2 (en) | 2008-09-23 | 2015-10-13 | Bio-Rad Laboratories, Inc. | Droplet-based assay system |
FR2936246A1 (en) * | 2008-09-24 | 2010-03-26 | Haploys | New compound comprising a duplicable nucleic acid (amplified fragment), where compound comprises a means of locking of polymerization (loop linkage), useful e.g. in complex for diagnosing the amplification of the nucleic acids |
US11866780B2 (en) | 2008-10-02 | 2024-01-09 | Illumina Cambridge Limited | Nucleic acid sample enrichment for sequencing applications |
US9702002B2 (en) | 2008-10-02 | 2017-07-11 | Illumina, Inc. | Nucleic acid sample enrichment for sequencing applications |
US8728764B2 (en) | 2008-10-02 | 2014-05-20 | Illumina Cambridge Limited | Nucleic acid sample enrichment for sequencing applications |
WO2010062775A2 (en) | 2008-11-03 | 2010-06-03 | The Regents Of The University Of California | Methods for detecting modification resistant nucleic acids |
US8486865B2 (en) | 2008-11-03 | 2013-07-16 | The Regents Of The University Of California | Methods for detecting modification resistant nucleic acids |
US9677068B2 (en) | 2008-11-03 | 2017-06-13 | The Regents Of The University Of California | Methods for detecting modification resistant nucleic acids |
US9284547B2 (en) | 2008-11-03 | 2016-03-15 | The Regents Of The University Of California | Methods for detecting modification resistant nucleic acids |
US10266901B2 (en) | 2008-11-07 | 2019-04-23 | Adaptive Biotechnologies Corp. | Methods of monitoring conditions by sequence analysis |
US10246752B2 (en) | 2008-11-07 | 2019-04-02 | Adaptive Biotechnologies Corp. | Methods of monitoring conditions by sequence analysis |
US11021757B2 (en) | 2008-11-07 | 2021-06-01 | Adaptive Biotechnologies Corporation | Monitoring health and disease status using clonotype profiles |
US9528160B2 (en) | 2008-11-07 | 2016-12-27 | Adaptive Biotechnolgies Corp. | Rare clonotypes and uses thereof |
US9523129B2 (en) | 2008-11-07 | 2016-12-20 | Adaptive Biotechnologies Corp. | Sequence analysis of complex amplicons |
US9512487B2 (en) | 2008-11-07 | 2016-12-06 | Adaptive Biotechnologies Corp. | Monitoring health and disease status using clonotype profiles |
US9506119B2 (en) | 2008-11-07 | 2016-11-29 | Adaptive Biotechnologies Corp. | Method of sequence determination using sequence tags |
US10865453B2 (en) | 2008-11-07 | 2020-12-15 | Adaptive Biotechnologies Corporation | Monitoring health and disease status using clonotype profiles |
US10155992B2 (en) | 2008-11-07 | 2018-12-18 | Adaptive Biotechnologies Corp. | Monitoring health and disease status using clonotype profiles |
US10519511B2 (en) | 2008-11-07 | 2019-12-31 | Adaptive Biotechnologies Corporation | Monitoring health and disease status using clonotype profiles |
US11001895B2 (en) | 2008-11-07 | 2021-05-11 | Adaptive Biotechnologies Corporation | Methods of monitoring conditions by sequence analysis |
US9416420B2 (en) | 2008-11-07 | 2016-08-16 | Adaptive Biotechnologies Corp. | Monitoring health and disease status using clonotype profiles |
US9365901B2 (en) | 2008-11-07 | 2016-06-14 | Adaptive Biotechnologies Corp. | Monitoring immunoglobulin heavy chain evolution in B-cell acute lymphoblastic leukemia |
US9347099B2 (en) | 2008-11-07 | 2016-05-24 | Adaptive Biotechnologies Corp. | Single cell analysis by polymerase cycling assembly |
US10760133B2 (en) | 2008-11-07 | 2020-09-01 | Adaptive Biotechnologies Corporation | Monitoring health and disease status using clonotype profiles |
US10323276B2 (en) | 2009-01-15 | 2019-06-18 | Adaptive Biotechnologies Corporation | Adaptive immunity profiling and methods for generation of monoclonal antibodies |
US8986958B2 (en) | 2009-03-30 | 2015-03-24 | Life Technologies Corporation | Methods for generating target specific probes for solution based capture |
US11339432B2 (en) | 2009-04-30 | 2022-05-24 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
US9783847B2 (en) | 2009-04-30 | 2017-10-10 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
US11352665B2 (en) | 2009-04-30 | 2022-06-07 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
US10000800B2 (en) | 2009-04-30 | 2018-06-19 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
US11447822B2 (en) | 2009-04-30 | 2022-09-20 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
US10119165B2 (en) | 2009-04-30 | 2018-11-06 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
US10266883B2 (en) | 2009-04-30 | 2019-04-23 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
US10501793B2 (en) | 2009-04-30 | 2019-12-10 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
US10266884B2 (en) | 2009-04-30 | 2019-04-23 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
US11499187B2 (en) | 2009-04-30 | 2022-11-15 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
US11499188B2 (en) | 2009-04-30 | 2022-11-15 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
US11840730B1 (en) | 2009-04-30 | 2023-12-12 | Molecular Loop Biosciences, Inc. | Methods and compositions for evaluating genetic markers |
EP2248914A1 (en) | 2009-05-05 | 2010-11-10 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | The use of class IIB restriction endonucleases in 2nd generation sequencing applications |
US10329544B2 (en) | 2009-05-13 | 2019-06-25 | Life Technologies Corporation | Nucleic acid amplification |
US11905511B2 (en) | 2009-06-25 | 2024-02-20 | Fred Hutchinson Cancer Center | Method of measuring adaptive immunity |
US11214793B2 (en) | 2009-06-25 | 2022-01-04 | Fred Hutchinson Cancer Research Center | Method of measuring adaptive immunity |
US9809813B2 (en) | 2009-06-25 | 2017-11-07 | Fred Hutchinson Cancer Research Center | Method of measuring adaptive immunity |
US10036063B2 (en) | 2009-07-24 | 2018-07-31 | Illumina, Inc. | Method for sequencing a polynucleotide template |
EP2470669A1 (en) * | 2009-08-25 | 2012-07-04 | Illumina, Inc. | Methods for selecting and amplifying polynucleotides |
EP2669387A1 (en) | 2009-08-25 | 2013-12-04 | Illumina, Inc. | Methods for selecting and amplifying polynucleotides |
EP3133169A1 (en) | 2009-08-25 | 2017-02-22 | Illumina, Inc. | Methods for selecting and amplifying polynucleotides |
EP2470669A4 (en) * | 2009-08-25 | 2013-01-30 | Illumina Inc | Methods for selecting and amplifying polynucleotides |
US10166522B2 (en) | 2009-09-02 | 2019-01-01 | Bio-Rad Laboratories, Inc. | System for mixing fluids by coalescence of multiple emulsions |
US9194861B2 (en) | 2009-09-02 | 2015-11-24 | Bio-Rad Laboratories, Inc. | Method of mixing fluids by coalescence of multiple emulsions |
US10677693B2 (en) | 2009-09-02 | 2020-06-09 | Bio-Rad Laboratories, Inc. | System for mixing fluids by coalescence of multiple emulsions |
WO2011034690A3 (en) * | 2009-09-15 | 2011-06-16 | Illumina Cambridge, Ltd. | Centroid markers for image analysis of high density clusters in complex polynucleotide sequencing |
WO2011034690A2 (en) * | 2009-09-15 | 2011-03-24 | Illumina Cambridge, Ltd. | Centroid markers for image analysis of high density clusters in complex polynucleotide sequencing |
US8182994B2 (en) | 2009-09-15 | 2012-05-22 | Illumina Cambridge Limited | Centroid markers for image analysis of high denisty clusters in complex polynucleotide sequencing |
US9758825B2 (en) | 2009-09-15 | 2017-09-12 | Illumina Cambridge Limited | Centroid markers for image analysis of high density clusters in complex polynucleotide sequencing |
US8795971B2 (en) | 2009-09-15 | 2014-08-05 | Illumina Cambridge Limited | Centroid markers for image analysis of high density clusters in complex polynucleotide sequencing |
US8541172B2 (en) | 2009-09-15 | 2013-09-24 | Illumina Cambridge Limited | Method for sequencing a polynucelotide template |
WO2011071923A2 (en) | 2009-12-07 | 2011-06-16 | Illumina, Inc. | Multi-sample indexing for multiplex genotyping |
US11884975B2 (en) | 2010-01-19 | 2024-01-30 | Verinata Health, Inc. | Sequencing methods and compositions for prenatal diagnoses |
US10388403B2 (en) | 2010-01-19 | 2019-08-20 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
US9260745B2 (en) | 2010-01-19 | 2016-02-16 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US9657342B2 (en) | 2010-01-19 | 2017-05-23 | Verinata Health, Inc. | Sequencing methods for prenatal diagnoses |
US11286520B2 (en) | 2010-01-19 | 2022-03-29 | Verinata Health, Inc. | Method for determining copy number variations |
US9323888B2 (en) | 2010-01-19 | 2016-04-26 | Verinata Health, Inc. | Detecting and classifying copy number variation |
EP3492601A1 (en) | 2010-01-19 | 2019-06-05 | Verinata Health, Inc | Novel protocol for preparing sequencing libraries |
US11952623B2 (en) | 2010-01-19 | 2024-04-09 | Verinata Health, Inc. | Simultaneous determination of aneuploidy and fetal fraction |
US11697846B2 (en) | 2010-01-19 | 2023-07-11 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US10482993B2 (en) | 2010-01-19 | 2019-11-19 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
WO2011090559A1 (en) | 2010-01-19 | 2011-07-28 | Verinata Health, Inc. | Sequencing methods and compositions for prenatal diagnoses |
US10612096B2 (en) | 2010-01-19 | 2020-04-07 | Verinata Health, Inc. | Methods for determining fraction of fetal nucleic acids in maternal samples |
US9115401B2 (en) | 2010-01-19 | 2015-08-25 | Verinata Health, Inc. | Partition defined detection methods |
EP3260555A1 (en) | 2010-01-19 | 2017-12-27 | Verinata Health, Inc | Novel protocol for preparing sequencing libraries |
US11130995B2 (en) | 2010-01-19 | 2021-09-28 | Verinata Health, Inc. | Simultaneous determination of aneuploidy and fetal fraction |
US10662474B2 (en) | 2010-01-19 | 2020-05-26 | Verinata Health, Inc. | Identification of polymorphic sequences in mixtures of genomic DNA by whole genome sequencing |
US9493828B2 (en) | 2010-01-19 | 2016-11-15 | Verinata Health, Inc. | Methods for determining fraction of fetal nucleic acids in maternal samples |
US10586610B2 (en) | 2010-01-19 | 2020-03-10 | Verinata Health, Inc. | Detecting and classifying copy number variation |
EP4074838A1 (en) | 2010-01-19 | 2022-10-19 | Verinata Health, Inc. | Novel protocol for preparing sequencing libraries |
US10415089B2 (en) | 2010-01-19 | 2019-09-17 | Verinata Health, Inc. | Detecting and classifying copy number variation |
WO2011091046A1 (en) | 2010-01-19 | 2011-07-28 | Verinata Health, Inc. | Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing |
US11875899B2 (en) | 2010-01-19 | 2024-01-16 | Verinata Health, Inc. | Analyzing copy number variation in the detection of cancer |
US10941442B2 (en) | 2010-01-19 | 2021-03-09 | Verinata Health, Inc. | Sequencing methods and compositions for prenatal diagnoses |
US9493831B2 (en) | 2010-01-23 | 2016-11-15 | Verinata Health, Inc. | Methods of fetal abnormality detection |
US10718020B2 (en) | 2010-01-23 | 2020-07-21 | Verinata Health, Inc. | Methods of fetal abnormality detection |
US8318430B2 (en) | 2010-01-23 | 2012-11-27 | Verinata Health, Inc. | Methods of fetal abnormality detection |
US11866771B2 (en) | 2010-03-02 | 2024-01-09 | Bio-Rad Laboratories, Inc. | Emulsion chemistry for encapsulated droplets |
US11060136B2 (en) | 2010-03-02 | 2021-07-13 | Bio-Rad Laboratories, Inc. | Emulsion chemistry for encapsulated droplets |
US10378048B2 (en) | 2010-03-02 | 2019-08-13 | Bio-Rad Laboratories, Inc. | Emulsion chemistry for encapsulated droplets |
US9598725B2 (en) | 2010-03-02 | 2017-03-21 | Bio-Rad Laboratories, Inc. | Emulsion chemistry for encapsulated droplets |
US9500664B2 (en) | 2010-03-25 | 2016-11-22 | Bio-Rad Laboratories, Inc. | Droplet generation for droplet-based assays |
US10272432B2 (en) | 2010-03-25 | 2019-04-30 | Bio-Rad Laboratories, Inc. | Device for generating droplets |
US9393560B2 (en) | 2010-03-25 | 2016-07-19 | Bio-Rad Laboratories, Inc. | Droplet transport system for detection |
US10099219B2 (en) | 2010-03-25 | 2018-10-16 | Bio-Rad Laboratories, Inc. | Device for generating droplets |
US10744506B2 (en) | 2010-03-25 | 2020-08-18 | Bio-Rad Laboratories, Inc. | Device for generating droplets |
US11208684B2 (en) | 2010-04-05 | 2021-12-28 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11733238B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10494667B2 (en) | 2010-04-05 | 2019-12-03 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11732292B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays correlating target nucleic acid to tissue section location |
US11634756B2 (en) | 2010-04-05 | 2023-04-25 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10480022B2 (en) | 2010-04-05 | 2019-11-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10472669B2 (en) | 2010-04-05 | 2019-11-12 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11761030B2 (en) | 2010-04-05 | 2023-09-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11767550B2 (en) | 2010-04-05 | 2023-09-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11560587B2 (en) | 2010-04-05 | 2023-01-24 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11549138B2 (en) | 2010-04-05 | 2023-01-10 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11542543B2 (en) | 2010-04-05 | 2023-01-03 | Prognosys Biosciences, Inc. | System for analyzing targets of a tissue section |
US11519022B2 (en) | 2010-04-05 | 2022-12-06 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10612079B2 (en) | 2010-04-05 | 2020-04-07 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11866770B2 (en) | 2010-04-05 | 2024-01-09 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10619196B1 (en) | 2010-04-05 | 2020-04-14 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11479810B1 (en) | 2010-04-05 | 2022-10-25 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10662467B2 (en) | 2010-04-05 | 2020-05-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10662468B2 (en) | 2010-04-05 | 2020-05-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11401545B2 (en) | 2010-04-05 | 2022-08-02 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11384386B2 (en) | 2010-04-05 | 2022-07-12 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11371086B2 (en) | 2010-04-05 | 2022-06-28 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11365442B2 (en) | 2010-04-05 | 2022-06-21 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11313856B2 (en) | 2010-04-05 | 2022-04-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11293917B2 (en) | 2010-04-05 | 2022-04-05 | Prognosys Biosciences, Inc. | Systems for analyzing target biological molecules via sample imaging and delivery of probes to substrate wells |
US10787701B2 (en) | 2010-04-05 | 2020-09-29 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10983113B2 (en) | 2010-04-05 | 2021-04-20 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10308982B2 (en) | 2010-04-05 | 2019-06-04 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11156603B2 (en) | 2010-04-05 | 2021-10-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10914730B2 (en) | 2010-04-05 | 2021-02-09 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11067567B2 (en) | 2010-04-05 | 2021-07-20 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10961566B2 (en) | 2010-04-05 | 2021-03-30 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10962532B2 (en) | 2010-04-05 | 2021-03-30 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11008607B2 (en) | 2010-04-05 | 2021-05-18 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11001879B1 (en) | 2010-04-05 | 2021-05-11 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10982268B2 (en) | 2010-04-05 | 2021-04-20 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11001878B1 (en) | 2010-04-05 | 2021-05-11 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US10996219B2 (en) | 2010-04-05 | 2021-05-04 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
US11332793B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11939634B2 (en) | 2010-05-18 | 2024-03-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11111545B2 (en) | 2010-05-18 | 2021-09-07 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11306357B2 (en) | 2010-05-18 | 2022-04-19 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11312996B2 (en) | 2010-05-18 | 2022-04-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11746376B2 (en) | 2010-05-18 | 2023-09-05 | Natera, Inc. | Methods for amplification of cell-free DNA using ligated adaptors and universal and inner target-specific primers for multiplexed nested PCR |
US11286530B2 (en) | 2010-05-18 | 2022-03-29 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11525162B2 (en) | 2010-05-18 | 2022-12-13 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11339429B2 (en) | 2010-05-18 | 2022-05-24 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11519035B2 (en) | 2010-05-18 | 2022-12-06 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11332785B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11326208B2 (en) | 2010-05-18 | 2022-05-10 | Natera, Inc. | Methods for nested PCR amplification of cell-free DNA |
US11408031B2 (en) | 2010-05-18 | 2022-08-09 | Natera, Inc. | Methods for non-invasive prenatal paternity testing |
US11482300B2 (en) | 2010-05-18 | 2022-10-25 | Natera, Inc. | Methods for preparing a DNA fraction from a biological sample for analyzing genotypes of cell-free DNA |
US11322224B2 (en) | 2010-05-18 | 2022-05-03 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US9029103B2 (en) | 2010-08-27 | 2015-05-12 | Illumina Cambridge Limited | Methods for sequencing polynucleotides |
US10329613B2 (en) | 2010-08-27 | 2019-06-25 | Illumina Cambridge Limited | Methods for sequencing polynucleotides |
US11279975B2 (en) | 2010-08-27 | 2022-03-22 | Illumina Cambridge Limited | Methods for sequencing polynucleotides |
EP3205730A1 (en) | 2010-08-27 | 2017-08-16 | Illumina Cambridge Limited | Methods for paired-end sequencing of polynucleotides |
WO2012025250A1 (en) | 2010-08-27 | 2012-03-01 | Illumina Cambridge Ltd. | Methods for paired - end sequencing of polynucleotides |
WO2012050920A1 (en) | 2010-09-29 | 2012-04-19 | Illumina, Inc. | Compositions and methods for sequencing nucleic acids |
US9902950B2 (en) | 2010-10-08 | 2018-02-27 | President And Fellows Of Harvard College | High-throughput single cell barcoding |
US11396651B2 (en) | 2010-10-08 | 2022-07-26 | President And Fellows Of Harvard College | High-throughput single cell barcoding |
GB2512213A (en) * | 2010-10-08 | 2014-09-24 | Harvard College | High-throughput single cell barcoding |
GB2512213B (en) * | 2010-10-08 | 2015-02-11 | Harvard College | High-throughput single cell barcoding |
GB2497912B (en) * | 2010-10-08 | 2014-06-04 | Harvard College | High-throughput single cell barcoding |
US10752895B2 (en) | 2010-10-08 | 2020-08-25 | President And Fellows Of Harvard College | High-throughput single cell barcoding |
US10246703B2 (en) | 2010-10-08 | 2019-04-02 | President And Fellows Of Harvard College | High-throughput single cell barcoding |
WO2012055929A1 (en) | 2010-10-26 | 2012-05-03 | Illumina, Inc. | Sequencing methods |
US11332774B2 (en) | 2010-10-26 | 2022-05-17 | Verinata Health, Inc. | Method for determining copy number variations |
US9089844B2 (en) | 2010-11-01 | 2015-07-28 | Bio-Rad Laboratories, Inc. | System for forming emulsions |
WO2012061036A1 (en) | 2010-11-03 | 2012-05-10 | Illumina, Inc. | Reducing adapter dimer formation |
US9506055B2 (en) | 2010-11-03 | 2016-11-29 | Illumina, Inc. | Reducing adapter dimer formation |
US10233443B2 (en) | 2010-11-03 | 2019-03-19 | Illumina, Inc. | Reducing adapter dimer formation |
US8575071B2 (en) | 2010-11-03 | 2013-11-05 | Illumina, Inc. | Reducing adapter dimer formation |
US9284604B2 (en) | 2010-11-22 | 2016-03-15 | The Regents Of The University Of California | Methods of identifying a cellular nascent RNA transcript |
US9309558B2 (en) | 2010-12-17 | 2016-04-12 | Life Technologies Corporation | Nucleic acid amplification |
US11578360B2 (en) | 2010-12-17 | 2023-02-14 | Life Technologies Corporation | Methods, compositions, systems, apparatuses and kits for nucleic acid amplification |
US9371557B2 (en) | 2010-12-17 | 2016-06-21 | Life Technologies Corporation | Nucleic acid amplification |
US10233488B2 (en) | 2010-12-17 | 2019-03-19 | Life Technologies Corporation | Clonal amplification of nucleic acid on solid surface with template walking |
US10858695B2 (en) | 2010-12-17 | 2020-12-08 | Life Technologies Corporation | Nucleic acid amplification |
EP3564392A1 (en) * | 2010-12-17 | 2019-11-06 | Life Technologies Corporation | Methods for nucleic acid amplification |
US10113195B2 (en) | 2010-12-17 | 2018-10-30 | Life Technologies Corporation | Nucleic acid amplification |
US9309557B2 (en) | 2010-12-17 | 2016-04-12 | Life Technologies Corporation | Nucleic acid amplification |
US10913976B2 (en) | 2010-12-17 | 2021-02-09 | Life Technologies Corporation | Methods, compositions, systems, apparatuses and kits for nucleic acid amplification |
US9309566B2 (en) | 2010-12-17 | 2016-04-12 | Life Technologies Corporation | Methods, compositions, systems, apparatuses and kits for nucleic acid amplification |
US9476080B2 (en) | 2010-12-17 | 2016-10-25 | Life Technologies Corporation | Clonal amplification of nucleic acid on solid surface with template walking |
US9334531B2 (en) | 2010-12-17 | 2016-05-10 | Life Technologies Corporation | Nucleic acid amplification |
US11725195B2 (en) | 2010-12-17 | 2023-08-15 | Life Technologies Corporation | Nucleic acid amplification |
US11001815B2 (en) | 2010-12-17 | 2021-05-11 | Life Technologies Corporation | Nucleic acid amplification |
US11768200B2 (en) | 2010-12-23 | 2023-09-26 | Molecular Loop Biosciences, Inc. | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
US11041851B2 (en) | 2010-12-23 | 2021-06-22 | Molecular Loop Biosciences, Inc. | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
US11041852B2 (en) | 2010-12-23 | 2021-06-22 | Molecular Loop Biosciences, Inc. | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
US8951781B2 (en) | 2011-01-10 | 2015-02-10 | Illumina, Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
US11697116B2 (en) | 2011-01-10 | 2023-07-11 | Illumina, Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
EP3714978A1 (en) | 2011-01-10 | 2020-09-30 | Illumina, Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
WO2012096703A1 (en) | 2011-01-10 | 2012-07-19 | Illumina, Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
US11559805B2 (en) | 2011-01-10 | 2023-01-24 | Illumina, Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
EP3378564A1 (en) | 2011-01-10 | 2018-09-26 | Illumina Inc. | Fluidic device holder |
US11938479B2 (en) | 2011-01-10 | 2024-03-26 | Illumina, Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
US10220386B2 (en) | 2011-01-10 | 2019-03-05 | Illumina, Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
US11117130B2 (en) | 2011-01-10 | 2021-09-14 | Illumina, Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
US10457936B2 (en) | 2011-02-02 | 2019-10-29 | University Of Washington Through Its Center For Commercialization | Massively parallel contiguity mapping |
US11299730B2 (en) | 2011-02-02 | 2022-04-12 | University Of Washington Through Its Center For Commercialization | Massively parallel contiguity mapping |
US11999951B2 (en) | 2011-02-02 | 2024-06-04 | University Of Washington Through Its Center For Commercialization | Massively parallel contiguity mapping |
US20130344540A1 (en) * | 2011-02-03 | 2013-12-26 | Mark T. Reed | Methods for minimizing sequence specific bias |
US11993772B2 (en) | 2011-02-10 | 2024-05-28 | Illumina, Inc. | Linking sequence reads using paired code tags |
US10246705B2 (en) | 2011-02-10 | 2019-04-02 | Ilumina, Inc. | Linking sequence reads using paired code tags |
US9222128B2 (en) | 2011-03-18 | 2015-12-29 | Bio-Rad Laboratories, Inc. | Multiplexed digital assays with combinatorial use of signals |
US9447453B2 (en) | 2011-04-12 | 2016-09-20 | Verinata Health, Inc. | Resolving genome fractions using polymorphism counts |
US10658070B2 (en) | 2011-04-12 | 2020-05-19 | Verinata Health, Inc. | Resolving genome fractions using polymorphism counts |
US11479809B2 (en) | 2011-04-13 | 2022-10-25 | Spatial Transcriptomics Ab | Methods of detecting analytes |
US11795498B2 (en) | 2011-04-13 | 2023-10-24 | 10X Genomics Sweden Ab | Methods of detecting analytes |
US11352659B2 (en) | 2011-04-13 | 2022-06-07 | Spatial Transcriptomics Ab | Methods of detecting analytes |
US11788122B2 (en) | 2011-04-13 | 2023-10-17 | 10X Genomics Sweden Ab | Methods of detecting analytes |
US8532936B2 (en) | 2011-04-14 | 2013-09-10 | Verinata Health, Inc. | Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies |
US9411937B2 (en) | 2011-04-15 | 2016-08-09 | Verinata Health, Inc. | Detecting and classifying copy number variation |
US10190115B2 (en) | 2011-04-25 | 2019-01-29 | Bio-Rad Laboratories, Inc. | Methods and compositions for nucleic acid analysis |
US10760073B2 (en) | 2011-04-25 | 2020-09-01 | Bio-Rad Laboratories, Inc. | Methods and compositions for nucleic acid analysis |
US11939573B2 (en) | 2011-04-25 | 2024-03-26 | Bio-Rad Laboratories, Inc. | Methods and compositions for nucleic acid analysis |
US9885034B2 (en) | 2011-04-25 | 2018-02-06 | Bio-Rad Laboratories, Inc. | Methods and compositions for nucleic acid analysis |
US9347059B2 (en) | 2011-04-25 | 2016-05-24 | Bio-Rad Laboratories, Inc. | Methods and compositions for nucleic acid analysis |
US8951939B2 (en) | 2011-07-12 | 2015-02-10 | Bio-Rad Laboratories, Inc. | Digital assays with multiplexed detection of two or more targets in the same optical channel |
US20150099642A1 (en) * | 2011-07-21 | 2015-04-09 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Methods and devices for dna sequencing and molecular diagnostics |
US9670540B2 (en) * | 2011-07-21 | 2017-06-06 | Cornell University | Methods and devices for DNA sequencing and molecular diagnostics |
US10385475B2 (en) | 2011-09-12 | 2019-08-20 | Adaptive Biotechnologies Corp. | Random array sequencing of low-complexity libraries |
EP3290528A1 (en) | 2011-09-23 | 2018-03-07 | Illumina, Inc. | Methods and compositions for nucleic acid sequencing |
EP3981886A1 (en) | 2011-09-23 | 2022-04-13 | Illumina, Inc. | Compositions for nucleic acid sequencing |
EP3623481A1 (en) | 2011-09-23 | 2020-03-18 | Illumina, Inc. | Methods and compositions for nucleic acid sequencing |
WO2013044018A1 (en) | 2011-09-23 | 2013-03-28 | Illumina, Inc. | Methods and compositions for nucleic acid sequencing |
WO2013049135A1 (en) | 2011-09-26 | 2013-04-04 | Gen-Probe Incorporated | Algorithms for sequence determinations |
US9822409B2 (en) | 2011-10-17 | 2017-11-21 | Good Start Genetics, Inc. | Analysis methods |
US10370710B2 (en) | 2011-10-17 | 2019-08-06 | Good Start Genetics, Inc. | Analysis methods |
US9228233B2 (en) | 2011-10-17 | 2016-01-05 | Good Start Genetics, Inc. | Analysis methods |
US9206418B2 (en) | 2011-10-19 | 2015-12-08 | Nugen Technologies, Inc. | Compositions and methods for directional nucleic acid amplification and sequencing |
US9181590B2 (en) | 2011-10-21 | 2015-11-10 | Adaptive Biotechnologies Corporation | Quantification of adaptive immune cell genomes in a complex mixture of cells |
US9279159B2 (en) | 2011-10-21 | 2016-03-08 | Adaptive Biotechnologies Corporation | Quantification of adaptive immune cell genomes in a complex mixture of cells |
US11286522B2 (en) | 2011-12-01 | 2022-03-29 | Genapsys, Inc. | Systems and methods for high efficiency electronic sequencing and detection |
US9824179B2 (en) | 2011-12-09 | 2017-11-21 | Adaptive Biotechnologies Corp. | Diagnosis of lymphoid malignancies and minimal residual disease detection |
US9499865B2 (en) | 2011-12-13 | 2016-11-22 | Adaptive Biotechnologies Corp. | Detection and measurement of tissue-infiltrating lymphocytes |
US10704091B2 (en) | 2012-01-13 | 2020-07-07 | Data2Bio | Genotyping by next-generation sequencing |
US9951384B2 (en) | 2012-01-13 | 2018-04-24 | Data2Bio | Genotyping by next-generation sequencing |
US10036012B2 (en) | 2012-01-26 | 2018-07-31 | Nugen Technologies, Inc. | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation |
US9650628B2 (en) | 2012-01-26 | 2017-05-16 | Nugen Technologies, Inc. | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library regeneration |
US10876108B2 (en) | 2012-01-26 | 2020-12-29 | Nugen Technologies, Inc. | Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation |
WO2013117595A2 (en) | 2012-02-07 | 2013-08-15 | Illumina Cambridge Limited | Targeted enrichment and amplification of nucleic acids on a support |
WO2013123442A1 (en) | 2012-02-17 | 2013-08-22 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
US11441180B2 (en) | 2012-02-17 | 2022-09-13 | Fred Hutchinson Cancer Center | Compositions and methods for accurately identifying mutations |
EP3363901A1 (en) | 2012-02-17 | 2018-08-22 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
US10450606B2 (en) | 2012-02-17 | 2019-10-22 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
EP2814959B1 (en) | 2012-02-17 | 2018-01-17 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
EP3854873A1 (en) | 2012-02-17 | 2021-07-28 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
US10011871B2 (en) | 2012-02-17 | 2018-07-03 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
EP3363901B1 (en) | 2012-02-17 | 2020-12-30 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
US10077478B2 (en) | 2012-03-05 | 2018-09-18 | Adaptive Biotechnologies Corp. | Determining paired immune receptor chains from frequency matched subunits |
EP3037552A1 (en) | 2012-03-06 | 2016-06-29 | Illumina Cambridge Limited | Improved methods of nucleic acid sequencing |
WO2013131962A1 (en) | 2012-03-06 | 2013-09-12 | Illumina Cambridge Limited | Improved methods of nucleic acid sequencing |
WO2013148970A1 (en) | 2012-03-30 | 2013-10-03 | Illumina, Inc. | Methods and systems for determining fetal chromosomal abnormalities |
US11149308B2 (en) | 2012-04-04 | 2021-10-19 | Invitae Corporation | Sequence assembly |
US10604799B2 (en) | 2012-04-04 | 2020-03-31 | Molecular Loop Biosolutions, Llc | Sequence assembly |
US11155863B2 (en) | 2012-04-04 | 2021-10-26 | Invitae Corporation | Sequence assembly |
US11667965B2 (en) | 2012-04-04 | 2023-06-06 | Invitae Corporation | Sequence assembly |
US8812422B2 (en) | 2012-04-09 | 2014-08-19 | Good Start Genetics, Inc. | Variant database |
US9298804B2 (en) | 2012-04-09 | 2016-03-29 | Good Start Genetics, Inc. | Variant database |
US9399215B2 (en) | 2012-04-13 | 2016-07-26 | Bio-Rad Laboratories, Inc. | Sample holder with a well having a wicking promoter |
US10227635B2 (en) | 2012-04-16 | 2019-03-12 | Molecular Loop Biosolutions, Llc | Capture reactions |
US10894977B2 (en) | 2012-05-08 | 2021-01-19 | Adaptive Biotechnologies Corporation | Compositions and methods for measuring and calibrating amplification bias in multiplexed PCR reactions |
US9150905B2 (en) | 2012-05-08 | 2015-10-06 | Adaptive Biotechnologies Corporation | Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions |
US9371558B2 (en) | 2012-05-08 | 2016-06-21 | Adaptive Biotechnologies Corp. | Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions |
US10214770B2 (en) | 2012-05-08 | 2019-02-26 | Adaptive Biotechnologies Corp. | Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions |
US10266891B2 (en) | 2012-06-08 | 2019-04-23 | Illumina, Inc. | Polymer coatings |
US11702694B2 (en) | 2012-06-08 | 2023-07-18 | Illumina, Inc. | Polymer coatings |
US9012022B2 (en) | 2012-06-08 | 2015-04-21 | Illumina, Inc. | Polymer coatings |
US10954561B2 (en) | 2012-06-08 | 2021-03-23 | Illumina, Inc. | Polymer coatings |
US9752186B2 (en) | 2012-06-08 | 2017-09-05 | Illumina, Inc. | Polymer coatings |
US9957549B2 (en) | 2012-06-18 | 2018-05-01 | Nugen Technologies, Inc. | Compositions and methods for negative selection of non-desired nucleic acid sequences |
WO2013191775A2 (en) | 2012-06-18 | 2013-12-27 | Nugen Technologies, Inc. | Compositions and methods for negative selection of non-desired nucleic acid sequences |
WO2014008448A1 (en) | 2012-07-03 | 2014-01-09 | Sloan Kettering Institute For Cancer Research | Quantitative assessment of human t-cell repertoire recovery after allogeneic hematopoietic stem cell transplantation |
US11697843B2 (en) | 2012-07-09 | 2023-07-11 | Tecan Genomics, Inc. | Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing |
US11028430B2 (en) | 2012-07-09 | 2021-06-08 | Nugen Technologies, Inc. | Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing |
EP3243937A1 (en) | 2012-07-17 | 2017-11-15 | Counsyl, Inc. | System and methods for detecting genetic variation |
WO2014013218A1 (en) | 2012-07-18 | 2014-01-23 | Illumina Cambridge Limited | Methods and systems for determining haplotypes and phasing of haplotypes |
US10221461B2 (en) | 2012-10-01 | 2019-03-05 | Adaptive Biotechnologies Corp. | Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization |
US11180813B2 (en) | 2012-10-01 | 2021-11-23 | Adaptive Biotechnologies Corporation | Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization |
US10150996B2 (en) | 2012-10-19 | 2018-12-11 | Adaptive Biotechnologies Corp. | Quantification of adaptive immune cell genomes in a complex mixture of cells |
US9092401B2 (en) | 2012-10-31 | 2015-07-28 | Counsyl, Inc. | System and methods for detecting genetic variation |
US10988760B2 (en) | 2013-01-09 | 2021-04-27 | Illumina Cambridge Limited | Sample preparation on a solid support |
US11970695B2 (en) | 2013-01-09 | 2024-04-30 | Illumina Cambridge Limited | Sample preparation on a solid support |
US10041066B2 (en) | 2013-01-09 | 2018-08-07 | Illumina Cambridge Limited | Sample preparation on a solid support |
CN104968805A (en) * | 2013-01-09 | 2015-10-07 | 伊鲁米纳剑桥有限公司 | Sample preparation on a solid support |
EP3486331A1 (en) * | 2013-01-09 | 2019-05-22 | Illumina Cambridge Limited | Sample preparation on a solid support |
KR20220093268A (en) * | 2013-01-09 | 2022-07-05 | 일루미나 케임브리지 리미티드 | Sample preparation on a solid support |
WO2014108810A3 (en) * | 2013-01-09 | 2014-12-04 | Illumina Cambridge Limited | Sample preparation on a solid support |
CN104968805B (en) * | 2013-01-09 | 2017-03-15 | 伊鲁米纳剑桥有限公司 | Sample preparation on solid support |
KR102602143B1 (en) | 2013-01-09 | 2023-11-13 | 일루미나 케임브리지 리미티드 | Sample preparation on a solid support |
WO2014108850A2 (en) | 2013-01-09 | 2014-07-17 | Yeda Research And Development Co. Ltd. | High throughput transcriptome analysis |
US9683230B2 (en) | 2013-01-09 | 2017-06-20 | Illumina Cambridge Limited | Sample preparation on a solid support |
WO2014135223A1 (en) | 2013-03-08 | 2014-09-12 | Illumina Cambridge Ltd | Rhodamine compounds and their use as fluorescent labels |
WO2014135221A1 (en) | 2013-03-08 | 2014-09-12 | Illumina Cambridge Ltd | Polymethine compounds and their use as fluorescent labels |
US10557133B2 (en) | 2013-03-13 | 2020-02-11 | Illumina, Inc. | Methods and compositions for nucleic acid sequencing |
US11319534B2 (en) | 2013-03-13 | 2022-05-03 | Illumina, Inc. | Methods and compositions for nucleic acid sequencing |
US9677124B2 (en) | 2013-03-14 | 2017-06-13 | Good Start Genetics, Inc. | Methods for analyzing nucleic acids |
US10202637B2 (en) | 2013-03-14 | 2019-02-12 | Molecular Loop Biosolutions, Llc | Methods for analyzing nucleic acid |
US9115387B2 (en) | 2013-03-14 | 2015-08-25 | Good Start Genetics, Inc. | Methods for analyzing nucleic acids |
US9822408B2 (en) | 2013-03-15 | 2017-11-21 | Nugen Technologies, Inc. | Sequential sequencing |
US10876107B2 (en) | 2013-03-15 | 2020-12-29 | Abvitro Llc | Single cell bar-coding for antibody discovery |
US10619206B2 (en) | 2013-03-15 | 2020-04-14 | Tecan Genomics | Sequential sequencing |
US10047359B2 (en) | 2013-03-15 | 2018-08-14 | Illumina, Inc. | Methods for producing stranded cDNA libraries |
US11118176B2 (en) | 2013-03-15 | 2021-09-14 | Abvitro Llc | Single cell bar-coding for antibody discovery |
US10392614B2 (en) | 2013-03-15 | 2019-08-27 | Abvitro Llc | Methods of single-cell barcoding and sequencing |
US9255265B2 (en) | 2013-03-15 | 2016-02-09 | Illumina, Inc. | Methods for producing stranded cDNA libraries |
US9816088B2 (en) | 2013-03-15 | 2017-11-14 | Abvitro Llc | Single cell bar-coding for antibody discovery |
WO2014150435A1 (en) | 2013-03-15 | 2014-09-25 | Illumina, Inc. | METHODS FOR PRODUCING STRANDED cDNA LIBRARIES |
US10760123B2 (en) | 2013-03-15 | 2020-09-01 | Nugen Technologies, Inc. | Sequential sequencing |
US10119134B2 (en) | 2013-03-15 | 2018-11-06 | Abvitro Llc | Single cell bar-coding for antibody discovery |
US9535920B2 (en) | 2013-06-03 | 2017-01-03 | Good Start Genetics, Inc. | Methods and systems for storing sequence read data |
US10706017B2 (en) | 2013-06-03 | 2020-07-07 | Good Start Genetics, Inc. | Methods and systems for storing sequence read data |
US11286515B2 (en) | 2013-06-25 | 2022-03-29 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
US11046996B1 (en) | 2013-06-25 | 2021-06-29 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
US11821024B2 (en) | 2013-06-25 | 2023-11-21 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
US11753674B2 (en) | 2013-06-25 | 2023-09-12 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
US10774372B2 (en) | 2013-06-25 | 2020-09-15 | Prognosy s Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
US11618918B2 (en) | 2013-06-25 | 2023-04-04 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
US10927403B2 (en) | 2013-06-25 | 2021-02-23 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
US11359228B2 (en) | 2013-06-25 | 2022-06-14 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
US10526650B2 (en) | 2013-07-01 | 2020-01-07 | Adaptive Biotechnologies Corporation | Method for genotyping clonotype profiles using sequence tags |
US10077473B2 (en) | 2013-07-01 | 2018-09-18 | Adaptive Biotechnologies Corp. | Method for genotyping clonotype profiles using sequence tags |
US9708657B2 (en) | 2013-07-01 | 2017-07-18 | Adaptive Biotechnologies Corp. | Method for generating clonotype profiles using sequence tags |
US11274351B2 (en) | 2013-07-25 | 2022-03-15 | Dch Molecular Diagnostics, Inc. | Methods and compositions for detecting bacterial contamination |
WO2015013465A2 (en) | 2013-07-25 | 2015-01-29 | Dch Molecular Diagnostics, Inc. | Methods and compositions for detecting bacterial contamination |
US10392670B2 (en) | 2013-07-25 | 2019-08-27 | Dch Molecular Diagnostics, Inc. | Methods and compositions for detecting bacterial contamination |
US10486153B2 (en) | 2013-09-27 | 2019-11-26 | Illumina, Inc. | Method to produce chemical pattern in micro-fluidic structure |
US11298697B2 (en) | 2013-09-27 | 2022-04-12 | Illumina, Inc. | Method to produce chemical pattern in micro-fluidic structure |
US11041203B2 (en) | 2013-10-18 | 2021-06-22 | Molecular Loop Biosolutions, Inc. | Methods for assessing a genomic region of a subject |
US10851414B2 (en) | 2013-10-18 | 2020-12-01 | Good Start Genetics, Inc. | Methods for determining carrier status |
US11098357B2 (en) | 2013-11-13 | 2021-08-24 | Tecan Genomics, Inc. | Compositions and methods for identification of a duplicate sequencing read |
US10570448B2 (en) | 2013-11-13 | 2020-02-25 | Tecan Genomics | Compositions and methods for identification of a duplicate sequencing read |
US11725241B2 (en) | 2013-11-13 | 2023-08-15 | Tecan Genomics, Inc. | Compositions and methods for identification of a duplicate sequencing read |
US10391467B2 (en) | 2013-12-05 | 2019-08-27 | Centrillion Technology Holdings Corporation | Fabrication of patterned arrays |
US10597715B2 (en) | 2013-12-05 | 2020-03-24 | Centrillion Technology Holdings | Methods for sequencing nucleic acids |
US10385335B2 (en) * | 2013-12-05 | 2019-08-20 | Centrillion Technology Holdings Corporation | Modified surfaces |
US11597973B2 (en) | 2013-12-11 | 2023-03-07 | Accuragen Holdings Limited | Compositions and methods for detecting rare sequence variants |
EP3495506A1 (en) | 2013-12-11 | 2019-06-12 | AccuraGen Holdings Limited | Methods for detecting rare sequence variants |
US10767222B2 (en) | 2013-12-11 | 2020-09-08 | Accuragen Holdings Limited | Compositions and methods for detecting rare sequence variants |
US11286519B2 (en) | 2013-12-11 | 2022-03-29 | Accuragen Holdings Limited | Methods and compositions for enrichment of amplification products |
US11859246B2 (en) | 2013-12-11 | 2024-01-02 | Accuragen Holdings Limited | Methods and compositions for enrichment of amplification products |
US10246746B2 (en) | 2013-12-20 | 2019-04-02 | Illumina, Inc. | Preserving genomic connectivity information in fragmented genomic DNA samples |
US11149310B2 (en) | 2013-12-20 | 2021-10-19 | Illumina, Inc. | Preserving genomic connectivity information in fragmented genomic DNA samples |
US10537889B2 (en) | 2013-12-31 | 2020-01-21 | Illumina, Inc. | Addressable flow cell using patterned electrodes |
WO2015103225A1 (en) | 2013-12-31 | 2015-07-09 | Illumina, Inc. | Addressable flow cell using patterned electrodes |
US9926598B2 (en) | 2014-01-16 | 2018-03-27 | Illumina, Inc. | Amplicon preparation and sequencing on solid supports |
AU2014377537B2 (en) * | 2014-01-16 | 2021-02-25 | Illumina, Inc. | Amplicon preparation and sequencing on solid supports |
WO2015108663A1 (en) | 2014-01-16 | 2015-07-23 | Illumina, Inc. | Amplicon preparation and sequencing on solid supports |
US10865444B2 (en) | 2014-01-16 | 2020-12-15 | Illumina, Inc. | Amplicon preparation and sequencing on solid supports |
US9745614B2 (en) | 2014-02-28 | 2017-08-29 | Nugen Technologies, Inc. | Reduced representation bisulfite sequencing with diversity adaptors |
US11248253B2 (en) | 2014-03-05 | 2022-02-15 | Adaptive Biotechnologies Corporation | Methods using randomer-containing synthetic molecules |
EP2921556A1 (en) | 2014-03-21 | 2015-09-23 | Lexogen GmbH | Copy number preserving RNA analysis method |
US11060139B2 (en) | 2014-03-28 | 2021-07-13 | Centrillion Technology Holdings Corporation | Methods for sequencing nucleic acids |
US10435745B2 (en) | 2014-04-01 | 2019-10-08 | Adaptive Biotechnologies Corp. | Determining antigen-specific T-cells |
US10066265B2 (en) | 2014-04-01 | 2018-09-04 | Adaptive Biotechnologies Corp. | Determining antigen-specific t-cells |
US11261490B2 (en) | 2014-04-01 | 2022-03-01 | Adaptive Biotechnologies Corporation | Determining antigen-specific T-cells |
US11371100B2 (en) | 2014-04-21 | 2022-06-28 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11390916B2 (en) | 2014-04-21 | 2022-07-19 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11408037B2 (en) | 2014-04-21 | 2022-08-09 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11414709B2 (en) | 2014-04-21 | 2022-08-16 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11486008B2 (en) | 2014-04-21 | 2022-11-01 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11530454B2 (en) | 2014-04-21 | 2022-12-20 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11319595B2 (en) | 2014-04-21 | 2022-05-03 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
US11319596B2 (en) | 2014-04-21 | 2022-05-03 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
EP3828167A1 (en) | 2014-05-07 | 2021-06-02 | Illumina Cambridge Limited | Polymethine compounds and their use as fluorescent labels |
US11053548B2 (en) | 2014-05-12 | 2021-07-06 | Good Start Genetics, Inc. | Methods for detecting aneuploidy |
EP3143161B1 (en) * | 2014-05-16 | 2021-04-21 | Illumina, Inc. | Nucleic acid synthesis techniques |
US10858696B2 (en) | 2014-06-02 | 2020-12-08 | Illumina Cambridge Limited | Methods of reducing density-dependent GC bias in amplification |
CN106795552A (en) * | 2014-06-14 | 2017-05-31 | 伊卢米纳剑桥有限公司 | The method for improving sequencing accuracy |
CN106795552B (en) * | 2014-06-14 | 2021-01-15 | 伊卢米纳剑桥有限公司 | Method for improving sequencing accuracy |
US10604800B2 (en) | 2014-06-14 | 2020-03-31 | Illumina Cambridge Limited | Methods of increasing sequencing accuracy |
WO2015189637A1 (en) * | 2014-06-14 | 2015-12-17 | Illumina Cambridge Limited | Methods of increasing sequencing accuracy |
US10102337B2 (en) | 2014-08-06 | 2018-10-16 | Nugen Technologies, Inc. | Digital measurements from targeted sequencing |
US11408024B2 (en) | 2014-09-10 | 2022-08-09 | Molecular Loop Biosciences, Inc. | Methods for selectively suppressing non-target sequences |
US10590483B2 (en) | 2014-09-15 | 2020-03-17 | Abvitro Llc | High-throughput nucleotide library sequencing |
US10429399B2 (en) | 2014-09-24 | 2019-10-01 | Good Start Genetics, Inc. | Process control for increased robustness of genetic assays |
US11873480B2 (en) | 2014-10-17 | 2024-01-16 | Illumina Cambridge Limited | Contiguity preserving transposition |
US10392663B2 (en) | 2014-10-29 | 2019-08-27 | Adaptive Biotechnologies Corp. | Highly-multiplexed simultaneous detection of nucleic acids encoding paired adaptive immune receptor heterodimers from a large number of samples |
US10246701B2 (en) | 2014-11-14 | 2019-04-02 | Adaptive Biotechnologies Corp. | Multiplexed digital quantitation of rearranged lymphoid receptors in a complex mixture |
US11066705B2 (en) | 2014-11-25 | 2021-07-20 | Adaptive Biotechnologies Corporation | Characterization of adaptive immune response to vaccination or infection using immune repertoire sequencing |
US10066259B2 (en) | 2015-01-06 | 2018-09-04 | Good Start Genetics, Inc. | Screening for structural variants |
US11680284B2 (en) | 2015-01-06 | 2023-06-20 | Moledular Loop Biosciences, Inc. | Screening for structural variants |
US11319588B2 (en) | 2015-02-17 | 2022-05-03 | Mgi Tech Co., Ltd. | DNA sequencing using controlled strand displacement |
US10227647B2 (en) | 2015-02-17 | 2019-03-12 | Complete Genomics, Inc. | DNA sequencing using controlled strand displacement |
US11047008B2 (en) | 2015-02-24 | 2021-06-29 | Adaptive Biotechnologies Corporation | Methods for diagnosing infectious disease and determining HLA status using immune repertoire sequencing |
CN107532205B (en) * | 2015-03-31 | 2021-06-08 | 伊卢米纳剑桥有限公司 | Surface concatemerization of templates |
WO2016156845A1 (en) * | 2015-03-31 | 2016-10-06 | Illumina Cambridge Limited | Surface concatamerization of templates |
EP3783109A1 (en) * | 2015-03-31 | 2021-02-24 | Illumina Cambridge Limited | Surface concatamerization of templates |
CN107532205A (en) * | 2015-03-31 | 2018-01-02 | 伊卢米纳剑桥有限公司 | The surface concatemerization of template |
US11041202B2 (en) | 2015-04-01 | 2021-06-22 | Adaptive Biotechnologies Corporation | Method of identifying human compatible T cell receptors specific for an antigenic target |
US11299774B2 (en) | 2015-04-10 | 2022-04-12 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
US11613773B2 (en) | 2015-04-10 | 2023-03-28 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
US11162132B2 (en) | 2015-04-10 | 2021-11-02 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
US11390912B2 (en) | 2015-04-10 | 2022-07-19 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
US10774374B2 (en) | 2015-04-10 | 2020-09-15 | Spatial Transcriptomics AB and Illumina, Inc. | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
US11739372B2 (en) | 2015-04-10 | 2023-08-29 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
US11866777B2 (en) | 2015-04-28 | 2024-01-09 | Illumina, Inc. | Error suppression in sequenced DNA fragments using redundant reads with unique molecular indices (UMIS) |
US10844428B2 (en) | 2015-04-28 | 2020-11-24 | Illumina, Inc. | Error suppression in sequenced DNA fragments using redundant reads with unique molecular indices (UMIS) |
US11946101B2 (en) | 2015-05-11 | 2024-04-02 | Natera, Inc. | Methods and compositions for determining ploidy |
US11479812B2 (en) | 2015-05-11 | 2022-10-25 | Natera, Inc. | Methods and compositions for determining ploidy |
US10239909B2 (en) | 2015-05-22 | 2019-03-26 | Illumina Cambridge Limited | Polymethine compounds with long stokes shifts and their use as fluorescent labels |
EP3098324A1 (en) | 2015-05-29 | 2016-11-30 | Molecular Cloning Laboratories (MCLAB) LLC | Compositions and methods for preparing sequencing libraries |
US11274333B2 (en) | 2015-05-29 | 2022-03-15 | Molecular Cloning Laboratories (MCLAB) LLC | Compositions and methods for preparing sequencing libraries |
EP4006150A1 (en) | 2015-09-09 | 2022-06-01 | QIAGEN GmbH | Polymerase enzyme |
DE102015011970A1 (en) | 2015-09-09 | 2017-03-09 | Scienion Ag | Dispenser and dispensing method |
DE102015011970B4 (en) * | 2015-09-09 | 2017-04-06 | Scienion Ag | Dispenser and dispensing method |
US11530439B2 (en) | 2015-09-25 | 2022-12-20 | Illumina Cambridge Limited | Polymethine compounds and their use as fluorescent labels |
EP3663290A1 (en) | 2015-09-25 | 2020-06-10 | Illumina Cambridge Limited | Polymethine compounds and their use as fluorescent labels |
EP3831825A1 (en) | 2015-09-25 | 2021-06-09 | Illumina Cambridge Limited | Polymethine compounds and their use as fluorescent labels |
US11981955B2 (en) | 2015-09-25 | 2024-05-14 | Illumina Cambridge Limited | Polymethine compounds and their use as fluorescent labels |
US10982261B2 (en) | 2015-09-25 | 2021-04-20 | Illumina Cambridge Limited | Polymethine compounds and their use as fluorescent labels |
US10752942B2 (en) | 2015-10-09 | 2020-08-25 | Accuragen Holdings Limited | Methods and compositions for enrichment of amplification products |
US11578359B2 (en) | 2015-10-09 | 2023-02-14 | Accuragen Holdings Limited | Methods and compositions for enrichment of amplification products |
WO2017096322A1 (en) | 2015-12-03 | 2017-06-08 | Accuragen Holdings Limited | Methods and compositions for forming ligation products |
US11015192B2 (en) | 2016-04-20 | 2021-05-25 | Qiagen Gmbh | Method for generating a stranded RNA library |
WO2017182578A1 (en) | 2016-04-20 | 2017-10-26 | Qiagen Gmbh | Method for generating a stranded rna library |
US11427866B2 (en) | 2016-05-16 | 2022-08-30 | Accuragen Holdings Limited | Method of improved sequencing by strand identification |
CN109790575A (en) * | 2016-07-20 | 2019-05-21 | 吉纳普赛斯股份有限公司 | System and method for nucleic acid sequencing |
US11535883B2 (en) | 2016-07-22 | 2022-12-27 | Illumina, Inc. | Single cell whole genome libraries and combinatorial indexing methods of making thereof |
EP3904514A1 (en) | 2016-07-22 | 2021-11-03 | Oregon Health & Science University | Single cell whole genome libraries and combinatorial indexing methods of making thereof |
WO2018018008A1 (en) | 2016-07-22 | 2018-01-25 | Oregon Health & Science University | Single cell whole genome libraries and combinatorial indexing methods of making thereof |
US11643683B2 (en) | 2016-08-15 | 2023-05-09 | Accuragen Holdings Limited | Compositions and methods for detecting rare sequence variants |
US10724088B2 (en) | 2016-08-15 | 2020-07-28 | Accuragen Holdings Limited | Compositions and methods for detecting rare sequence variants |
US10155980B2 (en) | 2016-08-15 | 2018-12-18 | Accuragen Holdings Limited | Compositions and methods for detecting rare sequence variants |
US10428325B1 (en) | 2016-09-21 | 2019-10-01 | Adaptive Biotechnologies Corporation | Identification of antigen-specific B cell receptors |
EP3974425A1 (en) | 2016-09-30 | 2022-03-30 | Illumina Cambridge Limited | New fluorescent dyes and their uses as biomarkers |
WO2018060482A1 (en) | 2016-09-30 | 2018-04-05 | Illumina Cambridge Limited | New fluorescent dyes and their uses as biomarkers |
US11370920B2 (en) | 2016-09-30 | 2022-06-28 | Illumina Cambridge Limited | Fluorescent dyes and their uses as biomarkers |
US10844225B2 (en) | 2016-09-30 | 2020-11-24 | Illumina Cambridge Limited | Fluorescent dyes and their uses as biomarkers |
US10385214B2 (en) | 2016-09-30 | 2019-08-20 | Illumina Cambridge Limited | Fluorescent dyes and their uses as biomarkers |
US11485996B2 (en) | 2016-10-04 | 2022-11-01 | Natera, Inc. | Methods for characterizing copy number variation using proximity-litigation sequencing |
EP3733292A1 (en) | 2016-10-21 | 2020-11-04 | GNA Biosolutions GmbH | Method for carrying out a polymerase chain reaction and device for carrying out the method |
WO2018073435A1 (en) | 2016-10-21 | 2018-04-26 | Gna Biosolutions Gmbh | Method for carrying out a polymerase chain reaction and device for carrying out the method |
US11519028B2 (en) | 2016-12-07 | 2022-12-06 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
US11530442B2 (en) | 2016-12-07 | 2022-12-20 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
US10214768B2 (en) | 2016-12-22 | 2019-02-26 | Illumina Cambridge Limited | Coumarin compounds and their uses as fluorescent labels |
US10907196B2 (en) | 2016-12-22 | 2021-02-02 | Illumina Cambridge Limited | Coumarin compounds and their uses as fluorescent labels |
WO2018114710A1 (en) | 2016-12-22 | 2018-06-28 | Illumina Cambridge Limited | Coumarin compounds and their uses as fluorescent labels |
US10533211B2 (en) | 2016-12-22 | 2020-01-14 | Illumina Cambridge Limited | Coumarin compounds and their uses as fluorescent labels |
US11371078B2 (en) | 2016-12-22 | 2022-06-28 | Illumina Cambridge Limited | Coumarin compounds and their uses as fluorescent labels |
EP4257596A2 (en) | 2016-12-22 | 2023-10-11 | Illumina Cambridge Limited | Coumarin compounds and their uses as fluorescent labels |
US11761035B2 (en) | 2017-01-18 | 2023-09-19 | Illumina, Inc. | Methods and systems for generation and error-correction of unique molecular index sets with heterogeneous molecular lengths |
US10844429B2 (en) | 2017-01-18 | 2020-11-24 | Illumina, Inc. | Methods and systems for generation and error-correction of unique molecular index sets with heterogeneous molecular lengths |
US11866741B2 (en) | 2017-02-13 | 2024-01-09 | IsoPlexis Corporation | Polymerase enzyme from 9°N |
WO2018148724A1 (en) | 2017-02-13 | 2018-08-16 | Qiagen Waltham Inc. | Polymerase enzyme from pyrococcus furiosus |
WO2018148723A1 (en) | 2017-02-13 | 2018-08-16 | Qiagen Waltham Inc. | Polymerase enzyme from pyrococcus abyssi |
WO2018148726A1 (en) | 2017-02-13 | 2018-08-16 | Qiagen Waltham Inc. | Polymerase enzyme from phage t4 |
WO2018148727A1 (en) | 2017-02-13 | 2018-08-16 | Qiagen Waltham Inc. | Polymerase enzyme from 9°n |
US11584958B2 (en) | 2017-03-31 | 2023-02-21 | Grail, Llc | Library preparation and use thereof for sequencing based error correction and/or variant identification |
WO2018197950A1 (en) | 2017-04-23 | 2018-11-01 | Illumina Cambridge Limited | Compositions and methods for improving sample identification in indexed nucleic acid libraries |
EP3872187A1 (en) | 2017-04-23 | 2021-09-01 | Illumina Cambridge Limited | Compositions and methods for improving sample identification in indexed nucleic acid libraries |
WO2018197945A1 (en) | 2017-04-23 | 2018-11-01 | Illumina Cambridge Limited | Compositions and methods for improving sample identification in indexed nucleic acid libraries |
EP3913053A1 (en) | 2017-04-23 | 2021-11-24 | Illumina Cambridge Limited | Compositions and methods for improving sample identification in indexed nucleic acid libraries |
EP3842545A1 (en) | 2017-04-23 | 2021-06-30 | Illumina, Inc. | Compositions and methods for improving sample identification in indexed nucleic acid libraries |
WO2018200380A1 (en) | 2017-04-23 | 2018-11-01 | Illumina, Inc. | Compositions and methods for improving sample identification in indexed nucleic acid libraries |
WO2018200386A1 (en) | 2017-04-23 | 2018-11-01 | Illumina, Inc. | Compositions and methods for improving sample identification in indexed nucleic acid libraries |
US11028435B2 (en) | 2017-05-01 | 2021-06-08 | Illumina, Inc. | Optimal index sequences for multiplex massively parallel sequencing |
WO2018204423A1 (en) | 2017-05-01 | 2018-11-08 | Illumina, Inc. | Optimal index sequences for multiplex massively parallel sequencing |
US11788139B2 (en) | 2017-05-01 | 2023-10-17 | Illumina, Inc. | Optimal index sequences for multiplex massively parallel sequencing |
US11028436B2 (en) | 2017-05-08 | 2021-06-08 | Illumina, Inc. | Universal short adapters for indexing of polynucleotide samples |
US11814678B2 (en) | 2017-05-08 | 2023-11-14 | Illumina, Inc. | Universal short adapters for indexing of polynucleotide samples |
WO2018208699A1 (en) | 2017-05-08 | 2018-11-15 | Illumina, Inc. | Universal short adapters for indexing of polynucleotide samples |
WO2018213803A1 (en) | 2017-05-19 | 2018-11-22 | Neon Therapeutics, Inc. | Immunogenic neoantigen identification |
EP4293122A2 (en) | 2017-06-07 | 2023-12-20 | Oregon Health & Science University | Single cell whole genome libraries for methylation sequencing |
EP3981884A1 (en) | 2017-06-07 | 2022-04-13 | Oregon Health & Science University | Single cell whole genome libraries for methylation sequencing |
WO2018226708A1 (en) | 2017-06-07 | 2018-12-13 | Oregon Health & Science University | Single cell whole genome libraries for methylation sequencing |
US10526648B2 (en) | 2017-07-12 | 2020-01-07 | Illumina Cambridge Limited | Short pendant arm linkers for nucleotides in sequencing applications |
US11655502B2 (en) | 2017-07-12 | 2023-05-23 | Illumina Cambridge Limited | Short pendant arm linkers for nucleotides in sequencing applications |
US11001888B2 (en) | 2017-07-12 | 2021-05-11 | Illumina Cambridge Limited | Short pendant arm linkers for nucleotides in sequencing applications |
WO2019027767A1 (en) | 2017-07-31 | 2019-02-07 | Illumina Inc. | Sequencing system with multiplexed biological sample aggregation |
US11649498B2 (en) | 2017-08-01 | 2023-05-16 | Illumina, Inc. | Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells |
WO2019028047A1 (en) | 2017-08-01 | 2019-02-07 | Illumina, Inc | Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells |
US11352668B2 (en) | 2017-08-01 | 2022-06-07 | Illumina, Inc. | Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells |
EP4289967A2 (en) | 2017-08-01 | 2023-12-13 | Illumina, Inc. | Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells |
EP3447153A1 (en) | 2017-08-24 | 2019-02-27 | Marian Grendár | Method for determining the qualification of a sample for fetal aneuploidy status determination in non-invasive prenatal testing |
WO2019055715A1 (en) | 2017-09-15 | 2019-03-21 | Illumina, Inc. | Universal short adapters with variable length non-random unique molecular identifiers |
US11447818B2 (en) | 2017-09-15 | 2022-09-20 | Illumina, Inc. | Universal short adapters with variable length non-random unique molecular identifiers |
US11898198B2 (en) | 2017-09-15 | 2024-02-13 | Illumina, Inc. | Universal short adapters with variable length non-random unique molecular identifiers |
US11390619B2 (en) | 2017-10-16 | 2022-07-19 | Illumina Cambridge Limited | Secondary amine-substituted coumarin compounds and their uses as fluorescent labels |
US11858923B2 (en) | 2017-10-16 | 2024-01-02 | Illumina Cambridge Limited | Secondary amine-substituted coumarin compounds and their uses as fluorescent labels |
US11099202B2 (en) | 2017-10-20 | 2021-08-24 | Tecan Genomics, Inc. | Reagent delivery system |
US11254980B1 (en) | 2017-11-29 | 2022-02-22 | Adaptive Biotechnologies Corporation | Methods of profiling targeted polynucleotides while mitigating sequencing depth requirements |
US11203782B2 (en) | 2018-03-29 | 2021-12-21 | Accuragen Holdings Limited | Compositions and methods comprising asymmetric barcoding |
WO2019195225A1 (en) | 2018-04-02 | 2019-10-10 | Illumina, Inc. | Compositions and methods for making controls for sequence-based genetic testing |
US11230731B2 (en) | 2018-04-02 | 2022-01-25 | Progenity, Inc. | Methods, systems, and compositions for counting nucleic acid molecules |
US11788121B2 (en) | 2018-04-02 | 2023-10-17 | Enumera Molecular, Inc. | Methods, systems, and compositions for counting nucleic acid molecules |
EP4306532A2 (en) | 2018-05-15 | 2024-01-17 | Illumina, Inc. | Chemical cleavage and deprotection |
WO2019222264A1 (en) | 2018-05-15 | 2019-11-21 | Illumina, Inc. | Compositions and methods for chemical cleavage and deprotection of surface-bound oligonucleotides |
US11981891B2 (en) | 2018-05-17 | 2024-05-14 | Illumina, Inc. | High-throughput single-cell sequencing with reduced amplification bias |
EP4269618A2 (en) | 2018-06-04 | 2023-11-01 | Illumina, Inc. | Methods of making high-throughput single-cell transcriptome libraries |
US11525159B2 (en) | 2018-07-03 | 2022-12-13 | Natera, Inc. | Methods for detection of donor-derived cell-free DNA |
WO2020036991A1 (en) | 2018-08-15 | 2020-02-20 | Illumina, Inc. | Compositions and methods for improving library enrichment |
WO2020114918A1 (en) | 2018-12-05 | 2020-06-11 | Illumina Cambridge Limited | Methods and compositions for cluster generation by bridge amplification |
WO2020120179A1 (en) | 2018-12-14 | 2020-06-18 | Illumina Cambridge Limited | Decreasing phasing with unlabeled nucleotides during sequencing |
WO2020126593A1 (en) | 2018-12-17 | 2020-06-25 | Illumina Cambridge Limited | Compositions for use in polyunucleotide sequencing |
WO2020126595A1 (en) | 2018-12-17 | 2020-06-25 | Illumina Cambridge Limited | Primer oligonucleotide for sequencing |
WO2020126602A1 (en) | 2018-12-18 | 2020-06-25 | Illumina Cambridge Limited | Methods and compositions for paired end sequencing using a single surface primer |
WO2020132103A1 (en) | 2018-12-19 | 2020-06-25 | Illumina, Inc. | Methods for improving polynucleotide cluster clonality priority |
WO2020136170A2 (en) | 2018-12-26 | 2020-07-02 | Illumina Cambridge Limited | Nucleosides and nucleotides with 3'-hydroxy blocking groups |
US11293061B2 (en) | 2018-12-26 | 2022-04-05 | Illumina Cambridge Limited | Sequencing methods using nucleotides with 3′ AOM blocking group |
US11827931B2 (en) | 2018-12-26 | 2023-11-28 | Illumina Cambridge Limited | Methods of preparing growing polynucleotides using nucleotides with 3′ AOM blocking group |
WO2020169635A1 (en) | 2019-02-20 | 2020-08-27 | Grendar Marian | Method for determining the uncertainty of the degree of placental mosaicism of a sample in non-invasive prenatal screening |
US11390753B2 (en) | 2019-03-01 | 2022-07-19 | Illumina Cambridge Limited | Exocyclic amine substituted coumarin compounds and uses as fluorescent labels |
NL2023327B1 (en) | 2019-03-01 | 2020-09-17 | Illumina Inc | Multiplexed fluorescent detection of analytes |
WO2020180778A1 (en) | 2019-03-01 | 2020-09-10 | Illumina, Inc. | High-throughput single-nuclei and single-cell libraries and methods of making and of using |
WO2020178231A1 (en) | 2019-03-01 | 2020-09-10 | Illumina, Inc. | Multiplexed fluorescent detection of analytes |
WO2020178162A1 (en) | 2019-03-01 | 2020-09-10 | Illumina Cambridge Limited | Exocyclic amine-substituted coumarin compounds and their uses as fluorescent labels |
WO2020178165A1 (en) | 2019-03-01 | 2020-09-10 | Illumina Cambridge Limited | Tertiary amine substituted coumarin compounds and their uses as fluorescent labels |
US11884825B2 (en) | 2019-03-01 | 2024-01-30 | Illumina Cambridge Limited | Exocyclic amine substituted coumarin compounds and uses as fluorescent labels |
NL2023310B1 (en) | 2019-03-21 | 2020-09-28 | Illumina Inc | Training data generation for artificial intelligence-based sequencing |
NL2023316B1 (en) | 2019-03-21 | 2020-09-28 | Illumina Inc | Artificial intelligence-based sequencing |
WO2020205296A1 (en) | 2019-03-21 | 2020-10-08 | Illumina, Inc. | Artificial intelligence-based generation of sequencing metadata |
EP4276769A2 (en) | 2019-03-21 | 2023-11-15 | Illumina, Inc. | Training data generation for artificial intelligence-based sequencing |
NL2023311B1 (en) | 2019-03-21 | 2020-09-28 | Illumina Inc | Artificial intelligence-based generation of sequencing metadata |
WO2020191389A1 (en) | 2019-03-21 | 2020-09-24 | Illumina, Inc. | Training data generation for artificial intelligence-based sequencing |
WO2020191391A2 (en) | 2019-03-21 | 2020-09-24 | Illumina, Inc. | Artificial intelligence-based sequencing |
US12020778B2 (en) | 2019-03-22 | 2024-06-25 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
WO2020193765A1 (en) | 2019-03-28 | 2020-10-01 | Illumina Cambridge Limited | Methods and compositions for nucleic acid sequencing using photoswitchable labels |
US11421271B2 (en) | 2019-03-28 | 2022-08-23 | Illumina Cambridge Limited | Methods and compositions for nucleic acid sequencing using photoswitchable labels |
US11959138B2 (en) | 2019-03-28 | 2024-04-16 | Illumina Cambridge Limited | Methods and compositions for nucleic acid sequencing using photoswitchable labels |
US11186863B2 (en) | 2019-04-02 | 2021-11-30 | Progenity, Inc. | Methods, systems, and compositions for counting nucleic acid molecules |
US11959129B2 (en) | 2019-04-02 | 2024-04-16 | Enumera Molecular, Inc. | Methods, systems, and compositions for counting nucleic acid molecules |
US12024738B2 (en) | 2019-04-12 | 2024-07-02 | Natera, Inc. | Methods for cancer detection and monitoring |
EP3963104A4 (en) * | 2019-05-03 | 2023-11-08 | Ultima Genomics, Inc. | Fast-forward sequencing by synthesis methods |
US11597969B2 (en) | 2019-11-27 | 2023-03-07 | Illumina Cambridge Limited | Cyclooctatetraene containing dyes and compositions |
WO2021104845A1 (en) | 2019-11-27 | 2021-06-03 | Illumina Cambridge Limited | Cyclooctatetraene containing dyes and compositions |
WO2021127436A2 (en) | 2019-12-19 | 2021-06-24 | Illumina, Inc. | High-throughput single-cell libraries and methods of making and of using |
WO2021128441A1 (en) | 2019-12-23 | 2021-07-01 | Mgi Tech Co.,Ltd. | Controlled strand-displacement for paired-end sequencing |
WO2021180724A1 (en) | 2020-03-09 | 2021-09-16 | Illumina, Inc. | Improvements in nucleic acid sequencing |
WO2021180733A1 (en) | 2020-03-09 | 2021-09-16 | Illumina, Inc. | Methods for sequencing polynucleotides |
WO2021231477A2 (en) | 2020-05-12 | 2021-11-18 | Illumina, Inc. | Generating nucleic acids with modified bases using recombinant terminal deoxynucleotidyl transferase |
WO2021252617A1 (en) | 2020-06-09 | 2021-12-16 | Illumina, Inc. | Methods for increasing yield of sequencing libraries |
US11787831B2 (en) | 2020-06-22 | 2023-10-17 | Illumina Cambridge Limited | Nucleosides and nucleotides with 3′ acetal blocking group |
WO2021259881A1 (en) | 2020-06-22 | 2021-12-30 | Illumina Cambridge Limited | Nucleosides and nucleotides with 3' acetal blocking group |
WO2022006081A1 (en) | 2020-06-30 | 2022-01-06 | Illumina, Inc. | Catalytically controlled sequencing by synthesis to produce scarless dna |
WO2022006495A1 (en) | 2020-07-02 | 2022-01-06 | Illumina, Inc. | A method to calibrate nucleic acid library seeding efficiency in flowcells |
US11952627B2 (en) | 2020-07-06 | 2024-04-09 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
US11981960B1 (en) | 2020-07-06 | 2024-05-14 | 10X Genomics, Inc. | Spatial analysis utilizing degradable hydrogels |
US11761038B1 (en) | 2020-07-06 | 2023-09-19 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
WO2022010965A1 (en) | 2020-07-08 | 2022-01-13 | Illumina, Inc. | Beads as transposome carriers |
US11981964B2 (en) | 2020-07-28 | 2024-05-14 | Illumina Cambridge Limited | Substituted coumarin dyes and uses as fluorescent labels |
WO2022023353A1 (en) | 2020-07-28 | 2022-02-03 | Illumina Cambridge Limited | Substituted coumarin dyes and uses as fluorescent labels |
US11981958B1 (en) | 2020-08-20 | 2024-05-14 | 10X Genomics, Inc. | Methods for spatial analysis using DNA capture |
US11926822B1 (en) | 2020-09-23 | 2024-03-12 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
US11827935B1 (en) | 2020-11-19 | 2023-11-28 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification and detection probes |
WO2022129930A1 (en) | 2020-12-17 | 2022-06-23 | Illumina Cambridge Limited | Alkylpyridinium coumarin dyes and uses in sequencing applications |
WO2022129437A1 (en) | 2020-12-17 | 2022-06-23 | Illumina Cambridge Limited | Long stokes shift chromenoquinoline dyes and uses in sequencing applications |
WO2022129439A1 (en) | 2020-12-17 | 2022-06-23 | Illumina Cambridge Limited | Methods, systems and compositions for nucleic acid sequencing |
US11873482B2 (en) | 2020-12-21 | 2024-01-16 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
US11959076B2 (en) | 2020-12-21 | 2024-04-16 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
US11680260B2 (en) | 2020-12-21 | 2023-06-20 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
US11618897B2 (en) | 2020-12-21 | 2023-04-04 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
WO2022136402A1 (en) | 2020-12-22 | 2022-06-30 | Illumina Cambridge Limited | Methods and compositions for nucleic acid sequencing |
WO2022165188A1 (en) | 2021-01-29 | 2022-08-04 | Illumina, Inc. | Methods, compositions and kits to improve seeding efficiency of flow cells with polynucleotides |
WO2022204032A1 (en) | 2021-03-22 | 2022-09-29 | Illumina Cambridge Limited | Methods for improving nucleic acid cluster clonality |
WO2022233795A1 (en) | 2021-05-05 | 2022-11-10 | Illumina Cambridge Limited | Fluorescent dyes containing bis-boron fused heterocycles and uses in sequencing |
WO2022243480A1 (en) | 2021-05-20 | 2022-11-24 | Illumina, Inc. | Compositions and methods for sequencing by synthesis |
US11891651B2 (en) | 2021-06-17 | 2024-02-06 | Element Biosciences, Inc. | Compositions and methods for pairwise sequencing |
US11427855B1 (en) | 2021-06-17 | 2022-08-30 | Element Biosciences, Inc. | Compositions and methods for pairwise sequencing |
US11220707B1 (en) | 2021-06-17 | 2022-01-11 | Element Biosciences, Inc. | Compositions and methods for pairwise sequencing |
US11859241B2 (en) | 2021-06-17 | 2024-01-02 | Element Biosciences, Inc. | Compositions and methods for pairwise sequencing |
US11236388B1 (en) | 2021-06-17 | 2022-02-01 | Element Biosciences, Inc. | Compositions and methods for pairwise sequencing |
US11535892B1 (en) | 2021-06-17 | 2022-12-27 | Element Biosciences, Inc. | Compositions and methods for pairwise sequencing |
WO2022272260A1 (en) | 2021-06-23 | 2022-12-29 | Illumina, Inc. | Compositions, methods, kits, cartridges, and systems for sequencing reagents |
WO2023278608A1 (en) | 2021-06-29 | 2023-01-05 | Illumina, Inc. | Self-learned base caller, trained using oligo sequences |
WO2023278609A1 (en) | 2021-06-29 | 2023-01-05 | Illumina, Inc. | Self-learned base caller, trained using organism sequences |
WO2023003757A1 (en) | 2021-07-19 | 2023-01-26 | Illumina Software, Inc. | Intensity extraction with interpolation and adaptation for base calling |
WO2023009758A1 (en) | 2021-07-28 | 2023-02-02 | Illumina, Inc. | Quality score calibration of basecalling systems |
WO2023014741A1 (en) | 2021-08-03 | 2023-02-09 | Illumina Software, Inc. | Base calling using multiple base caller models |
US11753673B2 (en) | 2021-09-01 | 2023-09-12 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
US11840724B2 (en) | 2021-09-01 | 2023-12-12 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
WO2023052427A1 (en) | 2021-09-30 | 2023-04-06 | Illumina Cambridge Limited | Polynucleotide sequencing |
WO2023114896A1 (en) | 2021-12-16 | 2023-06-22 | Illumina Cambridge Limited | Methods for metal directed cleavage of surface-bound polynucleotides |
WO2023114397A1 (en) | 2021-12-16 | 2023-06-22 | Illumina, Inc. | Hybrid clustering |
WO2023114394A1 (en) | 2021-12-17 | 2023-06-22 | Illumina, Inc. | Orthogonal hybridization |
WO2023122499A1 (en) | 2021-12-20 | 2023-06-29 | Illumina Cambridge Limited | Periodate compositions and methods for chemical cleavage of surface-bound polynucleotides |
WO2023122491A1 (en) | 2021-12-20 | 2023-06-29 | Illumina Cambridge Limited | Periodate compositions and methods for chemical cleavage of surface-bound polynucleotides |
WO2023126457A1 (en) | 2021-12-29 | 2023-07-06 | Illumina Cambridge Ltd. | Methods of nucleic acid sequencing using surface-bound primers |
WO2023175037A2 (en) | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Concurrent sequencing of forward and reverse complement strands on separate polynucleotides for methylation detection |
WO2023175040A2 (en) | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Concurrent sequencing of forward and reverse complement strands on concatenated polynucleotides for methylation detection |
WO2023175029A1 (en) | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Concurrent sequencing of hetero n-mer polynucleotides |
WO2023175041A1 (en) | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Concurrent sequencing of forward and reverse complement strands on concatenated polynucleotides |
WO2023175043A1 (en) | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Methods of base calling nucleobases |
WO2023175018A1 (en) | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Concurrent sequencing of forward and reverse complement strands on separate polynucleotides |
WO2023175026A1 (en) | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Methods of determining sequence information |
WO2023175021A1 (en) | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Methods of preparing loop fork libraries |
WO2023175024A1 (en) * | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Paired-end sequencing |
WO2023175013A1 (en) | 2022-03-15 | 2023-09-21 | Illumina, Inc. | Methods for preparing signals for concurrent sequencing |
WO2023186815A1 (en) | 2022-03-28 | 2023-10-05 | Illumina Cambridge Limited | Labeled avidin and methods for sequencing |
WO2023192163A1 (en) | 2022-03-29 | 2023-10-05 | Illumina Cambridge Limited | Systems and methods of sequencing polynucleotides |
WO2023186819A1 (en) | 2022-03-29 | 2023-10-05 | Illumina Cambridge Limited | Chromenoquinoline dyes and uses in sequencing |
WO2023186872A1 (en) | 2022-03-30 | 2023-10-05 | Illumina Cambridge Limited | Methods for chemical cleavage of surface-bound polynucleotides |
WO2023187061A1 (en) | 2022-03-31 | 2023-10-05 | Illumina Cambridge Limited | Paired-end re-synthesis using blocked p5 primers |
WO2023192900A1 (en) | 2022-03-31 | 2023-10-05 | Illumina Singapore Pte. Ltd. | Nucleosides and nucleotides with 3' vinyl blocking group useful in sequencing by synthesis |
WO2023186982A1 (en) | 2022-03-31 | 2023-10-05 | Illumina, Inc. | Compositions and methods for improving sequencing signals |
WO2023196572A1 (en) | 2022-04-07 | 2023-10-12 | Illumina Singapore Pte. Ltd. | Altered cytidine deaminases and methods of use |
WO2023209606A1 (en) | 2022-04-29 | 2023-11-02 | Illumina Cambridge Limited | Methods and systems for encapsulating lyophilised microspheres |
WO2023232829A1 (en) | 2022-05-31 | 2023-12-07 | Illumina, Inc | Compositions and methods for nucleic acid sequencing |
WO2024003087A1 (en) | 2022-06-28 | 2024-01-04 | Illumina, Inc. | Fluorescent dyes containing fused tetracyclic bis-boron heterocycle and uses in sequencing |
WO2024039516A1 (en) | 2022-08-19 | 2024-02-22 | Illumina, Inc. | Third dna base pair site-specific dna detection |
WO2024059852A1 (en) | 2022-09-16 | 2024-03-21 | Illumina, Inc. | Cluster segmentation and conditional base calling |
WO2024061799A1 (en) | 2022-09-19 | 2024-03-28 | Illumina, Inc. | Deformable polymers comprising immobilised primers |
WO2024068641A1 (en) | 2022-09-26 | 2024-04-04 | Illumina, Inc. | Resynthesis kits and methods |
WO2024073047A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Cytidine deaminases and methods of use in mapping modified cytosine nucleotides |
WO2024073712A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Thermophilic compositions for nucleic acid amplification |
WO2024069581A1 (en) | 2022-09-30 | 2024-04-04 | Illumina Singapore Pte. Ltd. | Helicase-cytidine deaminase complexes and methods of use |
WO2024073713A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Mesophilic compositions for nucleic acid amplification |
WO2024068889A2 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Compositions and methods for reducing photo damage during sequencing |
WO2024073714A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Methods of modulating clustering kinetics |
WO2024073043A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Methods of using cpg binding proteins in mapping modified cytosine nucleotides |
WO2024073663A1 (en) | 2022-09-30 | 2024-04-04 | Illumina, Inc. | Amplification compositions and methods |
WO2024118903A1 (en) | 2022-11-30 | 2024-06-06 | Illumina, Inc. | Chemoenzymatic correction of false positive uracil transformations |
WO2024123917A1 (en) | 2022-12-07 | 2024-06-13 | Illumina, Inc. | Monoclonal clustering using double stranded dna size exclusion with patterned seeding |
WO2024123866A1 (en) | 2022-12-09 | 2024-06-13 | Illumina, Inc. | Nucleosides and nucleotides with 3´ blocking groups and cleavable linkers |
Also Published As
Publication number | Publication date |
---|---|
US20050100900A1 (en) | 2005-05-12 |
US20080286795A1 (en) | 2008-11-20 |
EP0972081A1 (en) | 2000-01-19 |
DE69837913T2 (en) | 2008-02-07 |
US8143008B2 (en) | 2012-03-27 |
ATE545710T1 (en) | 2012-03-15 |
US20110045541A1 (en) | 2011-02-24 |
US8993271B2 (en) | 2015-03-31 |
US20130231254A1 (en) | 2013-09-05 |
US20150087531A1 (en) | 2015-03-26 |
ATE364718T1 (en) | 2007-07-15 |
ES2563643T3 (en) | 2016-03-15 |
US9593328B2 (en) | 2017-03-14 |
EP2327797A1 (en) | 2011-06-01 |
US9902951B2 (en) | 2018-02-27 |
EP1591541A3 (en) | 2006-07-05 |
HK1155784A1 (en) | 2012-05-25 |
US8476044B2 (en) | 2013-07-02 |
EP0972081B1 (en) | 2007-06-13 |
DE69837913D1 (en) | 2007-07-26 |
EP3034626A1 (en) | 2016-06-22 |
US20140371100A1 (en) | 2014-12-18 |
EP2327797B1 (en) | 2015-11-25 |
US20130217586A1 (en) | 2013-08-22 |
AU6846698A (en) | 1998-10-22 |
US20150133320A1 (en) | 2015-05-14 |
US7985565B2 (en) | 2011-07-26 |
EP1591541B1 (en) | 2012-02-15 |
EP1591541A2 (en) | 2005-11-02 |
JP2002503954A (en) | 2002-02-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9593328B2 (en) | Method of nucleic acid amplification | |
EP1634963B1 (en) | Method of nucleic acid amplification using immobilised colony primers | |
US6297006B1 (en) | Methods for sequencing repetitive sequences and for determining the order of sequence subfragments | |
US20030022207A1 (en) | Arrayed polynucleotides and their use in genome analysis | |
EP1597397B1 (en) | Dna sequence analysis | |
EP1716251A1 (en) | Arrayed polynucleotides | |
EP1356120A2 (en) | Arrayed polynucleotides and their use in genome analysis | |
AU2002219161A1 (en) | Isothermal amplification of nucleic acids on a solid support | |
CA2300940A1 (en) | Methods and compositions for detection or quantification of nucleic acid species | |
EP1689881A2 (en) | Nucleic acid sequencing methods | |
JP2001517948A (en) | Nucleic acid sequencing | |
WO2004050915A1 (en) | Determination of methylation of nucleic acid sequences | |
US20080108515A1 (en) | Arrayed polynucleotides | |
US20100130368A1 (en) | Method and system for sequencing polynucleotides | |
EP1567670A1 (en) | Recovery of original template | |
MXPA01003266A (en) | Methods of nucleic acid amplification and sequencing |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 1998913952 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1998 541308 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09402277 Country of ref document: US |
|
WWP | Wipo information: published in national office |
Ref document number: 1998913952 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
NENP | Non-entry into the national phase |
Ref country code: CA |
|
WWG | Wipo information: grant in national office |
Ref document number: 1998913952 Country of ref document: EP |
|
DPE2 | Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101) |