WO1998044151A1 - Method of nucleic acid amplification - Google Patents

Method of nucleic acid amplification Download PDF

Info

Publication number
WO1998044151A1
WO1998044151A1 PCT/GB1998/000961 GB9800961W WO9844151A1 WO 1998044151 A1 WO1998044151 A1 WO 1998044151A1 GB 9800961 W GB9800961 W GB 9800961W WO 9844151 A1 WO9844151 A1 WO 9844151A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
primers
immobilised
dna
colonies
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB1998/000961
Other languages
French (fr)
Inventor
Eric Kawashima
Laurent Farinelli
Pascal Mayer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Glaxo Group Ltd
Original Assignee
Glaxo Group Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27451621&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1998044151(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from GBGB9706529.6A external-priority patent/GB9706529D0/en
Priority claimed from GBGB9706528.8A external-priority patent/GB9706528D0/en
Priority claimed from GBGB9713236.9A external-priority patent/GB9713236D0/en
Priority claimed from GBGB9713238.5A external-priority patent/GB9713238D0/en
Priority to AU68466/98A priority Critical patent/AU6846698A/en
Priority to JP54130898A priority patent/JP2002503954A/en
Priority to DE69837913T priority patent/DE69837913T2/en
Priority to EP98913952A priority patent/EP0972081B1/en
Application filed by Glaxo Group Ltd filed Critical Glaxo Group Ltd
Publication of WO1998044151A1 publication Critical patent/WO1998044151A1/en
Anticipated expiration legal-status Critical
Priority to US10/449,010 priority patent/US7985565B2/en
Priority to US12/148,133 priority patent/US8476044B2/en
Priority to US12/771,324 priority patent/US8143008B2/en
Priority to US13/828,047 priority patent/US8993271B2/en
Priority to US13/886,234 priority patent/US9902951B2/en
Priority to US14/465,685 priority patent/US20140371100A1/en
Priority to US14/555,036 priority patent/US20150087531A1/en
Priority to US14/601,013 priority patent/US9593328B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1065Preparation or screening of tagged libraries, e.g. tagged microorganisms by STM-mutagenesis, tagged polynucleotides, gene tags
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6874Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation

Definitions

  • This invention relates, inter alia, to the amplification of nucleic acids .
  • nucleic acids of interest e.g., genomic or mitochondrial DNA or messenger RNA (mRNA)
  • mRNA messenger RNA
  • nucleic acids of interest it is necessary to isolate the nucleic acids of interest from the mixture of all nucleic acids and usually, to amplify these nucleic acids to obtain quantities suitable for their characterisation and/or detection. Isolating the nucleic fragments has been considered necessary even when one is interested in a representative but random set of all of the different nucleic acids, for instance, a representative set of all the mRNAs present in a cell or of all the fragments obtained after genomic DNA has been cut randomly into small pieces .
  • DNA ligases Several methods can be used to amplify DNA with biological means and are well known by those skilled in the art. Generally, the fragments of DNA are first inserted into vectors with the use of restriction enzymes and DNA ligases . A vector containing a fragment of interest can then be introduced into a biological host and amplified by means of well established protocols. Usually hosts are randomly spread over a growth medium (e.g. agar plates). They can then replicate to provide colonies that originated from individual host cells.
  • a growth medium e.g. agar plates
  • Another option is to transfer by sterile technique individually each colony into a container (e.g., 96 well plates) where further host cell replication can occur so that more DNA can be obtained from the colonies. Amplified nucleic acids can be recovered from the host cells with an appropriate purification process.
  • a container e.g., 96 well plates
  • Amplified nucleic acids can be recovered from the host cells with an appropriate purification process.
  • Such a procedure is generally time and labour consuming, and difficult to automate .
  • PCR polymerase chain reaction
  • Amplification occurs during the PCR cycling, which includes a step during which double stranded DNA molecules are denatured (typically a reaction mix is heated, e.g. to 95°C in order to separate double stranded DNA molecules into two single stranded fragments) , an annealing step (where the reaction mix is brought to e.g., 45°C in order to allow the primers to anneal to the single stranded templates) and an elongation step (DNA complementary to the single stranded fragment is synthesised via sequential nucleotide incorporation at the ends of the primers with the DNA polymerase enzyme) .
  • a reaction mix is heated, e.g. to 95°C in order to separate double stranded DNA molecules into two single stranded fragments
  • an annealing step where the reaction mix is brought to e.g., 45°C in order to allow the primers to anneal to the single stranded templates
  • an elongation step DNA complementary to the
  • the amplification is generally performed in containers (e.g., in 96 well format plates) in such a way that each container contains the PCR product (s) of one reaction.
  • containers e.g., in 96 well format plates
  • PCR product s
  • some of the PCR product become grafted to a surface of the container having primers therein which has been in contact with the reactant during the PCR cycling.
  • the grafting to the surface simplifies subsequent assays and allows efficient automation.
  • Arraying of DNA samples is more classically performed on membranes (e.g., nylon or nitro-cellulose membranes).
  • membranes e.g., nylon or nitro-cellulose membranes.
  • suitable robotics e.g., Q-bot m , Genetix ltd, Dorset BH23 3TG UK
  • the DNA is covalently linked to a membrane by physicochemical means (e.g., UV irradiation) .
  • physicochemical means e.g., UV irradiation
  • New approaches based on pre-arrayed glass slides arrays of reactive areas obtained by ink-jet technology (Blanchard, A. P. and L. Hood, Oligonucleotide array synthesis using ink jets, Microbial and Comparative Genomics, 1:225 (1996)) or arrays of reactive polyacrylamide gels (Yershov, G. et al . , DNA analysis and diagnostics on oligonucleotide microchips, Proceedings of the Na tional Academy of Science, USA, 93:4913-4918 (1996)) allow the arraying of up to 100 samples/mm 2 . With these technologies, only probe (oligonucleotide) grafting has been reported. Reported number of samples/mm 2 are still fairly low (25 to 64) .
  • DNA chips which can be arrays of oligonucleotides covalently bound to a surface and can be obtained with the use of micro-lithographic techniques (Fodor, S.P.A. et al., Light directed, spatially addressable parallel chemical synthesis, Science 251:767(1991)).
  • chips with 625 probes/mm 2 are used in applications for molecular biology (Lockhart, D.J. et al., Expression monitoring by hybridisation to high-density oligonucleotide arrays, Nature Biotechnology 14:1675 (1996)).
  • Probe densities of up to 250 000 samples/cm 2 are claimed to be achievable (Chee, M.
  • the present invention aims to overcome or at least alleviate some of the disadvantages of prior art methods of nucleic acid amplification.
  • a method of nucleic acid amplification comprising the steps of: A. providing a plurality of primers that are immobilised but that have one end exposed to allow primer extension;
  • step D allowing the extended immobilised nucleic acid strand to anneal to one of said plurality of primers referred to in step A) and then extending that primer using the extended immobilised nucleic acid strand as a template, so as to provide another extended immobilised nucleic acid strand; and optionally,
  • the method also comprises the step of:
  • step F repeating step F) one or more times.
  • the single-stranded target nucleic acid sequence is provided by a method in which said single-stranded target nucleic acid is produced by providing a given nucleic acid sequence to be amplified (which sequence may be known or unknown) and adding thereto a first nucleic acid sequence and a second nucleic acid sequence; wherein said first nucleic acid sequence hybridises to one of said plurality of primers and said second nucleic acid sequence is complementary to a sequence which hybridises to one of said plurality of primers.
  • the second nucleic acid sequence may be a sequence that is the same as the sequence of one of the plurality of primers.
  • the single- stranded target nucleic acid squence may be provided by a method in which said single-stranded target nucleic acid is produced by providing a given nucleic acid sequence to be amplified (which sequence may be known or unknown) and adding thereto a first nucleic acid sequence and a second nucleic acid sequence; wherein said first nucleic acid sequence hybridises to one of said plurality of primers and said second nucleic acid sequence is the same as the sequence of one of said plurality of primers.
  • the first and second nucleic acid sequences may be provided at first and second ends of said single-stranded target nucleic acid, although this is not essential.
  • a tag may be provided to enable amplification products of a given nucleic acid sequence to be identified.
  • the method of the present invention allows one or more distinct areas to be provided, each distinct area comprising a plurality of immobilised nucleic acid strands (hereafter called "colonies") .
  • These areas can contain large numbers of amplified nucleic acid molecules.
  • These molecules may be DNA and/or RNA molecules and may be provided in single or double stranded form. Both a given strand and its complementary strand can be provided in amplified form in a single colony.
  • Colonies of any particular size can be provided.
  • preferred colonies measure from lOnm to lOOum across their longest dimension, more preferably from lOOnm to lO ⁇ m across their longest dimension. Desirably a majority of the colonies present on a surface (i.e. at least 50% thereof) have sizes within the ranges given above.
  • Colonies can be arranged in a predetermined manner or can be randomly arranged. Two or three dimensional colony configurations are possible. The configurations may be regular (e.g. having a polygonal outline or having a generally circular outline) or they may be irregular. Colonies can be provided at high densities. Densities of over one colony/mm 2 of surface can be achieved. Indeed densities of over 10 2 , over 10 3 or even over 10 4 colonies/mm 2 are achievable using the present invention. In preferred embodiments, the present invention provides colony densities of 10 4"5 colonies/mm 2 , more preferably densities of 10 6"7 colonies/mm 2 , thus offering an improvement of 3 to 4 orders of magnitude relative to densities achievable using many of the prior art methods. It is this property of the invention that allows a great advantage over prior art, since the high density of DNA colonies allows a large number of diverse DNA templates (up to 10 6"7 colonies/mm 2 , to be randomly arrayed and amplified.
  • the immobilised primers for use in the present invention can be provided by any suitable means, as long as a free 3' -OH end is available for primer extension. Where many different nucleic acid molecules are to be amplified, many different primers may be provided. Alternatively "universal" primers may be used, whereby only one or two different types of primer (depending upon the embodiment of the invention) can be used to amplify the different nucleic acid molecules. Universal primers can be used where the molecules to be amplified comprise first and second sequences, as described previously. The provision of universal primers is advantageous over methods such as those disclosed in WO96/04404 (Mosaic Technologies, Inc.) where specific primers must be prepared for each particular sequence to be amplified.
  • Synthetic oligodeoxynucleotide primers are available commercially from many suppliers (e.g. Microsynth, Switzerland, Eurogentech, Belgium) .
  • Non covalent grafting of primers at the interface between an aqueous phase and a hydrophobic phase through an hydrophobic anchor is also possible for the present invention.
  • Such anchoring is commonly used for bio-macromolecules in general (S. Terrettaz et al. : Protein binding to supported lipid membranes, Langmuir 9,1361 (1993)).
  • Preferred forms of such interfaces would be liposomes, lipidic vesicles, emulsions, patterned bilayers, Langmuir or Langmuir- Blodgett films.
  • the patterns may be obtained by directed pattering on templates, e.g., silicon chips patterned through micro-lithographic methods (Goves, J.T. et al .
  • the patterns may also be obtained by due to the self-assembly properties of "colloids", e.g., emulsions or latex particles (Larsen, A.E. and D.G. Grier, Like charge attractions in metastable colloidal crystallites, Nature 385,230 (1997)).
  • "colloids” e.g., emulsions or latex particles
  • one, two or more different primers can be grafted onto a surface.
  • the primers can be grafted homogeneously and simultaneously over the surface.
  • microlithographic methods it is possible to provide immobilised primers in a controlled manner. If direct synthesis of oligonucleotides onto a solid support with a free 3' -OH end is desired, then micro-lithographic methods can be used to simultaneously synthesise many different oligonucleotide primers (Pirrung, M.C. and Bradley, J.C. Comparison of methods for photochemical phosphoramidite-based DNA- synthesis. Journal Of Organic Chemistry 60 (20) : 6270-6276, 1995). These may be provided in distinct areas that may correspond in configuration to colonies to be formed, (e.g. they may be several nanometers or micrometers across). Within each area, only a single type of primer oligonucleotide need be provided. Alternatively a mixture comprising a plurality of different primers may be provided. In either case, primers can be homogeneously distributed within each area. They may be provided in the form of a regular array.
  • areas initially comprise only one type of immobilised primer they may be modified, if desired, to carry two or more different types of primer.
  • One way to achieve this is to use molecules as templates for primer extension that have 3' ends that hybridise with a single type of primer initially present and that have 5' ends extending beyond the 3' ends of said primers.
  • primer extension of one type of primer using the mixture of such templates followed by strand separation will result in different modified primers.
  • the modified primers are referred to herein as "extended" primers in order to distinguish from the "primary" primers initially present on a surface) .
  • One, two or more different types of extended primer can be provided in this manner at any area where primary primers are initially located. Substantially equal portions of different templates can be used, if desired, in order to provide substantially equal proportions of different types of immobilised extended primer over a given area. If different proportions of different immobilised extended primers are desired, then this can be achieved by adjusting the proportions of different template molecules initially used accordingly.
  • a restriction endonuclease cleavage site may be located within the primer.
  • a primer may also be provided with a restriction endonuclease recognition site which directs DNA cleavage several bases distant (Type II restriction endonucleases) . (For the avoidance of doubt, such sites are deemed to be present even if the primer and its complement are required to be present in a double stranded molecule for recognition and/or cleavage to occur.)
  • a cleavage site and/or a recognition site may be produced when a primer is extended.
  • restriction endonucleases can be useful in allowing an immobilised nucleic acid molecule within a colony to be cleaved so as to release at least a part thereof.
  • ribozymes can be used to release at least parts of nucleic acid molecules from a surface (when such molecules are RNA molecules) .
  • Other methods are possible. For example if a covalent bond is used to link a primer to a surface this bond may be broken (e.g. by chemical, physical or enzymatic means) .
  • Primers for use in the present invention are preferably at least five bases long. Normally they will be less than 100 or less than 50 bases long. However this is not essential. Naturally occurring and/or non-naturally occurring bases may be present in the primers .
  • target nucleic acid molecules also referred to herein as “templates” for use in the method of the present invention
  • a target molecule (when in single-stranded form) comprises a first part having a sequence that can anneal with a first primer and a second part having a sequence complementary to a sequence that can anneal with a second primer.
  • the second part has the same sequence as the second primer.
  • the second primer may have a sequence that is the same as, or different from, the sequence of the first primer.
  • the first and second parts of the target nucleic acid molecules are preferably located at the 3' and at the 5' ends respectively thereof. However this is not essential.
  • the target molecule will usually also comprise a third part located between the first and second parts.
  • This part of the molecule comprises a particular sequence to be replicated. It can be from any desired source and may have a known or unknown (sometimes referred to as "anonymous") sequence. It may be derived from random fractionation by mechanical means or by limited restriction enzyme digestion of a nucleic acid sample, for example .
  • Further parts of the target molecules may be provided if desired. For example parts designed to act as tags may be provided.
  • a "tag' is defined by its function of enabling a particular nucleic acid molecule (or its complement) to be identified.
  • target nucleic acid molecules can be provided by techniques known to those skilled in the art of nucleic acid manipulation. For example, two or more parts can be joined together by ligation. If necessary, prior to ligation appropriate modifications can be made to provide molecules in a form ready for ligation. For example if blunt end ligation is desired then a single-strand specific exonuclease such as SI nuclease could be used to remove single stranded portions of molecules prior to ligation.
  • Linkers and/or adapters may also be used in nucleic acid manipulation. (Techniques useful for nucleic acid manipulation are disclosed in Sambrook et al , Molecular Cloning, 2 nd Edition, Cold Spring Harbor Laboratory Press (1989), for example.)
  • a template molecule Once a template molecule has been synthesised it can be cloned into a vector and can be amplified in a suitable host before being used in the present invention. It may alternatively be amplified by PCR. As a further alternative, batches of template molecules can be synthesised chemically using automated DNA synthesisers (e.g. from Perkin-Elmer/Applied Biosystems, Foster City, CA) .
  • the present invention allows large numbers of nucleic acid molecules identical in sequence to be provided in a colony arising from a single molecule of template. Furthermore, the template can be re-used to generate further colonies. Thus it is not essential to provide large numbers of template molecules to be used in colony formation.
  • the template can be of any desired length provided that it can participate in the method of the present invention. Preferably it is at least 10, more preferably at least 20 bases long. More preferably it is at least 100 or at least 1000 bases long. As is the case for primers for use in the present invention, templates may comprise naturally occurring and/or non-naturally occurring bases . Reaction Conditions
  • reaction conditions suitable for the method of the present invention uses repeated steps of annealing of primers to templates, primer extension and separation of extended primers from templates. These steps can generally be performed using reagents and conditions known to those skilled in PCR (or reverse transcriptase plus PCR) techniques. PCR techniques are disclosed, for example, in “PCR: Clinical Diagnostics and Research", published in 1992 by Springer- Verlag.
  • nucleic acid polymerase can be used together with a supply of nucleoside triphosphate molecules (or other molecules that function as precursors of nucleotides present in DNA/RNA, such as modified nucleoside triphosphates) to extend primers in the presence of a suitable template.
  • deoxyribonucleoside triphosphates are desirably provided.
  • Preferred deoxyribonucleoside triphosphates are abbreviated; dTTP (deoxythymidine nucleoside triphosphate) , dATP (deoxyadenosine nucleoside triphosphate) , dCTP (deoxycytosine nucleoside triphosphate) and dGTP (deoxyguanosine nucleoside triphosphate) .
  • Preferred ribonucleoside triphosphates are UTP, ATP, CTP and GTP. However alternatives are possible. These may be naturally or non- naturally occurring.
  • a buffer of the type generally used in PCR reactions may also be provided.
  • a nucleic acid polymerase used to incorporate nucleotides during primer extension is preferably stable under the pertaining reaction conditions in order that it can be used several times. (This is particularly useful in automated amplification procedures.)
  • the nucleic acid polymerase is preferably heat stable at the temperature used.
  • heat stable polymerases are known to those skilled in the art. They are obtainable from thermophilic micro-organisms . They include the DNA dependent DNA polymerase known as Taq polymerase and also thermostable derivatives thereof.
  • the nucleic acid polymerase need not however be DNA dependent . It may be RNA dependent . Thus it may be a reverse transcriptase - i.e. an RNA dependent DNA polymerase.
  • annealing of a primer to its template takes place at a temperature of 25 to 90°C. Such a temperature range will normally be maintained during primer extension. Once sufficient time has elapsed to allow annealing and also to allow a desired degree of primer extension to occur, the temperature can be increased, if desired, to allow strand separation. At this stage the temperature will typically be increased to a temperature of 60 to 100°C. [High temperatures can also be used to reduce non-specific priming problems prior to annealing. They can be used to control the timing of colony initiation, e.g.
  • the strands maybe separated by treatment with a solution of low salt and high pH (> 12) or by using a chaotropic salt (e.g. guanidinium hydrochloride) or by an organic solvent (e.g. formamide) .
  • a chaotropic salt e.g. guanidinium hydrochloride
  • an organic solvent e.g. formamide
  • a washing step will be performed.
  • the washing step can be omitted between initial rounds of annealing, primer extension and strand separation, if it is desired to maintain the same templates in the vicinity of immobilised primers. This allows templates to be used several times to initiate colony formation. (It is preferable to provide a high concentration of template molecules initially so that many colonies are initiated at one stage.)
  • the size of colonies can be controlled, e.g. by controlling the number of cycles of annealing, primer extension and strand separation that occur. Other factors which affect the size of colonies can also be controlled. These include the number and arrangement on a surface of immobilised primers, the conformation of a support onto which the primers are immobilised, the length and stiffness of template and/or primer molecules, temperature and the ionic strength and viscosity of a fluid in which the above-mentioned cycles can be performed.
  • colonies Once colonies have been formed they can be used for any desired purpose .
  • colonies may be modified to provide different colonies (referred to herein as "secondary colonies” in order to distinguish from the "primary colonies” initially formed) .
  • a surface comprising immobilised nucleic acid strands in the form of colonies of single stranded nucleic acid molecules is also within the scope of the present invention.
  • each immobilised nucleic acid strand within a colony will be located on the surface so that an immobilised and complementary nucleic acid strand thereto is located on the surface within a distance of the length of said immobilised nucleic acid strand (i.e. within the length of one molecule) .
  • This allows very high densities of nucleic acid strands and their complements to be provided in immobilised form.
  • a nucleic acid strand and its complement will preferably be substantially homogeneously distributed within the colony.
  • Such surfaces are also within the scope of the present invention. Normally, such surfaces are obtained after treating primary colonies, e.g., by partial digestion by restriction enzymes or by partial digestion after strand separation (e.g., after heating) by an enzyme which digests single stranded DNA) , or by chemical or physical means, (e.g., by irradiating with light colonies which have been stained by an intercalating dye e.g., ethidium bromide) .
  • an intercalating dye e.g., ethidium bromide
  • single stranded colonies can be used to provide double stranded molecules. This can be done, for example, by providing a suitable primer (preferably in solution) that hybridises to the 3' ends of single stranded immobilised molecules and then extending that primer using a nucleic acid polymerase and a supply of nucleoside triphosphates (or other nucleotide precursors) .
  • a suitable primer preferably in solution
  • non-bridged is used here to indicate that the molecules are not in the form of the bridge-like structures shown in e.g. figure lh.
  • small colonies can be provided that contain large numbers of nucleic acid molecules (whether single or double stranded) . Many colonies can therefore be located on a surface having a small area. Colony densities that can be obtained may therefore be very high, as discussed supra .
  • Different colonies will generally be comprised of different amplified nucleic acid strands and amplified complementary strands thereto.
  • the present invention allows many different populations of amplified nucleic acid molecules and their complements to be located on a single surface having a relatively small surface area.
  • the surface will usually be planar, although this is not essential.
  • the present invention also provides an apparatus for providing a surface comprising colonies of the immobilised nucleic acid molecules discussed supra .
  • Such an apparatus can include one or more of the following: a) means for immobilising primers on a surface (although this is not needed if immobilised primers are already provided) ;
  • a supply of precursors of the nucleotides to be incorporated into a nucleic acid e.g. a supply of nucleoside triphosphates
  • control means for co-ordinating the different steps required for the method of the present invention.
  • immobilised nucleic acids produced via the method of the present invention can include a source of reactants and detecting means for detecting a signal that may be generated once one or more reactants have been applied to the immobilised nucleic acid molecules. They may also be provided with a surface comprising immobilised nucleic acid molecules in the form of colonies, as described supra .
  • the means for detecting a signal has sufficient resolution to enable it to distinguish between signals generated from different colonies .
  • Apparatuses of the present invention are preferably provided in automated form so that once they are activated, individual process steps can be repeated automatically.
  • FIGURE 1 illustrates a method for the simultaneous amplification and immobilisation of nucleic acid molecules using a single type of primer.
  • FIGURE 2 illustrates how colony growth using a method of the present invention can occur.
  • FIGURE 3 illustrates the principle of the method used to produce DNA colonies using the present invention. It also illustrates the annealing, elongation and denaturing steps that are used to provide such colonies.
  • FIGURE 4 is an example of DNA colonies formed by amplification of a specific template with single primers grafted onto a surface.
  • FIGURE 5 illustrates a method for the simultaneous amplification and immobilisation of nucleic acid molecules using two types of primer.
  • FIGURE 6 shows actual DNA colonies produced via the present invention.
  • FIGURE 7 illustrates a method of the simultaneous amplification and immobilisation of nucleic acid molecules when a target molecule is used as a template having internal sequences that anneal with primers.
  • Figure 8 illustrates a method to synthesise additional copies of the original nucleic acid strands using nucleic acid strands present in colonies . The newly synthesised strands are shown in solution but can be provided in immobilised form if desired.
  • Figure 9 shows the PCR amplification of DNA from DNA found in the pre-formed DNA colonies.
  • FIGURE 10 illustrates how secondary primers can be generated from DNA colonies .
  • FIGURE 11 illustrates how secondary DNA colonies can be generated from secondary primers .
  • FIGURE 12 illustrates how primers with different sequences can be generated from a surface functionalised with existing primers .
  • FIGURE 13 depicts methods of preparing DNA fragments suitable for generating DNA colonies .
  • FIGURE 14 illustrates a method for synthesising cRNA using the DNA colony as a substrate for RNA polymerase.
  • FIGURE 15 illustrates a preferable method to determine the DNA sequence of DNA present in individual colonies.
  • FIGURE 16 illustrates a method of determining the sequence of a DNA colony, de novo .
  • FIGURE 17 illustrates the utility of secondary DNA colonies in the assay of mRNA expression levels.
  • FIGURES 18 and 19 illustrates the use of the secondary DNA colonies in the isolation and identification of novel and rare expressed genes.
  • a surface having attached thereto a plurality of primers (only one primer is shown for simplicity) .
  • Each primer (1) is attached to the surface by a linkage indicated by a dark block. This may be a covalent or a non-covalent linkage but should be sufficiently strong to keep a primer in place on the surface.
  • the primers are shown having a short nucleotide sequence (5' -ATT). In practice however longer sequences would generally be provided.
  • Figure lb shows a target molecule (II) that has annealed to a primer.
  • the target molecule comprises at its 3' end a sequence (5'- ATT) that is complementary to the primer sequence (5' -ATT).
  • the target molecule comprises a sequence (5' -ATT) that is the same as the primer sequence (although exact identity is not required) .
  • any sequence to be amplified (or the complement of any sequence to be amplified) can be provided.
  • part of the sequence to be amplified has been shown as 5' -CCG.
  • primer extension is shown.
  • a DNA polymerase is used together with dATP, dTTP, dGTP and dCTP to extend the primer (5' -ATT) from its 3' end, using the target molecule as a template.
  • an extended immobilised strand (III) is provided that is complementary to the target molecule.
  • the target molecule can then be separated from the extended immobilised strand (e.g. by heating, as shown in Figure le) ) .
  • This separation step frees the extended, immobilised strand so that it can then be used to initiate a subsequent round of primer extension, as shown in Figures If) and lg)
  • the extended, immobilised strand bends over so that one end of that strand (having the terminal sequence 5' -AAT) anneals with another primer (2, 5'-ATT), as shown in Figure If). That primer provides a 3' end from which primer extension can occur, this time using the extended, immobilised strand as a template.
  • Primer extension is shown occurring in Figure lg) and is shown completed in Figure lh) .
  • Figure li shows the two extended immobilised strands that were shown in Figure lh) after separation from one another (e.g. by heating) . Each of these strands can then themselves be used as templates in further rounds of primer extension initiated from new primers (3 and 4), as shown in Figures 1j ) and Ik).
  • Four single stranded, immobilised strands can be provided after two rounds of amplification followed by a strand separation step (e.g. by heating), as shown in Figure 11) . Two of these have sequences corresponding to the sequence of the target molecule originally used as a template. The other two have sequences complementary to the sequence of the target molecule originally used as a template. (In practice a given immobilised strand and its immobilised complement may anneal once.)
  • each extended immobilised molecule will be located at a surface within one molecule length of another extended immobilised molecule.
  • position 3 shown in Figure 11 is within one molecule length of position 1; position 1 is within one molecule length of position 2; and position 2 is within one molecule length of position 4.
  • Figure 2 is provided to illustrate how colony growth can occur (using the method described with reference to Figure 1 and to Figure 6 or any other method of the present invention for providing immobilised nucleic acid molecules) .
  • a flat plate is shown schematically in plan view having primers immobilised thereon in a square grid pattern (the primers are indicated by small dots) .
  • a regular grid is used solely for simplicity: in many real cases, the positions of the primers might indeed be less ordered or random.
  • a template molecule has annealed to a primer and an initial bout of primer extension has occurred to provide an immobilised, extended nucleic acid strand.
  • an end of that strand becomes free to anneal to further primers so that additional immobilised, extended nucleic acid strands can be produced.
  • This is shown having occurred sequentially at positions indicated by the letter Y.
  • the primer chosen for annealing is positioned next to the primer carrying the nucleic acid strand: in real cases, the nucleic acid strand could anneal with a primer which is not its next nearest neighbour. However, this primer will obviously be within a distance equal to the length of the nucleic acid strand.
  • FIG. 3 shows a simplified version of the annealing, elongation and denaturing cycle. It also depicts the typical observations that can be made, as can be seen on the examples shown in figures 4 and 6.
  • the simultaneous amplification and immobilisation of nucleic acids using solid phase primers has been successfully achieved using the procedure described in Examples 1, 2 and 3 below:
  • Oligonucleotides phosphorylated at their 5' -termini (Microsynth GmbH, Switzerland) , were grafted onto Nucleolink plastic microtitre wells (Nunc, Roskilde, Denmark) .
  • the sequence of the oligonucleotide p57 corresponds to the sequence 5' -TTTTTTCACCAACCCAAACCAACCCAAACC and p58 corresponds to the sequence 5 ' -TTTTTTAGAAGGAGAAGGAAAGGGAAAGGG .
  • Microtitre wells with p57 or p58 were prepared as follows.
  • Colony generation was initiated in each well with 15 ⁇ l of priming mix; 1 nanogram template DNA (where the template DNA began with the sequence 5' -AGAAGGAGAAGGAAAGGGAAAGGG and terminated at the 3 '-end with the sequence CCCTTTCCCTTTCCTTCTCCTTCT-3' ) , the four dNTPs (0.2 mM) , 0.1% BSA (bovine serum albumin, Boehringer-Mannheim, Germany), 0.1% Tween 20, 8% DMSO (dimethylsulfoxide, Fluka Chemicals, Switzerland), IX Amplitaq PCR buffer and 0.025 units/ ⁇ l of AmpliTaq DNA polymerase (Perkin Elmer, Foster City, CA) .
  • the priming reaction was a single round of PCR under the following conditions; 94 °C for 4 minutes, 60°C for 30 seconds and 72°C for 45 seconds in a thermocycler (PTC 200, MJ Research, Watertown, MA) . Then 100 ⁇ l TE buffer (lOmM trisHCl, pH 7.5, ImM EDTA) was used in three successive one minute long washes at 94 C C. The DNA colonies were then formed by adding to each well, 20 ⁇ l of polymerisation mix, which was identical to the priming mix but lacking the template DNA.
  • the wells were then placed in the PTC 200 thermocycler and colony growing was performed by incubating the sealed wells 4 minutes at 94 °C and cycling for 50 repetitions the following conditions: 94 °C for 45 seconds, 65°C for 2 minutes, 72°C for 45 seconds. After completion of this program, the wells were kept at 8°C until further use.
  • a 640 base pair fragment corresponding to the central sequence of the template was amplified by PCR.
  • the isolated fragment was labelled with biotin- N 4 -dCTP (NEN Life Sciences, Boston, MA) and a trace of [ ⁇ - 32 P]dCTP (Amersham, UK) using the Prime-it II labelling kit (Stratagene, San Diego, CA) to generate a biotinylated probe.
  • the biotinylated probe was diluted in to a concentration of 2.5 nM in EasyHyb (Boehringer-Mannheim, Germany) and 15 ⁇ l was hybridized to each sample with the following temperature scheme (PTC 200 thermocycler): 94°C for 5 minutes, followed by 500 steps of 0.1°C decrease in temperature every 12 seconds (in other words, the temperature is decreased down to 45 °C in 100 minutes) .
  • PTC 200 thermocycler 94°C for 5 minutes, followed by 500 steps of 0.1°C decrease in temperature every 12 seconds (in other words, the temperature is decreased down to 45 °C in 100 minutes) .
  • the samples are then washed as follows; 1 time with 2X SSC/0.1% SDS (2X SSC; 0.3M NaCl/0.03M sodium citrate pH7.0/0.001 mg/ml sodium dodecyl sulfate) at room temperature, once with 2X SSC/0.1% SDS at 37°C and once with 0.2X SSC/0.1% SDS at 50°C.
  • the wells are then incubated for 30 minutes with 50 ⁇ l of red fluorescent, Neutravidin-coated, 40 nm FluoSpheres (R) (580 nm excitation and 605 nm emission, Molecular Probes Inc., Eugene, OR) in TNT/0.1% BSA.
  • the solution of microspheres is made from a dilution of 2 ⁇ l of the stock solution of microspheres into 1ml of TNT/0.1% BSA, which is then sonicated for 5 minutes in a 50 W ultra-sound water-bath (Elgasonic, Switzerland) , followed by filtration through a 0.22 ⁇ m filter (Millex GV4). The wells are then counted (Cherenkov) on a Microbeta plate scintillation counter (WALLAC, Turku, Finland) . Excess FluoSpheres ⁇ R) are removed by washing for 30 min in TNT/0.1%BSA at room temperature.
  • Images of the stained samples are observed using a 20X objective on an inverted microscope (Axiovert S100TV, Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512x768 CCD camera (Princeton instruments, Trenton, NJ) through a XF43 filter set (PB546/FT580/LP590, Omega Optical, Brattleboro, VT) with a 5 second exposure.
  • a 20X objective on an inverted microscope (Axiovert S100TV, Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512x768 CCD camera (Princeton instruments, Trenton, NJ) through a XF43 filter set (PB546/FT580/LP590, Omega Optical, Brattleboro, VT) with a 5 second exposure.
  • PB546/FT580/LP590 Omega Optical, Brattleboro, VT
  • Figure 4 shows the hybridisation results for colony generation on tubes functionalised with either; (a) oligonucleotide p57 or (b) oligonucleotide p58.
  • the control reaction shows very few fluorescent spots, since the sequence of the flanking regions on the template do not correspond to the primer sequences grafted onto the well.
  • figure 4b shows the number of fluorescent spots detected when the primers grafted to the wells match the flanking sequences on the initiating DNA template. Calculating the number of fluorescent spots detected and taking into consideration the magnification, we can estimate that there are between 3 and 5 x 10 7 colonies/cm 2 .
  • the photos are generated by the program, Winview 1.6.2 (Princeton Instruments, Trenton, NJ) with backgrounds and intensities normalised to the same values.
  • the target molecule shown is provided with a nucleotide sequence at its 3' end (AAT-3' ) that is complementary to the sequence of a first primer, (5'-ATT, I), which is grafted on the surface, so that annealing with that primer can occur.
  • the sequence (5' -GGT) at the 5' end of the target molecule, III corresponds to the sequence (5' -GGT) of a second primer, II, which is also grafted to the surface, so that the sequence which is complementary to the sequence at the 5' end can anneal with that said second primer.
  • said complementary sequence (5' -ACC) is chosen so that it will not anneal with the first primer (5' -ATT).
  • a template has been cloned in a vector (pBlueScript Skminus, Stratagene Inc, San Diego, CA) with the appropriate DNA sequence at the cloning site (i.e., corresponding to PI and P2 at position 621 and 794 respectively) , and 174 bp long linear double stranded DNA template has been obtained by PCR amplification, using PI and P2.
  • the template PCR product has been purified on Qiagen Qia-quick columns (Qiagen GmbH, Hilden, Germany) in order to remove the nucleotides and the primers used during the PCR amplification.
  • the purified template in 50 ⁇ l solution containing IX PCR buffer (Perkin Elmer, Foster City, CA) with the four deoxyribonucleoside triphosphates (dNTPs) at 0.2 mM, (Pharmacia, Uppsala, Sweden) and 2.5 units of AmpliTaq Gold DNA polymerase (Perkin Elmer, Foster City, CA) ) has been spread on the support, i.e. on the Nucleolink plates grafted with PI and P2 (the plates have been rinsed with a solution containing 100 mM TRIS-HC1 (pH 7.5), 150 mM NaCl and 0.1% Tween 20 (Fluka, Switzerland) at room temperature for 15 min) .
  • IX PCR buffer Perkin Elmer, Foster City, CA
  • dNTPs deoxyribonucleoside triphosphates
  • AmpliTaq Gold DNA polymerase Perkin Elmer, Foster City, CA
  • This solution has been incubated at 93°C for 9 minutes to activate the DNA polymerase and then 60 cycles (94°C/30 sec.,48°C/30 sec.,72°C/30 sec.) have been performed on a PTC 200 thermocycler.
  • 60 cycles 94°C/30 sec.,48°C/30 sec.,72°C/30 sec.
  • concentrations of PCR template have been tested (approximately 1, 0.5, 0.25, 0.125, 0.0625 ng/ ⁇ l) and for each sample a control reaction carried out without Taq polymerase has been performed (same conditions as above but without DNA polymerase) .
  • YO-PRO Molecular Probes, Portland OR
  • YO-PRO Molecular Probes, Portland OR
  • the resulting products have been observed on a confocal microscope using a 40X objective (LSM 410, Carl Zeiss AG, Oberkochen, Germany) with appropriate excitation (an 488 argon laser) and detection filters (510 low pass filter) (note: the bottom of each well is flat and allows observation with an inverted fluorescence microscope) .
  • control well (without added DNA template, panel a) shows only rare objects which can be observed on a blank surface
  • Oligonucleotides (Microsynth GmbH, Switzerland) were grafted onto Nucleolink wells (Nunc, Denmark) .
  • Oligonucleotide PI corresponds to the sequence 5' -TTTTTTCTCACTATAGGGCGAATTGG and oligonucleotide P2 corresponds to 5' -TTTTTTCTCACTAAAGGGAACAAAAGCTGG.
  • a 45 ⁇ l of 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals, St. Louis, MO) solution containing 360 fmol of PI and 360 fmol of P2 was added.
  • SI and S2 are 704 base pair and 658bp fragments, respectively, which have been cloned into pBlueScript Skminus plasmids and subsequently amplified through a PCR using PI and P2 as primers. The fragments were purified on Qiagen Qia-quick columns (QIAGEN GmbH, Germany) in order to remove the nucleotides and the primers .
  • a 640base pair fragment corresponding to the central sequence of the SI fragment, but not including the PI or P2 sequence was amplified by PCR as previously described.
  • the probe was labelled with biotin-16- dUTP (Boehringer-Mannheim, Germany) using the Prime-it II random primer labelling kit (Stratagene, San Diego, CA) according to the manufacturers instructions .
  • the biotinylated probes were hybridized to the samples in EasyHyb buffer (Boehringer-Mannheim, Germany) , using the following temperature scheme (in the PTC 200 thermocycler) : 94°C for 5 minutes, followed by 68 steps of 0.5°C decrease in temperature every 30 seconds (in other words, the temperature is decreased down to 60 °C in 34 minutes), using sealed wells.
  • the samples are then washed 3 times with 200 ⁇ l of TNT at room temperature.
  • the wells are then incubated for 30 minutes with 50 ⁇ l TNT containing 0.1 mg/ l BSA.
  • the wells are incubated 5 minutes with 15 ⁇ l of solution of red fluorescent, Neutravidin-coated, 40 nm FluoS ⁇ heres (R) (580 nm excitation and 605 nm emission, Molecular Probes, Portland, OR) .
  • the solution of microspheres is made of 2 ⁇ l of the stock solution of microspheres, which have been sonicated for 5 minutes in a 50 W ultra-sound water-bath (Elgasonic, Bienne, Switzerland) , diluted in 1 ml of TNT solution containing 0.1 mg/ml BSA and filtered with Millex GV4 0.22 ⁇ m pore size filter (Millipore, Bedford, MA).
  • the stained samples are observed using an inverted Axiovert 10 microscope using a 20X objective (Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512x768 CCD camera (Princeton Instruments, Trenton, NJ) , using a XF43 filter set (PB546/FT580/LP590, Omega Optical, Brattleboro, VT) , and 10 seconds of light collection.
  • the files are converted to TIFF format and processed in the suitable software (PhotoPaint, Corel Corp., Ottawa, Canada).
  • the processing consisted in inversion and linear contrast enhancement, in order to provide a picture suitable for black and white print-out on a laser printer.
  • the figure 6B shows the results for 3 different ratios of the S1/S2 templates used in the initiating reaction: i) the S1/S2 is 1/0, many spots can be observed, ii) the S1/S2 is 1/10, and the number of spots is approximately 1/10 of the number of spots which can be observed in the i) image, as expected, and iii) the S1/S2 is 0/1, and only a few rare spots can be seen.
  • Figure 7 is provided to show that the sequences shown at the 5' and 3' ends of the target molecule illustrated in Figures 1 and 5 need not be located at the ends of a target molecule.
  • a target nucleic acid molecule (II) may have a sequence at each (or either) end that is neither involved in annealing with a primer nor in acting as a template to provide a complementary sequence that anneals with a primer (sequence 5'-AAA and sequence 5'-CCC).
  • One of the internal sequences (5' -AAT) is used as a template to synthesise a complementary sequence, III, thereto (5' -TTT), as is clear from figures 7(a) to 7(e).
  • the sequence 5' -TTT is not however itself used to provide a sequence complementary thereto, as is clear from figures 7(f) to 7(k). It can be seen from Figure 7(1) that only one of the four immobilised strands shown after two rounds of primer extension and a strand separation step comprises the additional sequence 5' -TTT and that no strand comprising a complementary sequence (5' -AAA) to this sequence is present (i.e. only one strand significantly larger than the others is present) . After several rounds of amplification the strand comprising the sequence 5' -TTT will represent an insignificant proportion of the total number of extended, immobilised nucleic acid molecules present.
  • Amplified, single stranded nucleic acid molecules present in colonies provided by the present invention can themselves be used as templates to synthesise additional nucleic acid strands.
  • Figure 8 illustrates one method of synthesising additional nucleic acids using immobilised nucleic acids as a starting point.
  • Colonies will usually comprise both a given nucleic acid strand and its complement in immobilised form (figure 8a) . Thus they can be used to provide additional copies not only of a given nucleic acid strand but also of its complement.
  • One way of doing this is to provide one or more primers (primers TTA and TGG) in solution that anneal to amplified, immobilised nucleic acid strands present in colonies (figure 8c) provided by the present invention.
  • primers may be the same as primers initially used to provide the immobilised colonies, apart from being provided in free rather than immobilised form.
  • the original DNA colony is denatured by heat to it single-stranded form (figure 8b) ,, allowing primers TTA and TGG to anneal to the available 3' end of each DNA strand.
  • Primer extension using AmpliTaq DNA polymerase and the four deoxyribonucleoside triphosphates (labelled or unlabeled) can then be used to synthesise complementary strands to immobilised nucleic acid strands or at least to parts thereof (step (iii)).
  • strands synthesised in this manner after separation from the immobilised strands, can, if desired, be annealed to one another (i.e. a given strand and its complement can anneal) to provide double-stranded nucleic acid molecules in solution. Alternatively they can be separated from one another to provide homogenous populations of single-stranded nucleic acid molecules in solution.
  • nucleic acid strands in different colonies have different sequences
  • primers can be provided to allow several or all of the colonies to be used as templates.
  • Such primers may be a mixture of many different primers (e.g. a mixture of all of the primers originally used to provide all of the colonies, but with the primers being provided in solution rather than in immobilised form) .
  • Oligonucleotides (Microsynth GmbH Balgach, Switzerland) were grafted onto Nucleolink wells (Nunc, Denmark) .
  • Oligonucleotide PI corresponds to the sequence 5' -TTTTTTTTTTCACCAACCCAAACCAACCCAAACC and oligonucleotide P2 corresponds to 5'-
  • TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG In each Nucleolink well, a 45 ⁇ l of 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals) solution containing 360 fmol of PI and 360 fmol of P2 was added. To each well, 15 ⁇ l of 40 mM l-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-imidazole, was added to the solution of oligonucleotides. The wells were then sealed and incubated at 50 °C for 16 hours.
  • initiation mix IX PCR buffer, 0.2 mM dNTPs and 0.75 units of AmpliTaq DNA polymerase, 20 nanograms of template DNA, where the template DNA was either SI DNA or S2 DNA or a 1/1 mixture of SI DNA and S2 DNA, as indicated in discussion to Example 3.
  • SI and S2 are 658 base pair and 704 b.p. fragments, respectively, which have been prepared as described in EXAMPLE 3.
  • set A was left untreated, set B has been incubated for 10 minutes with BAL-31 exonuclease (New England Biolabs, Beverly, MA) at 37°C in BAL-31 buffer (BAL-31 essentially digests double stranded DNA which has both ends free) , set C has been incubated for 10 minutes with SI nuclease (Pharmacia, Uppsala, Sweden) at 37 °C in SI buffer (SI nuclease essentially digests single stranded DNA) , set D, E and F have been incubated with both BAL-31 and SI nucleases. Reactions were stopped by rinsing the wells with TNT buffer.
  • BAL-31 exonuclease New England Biolabs, Beverly, MA
  • P70 and P71 are suited for the amplification of both SI and S2, since primer P70 contains the sequence of primer PI and p71 contains P2.
  • PCR has been performed with a set of forward (P150, 5' -GGTGCTGGTCCTCAGTCTGT) and reverse (P151, 5'- CCCGCTTACCAGTTTCCATT) primers which are within SI and not within S2 so as to produce a 321 bp PCR product
  • PCR has been performed with a set of forward (P152, 5'- CTGGCCTTATCCCTAACAGC) and reverse (P153, 5' -CGATCTTGGCTCATCACAAT) primers which are within S2 and not within Si so as to produce a 390 bp PCR product.
  • initially formed colonies it is also possible to modify initially formed colonies to provide different colonies (i.e. to provide colonies comprising immobilised nucleic acid molecules with different sequences from those molecules present in the initially formed colonies) .
  • initially formed colonies are referred to as “primary colonies” and the later formed colonies as “secondary colonies”.
  • primary colonies and the later formed colonies as “secondary colonies”.
  • secondary colonies A preliminary procedure is necessary to turn the primary colonies into “secondary primers" which will be suitable for secondary colony generation.
  • Figure 10 shows how Secondary primers' are generated using existing primary colonies.
  • the primary colony (figure 10a) is left in the fully hybridised, double-stranded form.
  • a single-strand specific DNA exonuclease might be used to remove all primers which have not been elongated.
  • the DNA molecules forming the colonies can be cleaved by using endonucleases.
  • endonucleases For example, a restriction enzyme that recognises a specific site within the colony (depicted by the 'RE' arrow in figure 10c) and cleaves the DNA colony (step (ii) , figure 10) .
  • the enzymatically cleaved colony (figure lOd) can then be partially digested with a 3' to 5' double-strand specific exonuclease (e.g. E . coli exonuclease III, depicted by 'N' , step (iii) , figure lOd) .
  • the secondary primers are available after denaturation (e.g., by heat) and washing (figure lOe) .
  • the double stranded DNA forming the colonies can be digested with the double-strand specific 3' -5' exonuclease, which digest only one strand of double stranded DNA.
  • An important case is when the exonuclease digests only a few bases of the DNA molecule before being released in solution, and when digestion can proceed when another enzyme binds to the DNA molecule (figure lOg) .
  • Templates useful for secondary colony growing may include molecules having known sequences (or complements of such sequences) .
  • templates may be derived from unsequenced molecules (e.g. random fragments). In either event the templates should be provided with one or more regions for annealing with nucleic acid strands present in the primary colonies.
  • Figure 11 a-e show how a secondary colony can be generated when an appropriate template (TP, figure 11a) is provided for a second round of DNA colony generation on a support for secondary colony growing, holding secondary primers.
  • treatment of the primary colony as described above has generated the secondary primers, SP1 and SP2 (figure 11a) .
  • the template TP will hybridise to its complementary secondary primer, SP1, and following an extension reaction using a DNA polymerase as described, will be extended as depicted (figure 12b) .
  • a replica of the original primary colony will be formed (figure lie) .
  • the maximum size of a secondary colony provided by this embodiment of the present invention is restricted by the size of the primary colony onto which it grows.
  • Several secondary growing processes can be used sequentially to create colonies for specific applications (i.e. a first colony can be replaced with a second colony, the second colony can be replaced with a third colony, etc.)
  • Figure 12 shows how extended primers can be generated on an array of oligonucleotides. The same procedure could be applied to a support covered with colonies or secondary primers as described in section E.
  • a support having a plurality of immobilised primers shown thereon. Different immobilised primers are shown present in different regions of the support (represented by squares). Primers having the sequence 5' -AAA are present in one square and primers having the sequence 5' -GGG are present in another square.
  • Figures 12b) to 12d) show how the initial primers present (initial primers) are modified to give different primers (extended primers) .
  • those initial primers having the sequence 5' -AAA are modified to produce two different types of extended primers, having the sequences 5'-AAAGCC and 5'-AAATAC respectively. This is achieved by the hybridisation of oligonucleotide templates, 5'-GTATTT and 5'- GGCTTT to the primary primers immobilised on the surface (figure 12b) , followed by DNA polymerase reaction.
  • Those initial primers having the sequence 5' -GGG are modified to produce two different types of extended primers, having the sequences 5'-GGGTAT and 5'- GGGTAA (figure 12d) in a similar manner.
  • the technique of producing extended primers is useful for transforming immobilised oligonucleotides provided on a DNA chip or other surface into immobilised primers useful in amplifying a particular target nucleic acid sequence and/or in amplifying a complementary strand thereto.
  • the DNA of interest is first extracted from the biological sample and cut randomly into "small" pieces (e.g., 50 to 10,000 bases long, but preferentially 500 to 1000 base pairs in length, represented by bar 'I', figure 13a). (This can be done e.g., by a phenol-chloroform extraction followed by ultrasound treatment, mechanical shearing, by partial digestion with frequent cutter restriction endonucleases or other methods known by those skilled in the art) .
  • the extracted and cut DNA fragments can be size-fractionated, e.g., by agarose gel electrophoresis, sucrose gradient centrifugation or gel chromatography. Fragments obtained within a single fraction can be used in providing templates in order to reduce the variability in size of the templates.
  • the extracted, cut and (optionally) sorted template DNA fragments can be ligated with oligonucleotide linkers (Ila and lib, figure 13a) containing the sequence of the primer (s) which have previously been grafted onto a support. This can be achieved, for instance, using "blunt-end" ligation.
  • the template DNA fragments can be inserted into a biological vector at a site that is flanked by the sequence of the primers that are grafted on the support. This cloned DNA can be amplified within a biological host and extracted. Obviously, if one is working with a single primer grafted to the solid support for DNA colony formation, purifying fragments containing both PI and P2 primers does not pose a problem.
  • DNA fragments obtained after such a suitable process are designated by the expression : "prepared genomic DNA” (III, figure 13a) .
  • the procedure is the same as that described in the previous section except that in this case, the oligonucleotide linkers used to tail the randomly cut genomic DNA fragments are now made of two parts; the sequence of the primers grafted onto the surface (PI and P2, figure 13b) and a "tag" sequence which is different for each sample and which will be used for identifying the origin of the DNA colony.
  • the tag may not be unique, but a plurality of tags could be used.
  • we will designate the DNA fragments obtained after such a suitable process by the expression : "tagged genomic DNA" (III, Figure 13b) .
  • This tagging procedure can be used for providing colonies carrying a means of identification which is independent from the sequence carried by the template itself. This could also be useful when some colonies are to be recovered specifically (using the procedure given in section D) . This could also be useful in the case the recovered colonies are further processed, e.g., by creating new primary colonies and a cross reference between the original colonies and the new colonies is desired.
  • the DNA of interest can first be extracted from a biological sample by any means known by those skilled in the art (as mentioned supra) . Then the specific sequences of interest can be amplified with PCR
  • step (i), figure 13d) The procedure is the same as in the previous section except that in this case the DNA primers (Ila and lib) used to perform the PCR amplification (step (i), figure 13d) are now made of three parts; 1) the sequence of the primers grafted onto the surface (PI and P2), 2) a "tag" sequence which is different for each sample and which will be used for the identifying the origin of the DNA colony and 3) primer sequences surrounding the specific sequence of interest (SI and S2) . Note that for each sample, a plurality of tags might be used, as in (ii) supra .
  • the procedure is similar to the procedures described for preparing DNA fragments in the previous sections except that the starting point is to extract mRNA by any means known to those skilled in the art (e.g., by use of commercially available mRNA preparation kits).
  • the mRNA can be copied into double-stranded cDNA by any means known to those skilled in the art (e.g. by using a reverse transcriptase and a DNA polymerase) .
  • the tags and primers described supra can be used in conjunction with the process of double-stranded cDNA synthesis to allow their incorporation into the templates.
  • we will designate the mRNA fragments obtained after such suitable processes by the expressions: "prepared total mRNA" (cf.
  • labels may be used to provide detectable signals.
  • Examples include: a) a fluorescent group or a energy-transfer based fluorescence system.
  • colonies can be incubated with streptavidin labelled with a fluorescent group or an enzyme (e.g. fluorescent latex beads coated with streptavidin; streptavidin labelled with fluorescent groups; enzymes for use with the corresponding fluorescence assay) .
  • colonies can be incubated with antibodies (e.g. specific for a hapten) .
  • the antibodies can be labelled with a fluorescent group or with an enzyme (e.g. fluorescent latex beads coated with the antibody; antibodies labelled with fluorescent groups; antibodies linked to an enzyme for use with a corresponding fluorescence or luminescence assay, etc.).
  • a radio-label e.g. incorporated by using a 5' -polynucleotide kinase and [ ⁇ - 32 P] adenosine triphosphate or a DNA polymerase and [oc- 32 P or ⁇ - 33 P] deoxyribonucleoside triphosphates to add a radioactive phosphate group (s) to a nucleic acid).
  • colonies can be incubated with a scintillation liquid.
  • a dye or other staining agent e.g. incorporated by using a 5' -polynucleotide kinase and [ ⁇ - 32 P] adenosine triphosphate or a DNA polymerase and [oc- 32 P
  • Labels for use in the present invention are preferably attached a) to nucleic acids b) to proteins which bind specifically to double stranded DNA (e.g., histones, repressors, enhancers) and/or c) to proteins which bind specifically to single stranded DNA (e . g. single-stranded nucleic acid binding protein) .
  • Labelled colonies are preferably detected by: a) measuring fluorescence. b) measuring luminescence. c) measuring radioactivity d) measuring flow or electric field induced fluorescence anisotropy. and/or e) measuring the polymer layer thickness.
  • Staining agents can be used in the present invention.
  • DNA colonies can be incubated with a suitable DNA-specific staining agent, such as the intercalating dyes, ethidium bromide, YO-YO, YO- PRO (Molecular Probes, Eugene, OR) .
  • a suitable DNA-specific staining agent such as the intercalating dyes, ethidium bromide, YO-YO, YO- PRO (Molecular Probes, Eugene, OR) .
  • DNA colonies are first prepared for hybridisation. Then they are hybridised with a probe (labelled or unlabelled) . If required, the hybridised probed is assayed, and the result is observed. This can be done with an apparatus of the present invention (e.g. as described supra) .
  • colonies are treated with a DNA restriction endonuclease which is specific either for a sequence provided by a double stranded form of one of the primers originally grafted onto the surface where colonies are formed or for another sequence present in a template DNA molecule (see e.g. figure 16c) .
  • the colonies can be heated to a temperature high enough for double stranded DNA molecules to be separated. After this thermal denaturing step, the colonies can be washed to remove the non-hybridised, detached single-stranded DNA strands, leaving a remaining attached single-strand DNA.
  • the colonies can be partially digested with a double-strandspecific 3' to 5' DNA exonuclease (see section E, figure lOf) which removes one strand of DNA duplexes starting from the 3' end, thus leaving a part of a DNA molecule in single stranded form.
  • a double-strandspecific 3' to 5' DNA exonuclease see section E, figure lOf
  • DNA in colonies can first be heat denatured and then partially digested with an single-strand specific 3' to 5' DNA exonuclease which digests single stranded DNA starting from the 3' end.
  • a further alternative is simply to heat denature DNA in the colonies.
  • Single-stranded nucleic acid probes (labelled or unlabelled) can be hybridised to single-stranded DNA in colonies at the appropriate temperature and buffer conditions (which depends on the sequence of each probe, and can be determined using protocols known to those skilled in the art) .
  • a hybridised probe provided initially in unlabelled form can be used as a primer for the incorporation of the different (or a subset of the different) labelled (or a mix of labelled and unlabelled) deoxyribonucleoside triphosphates with a DNA polymerase.
  • the incorporated labelled nucleotides can then be detected as described supra .
  • the DNA colonies can be prepared for hybridisation by the methods described supra . Then they can be hybridised with a probe (labelled or initially unlabelled) . If required, hybridised labelled probes are assayed and the result is observed with an apparatus as described previously. The probe may then be removed by heat denaturing and a probe specific for a second DNA sequence may be hybridised and detected. These steps maybe repeated with new probes as many times as desired.
  • the probes can be assayed as described supra for unlabelled probes, except that only a subset (preferably 1 only) of the different (labelled or unlabelled) nucleotides are used at each cycle.
  • the colonies can then be assayed for monitoring the incorporation of the nucleotides. This second process can be repeated until a sequence of a desired length has been determined.
  • DNA colonies can be used as templates for in si tu RNA synthesis as depicted in figure 14.
  • DNA colonies can be generated from templates and primers, such that a RNA polymerase promoter sequence is positioned at one end of the double-stranded DNA in the colony.
  • DNA colonies can then be incubated with RNA polymerase and the newly synthesised RNA (cRNA) can be assayed as desired. The detection can be done non-specifically (e.g., staining) or in a sequence dependent way (e.g., hybridisation).
  • the DNA template (I, figure 14a) to be amplified into a colony is generated by PCR reaction using primers (Ila and lib) which have the following four parts; 1) sequence identical to the sequences of the primers grafted onto the surface ( ⁇ P1' and ⁇ P2'), 2) a "tag" sequence which is different for each sample , a sequence corresponding to a RNA polymerase promoter, ie. the T3, T7 and SP6 RNA promoters, ( ⁇ RPP' , figure 14a) and 4) primer sequences surrounding the specific sequence of interest ( ⁇ S1' and ⁇ S2' ) .
  • primers Ila and lib
  • cRNA thus synthesised can be isolated and used as hybridisation probes, as messenger RNA (mRNA) templates for in vi tro protein synthesis or as templates for in situ RNA sequence analysis.
  • mRNA messenger RNA
  • colonies can be analysed in order to determine sequences of nucleic acid molecules which form the colonies. Since very large numbers of the same nucleic acid molecules can be provided within each colony the reliability of the sequencing data obtained is likely to be very high.
  • sequences determined may be full or partial. Sequences can be determined for nucleic acids present in one or more colonies. A plurality of sequences may be determined at the same time.
  • sequence of a complementary strand to a nucleic acid strand to be sequenced may be obtained initially.
  • this sequence can be converted using base-pairing rules to provide the desired sequence (or a part thereof) .
  • This conversion can be done via a computer or via a person. It can be done after each step of primer extension or can be done at a later stage.
  • Sequencing can be done by various methods . For example methods relying on sequential restriction endonuclease digestion and linker ligation can be used. One such method is disclosed in WO95/27080 for example. This method comprises the steps of: ligating a probe to an end of a polynucleotide, the probe having a nuclease recognition site; identifying one or more nucleotides at the end of the polynucleotide; and cleaving the polynucleotide with a nuclease recognising the nuclease recognition site of the probe such that the polynucleotide is shortened by one or more nucleotides.
  • amplified nucleic acid molecules are sequenced by allowing primers to hybridise with the nucleic acid molecules, extending the primers and detecting the nucleotides used in primer extension.
  • primers Preferably, after extending a primer by a single nucleotide, the nucleotide is detected before a further nucleotide is used in primer extension (step-by-step sequencing) .
  • label is used in its broad sense to indicate any moiety that can be identified using an appropriate detection system.
  • the label is not present in naturally- occurring nucleotides.
  • labels are non-radioactive, such as fluorophores. However radioactive labels can be used.
  • nucleotides are provided in labelled form the labels may be the same for different nucleotides. If the same label is used each nucleotide incorporation can be used to provide a cumulative increase of the same signal (e.g. of a signal detected at a particular wavelength) . Alternatively different labels may be used for each type of nucleotide (which may be detected at different wavelengths) .
  • dATP dATP
  • dTTP dTTP
  • dCTP dCTP
  • dGTP dGTP
  • ATP adenosine triphosphate
  • UTP adenosine triphosphate
  • CTP adenosine triphosphate
  • GTP adenosine triphosphate
  • a mixture of labelled and unlabelled nucleotides may be provided, as will be described in greater detail later on.
  • the sequencing of nucleic acid molecules present in at least 2 different colonies is performed simultaneously. More preferably, sequencing of nucleic acid molecules present in over 10, over 100, over 1000 or even over 1,000,000 different colonies is performed simultaneously. Thus if colonies having different nucleic acids molecules are provided, many different sequences (full or partial) can be determined simultaneously - i.e. over 10, over 100, over 1000 or even over 1,000,000 different sequences may be determined simultaneously.
  • controls may be provided, whereby a plurality of colonies comprising the same nucleic acid molecules are provided. By determining whether or not the same sequences are obtained for nucleic acid molecules in these colonies it can be ascertained whether or not the sequencing procedure is reliable.
  • FIG 17 is entitled “ in si tu sequencing”.
  • cyclic addition of the individual deoxyribonucleoside triphosphates and DNA polymerase will allow the determination of the DNA sequence immediately 3' to the sequencing primer.
  • the addition of dGTP allows the determination of colony 1 to contain a 'G' .
  • addition of dATP is detected in both colonies, determining that both colonies have an 'A' in the next position.
  • sequences of at least 10, at least 20, at least 50 or at least 100 bases may be determined.
  • colonies are provided initially in a form comprising double- stranded molecules the colonies can be processed to provide single- stranded molecules for use in sequencing as described above.
  • double stranded molecules can be used for sequencing without such processing.
  • a double stranded DNA molecule can be provided with a promoter sequence and step-by- step sequencing can then be performed using an RNA polymerase and labelled ribonucleotides (cf Figure 16 d) ) .
  • Another alternative is for a nick to be introduced in a double stranded DNA molecule so that nick translation can be performed using labelled deoxyribonucleotides . and a DNA polymerase with 5' to 3' exonuclease activity.
  • double-stranded immobilised molecules present in a colony are cleaved and this is followed by a denaturing step.
  • a denaturing step could be used initially and could be followed by a cleavage step
  • cleavage is carried out enzymatically.
  • other means of cleavage are possible, such as chemical cleavage.
  • Denaturing can be performed by any suitable means. For example it may be performed by heating and / or by changing the ionic strength of a medium in the vicinity of the nucleic acid molecules.
  • primers for primer extension can be hybridised thereto.
  • Oligonucleotides are preferred as primers. These are nucleic acid molecules that are typically 6 to 60, e.g. 15 to 25 nucleotides long. They may comprise naturally and / or non-naturally occurring nucleotides. (However other molecules, e.g. longer nucleic acid strands may alternatively be used as primers, if desired. )
  • the primers for use in sequencing preferably hybridise to the same sequences present in amplified nucleic acid molecules as do primers that were used to provide said amplified nucleic acids. (Primers having the same / similar sequences can be used for both amplification and sequencing purposes) .
  • annealing conditions prevent non-specific hybridisation.
  • These may be stringent conditions. Such conditions would typically be annealing temperatures close to a primer's Tm (melting temperature) at a given salt concentration (e.g. 50 nM primer in 200 mM NaCl buffer at 55 °C for a 20-mer oligonucleotide with 50% GC content) .
  • salt concentration e.g. 50 nM primer in 200 mM NaCl buffer at 55 °C for a 20-mer oligonucleotide with 50% GC content
  • primer extension need not be provided in solution, since they can be provided in immobilised form. In this embodiment the primers should be provided in the vicinity of the immobilised molecules to which they are to be annealed. (Such primers may indeed already be present as excess immobilised primers that were not used in amplifying nucleic acid molecules during the formation of colonies. )
  • the nucleic acid molecules present in colonies to be sequenced will include a sequence that hybridises to the primers to be used in sequencing (preferably under "stringent" conditions) .
  • This portion can be added to a given molecule prior to amplification (which molecule may have a totally / partially unknown sequence) using techniques known to those skilled in the art. For example it can be synthesised artificially and can be added to a given molecule using a ligase.
  • RNA or DNA polymerases can be used.
  • DNA polymerases are however the enzymes of choice for preferred embodiments. Several of these are commercially available. Polymerases which lack 3' to 5' exonuclease activity can be used, such as T7 DNA polymerase or the small (Klenow) fragment of DNA polymerase I may be used [e.g. the modified T7 DNA polymerase SequenaseTM 2.0 (Amersham) or Klenow fragment (3' to 5' exo-, New England Biolabs)]. However it is not essential to use such polymerases.
  • thermostable polymerases such as ThermoSequenaseTM (Amersham) or TaquenaseTM (ScienTech, St Louis, MO) . Any nucleotides may be used for primer extension reactions (whether naturally occurring or non- naturally occurring) .
  • Preferred nucleotides are deoxyribonucleotides ⁇ dATP, dTTP, dGTP and dCTP (although for some applications the dTTP analogue dUTP is preferred) or ribonucleotides ATP, UTP, GTP and CTP; at least some of which are provided in labelled form.
  • a washing step is preferably incorporated after each primer extension step in order to remove unincorporated nucleotides that may interfere with subsequent steps.
  • the preferred washing solution should be compatible with polymerase activity and have a salt concentration that does not interfere with the annealing of primer molecules to the nucleic acid molecules to be sequenced. (In less preferred embodiments, the washing solution may interfere with polymerase activity. Here the washing solution would need to be removed before further primer extension.
  • a combination of labelled and non- labelled nucleotides can be used.
  • the number of labels incorporated in each colony during primer extension can be sufficient to be detected by a detection device.
  • the ratio of labelled to non-labelled nucleotides may be chosen so that, on average, labelled nucleotides are used in primer extension less than 50%, less than 20%, less than 10% or even less than 1% of the time (i.e. on average in a given primer extension step a nucleotide is incorporated in labelled form in less than 50%, less than 20%, less than 10 %, or less than 1% of the extended primers.
  • Steps b) and c) may be repeated one or more times.
  • a plurality of different colonies are provided and several different sequences are determined simultaneously.
  • This further embodiment of the present invention can be used to reduce costs, since relatively few labelled nucleotides are needed. It can also be used to reduce quenching effects.
  • nucleotides for primer extension or to use a major portion thereof (eg. over 50 %, over 70% or over 90% of the nucleotides used may be labelled) .
  • labels may be removed or neutralised at various stages should quenching effects become problematic (e.g. laser bleaching of fluorophores may be performed).
  • this can increase the number of steps required and it is therefore preferred that labels are not removed (or at least that they are not removed after each nucleotide has been incorporated but are only removed periodically) .
  • the primer itself and its extension product may be removed and replaced with another primer.
  • a plurality of labelled bases are incorporated into an extended primer during sequencing. This is advantageous in that it can speed up the sequencing procedure relative to methods in which, once a labelled base has been incorporated into an extended primer, the label must be removed before a further labelled base can be incorporated.
  • the plurality of labelled bases may be in the form of one or more contiguous stretches, although this is not essential.
  • the present invention therefore also includes within its scope a method for sequencing nucleic acid molecules, comprising the steps of:
  • each colony with a nucleic acid polymerase and a given labelled nucleotide under conditions that allow extension of the primers if a complementary base or if a plurality of such bases is present at the appropriate position in the single stranded nucleic acid molecules;
  • sequences of the nucleic acid molecules present at said first and said locations are different from one another - i.e. a plurality of colonies comprising different nucleic acid molecules are sequenced
  • Various detection systems can be used to detect labels used in sequencing in these methods (although in certain embodiments detection may be possible simply by eye, so that no detection system is needed) .
  • a preferred detection system for fluorescent labels is a Charge-Coupled-Device (CCD) camera, which can optionally be coupled to a magnifying device. Any other device allowing detection and, preferably, also quantification of fluorescence on a surface may be used. Devices such as fluorescent imagers or confocal microscopes may be chosen.
  • the labels may be radioactive and a radioactivity detection device would then be required. Ideally such devices would be real-time radioactivity imaging systems. Also less preferred are other devices relying on phosphor screens (Moleculal Dynamics) or autoradiography films for detection.
  • a scanning system may be preferred for data collection.
  • a detector may move relative to a plurality of colonies to be analysed. This is useful when all the colonies providing signals are not within the field of view of a detector.
  • the detector may be maintained in a fixed position and colonies to be analysed may be moved into the field of view of the detector (e.g. by means of a movable platform). Alternatively the colonies may be maintained in fixed position and the detection device may be moved to bring them into its field of view.
  • the detection system is preferably used in combination with an analysis system in order to determine the number (and preferably also the nature) of bases incorporated by primer extension at each colony after each step. This analysis may be performed immediately after each step or later on, using recorded data. The sequence of nucleic acid molecules present within a given colony can then be deduced from the number and type of nucleotides added after each step.
  • the detection system is part of an apparatus comprising other components .
  • the present invention includes an apparatus comprising a plurality of labelled nucleotides, a nucleic acid polymerase and detection means for detecting labelled nucleotides when incorporated into a nucleic acid molecule by primer extension, the detection means being adapted to distinguish between signals provided by labelled nucleotides incorporated at different colonies.
  • the apparatus may also include temperature control, solvent delivery and washing means. It may be automated.
  • nucleic acid molecules which are to be sequenced to check if one or more differences relative to a known sequence are present (e.g. identification of polymorphisms). This is sometimes referred to as "re-sequencing”.
  • the order of nucleotides applied to a given location can be chosen as desired. For example one may choose the sequential addition of nucleotides dATP, dTTP, dGTP, dCTP; dATP, dTTP, dGTP, dCTP; and so on. (Generally a single order of four nucleotides would be repeated, although this is not essential.)
  • the order of nucleotides to be added at each step is preferably chosen according to a known sequence.
  • Re-sequencing may be of particular interest for the analysis of a large number of similar template molecules in order to detect and identify sequence differences (e.g. for the analysis of recombinant plasmids in candidate clones after site directed mutagenesis or more importantly, for polymorphism screening in a population) .
  • Differences from a given sequence can be detected by the lack of incorporation of one or more nucleotides present in the given sequence at particular stages of primer extension.
  • the present method allows for detection of any type of mutation such as point mutations, insertions or deletions.
  • not only known existing mutations, but also previously unidentified mutations can be characterised by the provision of sequence information.
  • long nucleic acid molecules may have to be sequenced by several sequencing reactions, each one allowing for determination of part of the complete sequence. These reactions may be carried out at different colonies (where the different colonies are each provided with the same nucleic acid molecules to be sequenced but different primers), or in successive cycles applied at the same colony (where between each cycles the primers and extension products are washed off and replaced by different primers) .
  • This embodiment of the present invention aims to solve the problem of screening a large population for the identification of given features of given genes, such as the detection of single nucleotide polymorphisms .
  • it consists in generating tagged genomic DNA (see section G(ii) supra) . (Thus each sample originating from a given individual sample has been labelled with a unique tag) .
  • This tagged DNA can be used for generating primary colonies on an appropriate surface comprising immobilised primers. Several successive probe hybridisation assays to the colonies can then be performed. Between each assay the preceding probe can be removed, e.g. by thermal denaturation and washing.
  • a PCR amplification can be performed to specifically amplify the gene of interest and to link a tag and a colony generating primer (refer to section G(iv), preparation of "tagged DNA").
  • Another advantage of using the present invention lies in the fact that it overcomes the problem arising with individuals who have heterozygous mutations for a given gene. While this problem may be addressed by existing sequencing methods to determine allelic polymorphisms, current high throughput mutation detection methods based on oligonucleotide probe hybridisation may lead to difficulties in the interpretation of results due to an unequal hybridisation of probes in cases of allelic polymorphisms and therefore errors can occur.
  • each colony arises from a single copy of an amplified gene of interest. If an average of 10 colonies are generated for each individual locus, there will be an average of 5 colonies corresponding to one version of a gene and 5 colonies corresponding to the other version of the gene. Thus heterozygotic mutations can be scored by the number of times a single allele is detected per individual genome sample.
  • This embodiment of the present invention provides a solution to the problem of identifying and characterising novel allelic polymorphisms within known genes in a large population of biological samples.
  • the DNA sequence 3' to a specific probe may be determined directly by in si tu sequencing' (section I (iii), Methods of sequencing).
  • the present invention can allow the whole screening experiment to be performed in approximately one day, with one apparatus. This can be compared to the most powerful systems operational at the present time.
  • Genomic DNA can be prepared, either directly from the total DNA of an organism of interest or from a vector into which DNA has been inserted.
  • the prepared genomic DNA (from whatever source) can be used to generate DNA colonies.
  • the DNA colonies can then be digested with a rare- cutting restriction enzyme, whose site is included in the linker, denatured and sequenced.
  • Figure 16 depicts an example of de novo DNA sequencing.
  • genomic DNA is fragmented into pieces of 100 to 2000 base pairs (see preparation of random DNA fragments, section G(i)). These fragments will be ligated to oligonucleotide linkers (Ila and lib, figure 16a) which include sequences specific for the grafted primers on the surface ( 'PI' and 'P2' ) , a sequence which is recognised by a rare-cutting restriction nuclease ( 'RE' ) and a sequence corresponding to a sequencing primer ( 'SP' ) , resulting in templates (III, figure 16b) .
  • oligonucleotide linkers Ila and lib, figure 16a
  • oligonucleotide linkers include sequences specific for the grafted primers on the surface ( 'PI' and 'P2' ) , a sequence which is recognised by a rare-cutting restriction nuclease ( 'RE' ) and a
  • the throughput obtainable can be at least 400 times higher than presently available methods.
  • This embodiment of our invention means to solve the problem of monitoring the expression of a large number of genes simultaneously.
  • the DNA used for this preparation is 'prepared genomic DNA' or 'tagged genomic DNA', as described in section G(i) and G(iii), respectively, and where the DNA is either from the whole genome of one (or several) organism(s) or from a subset thereof (e.g., from a library of previously isolated genes) .
  • the uppercase letters, "A", "B” and “D” represent colonies which have arisen from genes which exhibit high, medium and low expression levels, respectively, and "E” represents colonies arising from non- expressed genes (in real cases, all these situations may not necessarily be present simultaneously) .
  • the colonies are treated to turn then into supports (i.e. secondary primers) for secondary colony growing (step i in figure 17a), as described in section E.
  • the treated colonies are represented by underlined characters (A, B, D, or E) .
  • this support for secondary colony growing is used to regenerate colonies from mRNA (or cDNA) templates extracted from a biological sample, as described in section C. If the template is mRNA, the priming step of colony regeneration will be performed with a reverse transcriptase.
  • step iii in figure 17c additional cycles of colony growing are performed (preferably 2 to 50), and the colonies which have not been totally regenerated during the previous steps finally become totally regenerated, "b" becomes “B”, “d” becomes “D” (figure 17d) : the colonies corresponding to genes with high and medium expression levels are all regenerated “A” and “B” or “B”; the colonies corresponding to genes with low levels of expression are not all regenerated “D” and “D”; the colonies corresponding to non-expressed sequences are not regenerated at all "E”.
  • the relative levels of expression of the genes can be obtained by the following preferred methods:
  • levels of expression can be monitored by counting, for each gene, the number of colonies which have been regenerated and comparing this number to the total number of colonies corresponding to that gene. These measurements will generally give access to the relative expression levels of the genes represented by the colonies.
  • the identification of the colonies is preferably performed by fingerprinting, in a manner essentially similar to embodiment, section I(iv). Note that encoding the DNA samples is not required, but can be considered as an alternative to the direct identification of the DNA in the colonies.
  • This embodiment of our invention has many advantages if compared to current state of the art including: a very high throughput; no requirement for prior amplification of the mRNA (even though prior amplification is compatible with or invention) ; small amounts of samples and reactants are required due to the high density of samples with our invention; the presence of highly expressed genes has no incidence on the ability to monitor genes with low levels of expression; the ability to simultaneously monitor low and high levels of expression within the set of genes of interest.
  • this embodiment When the initial DNA in the generation of the primary DNA colony is made from the DNA of a whole genome, this embodiment also provides the following features: there is no interference between genes expressed at high level and at low level even though one has not performed specific amplification of the genes of interest.
  • the ability of our invention to perform this type of mRNA expression monitoring is due to the fact that when the primary colonies are prepared, statistically, each piece of the initial genome will be represented by the same number of colonies. Thus, frequent and rare DNA will initiate the same number of colonies (e.g., one colony per added genome molecule) . Quantitative information might be obtained both from frequent and rare mRNAs by monitoring the growing rate of the colonies.
  • This embodiment of our invention means to solve the problem of isolating the genes which are specifically induced under given conditions, e.g., in specific tissues, different strains of a given species or under specific activation.
  • a practical example is the identification of genes which are up or down regulated after drug administration.
  • target sample a specific or activated biological sample which are up-regulated compared with a reference biological sample (hereafter called reference sample) is depicted in figure 18.
  • the DNA used for this preparation is prepared genomic DNA or tagged genomic DNA, as described in sections G(i) and G(ii), respectively, where the DNA is either from the whole genome of one (or several) organism(s) or from a subset thereof (e.g., from a library of previously isolated genes) , and where both the primers used for colony generation (hereafter called Pi and P2) contain a endonuclease restriction site.
  • step ii in figure 21b the secondary primers are used to regenerate colonies using mRNA or cDNA (represented by "mA + mB") extracted from the biological reference sample as a template, as described in G(v). If the template is mRNA, the first elongation step of colony regeneration will be performed with a reverse transcriptase. After enough colony growing cycles, preferably 5 to 100, only the colonies corresponding to genes expressed in the reference sample ("A" and "B") will be regenerated, as depicted in (figure 18c) .
  • step (iii) the colonies are digested with a restriction enzyme (represented by RE) which recognises a site in the flanking primer sequences, PI and P2, which are grafted on the support and which were the basis of primary colony generation.
  • RE restriction enzyme
  • the colonies which have been regenerated during step (ii) will be digested. This is because the support for secondary colony growth is made of single stranded DNA molecules, which can not be digested by the restriction enzyme. Only the regenerated colonies are present in a double stranded form, and are digested. After digestion, the situation is the one depicted in figure 18d.
  • the colonies corresponding to the genes expressed in the reference sample have totally disappeared, i.e., they are not even present as a support for secondary colony growth, and the colonies corresponding to genes expressed only in the target sample "C” and the colonies corresponding to non-expressed genes "D" are still present as a support for secondary colony generation.
  • step (iv) mRNA (or cDNA) (represented by "mA + mC") extracted from the target sample is used to generate secondary colonies. Because colonies corresponding to mA and mB no longer exist, only the colonies corresponding to mC can be regenerated (ie. Only the mRNA specifically expressed in the target sample) . After sufficient number of colony growing cycles (preferably 5 to 100), the situation is such that only the colonies corresponding to genes expressed specifically in the target sample are regenerated ("C", figure 18e) .
  • step (v) the regenerated colonies "C" are used to generate copies of the DNA that they contain by performing several (preferably 1 to 20) colony growing cycles in the presence of the primers PI and P2, as described in section D of the present invention.
  • a PCR amplification is then performed using PI and P2 in solution (described in section D) and the amplified DNA characterised by classical methods.
  • step (ii) the mRNA used is the one extracted from the target biological sample ("mA + mC") instead of the mRNA extracted form the reference biological sample ("mA + mB")
  • step (iv) the mRNA used is the one extracted from the reference biological sample ("mA + mB") instead of the one extracted from the target sample ("mA + mC”) .

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

A nucleic acid molecule can be annealed to an appropriate immobilised primer. The primer can then be extended and the molecule and the primer can be separated from one another. The extended primer can then be annealed to another immobilised primer and the other primer can be extended. Both extended primers can then be separated from one another and can be used to provide further extended primers. The process can be repeated to provide amplified, immobilised nucleic acid molecules. These can be used for many different purposes, including sequencing, screening, diagnosis, in situ nucleic acid synthesis, monitoring gene expression, nucleic acid fingerprinting, etc.

Description

Method of Nucleic Acid Amplification
This invention relates, inter alia, to the amplification of nucleic acids .
Molecular biology and pharmaceutical drug development now make intensive use of nucleic acid analysis (Friedrich, G.A. Moving beyond the genome projects, Nature Biotechnology 14, 1234 (1996) ) . The most challenging areas are whole genome sequencing, single nucleotide polymorphism detection, screening and gene expression monitoring. Currently, up to hundreds of thousands of samples are handled in single DNA sequencing projects (Venter, J.C., H.O Smith, L. Hood, A new strategy for genome sequencing, Nature 381, 364 (1996)). This capacity is limited by the available technology. Projects like the "human genome project" (gene mapping and DNA sequencing) and identifying all polymorphisms in expressed genes involved in common diseases imply the sequencing of millions of DNA samples.
With most of the current DNA sequencing technologies, it is simply not possible to decrease indefinitely the time required to process a single sample. A way of increasing throughput is to perform many processes in parallel. The introduction of robotic sample preparation and delivery, 96 and 384 well plates, high density gridding machines (Maier, E., S. Meierewer, A.R. Ahmadi, J. Curtis, H. Lehrach, Application of robotic technology to automated sequence fingerprint analysis by oligonucleotide hybridization, Journal Of Biotechnology 35,191 (1994)) and recently the development of high density oligonucleotide arrays (Chee, M., R.Yang, E. Hubbell, A. Berno,X.C. Huang, D. Stern, J. Winkler, D.J. Lockhart,M.S. Morris, and S.P.A. Fodor, Accessing genetic information with high-density DNA arrays, Science 274 (5287) : 610-614, (1996)) are starting to bring answers to the demand in ever higher throughput. Such technologies allow up to 50, 000~100, 000 samples at a time to be processed within days and even hours (Maier, E., Robotic technology in library screening, Laboratory Robotics and Automation 7, 123 (1995)). In most known methods for performing nucleic acid analysis, it is necessary to first extract the nucleic acids of interest (e.g., genomic or mitochondrial DNA or messenger RNA (mRNA) ) from an organism. Then it is necessary to isolate the nucleic acids of interest from the mixture of all nucleic acids and usually, to amplify these nucleic acids to obtain quantities suitable for their characterisation and/or detection. Isolating the nucleic fragments has been considered necessary even when one is interested in a representative but random set of all of the different nucleic acids, for instance, a representative set of all the mRNAs present in a cell or of all the fragments obtained after genomic DNA has been cut randomly into small pieces .
Several methods can be used to amplify DNA with biological means and are well known by those skilled in the art. Generally, the fragments of DNA are first inserted into vectors with the use of restriction enzymes and DNA ligases . A vector containing a fragment of interest can then be introduced into a biological host and amplified by means of well established protocols. Usually hosts are randomly spread over a growth medium (e.g. agar plates). They can then replicate to provide colonies that originated from individual host cells.
Up to millions of simultaneous amplification of cloned DNA fragments can be carried out simultaneously in such hosts. The density of colonies is of the order of 1 colony/mm2. In order to obtain DNA from such colonies one option is to transfer the colonies to a membrane, and then to immobilise the DNA from within the biological hosts directly to the membrane (Grunstein, M. and D.S. Hogness, Colony Hybridization: A method for the isolation of cloned DNAs that contain a specific gene, Proceedings of the National Academy of Science, USA, 72:3961 (1975)). With these options however, the amount of transferred DNA is limited and often insufficient for non-radioactive detection.
Another option is to transfer by sterile technique individually each colony into a container (e.g., 96 well plates) where further host cell replication can occur so that more DNA can be obtained from the colonies. Amplified nucleic acids can be recovered from the host cells with an appropriate purification process. However such a procedure is generally time and labour consuming, and difficult to automate .
The revolutionary technique of DNA amplification using the polymerase chain reaction (PCR) was proposed in 1985 by Mullis et al. (Saiki, R., S. Scharf, F. Faloona, K. Mullis, G. Horn, H. Erlich and N. Arnheim, Science 230, 1350-1354 (1985) and is now well known by those skilled in the art. In this amplification process, a DNA fragment of interest can be amplified using two short (typically about 20 base long) oligonucleotides that flank a region to be amplified, and that are usually referred to as "primers". Amplification occurs during the PCR cycling, which includes a step during which double stranded DNA molecules are denatured (typically a reaction mix is heated, e.g. to 95°C in order to separate double stranded DNA molecules into two single stranded fragments) , an annealing step (where the reaction mix is brought to e.g., 45°C in order to allow the primers to anneal to the single stranded templates) and an elongation step (DNA complementary to the single stranded fragment is synthesised via sequential nucleotide incorporation at the ends of the primers with the DNA polymerase enzyme) .
The above procedure is usually performed in solution, whereby neither the primers nor a template are linked to any solid matrix.
More recently, however, it has been proposed to use one primer grafted to a surface in conjunction with free primers in solution in order to simultaneously amplify and graft a PCR product onto the surface (Oroskar, A.A. , S.E. Rasmussen,H.N. Rasmussen, S.R. Rasmussen,B.M. Sullivan, and A. Johansson, Detection of immobilised amplicons by ELISA-like techniques, Clinical Chemistry 42:1547 (1996)). (The term "graft" is used herein to indicate that a moiety becomes attached to a surface and remains there unless and until it is desired to remove it . ) The amplification is generally performed in containers (e.g., in 96 well format plates) in such a way that each container contains the PCR product (s) of one reaction. With such methods, some of the PCR product become grafted to a surface of the container having primers therein which has been in contact with the reactant during the PCR cycling. The grafting to the surface simplifies subsequent assays and allows efficient automation.
Arraying of DNA samples is more classically performed on membranes (e.g., nylon or nitro-cellulose membranes). With the use of suitable robotics (e.g., Q-botm , Genetix ltd, Dorset BH23 3TG UK) it is possible to reach a density of up to 10 samples/mm2. Here, the DNA is covalently linked to a membrane by physicochemical means (e.g., UV irradiation) . These technologies allow the arraying of large DNA molecules (e.g. molecules over 100 nucleotides long) as well as smaller DNA molecules. Thus both templates and probes can be arrayed.
New approaches based on pre-arrayed glass slides (arrays of reactive areas obtained by ink-jet technology (Blanchard, A. P. and L. Hood, Oligonucleotide array synthesis using ink jets, Microbial and Comparative Genomics, 1:225 (1996)) or arrays of reactive polyacrylamide gels (Yershov, G. et al . , DNA analysis and diagnostics on oligonucleotide microchips, Proceedings of the Na tional Academy of Science, USA, 93:4913-4918 (1996)) allow the arraying of up to 100 samples/mm2. With these technologies, only probe (oligonucleotide) grafting has been reported. Reported number of samples/mm2 are still fairly low (25 to 64) .
Higher sample densities are achievable by the use of DNA chips, which can be arrays of oligonucleotides covalently bound to a surface and can be obtained with the use of micro-lithographic techniques (Fodor, S.P.A. et al., Light directed, spatially addressable parallel chemical synthesis, Science 251:767(1991)). Currently, chips with 625 probes/mm2 are used in applications for molecular biology (Lockhart, D.J. et al., Expression monitoring by hybridisation to high-density oligonucleotide arrays, Nature Biotechnology 14:1675 (1996)). Probe densities of up to 250 000 samples/cm2 are claimed to be achievable (Chee, M. et al., Accessing genetic information with high-density DNA arrays, Science 274:610 (1996)). Currently, up to 132000 different oligonucleotides can be arrayed on a single chips of approximately 2.5 cm2. Presently, these chips are manufactured by direct solid phase oligonucleotide synthesis with the 3'OH end of the oligo attached to the surface. Thus these chips have been used to provide oligonucleotide probes which cannot act as primers in a DNA polymerase-mediated elongation step.
When PCR products are linked to the vessel in which PCR amplification takes place, this can be considered as a direct arraying process. The density of the resultant array of PCR products is then limited by the available vessel. Currently available vessels are only in 96 well microtiter plate format. These allow only around ~0.02 samples of PCR products/mm2 of surface to be obtained.
Using the commercially available Nucleolink™ system obtainable from Nunc A/S (Roskilde, Denmark) it is possible to achieve simultaneous amplification and arraying of samples in containers on the surface of which oligonucleotide primers have been grafted. However, in this case the density of the array of samples is fixed by the size of the vessel. Presently a density of 0.02 samples/mm2 is achievable for the 96 well plate format. Increasing this density is difficult. This is apparent since, for instance, the availability of 384 well plates (0.08 samples/mm2) suitable for PCR has been delayed due to technical problems (e.g. heat transfer and capillary effects during filling). It is thus unlikely that orders of magnitude improvements in the density of samples arrayed with this approach can be achieved in the foreseeable future.
The present invention aims to overcome or at least alleviate some of the disadvantages of prior art methods of nucleic acid amplification.
According to the present invention there is provided a method of nucleic acid amplification, comprising the steps of: A. providing a plurality of primers that are immobilised but that have one end exposed to allow primer extension;
B. allowing a single stranded target nucleic acid molecule to anneal to one of said plurality of primers over part of the length of said single stranded nucleic acid molecule and then extending that primer using the annealed single stranded nucleic acid molecule as a template, so as to provide an extended immobilised nucleic acid strand;
C. separating the target nucleic molecule from the extended immobilised nucleic acid strand;
D. allowing the extended immobilised nucleic acid strand to anneal to one of said plurality of primers referred to in step A) and then extending that primer using the extended immobilised nucleic acid strand as a template, so as to provide another extended immobilised nucleic acid strand; and optionally,
E. separating the annealed extended immobilised nucleic acid strands from one another.
Preferably the method also comprises the step of:
F. using at least one extended immobilised nucleic acid strand to repeat steps D) and E) , so as to provide additional extended immobilised nucleic acid strands and, optionally,
G. repeating step F) one or more times.
Desirably the single-stranded target nucleic acid sequence is provided by a method in which said single-stranded target nucleic acid is produced by providing a given nucleic acid sequence to be amplified (which sequence may be known or unknown) and adding thereto a first nucleic acid sequence and a second nucleic acid sequence; wherein said first nucleic acid sequence hybridises to one of said plurality of primers and said second nucleic acid sequence is complementary to a sequence which hybridises to one of said plurality of primers.
The second nucleic acid sequence may be a sequence that is the same as the sequence of one of the plurality of primers. Thus the single- stranded target nucleic acid squence may be provided by a method in which said single-stranded target nucleic acid is produced by providing a given nucleic acid sequence to be amplified (which sequence may be known or unknown) and adding thereto a first nucleic acid sequence and a second nucleic acid sequence; wherein said first nucleic acid sequence hybridises to one of said plurality of primers and said second nucleic acid sequence is the same as the sequence of one of said plurality of primers.
The first and second nucleic acid sequences may be provided at first and second ends of said single-stranded target nucleic acid, although this is not essential.
If desired a tag may be provided to enable amplification products of a given nucleic acid sequence to be identified.
Colonies
The method of the present invention allows one or more distinct areas to be provided, each distinct area comprising a plurality of immobilised nucleic acid strands (hereafter called "colonies") . These areas can contain large numbers of amplified nucleic acid molecules. These molecules may be DNA and/or RNA molecules and may be provided in single or double stranded form. Both a given strand and its complementary strand can be provided in amplified form in a single colony.
Colonies of any particular size can be provided.
However, preferred colonies measure from lOnm to lOOum across their longest dimension, more preferably from lOOnm to lOμm across their longest dimension. Desirably a majority of the colonies present on a surface (i.e. at least 50% thereof) have sizes within the ranges given above.
Colonies can be arranged in a predetermined manner or can be randomly arranged. Two or three dimensional colony configurations are possible. The configurations may be regular (e.g. having a polygonal outline or having a generally circular outline) or they may be irregular. Colonies can be provided at high densities. Densities of over one colony/mm2 of surface can be achieved. Indeed densities of over 102, over 103 or even over 104 colonies/mm2 are achievable using the present invention. In preferred embodiments, the present invention provides colony densities of 104"5 colonies/mm2, more preferably densities of 106"7 colonies/mm2, thus offering an improvement of 3 to 4 orders of magnitude relative to densities achievable using many of the prior art methods. It is this property of the invention that allows a great advantage over prior art, since the high density of DNA colonies allows a large number of diverse DNA templates (up to 106"7 colonies/mm2, to be randomly arrayed and amplified.
Primers
The immobilised primers for use in the present invention can be provided by any suitable means, as long as a free 3' -OH end is available for primer extension. Where many different nucleic acid molecules are to be amplified, many different primers may be provided. Alternatively "universal" primers may be used, whereby only one or two different types of primer (depending upon the embodiment of the invention) can be used to amplify the different nucleic acid molecules. Universal primers can be used where the molecules to be amplified comprise first and second sequences, as described previously. The provision of universal primers is advantageous over methods such as those disclosed in WO96/04404 (Mosaic Technologies, Inc.) where specific primers must be prepared for each particular sequence to be amplified.
Synthetic oligodeoxynucleotide primers are available commercially from many suppliers (e.g. Microsynth, Switzerland, Eurogentech, Belgium) .
Grafting of primers onto silanized glass or quartz and grafting of primers onto silicon wafers or gold surface has been described (Maskos, U. and E.M Southern, Oligonucleotide hybridizations on glass supports: a novel linker for oligonucleotide synthesis and hybridization properties of oligonucleotides synthesised in situ, Nucleic Acids Research 20 (7) : 1679-84, 1992; Lamture, J.B., et.al. Direct-detection of nucleic-acid hybridization on the surface of a charge-coupled-device, Nucleic Acids Research 22 (11) :2121-2125, 1994; Chrisey, L.A., G.U. Lee, and C.E. Oferrall, Covalent attachment of synthetic DNA to self-assembled monolayer films, Nucleic Acids Research 24(15) :3031-3039, 1996).
Grafting biotinylated primers to supports covered with streptavidin is another alternative. This grafting method is commonly used for bio-macromolecules in general.
Non covalent grafting of primers at the interface between an aqueous phase and a hydrophobic phase through an hydrophobic anchor is also possible for the present invention. Such anchoring is commonly used for bio-macromolecules in general (S. Terrettaz et al. : Protein binding to supported lipid membranes, Langmuir 9,1361 (1993)). Preferred forms of such interfaces would be liposomes, lipidic vesicles, emulsions, patterned bilayers, Langmuir or Langmuir- Blodgett films. The patterns may be obtained by directed pattering on templates, e.g., silicon chips patterned through micro-lithographic methods (Goves, J.T. et al . , Micropatterning Fluid Bilayers on Solid Supports, in Science 275,651 (1997)). The patterns may also be obtained by due to the self-assembly properties of "colloids", e.g., emulsions or latex particles (Larsen, A.E. and D.G. Grier, Like charge attractions in metastable colloidal crystallites, Nature 385,230 (1997)).
In the above methods, one, two or more different primers can be grafted onto a surface. The primers can be grafted homogeneously and simultaneously over the surface.
Using microlithographic methods it is possible to provide immobilised primers in a controlled manner. If direct synthesis of oligonucleotides onto a solid support with a free 3' -OH end is desired, then micro-lithographic methods can be used to simultaneously synthesise many different oligonucleotide primers (Pirrung, M.C. and Bradley, J.C. Comparison of methods for photochemical phosphoramidite-based DNA- synthesis. Journal Of Organic Chemistry 60 (20) : 6270-6276, 1995). These may be provided in distinct areas that may correspond in configuration to colonies to be formed, (e.g. they may be several nanometers or micrometers across). Within each area, only a single type of primer oligonucleotide need be provided. Alternatively a mixture comprising a plurality of different primers may be provided. In either case, primers can be homogeneously distributed within each area. They may be provided in the form of a regular array.
Where areas initially comprise only one type of immobilised primer they may be modified, if desired, to carry two or more different types of primer. One way to achieve this is to use molecules as templates for primer extension that have 3' ends that hybridise with a single type of primer initially present and that have 5' ends extending beyond the 3' ends of said primers. By providing a mixture of templates with different sequences from one another, primer extension of one type of primer using the mixture of such templates followed by strand separation will result in different modified primers. (The modified primers are referred to herein as "extended" primers in order to distinguish from the "primary" primers initially present on a surface) .
One, two or more different types of extended primer can be provided in this manner at any area where primary primers are initially located. Substantially equal portions of different templates can be used, if desired, in order to provide substantially equal proportions of different types of immobilised extended primer over a given area. If different proportions of different immobilised extended primers are desired, then this can be achieved by adjusting the proportions of different template molecules initially used accordingly.
A restriction endonuclease cleavage site may be located within the primer. A primer may also be provided with a restriction endonuclease recognition site which directs DNA cleavage several bases distant (Type II restriction endonucleases) . (For the avoidance of doubt, such sites are deemed to be present even if the primer and its complement are required to be present in a double stranded molecule for recognition and/or cleavage to occur.) Alternatively a cleavage site and/or a recognition site may be produced when a primer is extended. In any event, restriction endonucleases can be useful in allowing an immobilised nucleic acid molecule within a colony to be cleaved so as to release at least a part thereof. As an alternative to using other restriction endonucleases, ribozymes can be used to release at least parts of nucleic acid molecules from a surface (when such molecules are RNA molecules) . Other methods are possible. For example if a covalent bond is used to link a primer to a surface this bond may be broken (e.g. by chemical, physical or enzymatic means) .
Primers for use in the present invention are preferably at least five bases long. Normally they will be less than 100 or less than 50 bases long. However this is not essential. Naturally occurring and/or non-naturally occurring bases may be present in the primers .
Target Nucleic Acid Molecules
Turning now to target nucleic acid molecules (also referred to herein as "templates") for use in the method of the present invention, these can be provided by any appropriate means. A target molecule (when in single-stranded form) comprises a first part having a sequence that can anneal with a first primer and a second part having a sequence complementary to a sequence that can anneal with a second primer. In a preferred embodiment the second part has the same sequence as the second primer.
The second primer may have a sequence that is the same as, or different from, the sequence of the first primer.
The first and second parts of the target nucleic acid molecules are preferably located at the 3' and at the 5' ends respectively thereof. However this is not essential. The target molecule will usually also comprise a third part located between the first and second parts. This part of the molecule comprises a particular sequence to be replicated. It can be from any desired source and may have a known or unknown (sometimes referred to as "anonymous") sequence. It may be derived from random fractionation by mechanical means or by limited restriction enzyme digestion of a nucleic acid sample, for example . Further parts of the target molecules may be provided if desired. For example parts designed to act as tags may be provided. A "tag' is defined by its function of enabling a particular nucleic acid molecule (or its complement) to be identified.
Whatever parts are present, target nucleic acid molecules can be provided by techniques known to those skilled in the art of nucleic acid manipulation. For example, two or more parts can be joined together by ligation. If necessary, prior to ligation appropriate modifications can be made to provide molecules in a form ready for ligation. For example if blunt end ligation is desired then a single-strand specific exonuclease such as SI nuclease could be used to remove single stranded portions of molecules prior to ligation. Linkers and/or adapters may also be used in nucleic acid manipulation. (Techniques useful for nucleic acid manipulation are disclosed in Sambrook et al , Molecular Cloning, 2nd Edition, Cold Spring Harbor Laboratory Press (1989), for example.)
Once a template molecule has been synthesised it can be cloned into a vector and can be amplified in a suitable host before being used in the present invention. It may alternatively be amplified by PCR. As a further alternative, batches of template molecules can be synthesised chemically using automated DNA synthesisers (e.g. from Perkin-Elmer/Applied Biosystems, Foster City, CA) .
It is however important to note that the present invention allows large numbers of nucleic acid molecules identical in sequence to be provided in a colony arising from a single molecule of template. Furthermore, the template can be re-used to generate further colonies. Thus it is not essential to provide large numbers of template molecules to be used in colony formation.
The template can be of any desired length provided that it can participate in the method of the present invention. Preferably it is at least 10, more preferably at least 20 bases long. More preferably it is at least 100 or at least 1000 bases long. As is the case for primers for use in the present invention, templates may comprise naturally occurring and/or non-naturally occurring bases . Reaction Conditions
Turning now to reaction conditions suitable for the method of the present invention, it will be appreciated that the present invention uses repeated steps of annealing of primers to templates, primer extension and separation of extended primers from templates. These steps can generally be performed using reagents and conditions known to those skilled in PCR (or reverse transcriptase plus PCR) techniques. PCR techniques are disclosed, for example, in "PCR: Clinical Diagnostics and Research", published in 1992 by Springer- Verlag.
Thus a nucleic acid polymerase can be used together with a supply of nucleoside triphosphate molecules (or other molecules that function as precursors of nucleotides present in DNA/RNA, such as modified nucleoside triphosphates) to extend primers in the presence of a suitable template.
Excess deoxyribonucleoside triphosphates are desirably provided. Preferred deoxyribonucleoside triphosphates are abbreviated; dTTP (deoxythymidine nucleoside triphosphate) , dATP (deoxyadenosine nucleoside triphosphate) , dCTP (deoxycytosine nucleoside triphosphate) and dGTP (deoxyguanosine nucleoside triphosphate) . Preferred ribonucleoside triphosphates are UTP, ATP, CTP and GTP. However alternatives are possible. These may be naturally or non- naturally occurring. A buffer of the type generally used in PCR reactions may also be provided.
A nucleic acid polymerase used to incorporate nucleotides during primer extension is preferably stable under the pertaining reaction conditions in order that it can be used several times. (This is particularly useful in automated amplification procedures.) Thus, where heating is used to separate a newly synthesised nucleic acid strand from its template, the nucleic acid polymerase is preferably heat stable at the temperature used. Such heat stable polymerases are known to those skilled in the art. They are obtainable from thermophilic micro-organisms . They include the DNA dependent DNA polymerase known as Taq polymerase and also thermostable derivatives thereof. (The nucleic acid polymerase need not however be DNA dependent . It may be RNA dependent . Thus it may be a reverse transcriptase - i.e. an RNA dependent DNA polymerase.)
Typically, annealing of a primer to its template takes place at a temperature of 25 to 90°C. Such a temperature range will normally be maintained during primer extension. Once sufficient time has elapsed to allow annealing and also to allow a desired degree of primer extension to occur, the temperature can be increased, if desired, to allow strand separation. At this stage the temperature will typically be increased to a temperature of 60 to 100°C. [High temperatures can also be used to reduce non-specific priming problems prior to annealing. They can be used to control the timing of colony initiation, e.g. in order to synchronise colony initiation for a number of samples.] Alternatively, the strands maybe separated by treatment with a solution of low salt and high pH (> 12) or by using a chaotropic salt (e.g. guanidinium hydrochloride) or by an organic solvent (e.g. formamide) .
Following strand separation (e.g. by heating) , preferably a washing step will be performed. The washing step can be omitted between initial rounds of annealing, primer extension and strand separation, if it is desired to maintain the same templates in the vicinity of immobilised primers. This allows templates to be used several times to initiate colony formation. (It is preferable to provide a high concentration of template molecules initially so that many colonies are initiated at one stage.)
The size of colonies can be controlled, e.g. by controlling the number of cycles of annealing, primer extension and strand separation that occur. Other factors which affect the size of colonies can also be controlled. These include the number and arrangement on a surface of immobilised primers, the conformation of a support onto which the primers are immobilised, the length and stiffness of template and/or primer molecules, temperature and the ionic strength and viscosity of a fluid in which the above-mentioned cycles can be performed. Uses of Colonies
Once colonies have been formed they can be used for any desired purpose .
For example, they may be used in nucleic acid sequencing (whether partial or full) , in diagnosis, in screening, as supports for other components and/or for research purposes (preferred uses will be described in greater detail later on) . If desired colonies may be modified to provide different colonies (referred to herein as "secondary colonies" in order to distinguish from the "primary colonies" initially formed) .
Surfaces Comprising Immobilised Nucleic Acid Strands
A surface comprising immobilised nucleic acid strands in the form of colonies of single stranded nucleic acid molecules is also within the scope of the present invention.
Normally each immobilised nucleic acid strand within a colony will be located on the surface so that an immobilised and complementary nucleic acid strand thereto is located on the surface within a distance of the length of said immobilised nucleic acid strand (i.e. within the length of one molecule) . This allows very high densities of nucleic acid strands and their complements to be provided in immobilised form. Preferably there will be substantially equal proportions of a given nucleic acid strand and its complement within a colony. A nucleic acid strand and its complement will preferably be substantially homogeneously distributed within the colony.
It is also possible to provide a surface comprising single stranded nucleic acid strands in the form of colonies, where in each colony, the sense and anti-sense single strands are provided in a form such that the two strands are no longer at all complementary, or simply partially complementary. Such surfaces are also within the scope of the present invention. Normally, such surfaces are obtained after treating primary colonies, e.g., by partial digestion by restriction enzymes or by partial digestion after strand separation (e.g., after heating) by an enzyme which digests single stranded DNA) , or by chemical or physical means, (e.g., by irradiating with light colonies which have been stained by an intercalating dye e.g., ethidium bromide) .
Once single stranded colonies have been provided they can be used to provide double stranded molecules. This can be done, for example, by providing a suitable primer (preferably in solution) that hybridises to the 3' ends of single stranded immobilised molecules and then extending that primer using a nucleic acid polymerase and a supply of nucleoside triphosphates (or other nucleotide precursors) .
Thus surfaces comprising colonies of non-bridged double stranded nucleic acid molecules are also within the scope of the present invention. (The term "non-bridged" is used here to indicate that the molecules are not in the form of the bridge-like structures shown in e.g. figure lh. )
Using the present invention, small colonies can be provided that contain large numbers of nucleic acid molecules (whether single or double stranded) . Many colonies can therefore be located on a surface having a small area. Colony densities that can be obtained may therefore be very high, as discussed supra .
Different colonies will generally be comprised of different amplified nucleic acid strands and amplified complementary strands thereto. Thus the present invention allows many different populations of amplified nucleic acid molecules and their complements to be located on a single surface having a relatively small surface area. The surface will usually be planar, although this is not essential.
Apparatuses
The present invention also provides an apparatus for providing a surface comprising colonies of the immobilised nucleic acid molecules discussed supra .
Such an apparatus can include one or more of the following: a) means for immobilising primers on a surface (although this is not needed if immobilised primers are already provided) ;
b) a supply of a nucleic acid polymerase;
c) a supply of precursors of the nucleotides to be incorporated into a nucleic acid (e.g. a supply of nucleoside triphosphates) ;
d) means for separating annealed nucleic acids (e.g. heating means) ;
and
e) control means for co-ordinating the different steps required for the method of the present invention.
Other apparatuses are within the scope of the present invention. These allow immobilised nucleic acids produced via the method of the present invention to be analysed. They can include a source of reactants and detecting means for detecting a signal that may be generated once one or more reactants have been applied to the immobilised nucleic acid molecules. They may also be provided with a surface comprising immobilised nucleic acid molecules in the form of colonies, as described supra .
Desirably the means for detecting a signal has sufficient resolution to enable it to distinguish between signals generated from different colonies .
Apparatuses of the present invention (of whatever nature) are preferably provided in automated form so that once they are activated, individual process steps can be repeated automatically.
The present invention will now be described without limitation thereof in sections A to I below with reference to the accompanying drawings . It should be appreciated that procedures using DNA molecules referred to in these sections are applicable mutatis mutandis to RNA molecules, unless the context indicates otherwise.
It should also be appreciated that where sequences are provided in the following description, these are written from 5' to 3' (going from left to right), unless the context indicates otherwise.
The figures provided are summarised below:
FIGURE 1 illustrates a method for the simultaneous amplification and immobilisation of nucleic acid molecules using a single type of primer.
FIGURE 2 illustrates how colony growth using a method of the present invention can occur.
FIGURE 3 illustrates the principle of the method used to produce DNA colonies using the present invention. It also illustrates the annealing, elongation and denaturing steps that are used to provide such colonies.
FIGURE 4 is an example of DNA colonies formed by amplification of a specific template with single primers grafted onto a surface.
FIGURE 5 illustrates a method for the simultaneous amplification and immobilisation of nucleic acid molecules using two types of primer.
FIGURE 6 shows actual DNA colonies produced via the present invention.
FIGURE 7 illustrates a method of the simultaneous amplification and immobilisation of nucleic acid molecules when a target molecule is used as a template having internal sequences that anneal with primers. Figure 8 illustrates a method to synthesise additional copies of the original nucleic acid strands using nucleic acid strands present in colonies . The newly synthesised strands are shown in solution but can be provided in immobilised form if desired.
Figure 9 shows the PCR amplification of DNA from DNA found in the pre-formed DNA colonies.
FIGURE 10 illustrates how secondary primers can be generated from DNA colonies .
FIGURE 11 illustrates how secondary DNA colonies can be generated from secondary primers .
FIGURE 12 illustrates how primers with different sequences can be generated from a surface functionalised with existing primers .
FIGURE 13 depicts methods of preparing DNA fragments suitable for generating DNA colonies .
FIGURE 14 illustrates a method for synthesising cRNA using the DNA colony as a substrate for RNA polymerase.
FIGURE 15 illustrates a preferable method to determine the DNA sequence of DNA present in individual colonies.
FIGURE 16 illustrates a method of determining the sequence of a DNA colony, de novo .
FIGURE 17 illustrates the utility of secondary DNA colonies in the assay of mRNA expression levels.
FIGURES 18 and 19 illustrates the use of the secondary DNA colonies in the isolation and identification of novel and rare expressed genes. A) Scheme Showing The Simultaneous Amplification And
Immobilisation Of Nucleic Acid Molecules Using A Single Type Of Primer
Referring now to Figure la), a surface is provided having attached thereto a plurality of primers (only one primer is shown for simplicity) . Each primer (1) is attached to the surface by a linkage indicated by a dark block. This may be a covalent or a non-covalent linkage but should be sufficiently strong to keep a primer in place on the surface. The primers are shown having a short nucleotide sequence (5' -ATT). In practice however longer sequences would generally be provided.
Figure lb) shows a target molecule (II) that has annealed to a primer. The target molecule comprises at its 3' end a sequence (5'- ATT) that is complementary to the primer sequence (5' -ATT). At its 5' end the target molecule comprises a sequence (5' -ATT) that is the same as the primer sequence (although exact identity is not required) .
Between the two ends any sequence to be amplified (or the complement of any sequence to be amplified) can be provided. By way of example, part of the sequence to be amplified has been shown as 5' -CCG.
In Figure lc) primer extension is shown. Here a DNA polymerase is used together with dATP, dTTP, dGTP and dCTP to extend the primer (5' -ATT) from its 3' end, using the target molecule as a template.
When primer extension is complete, as shown in Figure Id) , it can be seen that an extended immobilised strand (III) is provided that is complementary to the target molecule. The target molecule can then be separated from the extended immobilised strand (e.g. by heating, as shown in Figure le) ) . This separation step frees the extended, immobilised strand so that it can then be used to initiate a subsequent round of primer extension, as shown in Figures If) and lg) Here the extended, immobilised strand bends over so that one end of that strand (having the terminal sequence 5' -AAT) anneals with another primer (2, 5'-ATT), as shown in Figure If). That primer provides a 3' end from which primer extension can occur, this time using the extended, immobilised strand as a template. Primer extension is shown occurring in Figure lg) and is shown completed in Figure lh) .
Figure li) shows the two extended immobilised strands that were shown in Figure lh) after separation from one another (e.g. by heating) . Each of these strands can then themselves be used as templates in further rounds of primer extension initiated from new primers (3 and 4), as shown in Figures 1j ) and Ik). Four single stranded, immobilised strands can be provided after two rounds of amplification followed by a strand separation step (e.g. by heating), as shown in Figure 11) . Two of these have sequences corresponding to the sequence of the target molecule originally used as a template. The other two have sequences complementary to the sequence of the target molecule originally used as a template. (In practice a given immobilised strand and its immobilised complement may anneal once.)
It will therefore be appreciated that a given sequence and its complement can be provided in equal numbers in immobilised form and can be substantially homogeneously distributed within a colony.
Further rounds of amplification beyond those shown in Figure 1 can of course be performed so that colonies comprising large numbers of a given single stranded nucleic acid molecule and a complementary strand thereto can be provided. Only a single template need be used to initiate each colony, although, if desired, a template can be reused to initiate several colonies.
It will be appreciated that the present invention allows very high densities of immobilised extended nucleic acid molecules to be provided. Within a colony each extended immobilised molecule will be located at a surface within one molecule length of another extended immobilised molecule. Thus position 3 shown in Figure 11) is within one molecule length of position 1; position 1 is within one molecule length of position 2; and position 2 is within one molecule length of position 4.
Figure 2 is provided to illustrate how colony growth can occur (using the method described with reference to Figure 1 and to Figure 6 or any other method of the present invention for providing immobilised nucleic acid molecules) .
A flat plate is shown schematically in plan view having primers immobilised thereon in a square grid pattern (the primers are indicated by small dots) . A regular grid is used solely for simplicity: in many real cases, the positions of the primers might indeed be less ordered or random.
At the position indicated by arrow X a template molecule has annealed to a primer and an initial bout of primer extension has occurred to provide an immobilised, extended nucleic acid strand. Following strand separation, an end of that strand becomes free to anneal to further primers so that additional immobilised, extended nucleic acid strands can be produced. This is shown having occurred sequentially at positions indicated by the letter Y. For simplicity, the primer chosen for annealing is positioned next to the primer carrying the nucleic acid strand: in real cases, the nucleic acid strand could anneal with a primer which is not its next nearest neighbour. However, this primer will obviously be within a distance equal to the length of the nucleic acid strand.
It will be appreciated that annealing at only one (rather than at all) of these positions is required for colony cell growth to occur.
After immobilised, extended, single-stranded nucleic acid molecules have been provided at the positions indicated by letter Y, the resultant molecules can themselves anneal to other primers and the process can be continued to provide a colony comprising a large number of immobilised nucleic acid molecules in a relatively small area. Figure 3 shows a simplified version of the annealing, elongation and denaturing cycle. It also depicts the typical observations that can be made, as can be seen on the examples shown in figures 4 and 6. The simultaneous amplification and immobilisation of nucleic acids using solid phase primers has been successfully achieved using the procedure described in Examples 1, 2 and 3 below:
EXAMPLE 1
Oligonucleotides, phosphorylated at their 5' -termini (Microsynth GmbH, Switzerland) , were grafted onto Nucleolink plastic microtitre wells (Nunc, Roskilde, Denmark) . The sequence of the oligonucleotide p57 corresponds to the sequence 5' -TTTTTTCACCAACCCAAACCAACCCAAACC and p58 corresponds to the sequence 5 ' -TTTTTTAGAAGGAGAAGGAAAGGGAAAGGG . Microtitre wells with p57 or p58 were prepared as follows. In each Nucleolink well, 30 μl of a 160nM solution of the oligonucleotide in 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals, St. Louis, MO) was added. To each well, 10 μl of 40 mM l-ethyl-3- (3- dimethylaminopropyl) -carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-imidazole, was added to the solution of oligonucleotides. The wells were then sealed and incubated at 50 °C overnight. After the incubation, wells were rinsed twice with 200 μl of RS (0.4N NaOH, 0.25% Tween 20 (Fluka Chemicals, Switzerland)), incubated 15 minutes with 200 μl RS, washed twice with 200 μl RS and twice with 200 μl TNT (lOOmM TrisHCl pH7.5, 150mM NaCl, 0.1% Tween 20). Tubes were dried at 50°C and were stored in a sealed plastic bag at 4°C.
Colony generation was initiated in each well with 15 μl of priming mix; 1 nanogram template DNA (where the template DNA began with the sequence 5' -AGAAGGAGAAGGAAAGGGAAAGGG and terminated at the 3 '-end with the sequence CCCTTTCCCTTTCCTTCTCCTTCT-3' ) , the four dNTPs (0.2 mM) , 0.1% BSA (bovine serum albumin, Boehringer-Mannheim, Germany), 0.1% Tween 20, 8% DMSO (dimethylsulfoxide, Fluka Chemicals, Switzerland), IX Amplitaq PCR buffer and 0.025 units/μl of AmpliTaq DNA polymerase (Perkin Elmer, Foster City, CA) . The priming reaction was a single round of PCR under the following conditions; 94 °C for 4 minutes, 60°C for 30 seconds and 72°C for 45 seconds in a thermocycler (PTC 200, MJ Research, Watertown, MA) . Then 100 μl TE buffer (lOmM trisHCl, pH 7.5, ImM EDTA) was used in three successive one minute long washes at 94 CC. The DNA colonies were then formed by adding to each well, 20 μl of polymerisation mix, which was identical to the priming mix but lacking the template DNA. The wells were then placed in the PTC 200 thermocycler and colony growing was performed by incubating the sealed wells 4 minutes at 94 °C and cycling for 50 repetitions the following conditions: 94 °C for 45 seconds, 65°C for 2 minutes, 72°C for 45 seconds. After completion of this program, the wells were kept at 8°C until further use.
A 640 base pair fragment corresponding to the central sequence of the template (but not including the 5' - GAAGGAGAAGGAAAGGGAAAGGG sequence) was amplified by PCR. The isolated fragment was labelled with biotin- N4-dCTP (NEN Life Sciences, Boston, MA) and a trace of [α-32P]dCTP (Amersham, UK) using the Prime-it II labelling kit (Stratagene, San Diego, CA) to generate a biotinylated probe.
The biotinylated probe was diluted in to a concentration of 2.5 nM in EasyHyb (Boehringer-Mannheim, Germany) and 15 μl was hybridized to each sample with the following temperature scheme (PTC 200 thermocycler): 94°C for 5 minutes, followed by 500 steps of 0.1°C decrease in temperature every 12 seconds (in other words, the temperature is decreased down to 45 °C in 100 minutes) . The samples are then washed as follows; 1 time with 2X SSC/0.1% SDS (2X SSC; 0.3M NaCl/0.03M sodium citrate pH7.0/0.001 mg/ml sodium dodecyl sulfate) at room temperature, once with 2X SSC/0.1% SDS at 37°C and once with 0.2X SSC/0.1% SDS at 50°C. The wells are then incubated for 30 minutes with 50 μl of red fluorescent, Neutravidin-coated, 40 nm FluoSpheres(R) (580 nm excitation and 605 nm emission, Molecular Probes Inc., Eugene, OR) in TNT/0.1% BSA. (The solution of microspheres is made from a dilution of 2 μl of the stock solution of microspheres into 1ml of TNT/0.1% BSA, which is then sonicated for 5 minutes in a 50 W ultra-sound water-bath (Elgasonic, Switzerland) , followed by filtration through a 0.22 μm filter (Millex GV4). The wells are then counted (Cherenkov) on a Microbeta plate scintillation counter (WALLAC, Turku, Finland) . Excess FluoSpheres<R) are removed by washing for 30 min in TNT/0.1%BSA at room temperature. Images of the stained samples are observed using a 20X objective on an inverted microscope (Axiovert S100TV, Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512x768 CCD camera (Princeton instruments, Trenton, NJ) through a XF43 filter set (PB546/FT580/LP590, Omega Optical, Brattleboro, VT) with a 5 second exposure.
Figure 4 shows the hybridisation results for colony generation on tubes functionalised with either; (a) oligonucleotide p57 or (b) oligonucleotide p58. The control reaction shows very few fluorescent spots, since the sequence of the flanking regions on the template do not correspond to the primer sequences grafted onto the well. In contrast, figure 4b shows the number of fluorescent spots detected when the primers grafted to the wells match the flanking sequences on the initiating DNA template. Calculating the number of fluorescent spots detected and taking into consideration the magnification, we can estimate that there are between 3 and 5 x 107 colonies/cm2. The photos are generated by the program, Winview 1.6.2 (Princeton Instruments, Trenton, NJ) with backgrounds and intensities normalised to the same values.
B) Scheme Showing The Simultaneous Amplification And
Immobilisation Of Nucleic Acid Molecules Using Two Different Types of Primer
Referring now to Figure 5, another embodiment of the present invention is illustrated. Here two different immobilised primers are used to provide primer extension.
In this embodiment the target molecule shown is provided with a nucleotide sequence at its 3' end (AAT-3' ) that is complementary to the sequence of a first primer, (5'-ATT, I), which is grafted on the surface, so that annealing with that primer can occur. The sequence (5' -GGT) at the 5' end of the target molecule, III, corresponds to the sequence (5' -GGT) of a second primer, II, which is also grafted to the surface, so that the sequence which is complementary to the sequence at the 5' end can anneal with that said second primer. Generally said complementary sequence (5' -ACC) is chosen so that it will not anneal with the first primer (5' -ATT). Unlike the situation described in section A, once the 3' end of a newly synthesised strand anneals to a primer on the surface, it will have to find a primer whose sequence is different from the sequence it carries at its 5' end (see the difference between Figures If and 5f) .
The embodiment shown in Figure 5 has an advantage over the embodiment illustrated in Figure 1 since the possibility of one end of a single stranded target molecule annealing with another end of the same molecule in solution can be avoided and therefore amplification can proceed further. The possibility of annealing occurring between both ends of an immobilised complement to a target molecule can also be avoided. EXAMPLE 2
A mix of two oligonucleotides which are phosphorylated at the 5' -end (Microsynth GmbH, Balgach, Switzerland) have been grafted on 96 well Nucleolink plates (Nunc, Denmark) as recommended by the manufacturer. The resulting plates has been stored dry at 4°C. The sequence of the primer, PI, was 5' -GCGCGTAATACGACTCACTA, the sequence of the other primer, P2, was 5' -CGCAATTAACCCTCACTAAA. These plates are specially formulated by Nunc, allowing the covalent grafting of 5'- phosphorylated DNA fragments through a standard procedure .
A template has been cloned in a vector (pBlueScript Skminus, Stratagene Inc, San Diego, CA) with the appropriate DNA sequence at the cloning site (i.e., corresponding to PI and P2 at position 621 and 794 respectively) , and 174 bp long linear double stranded DNA template has been obtained by PCR amplification, using PI and P2. The template PCR product has been purified on Qiagen Qia-quick columns (Qiagen GmbH, Hilden, Germany) in order to remove the nucleotides and the primers used during the PCR amplification.
The purified template (in 50 μl solution containing IX PCR buffer (Perkin Elmer, Foster City, CA) with the four deoxyribonucleoside triphosphates (dNTPs) at 0.2 mM, (Pharmacia, Uppsala, Sweden) and 2.5 units of AmpliTaq Gold DNA polymerase (Perkin Elmer, Foster City, CA) ) has been spread on the support, i.e. on the Nucleolink plates grafted with PI and P2 (the plates have been rinsed with a solution containing 100 mM TRIS-HC1 (pH 7.5), 150 mM NaCl and 0.1% Tween 20 (Fluka, Switzerland) at room temperature for 15 min) . This solution has been incubated at 93°C for 9 minutes to activate the DNA polymerase and then 60 cycles (94°C/30 sec.,48°C/30 sec.,72°C/30 sec.) have been performed on a PTC 200 thermocycler. Several different concentrations of PCR template have been tested (approximately 1, 0.5, 0.25, 0.125, 0.0625 ng/μl) and for each sample a control reaction carried out without Taq polymerase has been performed (same conditions as above but without DNA polymerase) .
Each sample has been stained with YO-PRO (Molecular Probes, Portland OR) , a highly sensitive stain for double stranded DNA. The resulting products have been observed on a confocal microscope using a 40X objective (LSM 410, Carl Zeiss AG, Oberkochen, Germany) with appropriate excitation (an 488 argon laser) and detection filters (510 low pass filter) (note: the bottom of each well is flat and allows observation with an inverted fluorescence microscope) .
In figure 6A, the control well (without added DNA template, panel a) shows only rare objects which can be observed on a blank surface
(these objects were useful at this stage for reporting that the focus was correct) . These objects have an irregular shape, are 20 to 100 micro-meters in size and have a thickness much larger than the field depth of the observation. In a well where DNA polymerase was present
(figure 6A, panel ii) , in addition to the objects of irregular shape observed in the control well, a great number of fluorescent spots can be observed. They present a circular shape, they are 1 to 5 micro meters in size and do not span the field of view. The number of spots depends on the concentration of the template used for initiating colony formation. From the observed size of the colonies, one can estimate that more than 10,000 distinct colonies can be arrayed within 1 mm2 of support.
EXAMPLE 3
Oligonucleotides (Microsynth GmbH, Switzerland) were grafted onto Nucleolink wells (Nunc, Denmark) . Oligonucleotide PI corresponds to the sequence 5' -TTTTTTCTCACTATAGGGCGAATTGG and oligonucleotide P2 corresponds to 5' -TTTTTTCTCACTAAAGGGAACAAAAGCTGG. In each Nucleolink well, a 45 μl of 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals, St. Louis, MO) solution containing 360 fmol of PI and 360 fmol of P2 was added. To each well, 15 μl of 40 mM l-ethyl-3- (3- dimethylaminopropyl) -carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-imidazole, was added to the solution of oligonucleotides. The wells were then sealed and incubated at 50°C for 16 hours. After the incubation, wells have been rinsed twice with 200 μl of RS (0.4N NaOH, 0.25% Tween 20), incubated 15 minutes with 200 μl RS, washed twice with 200 μl RS, and twice with 200μl TNT (lOOmM Tris/HCl pH7.5, 150mM NaCl, 0.1% Tween 20), before they are put to dry at 50°C in an oven. The dried tubes were stored in a sealed plastic bag at 4°C. Colony growing was initiated in each well with 15 μl of initiation mix (IX PCR buffer, 0.2 mM dNTPs and 0.75 units of AmpliTaq Gold DNA polymerase, 20 nanograms of template DNA, where the template DNA was either SI DNA or S2 DNA or a mixture of different ratios of SI DNA and S2 DNA, as indicated in discussion to figure 6B. SI and S2 are 704 base pair and 658bp fragments, respectively, which have been cloned into pBlueScript Skminus plasmids and subsequently amplified through a PCR using PI and P2 as primers. The fragments were purified on Qiagen Qia-quick columns (QIAGEN GmbH, Germany) in order to remove the nucleotides and the primers .
Each well was sealed with Cycleseal™ (Robbins Scientific Corp., Sunnyvale, CA) , and incubated at 93 °C for 9 minutes, 65°C for 5 minutes and 72°C for 2 minutes and back to 93°C. Then 200 μl TNT solution was used in three successive one minute long washes at 93°C. The initiation mix was then replaced by 15 μl growing mix (same as initiation mix, but without template DNA) , and growing was performed by incubating the sealed wells 9 minutes at 93 °C and repeating 40 times the following conditions: 93°C for 45 seconds, 65°C for 3 minutes, 72 °C for 2 minutes. After completion of this program, the wells were kept at 6°C until further use. The temperature control was performed in a PTC 200 thermo-cycler, using the silicon pad provided in the Nucleolink kit and the heated (104 °C) lid of the PTC 200.
A 640base pair fragment corresponding to the central sequence of the SI fragment, but not including the PI or P2 sequence was amplified by PCR as previously described. The probe was labelled with biotin-16- dUTP (Boehringer-Mannheim, Germany) using the Prime-it II random primer labelling kit (Stratagene, San Diego, CA) according to the manufacturers instructions .
The biotinylated probes were hybridized to the samples in EasyHyb buffer (Boehringer-Mannheim, Germany) , using the following temperature scheme (in the PTC 200 thermocycler) : 94°C for 5 minutes, followed by 68 steps of 0.5°C decrease in temperature every 30 seconds (in other words, the temperature is decreased down to 60 °C in 34 minutes), using sealed wells. The samples are then washed 3 times with 200μl of TNT at room temperature. The wells are then incubated for 30 minutes with 50 μl TNT containing 0.1 mg/ l BSA. Then the wells are incubated 5 minutes with 15μl of solution of red fluorescent, Neutravidin-coated, 40 nm FluoSρheres(R) (580 nm excitation and 605 nm emission, Molecular Probes, Portland, OR) . The solution of microspheres is made of 2 μl of the stock solution of microspheres, which have been sonicated for 5 minutes in a 50 W ultra-sound water-bath (Elgasonic, Bienne, Switzerland) , diluted in 1 ml of TNT solution containing 0.1 mg/ml BSA and filtered with Millex GV4 0.22 μm pore size filter (Millipore, Bedford, MA).
The stained samples are observed using an inverted Axiovert 10 microscope using a 20X objective (Carl Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512x768 CCD camera (Princeton Instruments, Trenton, NJ) , using a XF43 filter set (PB546/FT580/LP590, Omega Optical, Brattleboro, VT) , and 10 seconds of light collection. The files are converted to TIFF format and processed in the suitable software (PhotoPaint, Corel Corp., Ottawa, Canada). The processing consisted in inversion and linear contrast enhancement, in order to provide a picture suitable for black and white print-out on a laser printer.
The figure 6B shows the results for 3 different ratios of the S1/S2 templates used in the initiating reaction: i) the S1/S2 is 1/0, many spots can be observed, ii) the S1/S2 is 1/10, and the number of spots is approximately 1/10 of the number of spots which can be observed in the i) image, as expected, and iii) the S1/S2 is 0/1, and only a few rare spots can be seen.
Scheme Showing Simultaneous Amplification And Immobilisation Of Nucleic Acid Molecules When The Target Molecule Contains Internal Sequences Complementary To The Immobilised Primers
Figure 7 is provided to show that the sequences shown at the 5' and 3' ends of the target molecule illustrated in Figures 1 and 5 need not be located at the ends of a target molecule.
A target nucleic acid molecule (II) may have a sequence at each (or either) end that is neither involved in annealing with a primer nor in acting as a template to provide a complementary sequence that anneals with a primer (sequence 5'-AAA and sequence 5'-CCC). One of the internal sequences (5' -AAT) is used as a template to synthesise a complementary sequence, III, thereto (5' -TTT), as is clear from figures 7(a) to 7(e).
The sequence 5' -TTT is not however itself used to provide a sequence complementary thereto, as is clear from figures 7(f) to 7(k). It can be seen from Figure 7(1) that only one of the four immobilised strands shown after two rounds of primer extension and a strand separation step comprises the additional sequence 5' -TTT and that no strand comprising a complementary sequence (5' -AAA) to this sequence is present (i.e. only one strand significantly larger than the others is present) . After several rounds of amplification the strand comprising the sequence 5' -TTT will represent an insignificant proportion of the total number of extended, immobilised nucleic acid molecules present.
D) Using Nucleic Acid Strands Present in Colonies to Synthesise
Additional Copies of Nucleic Acid Strands
Amplified, single stranded nucleic acid molecules present in colonies provided by the present invention can themselves be used as templates to synthesise additional nucleic acid strands.
Figure 8 illustrates one method of synthesising additional nucleic acids using immobilised nucleic acids as a starting point.
Colonies will usually comprise both a given nucleic acid strand and its complement in immobilised form (figure 8a) . Thus they can be used to provide additional copies not only of a given nucleic acid strand but also of its complement.
One way of doing this is to provide one or more primers (primers TTA and TGG) in solution that anneal to amplified, immobilised nucleic acid strands present in colonies (figure 8c) provided by the present invention. (These primers may be the same as primers initially used to provide the immobilised colonies, apart from being provided in free rather than immobilised form. ) The original DNA colony is denatured by heat to it single-stranded form (figure 8b) ,, allowing primers TTA and TGG to anneal to the available 3' end of each DNA strand. Primer extension, using AmpliTaq DNA polymerase and the four deoxyribonucleoside triphosphates (labelled or unlabeled) can then be used to synthesise complementary strands to immobilised nucleic acid strands or at least to parts thereof (step (iii)).
Once newly formed strands (figure 8d) have been synthesised by the process described above, they can be separated from the immobilised strands to which they are hybridised (e.g. by heating). The process can then be repeated if desired using the PCR reaction, to provide large number of such strands in solution (figure 8e) . Strands synthesised in this manner, after separation from the immobilised strands, can, if desired, be annealed to one another (i.e. a given strand and its complement can anneal) to provide double-stranded nucleic acid molecules in solution. Alternatively they can be separated from one another to provide homogenous populations of single-stranded nucleic acid molecules in solution.
It should also be noted that once single-stranded molecules are provided in solution they can be used as templates for PCR (or reverse PCR) . Therefore it is not essential to continue to use the immobilised nucleic acid strands to obtain further amplification of given strands or complementary strands thereto.
It should be noted that where a plurality of colonies are provided and nucleic acid strands in different colonies have different sequences, it is possible to select only certain colonies for use as templates in the synthesis of additional nucleic acid molecules. This can be done by using primers for primer extension that are specific for molecules present in selected colonies.
Alternatively primers can be provided to allow several or all of the colonies to be used as templates. Such primers may be a mixture of many different primers (e.g. a mixture of all of the primers originally used to provide all of the colonies, but with the primers being provided in solution rather than in immobilised form) .
EXAMPLE 4
Oligonucleotides (Microsynth GmbH Balgach, Switzerland) were grafted onto Nucleolink wells (Nunc, Denmark) . Oligonucleotide PI corresponds to the sequence 5' -TTTTTTTTTTCACCAACCCAAACCAACCCAAACC and oligonucleotide P2 corresponds to 5'-
TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG. In each Nucleolink well, a 45 μl of 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals) solution containing 360 fmol of PI and 360 fmol of P2 was added. To each well, 15 μl of 40 mM l-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-imidazole, was added to the solution of oligonucleotides. The wells were then sealed and incubated at 50 °C for 16 hours. After the incubation, wells have been rinsed twice with 200 μl of RS (0.4N NaOH, 0.25% Tween 20), incubated 15 minutes with 200 μl RS, washed twice with 200 μl RS, and twice with 200μl TNT (lOOmM Tris/HCl pH7.5, 150mM NaCl, 0.1% Tween 20) , before they are put to dry at 50°C in an oven. The dried tubes were stored in a sealed plastic bag at 4°C.
Colony growing was initiated in each well with 15 μl of initiation mix (IX PCR buffer, 0.2 mM dNTPs and 0.75 units of AmpliTaq DNA polymerase, 20 nanograms of template DNA, where the template DNA was either SI DNA or S2 DNA or a 1/1 mixture of SI DNA and S2 DNA, as indicated in discussion to Example 3. SI and S2 are 658 base pair and 704 b.p. fragments, respectively, which have been prepared as described in EXAMPLE 3.
Each well was sealed with Cycleseal™ (Robbins Scientific Corp., Sunnyvale, CA) and incubated at 93°C for 9 minutes, 65°C for 5 minutes and 72°C for 2 minutes and back to 93°C. Then 200 μl TNT solution was used in three successive one minute long washes at 93 °C. The initiation mix was then replaced by 15 μl growing mix (same as initiation mix, but without template DNA) and growing was performed by incubating the sealed wells 9 minutes at 93°C and repeating 40 times the following conditions: 93°C for 45 seconds, 65°C for 3 minutes, 72°C for 2 minutes. After completion of this program, the wells were kept at 6°C until further use. The temperature control was performed in a PTC 200 thermo-cycler.
Different treatments where applied to 6 sets (A, B,C,D,E and F)of 3 wells (1,2,3), one prepared with template SI, one with template SI and template S2 and one prepared with template S2 alone (yielding A1,A2,A3,..., F1,F2,F3) . The set A was left untreated, set B has been incubated for 10 minutes with BAL-31 exonuclease (New England Biolabs, Beverly, MA) at 37°C in BAL-31 buffer (BAL-31 essentially digests double stranded DNA which has both ends free) , set C has been incubated for 10 minutes with SI nuclease (Pharmacia, Uppsala, Sweden) at 37 °C in SI buffer (SI nuclease essentially digests single stranded DNA) , set D, E and F have been incubated with both BAL-31 and SI nucleases. Reactions were stopped by rinsing the wells with TNT buffer.
PCR (25 cycles, 30 sec. at 94°C , 45 sec. at 60°C , 45 sec. at 72°C) has been performed in the Nucleolink wells with 0.25 μM primers P70 (5'-CACCAACCCAAACCAACCCAAACCACGACTCACTATAGGGCGAA) and P71 (5'- AGAAGGAGAAGGAAAGGGAAAGGGTAAAGGGAACAAAAGCTGGA) in solution in sets A,
B, C and D. P70 and P71 are suited for the amplification of both SI and S2, since primer P70 contains the sequence of primer PI and p71 contains P2. In the set E wells, PCR has been performed with a set of forward (P150, 5' -GGTGCTGGTCCTCAGTCTGT) and reverse (P151, 5'- CCCGCTTACCAGTTTCCATT) primers which are within SI and not within S2 so as to produce a 321 bp PCR product, and in the set F wells, PCR has been performed with a set of forward (P152, 5'- CTGGCCTTATCCCTAACAGC) and reverse (P153, 5' -CGATCTTGGCTCATCACAAT) primers which are within S2 and not within Si so as to produce a 390 bp PCR product. For each of the 18 PCR reactions, 3 μl of solution have been used for gel electrophoresis on 1% agarose in presence of 0.1 μg/ml ethidium-bromide . The pictures of the gels are presented in Figure 9. These pictures show that DNA in the colonies is protected from exonuclease digestion (sets B, C and D as compared to set A) , and that both SI and S2 can be recovered either simultaneously using PI and P2 (sets A, B, C and D) or specifically (set E and F) . In set E and F, where the shorter PCR products are more efficiently amplified than the longer PCR products in sets A, B,
C, D, a cross-contamination between the SI and S2 templates is detectable (see lane E2 and FI) .
E) Provision of Secondary Colonies
It is also possible to modify initially formed colonies to provide different colonies (i.e. to provide colonies comprising immobilised nucleic acid molecules with different sequences from those molecules present in the initially formed colonies) . Here, the initially formed colonies are referred to as "primary colonies" and the later formed colonies as "secondary colonies". A preliminary procedure is necessary to turn the primary colonies into "secondary primers" which will be suitable for secondary colony generation.
Figure 10 shows how Secondary primers' are generated using existing primary colonies. As a starting point, the primary colony (figure 10a) is left in the fully hybridised, double-stranded form. A single-strand specific DNA exonuclease might be used to remove all primers which have not been elongated. One could also choose to cap all free 3' -OH ends of primers with dideoxyribonucleotide triphosphates using a DNA terminal transferase (step (i), figure 10b) .
Secondly and independently, the DNA molecules forming the colonies can be cleaved by using endonucleases. For example, a restriction enzyme that recognises a specific site within the colony (depicted by the 'RE' arrow in figure 10c) and cleaves the DNA colony (step (ii) , figure 10) . If desired, the enzymatically cleaved colony (figure lOd) can then be partially digested with a 3' to 5' double-strand specific exonuclease (e.g. E . coli exonuclease III, depicted by 'N' , step (iii) , figure lOd) . In any case, the secondary primers are available after denaturation (e.g., by heat) and washing (figure lOe) .
Alternatively, the double stranded DNA forming the colonies (figure lOf) can be digested with the double-strand specific 3' -5' exonuclease, which digest only one strand of double stranded DNA. An important case is when the exonuclease digests only a few bases of the DNA molecule before being released in solution, and when digestion can proceed when another enzyme binds to the DNA molecule (figure lOg) . In this case the exonuclease digestion will proceed until there remain only single stranded molecules which, on average, are half the length of the starting material, and are without any complementary parts (which could form partial duplexes) remaining in the single stranded molecules in a colony (figure lOh) .
In all cases, these treatments result in single-stranded fragments grafted onto a support which correspond to the sequence of the original template and that can be used for new DNA colony growing if an appropriate new template is provided for colony initiation (figures lOe and lOh) .
The result of such a treatment, thus a support holding secondary primers, will be referred to as a "support for secondary colony growing" . Templates useful for secondary colony growing may include molecules having known sequences (or complements of such sequences) . Alternatively templates may be derived from unsequenced molecules (e.g. random fragments). In either event the templates should be provided with one or more regions for annealing with nucleic acid strands present in the primary colonies.
Figure 11 a-e show how a secondary colony can be generated when an appropriate template (TP, figure 11a) is provided for a second round of DNA colony generation on a support for secondary colony growing, holding secondary primers. In this example, treatment of the primary colony as described above has generated the secondary primers, SP1 and SP2 (figure 11a) . The template TP, will hybridise to its complementary secondary primer, SP1, and following an extension reaction using a DNA polymerase as described, will be extended as depicted (figure 12b) . Following a denaturing (step ii) , reannealing (step iii) and DNA polymerase (step iv) cycle, a replica of the original primary colony will be formed (figure lie) . The maximum size of a secondary colony provided by this embodiment of the present invention is restricted by the size of the primary colony onto which it grows. Several secondary growing processes can be used sequentially to create colonies for specific applications (i.e. a first colony can be replaced with a second colony, the second colony can be replaced with a third colony, etc.)
F) Provision of Extended Primers
Figure 12 shows how extended primers can be generated on an array of oligonucleotides. The same procedure could be applied to a support covered with colonies or secondary primers as described in section E.
In Figure 12a) a support is provided having a plurality of immobilised primers shown thereon. Different immobilised primers are shown present in different regions of the support (represented by squares). Primers having the sequence 5' -AAA are present in one square and primers having the sequence 5' -GGG are present in another square.
Figures 12b) to 12d) show how the initial primers present (initial primers) are modified to give different primers (extended primers) . In this example, those initial primers having the sequence 5' -AAA are modified to produce two different types of extended primers, having the sequences 5'-AAAGCC and 5'-AAATAC respectively. This is achieved by the hybridisation of oligonucleotide templates, 5'-GTATTT and 5'- GGCTTT to the primary primers immobilised on the surface (figure 12b) , followed by DNA polymerase reaction. Those initial primers having the sequence 5' -GGG are modified to produce two different types of extended primers, having the sequences 5'-GGGTAT and 5'- GGGTAA (figure 12d) in a similar manner.
The technique of producing extended primers is useful for transforming immobilised oligonucleotides provided on a DNA chip or other surface into immobilised primers useful in amplifying a particular target nucleic acid sequence and/or in amplifying a complementary strand thereto. G) Preparation of nucleic acid fragments
Apparatuses of the present invention can be used for various procedures some of which will be described later on. Nucleic acid fragments for use in colony generation may be prepared differently for the different procedures (referred to herein as "prepared nucleic acids") . Various preparation procedures are described below:
(i) Preparation of random DNA fragments
Here is described a method to prepare DNA originating from one biological sample (or from a plurality of samples) for amplification in the case where it is not necessary to keep track of the origin of the DNA when it is incorporated within a colony.
The DNA of interest is first extracted from the biological sample and cut randomly into "small" pieces (e.g., 50 to 10,000 bases long, but preferentially 500 to 1000 base pairs in length, represented by bar 'I', figure 13a). (This can be done e.g., by a phenol-chloroform extraction followed by ultrasound treatment, mechanical shearing, by partial digestion with frequent cutter restriction endonucleases or other methods known by those skilled in the art) . In order to standardise experimental conditions, the extracted and cut DNA fragments can be size-fractionated, e.g., by agarose gel electrophoresis, sucrose gradient centrifugation or gel chromatography. Fragments obtained within a single fraction can be used in providing templates in order to reduce the variability in size of the templates.
Secondly, the extracted, cut and (optionally) sorted template DNA fragments can be ligated with oligonucleotide linkers (Ila and lib, figure 13a) containing the sequence of the primer (s) which have previously been grafted onto a support. This can be achieved, for instance, using "blunt-end" ligation. Alternatively, the template DNA fragments can be inserted into a biological vector at a site that is flanked by the sequence of the primers that are grafted on the support. This cloned DNA can be amplified within a biological host and extracted. Obviously, if one is working with a single primer grafted to the solid support for DNA colony formation, purifying fragments containing both PI and P2 primers does not pose a problem.
Hereafter, the DNA fragments obtained after such a suitable process are designated by the expression : "prepared genomic DNA" (III, figure 13a) .
(ii) Preparation of random DNA fragments originating from a plurality of samples
Here it is described how to prepare DNA originating from a plurality of biological samples in the case where it is necessary to keep track of the origin of the DNA when it is incorporated within a colony.
The procedure is the same as that described in the previous section except that in this case, the oligonucleotide linkers used to tail the randomly cut genomic DNA fragments are now made of two parts; the sequence of the primers grafted onto the surface (PI and P2, figure 13b) and a "tag" sequence which is different for each sample and which will be used for identifying the origin of the DNA colony. Note that for each sample, the tag may not be unique, but a plurality of tags could be used. Hereafter, we will designate the DNA fragments obtained after such a suitable process by the expression : "tagged genomic DNA" (III, Figure 13b) .
This tagging procedure can be used for providing colonies carrying a means of identification which is independent from the sequence carried by the template itself. This could also be useful when some colonies are to be recovered specifically (using the procedure given in section D) . This could also be useful in the case the recovered colonies are further processed, e.g., by creating new primary colonies and a cross reference between the original colonies and the new colonies is desired.
(iii) Preparation of DNA fragments corresponding to a plurality of DNA sequences originating from one sample
The DNA of interest can first be extracted from a biological sample by any means known by those skilled in the art (as mentioned supra) . Then the specific sequences of interest can be amplified with PCR
(step (i), figure 13c) using PCR primers (Ila and lib) made of two parts; 1) at the 5' -end, the sequences corresponding to the sequences of primer oligonucleotide (s) that have been grafted onto a surface
(PI and P2)and 2) at the 3' -end, primer sequences specific to the sequence of interest (SI and S2) . Hereafter, we will designate the DNA fragments obtained after such a suitable process by the expression: "prepared DNA" (III, figure 13c) .
(iv) Preparation of a plurality of DNA fragments originating from a plurality of samples
The procedure is the same as in the previous section except that in this case the DNA primers (Ila and lib) used to perform the PCR amplification (step (i), figure 13d) are now made of three parts; 1) the sequence of the primers grafted onto the surface (PI and P2), 2) a "tag" sequence which is different for each sample and which will be used for the identifying the origin of the DNA colony and 3) primer sequences surrounding the specific sequence of interest (SI and S2) . Note that for each sample, a plurality of tags might be used, as in (ii) supra .
Hereafter, we will designate the DNA fragments obtained after such a suitable process by the expression : "tagged DNA" (III, figure 13d) . Potential uses of tags are the same as in (ii) , supra . (v) Preparation of mRNA
The procedure is similar to the procedures described for preparing DNA fragments in the previous sections except that the starting point is to extract mRNA by any means known to those skilled in the art (e.g., by use of commercially available mRNA preparation kits). The mRNA can be copied into double-stranded cDNA by any means known to those skilled in the art (e.g. by using a reverse transcriptase and a DNA polymerase) . Certainly, the tags and primers described supra can be used in conjunction with the process of double-stranded cDNA synthesis to allow their incorporation into the templates. Hereafter, we will designate the mRNA fragments obtained after such suitable processes by the expressions: "prepared total mRNA" (cf. "prepared genomic DNA", as described in section (I) supra ) , "tagged total mRNA", (cf. "tagged genomic DNA", as described in section (ii) supra ) , "prepared mRNA" (cf. "prepared DNA", as described in section (iii) supra) and "tagged mRNA" (cf. "tagged DNA", as described in section (iv) supra) .
H) Preferred Detection Assays
In assay procedures of the present invention labels may be used to provide detectable signals. Examples include: a) a fluorescent group or a energy-transfer based fluorescence system. b) a biotin based system. In this case colonies can be incubated with streptavidin labelled with a fluorescent group or an enzyme (e.g. fluorescent latex beads coated with streptavidin; streptavidin labelled with fluorescent groups; enzymes for use with the corresponding fluorescence assay) . c) a system based on detecting an antigen or a fragment thereof - e.g. a hapten (including biotin and fluorescent groups). In this case colonies can be incubated with antibodies (e.g. specific for a hapten) . The antibodies can be labelled with a fluorescent group or with an enzyme (e.g. fluorescent latex beads coated with the antibody; antibodies labelled with fluorescent groups; antibodies linked to an enzyme for use with a corresponding fluorescence or luminescence assay, etc.). d) a radio-label (e.g. incorporated by using a 5' -polynucleotide kinase and [γ-32P] adenosine triphosphate or a DNA polymerase and [oc-32P or α-33P] deoxyribonucleoside triphosphates to add a radioactive phosphate group (s) to a nucleic acid). Here colonies can be incubated with a scintillation liquid. e) a dye or other staining agent.
Labels for use in the present invention are preferably attached a) to nucleic acids b) to proteins which bind specifically to double stranded DNA (e.g., histones, repressors, enhancers) and/or c) to proteins which bind specifically to single stranded DNA (e . g. single-stranded nucleic acid binding protein) . Labelled colonies are preferably detected by: a) measuring fluorescence. b) measuring luminescence. c) measuring radioactivity d) measuring flow or electric field induced fluorescence anisotropy. and/or e) measuring the polymer layer thickness.
Staining agents can be used in the present invention. Thus DNA colonies can be incubated with a suitable DNA-specific staining agent, such as the intercalating dyes, ethidium bromide, YO-YO, YO- PRO (Molecular Probes, Eugene, OR) .
With certain staining agents the result can be observed with a suitable fluorescence imaging apparatus.
Examples of particular assays/procedures will now be described in greater detail:
X) Preferred Embodiments of Assays of the Present Invention
(i) Nucleic acid probe hybridisation assay
DNA colonies are first prepared for hybridisation. Then they are hybridised with a probe (labelled or unlabelled) . If required, the hybridised probed is assayed, and the result is observed. This can be done with an apparatus of the present invention (e.g. as described supra) .
Preparation for hybridisation
In a preferred embodiment of the present invention colonies are treated with a DNA restriction endonuclease which is specific either for a sequence provided by a double stranded form of one of the primers originally grafted onto the surface where colonies are formed or for another sequence present in a template DNA molecule (see e.g. figure 16c) .
After restriction enzyme digestion, the colonies can be heated to a temperature high enough for double stranded DNA molecules to be separated. After this thermal denaturing step, the colonies can be washed to remove the non-hybridised, detached single-stranded DNA strands, leaving a remaining attached single-strand DNA.
In another embodiment the colonies can be partially digested with a double-strandspecific 3' to 5' DNA exonuclease (see section E, figure lOf) which removes one strand of DNA duplexes starting from the 3' end, thus leaving a part of a DNA molecule in single stranded form.
Alternatively, DNA in colonies can first be heat denatured and then partially digested with an single-strand specific 3' to 5' DNA exonuclease which digests single stranded DNA starting from the 3' end. A further alternative is simply to heat denature DNA in the colonies.
Hybridisation of the probe
Single-stranded nucleic acid probes (labelled or unlabelled) can be hybridised to single-stranded DNA in colonies at the appropriate temperature and buffer conditions (which depends on the sequence of each probe, and can be determined using protocols known to those skilled in the art) .
Assaying of unlabelled hybridised probes
A hybridised probe provided initially in unlabelled form can be used as a primer for the incorporation of the different (or a subset of the different) labelled (or a mix of labelled and unlabelled) deoxyribonucleoside triphosphates with a DNA polymerase. The incorporated labelled nucleotides can then be detected as described supra .
Cyclic assaying of labelled or unlabelled probes
Firstly, the DNA colonies can be prepared for hybridisation by the methods described supra . Then they can be hybridised with a probe (labelled or initially unlabelled) . If required, hybridised labelled probes are assayed and the result is observed with an apparatus as described previously. The probe may then be removed by heat denaturing and a probe specific for a second DNA sequence may be hybridised and detected. These steps maybe repeated with new probes as many times as desired.
Secondly, the probes can be assayed as described supra for unlabelled probes, except that only a subset (preferably 1 only) of the different (labelled or unlabelled) nucleotides are used at each cycle. The colonies can then be assayed for monitoring the incorporation of the nucleotides. This second process can be repeated until a sequence of a desired length has been determined. (ii) in situ RNA Synthesis assay
In this embodiment, DNA colonies can be used as templates for in si tu RNA synthesis as depicted in figure 14. DNA colonies can be generated from templates and primers, such that a RNA polymerase promoter sequence is positioned at one end of the double-stranded DNA in the colony. DNA colonies can then be incubated with RNA polymerase and the newly synthesised RNA (cRNA) can be assayed as desired. The detection can be done non-specifically (e.g., staining) or in a sequence dependent way (e.g., hybridisation).
The DNA template (I, figure 14a) to be amplified into a colony is generated by PCR reaction using primers (Ila and lib) which have the following four parts; 1) sequence identical to the sequences of the primers grafted onto the surface ( ΛP1' and ΛP2'), 2) a "tag" sequence which is different for each sample , a sequence corresponding to a RNA polymerase promoter, ie. the T3, T7 and SP6 RNA promoters, ( ΛRPP' , figure 14a) and 4) primer sequences surrounding the specific sequence of interest ( ΛS1' and ΛS2' ) . Hereafter, we will designate the DNA fragments obtained after such a suitable process by the expression: "tagged RNA synthesis DNA" (III, figure 14b) .
After amplification of the DNA template from the original DNA sample, these templates are used to generate DNA colonies. The DNA colonies
(IV, figure 14c) are then incubated with the RNA polymerase specific for the RNA polymerase promoter ( λRPP' , figure 14c) . This will generate a copy of RNA specific for the DNA colony template
(Template-cRNA, V, figure 14d) .
cRNA thus synthesised can be isolated and used as hybridisation probes, as messenger RNA (mRNA) templates for in vi tro protein synthesis or as templates for in situ RNA sequence analysis. (iii) Methods for sequencing
In another embodiment of the present invention, colonies can be analysed in order to determine sequences of nucleic acid molecules which form the colonies. Since very large numbers of the same nucleic acid molecules can be provided within each colony the reliability of the sequencing data obtained is likely to be very high.
The sequences determined may be full or partial. Sequences can be determined for nucleic acids present in one or more colonies. A plurality of sequences may be determined at the same time.
In some embodiments the sequence of a complementary strand to a nucleic acid strand to be sequenced (or of a part thereof) may be obtained initially. However this sequence can be converted using base-pairing rules to provide the desired sequence (or a part thereof) . This conversion can be done via a computer or via a person. It can be done after each step of primer extension or can be done at a later stage.
Sequencing can be done by various methods . For example methods relying on sequential restriction endonuclease digestion and linker ligation can be used. One such method is disclosed in WO95/27080 for example. This method comprises the steps of: ligating a probe to an end of a polynucleotide, the probe having a nuclease recognition site; identifying one or more nucleotides at the end of the polynucleotide; and cleaving the polynucleotide with a nuclease recognising the nuclease recognition site of the probe such that the polynucleotide is shortened by one or more nucleotides.
However in a preferred method of the present invention, amplified nucleic acid molecules (preferably in the form of colonies, as disclosed herein) are sequenced by allowing primers to hybridise with the nucleic acid molecules, extending the primers and detecting the nucleotides used in primer extension. Preferably, after extending a primer by a single nucleotide, the nucleotide is detected before a further nucleotide is used in primer extension (step-by-step sequencing) .
One or more of the nucleotides used in primer extension may be labelled. The use of labelled nucleotides during primer extension facilitates detection. (The term "label" is used in its broad sense to indicate any moiety that can be identified using an appropriate detection system. Preferably the label is not present in naturally- occurring nucleotides.) Ideally, labels are non-radioactive, such as fluorophores. However radioactive labels can be used.
Where nucleotides are provided in labelled form the labels may be the same for different nucleotides. If the same label is used each nucleotide incorporation can be used to provide a cumulative increase of the same signal (e.g. of a signal detected at a particular wavelength) . Alternatively different labels may be used for each type of nucleotide (which may be detected at different wavelengths) .
Thus four different labels may be provided for dATP, dTTP, dCTP and dGTP, or the same label may be provided for them all. Similarly, four different labels may be provided for ATP, UTP,CTP and GTP, or the same label may be provided for them all ) . In some embodiments of the present invention a mixture of labelled and unlabelled nucleotides may be provided, as will be described in greater detail later on.
In a preferred embodiment of the present invention the sequencing of nucleic acid molecules present in at least 2 different colonies is performed simultaneously. More preferably, sequencing of nucleic acid molecules present in over 10, over 100, over 1000 or even over 1,000,000 different colonies is performed simultaneously. Thus if colonies having different nucleic acids molecules are provided, many different sequences (full or partial) can be determined simultaneously - i.e. over 10, over 100, over 1000 or even over 1,000,000 different sequences may be determined simultaneously.
If desired, controls may be provided, whereby a plurality of colonies comprising the same nucleic acid molecules are provided. By determining whether or not the same sequences are obtained for nucleic acid molecules in these colonies it can be ascertained whether or not the sequencing procedure is reliable.
One sequencing method of the present invention is illustrated in figure 17, which is entitled " in si tu sequencing". On prepared DNA colonies hybridised with an appropriate sequencing primer, cyclic addition of the individual deoxyribonucleoside triphosphates and DNA polymerase will allow the determination of the DNA sequence immediately 3' to the sequencing primer. In the example outlined in figure 17, the addition of dGTP allows the determination of colony 1 to contain a 'G' . In the second cycle addition of dATP is detected in both colonies, determining that both colonies have an 'A' in the next position. After several repetitions of the addition of single deoxyribonucleoside triphosphates, it will be possible to determine any sequence. For example sequences of at least 10, at least 20, at least 50 or at least 100 bases may be determined.
If colonies are provided initially in a form comprising double- stranded molecules the colonies can be processed to provide single- stranded molecules for use in sequencing as described above. (It should however be noted that double stranded molecules can be used for sequencing without such processing. For example a double stranded DNA molecule can be provided with a promoter sequence and step-by- step sequencing can then be performed using an RNA polymerase and labelled ribonucleotides (cf Figure 16 d) ) . Another alternative is for a nick to be introduced in a double stranded DNA molecule so that nick translation can be performed using labelled deoxyribonucleotides . and a DNA polymerase with 5' to 3' exonuclease activity. )
One way of processing double-stranded molecules present in colonies to provide single-stranded colonies as described later with reference to Figure 19. Here double-stranded immobilised molecules present in a colony (which may be in the form of bridge-like structures) are cleaved and this is followed by a denaturing step. (Alternatively a denaturing step could be used initially and could be followed by a cleavage step) . Preferably cleavage is carried out enzymatically. However other means of cleavage are possible, such as chemical cleavage. (An appropriate cleavage site can be provided in said molecule). Denaturing can be performed by any suitable means. For example it may be performed by heating and / or by changing the ionic strength of a medium in the vicinity of the nucleic acid molecules.
Once single-stranded molecules to be sequenced are provided, suitable primers for primer extension can be hybridised thereto. Oligonucleotides are preferred as primers. These are nucleic acid molecules that are typically 6 to 60, e.g. 15 to 25 nucleotides long. They may comprise naturally and / or non-naturally occurring nucleotides. (However other molecules, e.g. longer nucleic acid strands may alternatively be used as primers, if desired. ) The primers for use in sequencing preferably hybridise to the same sequences present in amplified nucleic acid molecules as do primers that were used to provide said amplified nucleic acids. (Primers having the same / similar sequences can be used for both amplification and sequencing purposes) .
When primers are provided in solution and are annealed (hybridised) to nucleic acid molecules present in colonies to be sequenced, those primers which remain in solution or which do not anneal specifically can be removed after annealing. Preferred annealing conditions (temperature and buffer composition) prevent non-specific hybridisation. These may be stringent conditions. Such conditions would typically be annealing temperatures close to a primer's Tm (melting temperature) at a given salt concentration (e.g. 50 nM primer in 200 mM NaCl buffer at 55 °C for a 20-mer oligonucleotide with 50% GC content) . (Stringent conditions for a given system can be determined by a skilled person. They will depend on the base composition, GC content, the length of the primer used and the salt concentration. For a 20 base oligonucleotide of 50% GC, calculated average annealing temperature is 55-60°C, but in practice may vary between 35 to 70°C) . Primers used for primer extension need not be provided in solution, since they can be provided in immobilised form. In this embodiment the primers should be provided in the vicinity of the immobilised molecules to which they are to be annealed. (Such primers may indeed already be present as excess immobilised primers that were not used in amplifying nucleic acid molecules during the formation of colonies. )
The nucleic acid molecules present in colonies to be sequenced will include a sequence that hybridises to the primers to be used in sequencing (preferably under "stringent" conditions) . This portion can be added to a given molecule prior to amplification (which molecule may have a totally / partially unknown sequence) using techniques known to those skilled in the art. For example it can be synthesised artificially and can be added to a given molecule using a ligase.
Once a nucleic acid molecule annealed to a primer is provided, primer extension can be performed. RNA or DNA polymerases can be used. DNA polymerases are however the enzymes of choice for preferred embodiments. Several of these are commercially available. Polymerases which lack 3' to 5' exonuclease activity can be used, such as T7 DNA polymerase or the small (Klenow) fragment of DNA polymerase I may be used [e.g. the modified T7 DNA polymerase Sequenase™ 2.0 (Amersham) or Klenow fragment (3' to 5' exo-, New England Biolabs)]. However it is not essential to use such polymerases. Indeed, where it is desired that the polymerases have proof-reading activity polymerases lacking 3' to 5' exonuclease activity would not be used. Certain applications may require the use of thermostable polymerases such as ThermoSequenase™ (Amersham) or Taquenase™ (ScienTech, St Louis, MO) . Any nucleotides may be used for primer extension reactions (whether naturally occurring or non- naturally occurring) . Preferred nucleotides are deoxyribonucleotides^ dATP, dTTP, dGTP and dCTP (although for some applications the dTTP analogue dUTP is preferred) or ribonucleotides ATP, UTP, GTP and CTP; at least some of which are provided in labelled form. A washing step is preferably incorporated after each primer extension step in order to remove unincorporated nucleotides that may interfere with subsequent steps. The preferred washing solution should be compatible with polymerase activity and have a salt concentration that does not interfere with the annealing of primer molecules to the nucleic acid molecules to be sequenced. (In less preferred embodiments, the washing solution may interfere with polymerase activity. Here the washing solution would need to be removed before further primer extension.)
Considering that many copies of molecules to be sequenced can be provided in a given colony, a combination of labelled and non- labelled nucleotides can be used. In this case, even if a small proportion of the nucleotides are labelled (e.g. fluorescence- labelled) , the number of labels incorporated in each colony during primer extension can be sufficient to be detected by a detection device. For example the ratio of labelled to non-labelled nucleotides may be chosen so that, on average, labelled nucleotides are used in primer extension less than 50%, less than 20%, less than 10% or even less than 1% of the time (i.e. on average in a given primer extension step a nucleotide is incorporated in labelled form in less than 50%, less than 20%, less than 10 %, or less than 1% of the extended primers. )
Thus in a further embodiment of the present invention there is provided a method for sequencing nucleic acid molecules present in a colony of the present invention, the method comprising the steps of:
a) providing at least one colony comprising a plurality of single stranded nucleic acid molecules that have the same sequences as one another and that are hybridised to primers in a manner to allow primer extension in the presence of nucleotides and a nucleic acid polymerase;
b) providing said at least one colony with a nucleic acid polymerase and a given nucleotide in labelled and unlabelled form under conditions that allow extension of the primers if a complementary base or if a plurality of such bases is present at the appropriate position in the single stranded nucleic acid molecules present in said at least one colony;
c) detecting whether or not said labelled nucleotide has been used for primer extension by determining whether or not the label present on said nucleotide has been incorporated into extended primers;
Steps b) and c) may be repeated one or more times. Preferably a plurality of different colonies are provided and several different sequences are determined simultaneously.
This further embodiment of the present invention can be used to reduce costs, since relatively few labelled nucleotides are needed. It can also be used to reduce quenching effects.
It is however also possible to use only labelled nucleotides for primer extension or to use a major portion thereof (eg. over 50 %, over 70% or over 90% of the nucleotides used may be labelled) . This can be done for example if labels are selected so as to prevent or reduce quenching effects. Alternatively labels may be removed or neutralised at various stages should quenching effects become problematic (e.g. laser bleaching of fluorophores may be performed). However this can increase the number of steps required and it is therefore preferred that labels are not removed (or at least that they are not removed after each nucleotide has been incorporated but are only removed periodically) . In other less preferred embodiments, the primer itself and its extension product may be removed and replaced with another primer. If required, several steps of sequential label-free nucleotide additions may be performed before actual sequencing in the presence of labelled nucleotides is resumed. A further alternative is to use a different type of label from that used initially (e.g. by switching from fluorescein to rhodamine) should quenching effects become problematic.
In preferred embodiments of the present invention a plurality of labelled bases are incorporated into an extended primer during sequencing. This is advantageous in that it can speed up the sequencing procedure relative to methods in which, once a labelled base has been incorporated into an extended primer, the label must be removed before a further labelled base can be incorporated. (The plurality of labelled bases may be in the form of one or more contiguous stretches, although this is not essential.)
The present invention therefore also includes within its scope a method for sequencing nucleic acid molecules, comprising the steps of:
a) using a first colony to provide a plurality of single stranded nucleic acid molecules that have the same sequences as one another and that are hybridised to primers in a manner to allow primer extension in the presence of nucleotides and a nucleic acid polymerase;
b) using a second colony to provide a plurality of single stranded nucleic acid molecules that have the same sequences as one another, and that are also hybridised to primers in a manner to allow primer extension in the presence of nucleotides and a nucleic acid polymerase;
c) providing each colony with a nucleic acid polymerase and a given labelled nucleotide under conditions that allow extension of the primers if a complementary base or if a plurality of such bases is present at the appropriate position in the single stranded nucleic acid molecules;
d) detecting whether or not said labelled nucleotide has been used for primer extension at each colony by determining whether or not the label present on said nucleotide has been incorporated into extended primers;
e) repeating steps c) and d) one or more times so that extended primers comprising a plurality of labels are provided.
Preferably the sequences of the nucleic acid molecules present at said first and said locations are different from one another - i.e. a plurality of colonies comprising different nucleic acid molecules are sequenced In view of the foregoing description it will be appreciated that a large number of different sequencing methods using colonies of the present invention can be used. Various detection systems can be used to detect labels used in sequencing in these methods (although in certain embodiments detection may be possible simply by eye, so that no detection system is needed) . A preferred detection system for fluorescent labels is a Charge-Coupled-Device (CCD) camera, which can optionally be coupled to a magnifying device. Any other device allowing detection and, preferably, also quantification of fluorescence on a surface may be used. Devices such as fluorescent imagers or confocal microscopes may be chosen.
In less preferred embodiments, the labels may be radioactive and a radioactivity detection device would then be required. Ideally such devices would be real-time radioactivity imaging systems. Also less preferred are other devices relying on phosphor screens (Moleculal Dynamics) or autoradiography films for detection.
Depending on the number of colonies to be monitored, a scanning system may be preferred for data collection. (Although an alternative is to provide a plurality of detectors to enable all colonies to be covered.) Such a system allows a detector to move relative to a plurality of colonies to be analysed. This is useful when all the colonies providing signals are not within the field of view of a detector. The detector may be maintained in a fixed position and colonies to be analysed may be moved into the field of view of the detector (e.g. by means of a movable platform). Alternatively the colonies may be maintained in fixed position and the detection device may be moved to bring them into its field of view.
The detection system is preferably used in combination with an analysis system in order to determine the number (and preferably also the nature) of bases incorporated by primer extension at each colony after each step. This analysis may be performed immediately after each step or later on, using recorded data. The sequence of nucleic acid molecules present within a given colony can then be deduced from the number and type of nucleotides added after each step.
Preferably the detection system is part of an apparatus comprising other components . The present invention includes an apparatus comprising a plurality of labelled nucleotides, a nucleic acid polymerase and detection means for detecting labelled nucleotides when incorporated into a nucleic acid molecule by primer extension, the detection means being adapted to distinguish between signals provided by labelled nucleotides incorporated at different colonies.
The apparatus may also include temperature control, solvent delivery and washing means. It may be automated.
Methods and apparatuses within the scope of the present invention can be used in the sequencing of:
• unidentified nucleic acid molecules (i.e. de novo sequencing);
• and nucleic acid molecules which are to be sequenced to check if one or more differences relative to a known sequence are present (e.g. identification of polymorphisms). This is sometimes referred to as "re-sequencing".
Both de novo sequencing and re-sequencing are discussed in greater detail later on (see the following sections (v) and (vi) ) .
For de novo sequencing applications, the order of nucleotides applied to a given location can be chosen as desired. For example one may choose the sequential addition of nucleotides dATP, dTTP, dGTP, dCTP; dATP, dTTP, dGTP, dCTP; and so on. (Generally a single order of four nucleotides would be repeated, although this is not essential.) For re-sequencing applications, the order of nucleotides to be added at each step is preferably chosen according to a known sequence.
Re-sequencing may be of particular interest for the analysis of a large number of similar template molecules in order to detect and identify sequence differences (e.g. for the analysis of recombinant plasmids in candidate clones after site directed mutagenesis or more importantly, for polymorphism screening in a population) . Differences from a given sequence can be detected by the lack of incorporation of one or more nucleotides present in the given sequence at particular stages of primer extension. In contrast to most commonly used techniques, the present method allows for detection of any type of mutation such as point mutations, insertions or deletions. Furthermore, not only known existing mutations, but also previously unidentified mutations can be characterised by the provision of sequence information.
In some embodiments of the present invention long nucleic acid molecules may have to be sequenced by several sequencing reactions, each one allowing for determination of part of the complete sequence. These reactions may be carried out at different colonies (where the different colonies are each provided with the same nucleic acid molecules to be sequenced but different primers), or in successive cycles applied at the same colony (where between each cycles the primers and extension products are washed off and replaced by different primers) .
(iv) DNA Fingerprinting
This embodiment of the present invention aims to solve the problem of screening a large population for the identification of given features of given genes, such as the detection of single nucleotide polymorphisms .
In one preferred embodiment, it consists in generating tagged genomic DNA (see section G(ii) supra) . (Thus each sample originating from a given individual sample has been labelled with a unique tag) . This tagged DNA can be used for generating primary colonies on an appropriate surface comprising immobilised primers. Several successive probe hybridisation assays to the colonies can then be performed. Between each assay the preceding probe can be removed, e.g. by thermal denaturation and washing. Advantages of this embodiment of the present invention over other approaches for solving this problem are illustrated in the following example of a potential practical application.
It is intended to detect which part of a gene (of, e.g., 2000 bases in size) , if any, is related to a disease phenotype in a population of typically 1,000 to 10,000 individuals. For each individual, a PCR amplification can be performed to specifically amplify the gene of interest and to link a tag and a colony generating primer (refer to section G(iv), preparation of "tagged DNA").
In order to obtain a representative array of sample, one might want to array randomly 500,000 colonies (i.e. 10 times redundancy, so to have only a small probability of missing the detection of a sample) . With a colony density of 10,000 colonies per mm2, a surface of ~7 mm x 7 mm can be used. This is a much smaller surface than any other technology available at present time (e.g. The HySeq approach uses 220 mm x 220 mm for the same number of samples (50,000) without redundancy) . The amount of reactants (a great part of the cost) will be proportional to the surface occupied by of the array of samples. Thus the present invention can provide an 800 fold improvement over the presently available technology.
Using an apparatus to monitor the result of the ^in situ ' sequencing or probe hybridisation assays, it should take on the order of 1 to 10 seconds to image a fluorescent signal from colonies assayed using fluorescence present on a surface of ~1 mm2. Thus, assuming that the bottleneck of the method is the time required to image the result of the assay, it takes of the order of 10 minutes to image the result of an assay on 50,000 samples (500,000 colonies). To provide 200 assays including imaging (on one or several 7 mm x 7 mm surfaces) , using the present invention can take less than 36 hours. This represents a 20 times improvement compared to the best method known at present time (HySeq claims 30 days to achieve a comparable task) . Improvements (colony densities 10 times higher and imaging time of 1 second) could allow for much higher throughput and finally the ultimately expected throughput could be about 2000 times faster than the best, not yet fully demonstrated, technology available at present time.
Another advantage of using the present invention lies in the fact that it overcomes the problem arising with individuals who have heterozygous mutations for a given gene. While this problem may be addressed by existing sequencing methods to determine allelic polymorphisms, current high throughput mutation detection methods based on oligonucleotide probe hybridisation may lead to difficulties in the interpretation of results due to an unequal hybridisation of probes in cases of allelic polymorphisms and therefore errors can occur. In this embodiment of the present invention, each colony arises from a single copy of an amplified gene of interest. If an average of 10 colonies are generated for each individual locus, there will be an average of 5 colonies corresponding to one version of a gene and 5 colonies corresponding to the other version of the gene. Thus heterozygotic mutations can be scored by the number of times a single allele is detected per individual genome sample.
(v) DNA resequencing
This embodiment of the present invention provides a solution to the problem of identifying and characterising novel allelic polymorphisms within known genes in a large population of biological samples.
In its preferred embodiment it consists in obtaining tagged DNA (each sample originating from a given individual has been tagged with a unique tag - see section G(iv)). This encoded DNA can then be used for generating primary colonies on an appropriate surface comprising immobilised primers. Several successive assays of probe hybridisation to the colonies can then be performed wherein between each cyclic assay the preceding probe can be removed by thermal denaturation and washing. Preferably, the DNA sequence 3' to a specific probe may be determined directly by in si tu sequencing' (section I (iii), Methods of sequencing).
The advantages of the present invention over other approaches for solving this problem are illustrated in the following example of potential practical application:
It is desired to identify the variability of the sequence of a gene (of, e.g., 2 000 bases in size), if any, in a population of typically 4 000 individuals. It is assumed that a reference sequence of the gene is known. For each individual, a PCR amplification can be performed to specifically amplify the gene of interest and link a tag and a colony generating primer. In order to obtain a representative array of sample, one might want to array randomly 40 000 colonies (i.e. 10 times redundancy, so to have a small probability of missing the detection of a sample) . With a colony density of 10 000 colonies per mm2, a surface of ~2 mm x 2 mm can be used.
Using an apparatus with a CCD camera (having a 2000 x 2000 pixel chip) to monitor the result of the assay, it should take of the order of 10 seconds to image a fluorescent signal from colonies on a surface of 4 mm2. If it is assumed possible to read at least 20 bases during one round of the assay, this requires 61 imaging steps (3n+l imaging steps are necessary for reading n numbers of bases) . If it is assumed that the bottleneck of the method is the time to image the result of the assay, it takes of the order of 15 minutes to image the result of an assay on 4 000 samples (40 000 colonies) . To realise 100 assays (on one or several 2x2 m2 surfaces) in order to cover the entire gene of interest, the present invention can allow the whole screening experiment to be performed in approximately one day, with one apparatus. This can be compared to the most powerful systems operational at the present time.
In this embodiment of the present invention with conservative assumptions (colony density, imaging time, size of the CCD chip) , a throughput of 3.2x 106 bases per hour could be reached, i.e. a 400 fold improvement when compared to the most commonly used system at present time (current DNA sequencers have a typical throughput of the order of 8,000 bases read/hour).
(vi) da novo DNA sequencing
This embodiment of the present invention aims to solve the problem of sequencing novel genomes (or parts thereof) with low cost and in short time, where the sequence of the DNA is not known. Genomic DNA can be prepared, either directly from the total DNA of an organism of interest or from a vector into which DNA has been inserted. The prepared genomic DNA (from whatever source) can be used to generate DNA colonies. The DNA colonies can then be digested with a rare- cutting restriction enzyme, whose site is included in the linker, denatured and sequenced.
Figure 16 depicts an example of de novo DNA sequencing. In this example, genomic DNA is fragmented into pieces of 100 to 2000 base pairs (see preparation of random DNA fragments, section G(i)). These fragments will be ligated to oligonucleotide linkers (Ila and lib, figure 16a) which include sequences specific for the grafted primers on the surface ( 'PI' and 'P2' ) , a sequence which is recognised by a rare-cutting restriction nuclease ( 'RE' ) and a sequence corresponding to a sequencing primer ( 'SP' ) , resulting in templates (III, figure 16b) . Using this prepared DNA as template for DNA colony formation, one obtains primary colonies (IV, figure 16c) . These colonies are then digested with the corresponding restriction endonuclease and denatured to remove the non-attached DNA strand (V, figure 16d) . The sequencing primer (SP) is then annealed to the attached single- stranded template (figure 16e) . Incorporation and detection of labelled nucleotides can then be carried out as previously described (see section I (iii) , Methods of Sequencing) .
In this embodiment, the throughput obtainable can be at least 400 times higher than presently available methods. (vii) mRNA gene expression monitoring
This embodiment of our invention means to solve the problem of monitoring the expression of a large number of genes simultaneously.
Its preferred embodiment is depicted in figure 17.
Firstly, primary colonies are prepared, as depicted in figure 3. In its preferred form, the DNA used for this preparation is 'prepared genomic DNA' or 'tagged genomic DNA', as described in section G(i) and G(iii), respectively, and where the DNA is either from the whole genome of one (or several) organism(s) or from a subset thereof (e.g., from a library of previously isolated genes) . In figure 17, the uppercase letters, "A", "B" and "D" represent colonies which have arisen from genes which exhibit high, medium and low expression levels, respectively, and "E" represents colonies arising from non- expressed genes (in real cases, all these situations may not necessarily be present simultaneously) .
Secondly, the colonies are treated to turn then into supports (i.e. secondary primers) for secondary colony growing (step i in figure 17a), as described in section E. At this stage (figure 17b), the treated colonies are represented by underlined characters (A, B, D, or E) .
Thirdly, (step ii in figure 17b) this support for secondary colony growing is used to regenerate colonies from mRNA (or cDNA) templates extracted from a biological sample, as described in section C. If the template is mRNA, the priming step of colony regeneration will be performed with a reverse transcriptase. After a given number of colony amplification cycles, preferably 1 to 50, the situation will be as depicted in (figure 17c) : the colonies corresponding to highly expressed genes (represented by the letter "A") are totally regenerated, as their regeneration has been initiated by many copies of the mRNA; the colonies corresponding to genes of medium expression levels (represented by the letters "b" and "B") , have been only partially regenerated; only a few of the colonies corresponding to rare genes (represented by the letter "d") , have been partially regenerated; the colonies corresponding to non-expressed sequences (represented by the letter "E"), have not been regenerated at all.
Lastly, (step iii in figure 17c) , additional cycles of colony growing are performed (preferably 2 to 50), and the colonies which have not been totally regenerated during the previous steps finally become totally regenerated, "b" becomes "B", "d" becomes "D" (figure 17d) : the colonies corresponding to genes with high and medium expression levels are all regenerated "A" and "B" or "B"; the colonies corresponding to genes with low levels of expression are not all regenerated "D" and "D"; the colonies corresponding to non-expressed sequences are not regenerated at all "E".
The relative levels of expression of the genes can be obtained by the following preferred methods:
- Firstly levels of expression can be monitored by following the rate of regeneration of the colonies (i.e., by measuring the amount of DNA inside a colony after different number of colony growing cycles during step (iii) ) as the rate at which a colony is regenerated will be linked the number of mRNA (or cDNA) molecules which initiated the regeneration of that colony (at first approximation, the number of DNA molecules after n cycles, noted M(n), in a colony undergoing regeneration should be given by M(n) = Mnr'""11, where M0 is the number of molecules which initiated the regeneration of the colony, r is the growing rate and n is the number of cycles);
- Secondly, levels of expression can be monitored by counting, for each gene, the number of colonies which have been regenerated and comparing this number to the total number of colonies corresponding to that gene. These measurements will generally give access to the relative expression levels of the genes represented by the colonies. The identification of the colonies is preferably performed by fingerprinting, in a manner essentially similar to embodiment, section I(iv). Note that encoding the DNA samples is not required, but can be considered as an alternative to the direct identification of the DNA in the colonies. This can be of practical interest because with coding, the same codes (thus the same oligonucleotides involved in assaying the code) can be used for any set of genes, whereas without code, a different set of specific oligonucleotides has to be used for each set of genes.
This embodiment of our invention has many advantages if compared to current state of the art including: a very high throughput; no requirement for prior amplification of the mRNA (even though prior amplification is compatible with or invention) ; small amounts of samples and reactants are required due to the high density of samples with our invention; the presence of highly expressed genes has no incidence on the ability to monitor genes with low levels of expression; the ability to simultaneously monitor low and high levels of expression within the set of genes of interest.
When the initial DNA in the generation of the primary DNA colony is made from the DNA of a whole genome, this embodiment also provides the following features: there is no interference between genes expressed at high level and at low level even though one has not performed specific amplification of the genes of interest. This is a unique feature of the use of this invention: specific amplification is not possible because the initial assumption of this embodiment is to monitor the expression genes which may have not yet been isolated, thus which are unknown, and thus for which no specific (unique) sequences are known and which specific sequences would have been necessary for specific gene amplification. The ability of our invention to perform this type of mRNA expression monitoring is due to the fact that when the primary colonies are prepared, statistically, each piece of the initial genome will be represented by the same number of colonies. Thus, frequent and rare DNA will initiate the same number of colonies (e.g., one colony per added genome molecule) . Quantitative information might be obtained both from frequent and rare mRNAs by monitoring the growing rate of the colonies.
(viii) Isolation and characterisation of novel expressed genes
This embodiment of our invention means to solve the problem of isolating the genes which are specifically induced under given conditions, e.g., in specific tissues, different strains of a given species or under specific activation. A practical example is the identification of genes which are up or down regulated after drug administration.
The preferred embodiment for isolating genes from a specific or activated biological sample (hereafter called target sample) which are up-regulated compared with a reference biological sample (hereafter called reference sample) is depicted in figure 18.
Firstly, primary colonies are prepared (figure 18a) . In its preferred form, the DNA used for this preparation is prepared genomic DNA or tagged genomic DNA, as described in sections G(i) and G(ii), respectively, where the DNA is either from the whole genome of one (or several) organism(s) or from a subset thereof (e.g., from a library of previously isolated genes) , and where both the primers used for colony generation (hereafter called Pi and P2) contain a endonuclease restriction site. In figure 18a, "A" represents colonies which have arisen from genes expressed in both the reference sample and the target sample, "B" represents colonies which have arisen from genes expressed only in the reference sample, "C" represents colonies which have arisen from genes expressed only in the target sample, and "D" represents colonies arising from non-expressed genes (in real cases, all these situations may not necessarily be present simultaneously) . Secondly, primary colonies are then treated to generate secondary primers as the support for secondary colony growing (step i in figure 18a) . At this stage (b) , the colonies are represented as underlined characters (A, B,C,D).
Thirdly, (step ii in figure 21b) the secondary primers are used to regenerate colonies using mRNA or cDNA (represented by "mA + mB") extracted from the biological reference sample as a template, as described in G(v). If the template is mRNA, the first elongation step of colony regeneration will be performed with a reverse transcriptase. After enough colony growing cycles, preferably 5 to 100, only the colonies corresponding to genes expressed in the reference sample ("A" and "B") will be regenerated, as depicted in (figure 18c) .
In step (iii), the colonies are digested with a restriction enzyme (represented by RE) which recognises a site in the flanking primer sequences, PI and P2, which are grafted on the support and which were the basis of primary colony generation. Importantly, only the colonies which have been regenerated during step (ii) will be digested. This is because the support for secondary colony growth is made of single stranded DNA molecules, which can not be digested by the restriction enzyme. Only the regenerated colonies are present in a double stranded form, and are digested. After digestion, the situation is the one depicted in figure 18d. The colonies corresponding to the genes expressed in the reference sample have totally disappeared, i.e., they are not even present as a support for secondary colony growth, and the colonies corresponding to genes expressed only in the target sample "C" and the colonies corresponding to non-expressed genes "D" are still present as a support for secondary colony generation.
In step (iv) , mRNA (or cDNA) (represented by "mA + mC") extracted from the target sample is used to generate secondary colonies. Because colonies corresponding to mA and mB no longer exist, only the colonies corresponding to mC can be regenerated (ie. Only the mRNA specifically expressed in the target sample) . After sufficient number of colony growing cycles (preferably 5 to 100), the situation is such that only the colonies corresponding to genes expressed specifically in the target sample are regenerated ("C", figure 18e) .
In step (v) , the regenerated colonies "C" are used to generate copies of the DNA that they contain by performing several (preferably 1 to 20) colony growing cycles in the presence of the primers PI and P2, as described in section D of the present invention. A PCR amplification is then performed using PI and P2 in solution (described in section D) and the amplified DNA characterised by classical methods.
The preferred embodiment for isolating genes from a specific or activated biological sample which are less expressed than in a reference biological sample is depicted in figure 19. The different steps involved in this procedure are very similar to those involved in the isolation of gene which are more regulated than in the reference sample, and the notation are the same as in figure 18. The only difference is to inverse the order used to regenerate the colonies: in step (ii), the mRNA used is the one extracted from the target biological sample ("mA + mC") instead of the mRNA extracted form the reference biological sample ("mA + mB") , and in step (iv) , the mRNA used is the one extracted from the reference biological sample ("mA + mB") instead of the one extracted from the target sample ("mA + mC") . As a result, only the DNA from colonies corresponding to genes which are expressed in the reference sample but not in the target sample is recovered and amplified ("B", figure 19f) .

Claims

Claims
1. A method of nucleic acid amplification, comprising the steps of:
A. providing a plurality of primers that are immobilised but that have one end exposed to allow primer extension;
B. allowing a single stranded target nucleic acid molecule to anneal to one of said plurality of primers over part of the length of said single stranded nucleic acid molecule and then extending that primer using the annealed single stranded nucleic acid molecule as a template, so as to provide an extended immobilised nucleic acid strand;
C. separating the target nucleic molecule from the extended immobilised nucleic acid strand;
D. allowing the extended immobilised nucleic acid strand to anneal to one of said plurality of primers referred to in step A) and then extending that primer using the extended immobilised nucleic acid strand as a template, so as to provide another extended immobilised nucleic acid strand; and optionally,
E. separating the annealed extended immobilised nucleic acid strands from one another.
2. A method according to claim 1, further comprising:
F. using at least one extended immobilised nucleic acid strand to repeat steps D) and E) , so as to provide additional extended immobilised nucleic acid strands and, optionally,
G. repeating step F) one or more times.
3. A method according to claim 1 or claim 2, wherein said single- stranded target nucleic acid is produced by providing a given nucleic acid sequence to be amplified (which sequence may be known or unknown) and adding thereto a first nucleic acid sequence and a second nucleic acid sequence; wherein said first nucleic acid sequence hybridises to one of said plurality of primers and said second nucleic acid sequence is complementary to a sequence which hybridises to one of said plurality of primers.
4. A method according to any preceding claim; wherein said single- stranded target nucleic acid is produced by providing a given nucleic acid sequence to be amplified (which sequence may be known or unknown) and adding thereto a first nucleic acid sequence and a second nucleic acid sequence; wherein said first nucleic acid sequence hybridises to one of said plurality of primers and said second nucleic acid sequence is the same as the sequence of one of said plurality of primers.
5. A method according to claim 3 or claim 4 wherein said first and second nucleic acid sequences are provided at first and second ends of said single-stranded target nucleic acid.
6. A method according to any of claims 3 to 5, wherein a tag is also added to the given nucleic acid sequence, said tag enabling amplification products of the given nucleic acid sequence to be identified.
7. A method according to any preceding claim wherein the plurality of primers is a plurality of primers that have the same sequence.
8. A method according to any of claims 1 to 6, wherein the plurality of primers comprises at least two different types of primer, one type having a different sequence from another type.
9. A method according to claim 8, wherein the plurality of primers consists of 2n different types of primer; wherein n is an integer.
10. A method according to claim 8 or claim 9, wherein the different types of primer are present in substantially the same concentrations as one another
11. A method according to any preceding claim, wherein the primers are substantially homogeneously dispersed over a given area
12. A method according to any preceding claim, wherein the primers are located in a predetermined arrangement (e.g. in a grid pattern)
13. A method according to any preceding claim, wherein a supply of nucleotides and a nucleic acid polymerase are used to extend primers
14. A method according to any preceding claim, wherein heating is used to separate annealed nucleic acid strands
15. A method according to claim 14 when dependent upon claim 13, wherein the nucleic acid polymerase is not rendered inactive by the heating conditions used to separate annealed nucleic acid strands.
16. A method according to claim 15, wherein said nucleic acid polymerase is taq polymerase, is another polymerase that is derivable from a thermophilic organism; or is a thermostable derivative thereof.
17. A method according to any preceding claim, wherein said primer extension results in the incorporation of one or more detectable labels (e.g. fluorescent labels or radiolabels) into extended immobilised nucleic acid strands .
18. A method according to any preceding claim, further including the step of treating one or more extended immobilised nucleic acid strands so as to release a nucleic acid molecule or a part thereof.
19. A method according to claim 18, wherein said treating consists of cleavage with a restriction endonuclease or with a ribozyme.
20. A method according to any preceding claim, wherein one or more of said primers has a restriction endonuclease recognition site or a ribozyme recognition site or has part of such a site, which part becomes complete when primer extension occurs.
21. A method according to any preceding claim that is automated to allow repeated cycles of nucleic acid amplification.
22. A method according to any preceding claim, when used to amplify a plurality of different nucleic acid sequences
23. A method according to claim 22, when used to amplify a plurality of different nucleic acid sequences simultaneously.
24. A method according to claim 22 or 23, wherein said different nucleic acid sequences are each provided with a first and second nucleic acid sequence as described in any of claims 3 to 5, said first and second nucleic acid sequences being the same for the each of the different nucleic acid sequences.
25. A method according to any of claims 22 to 24, wherein said different nucleic acid sequences are each provided with a different tag so that the different sequences can be distinguished from one another.
26. A plurality of immobilised nucleic acids producable by a method according to any preceding claim.
27. A plurality of immobilised nucleic acids in the form of one or more distinct areas on a surface, each area comprising a plurality of identical nucleic acid strands and a plurality of identical complementary strands thereto; wherein each nucleic acid strand within such an area is located so that another nucleic acid strand is located on the surface within a distance of the length of that strand.
28. A plurality of immobilised nucleic acids according to claim 26 or claim 27, wherein there is at least one distinct area present per mm2 of surface on which the nucleic acids are immobilised.
29. A plurality of immobilised nucleic acids according to claim 27, wherein the number of distinct areas/mm2 of surface on which the nucleic acids are immobilised is greater than 1, greater than 102, greater than 103 or greater than 104.
30. The use of a method according to any of claims 1 to 25 or of a plurality of immobilised nucleic acid molecules according to any of claims 26 to 29 in providing nucleic acid molecules for sequencing.
31. The use according to claim 30, wherein sequencing is performed by extending primers hybridised to single stranded nucleic acid molecules and detecting the nucleotides used in primer extension.
32. The use according to claim 31, wherein said primers hybridise to the same sequences as the primers used in the method of claim 1 to provide the immobilised nucleic acid molecules for sequencing.
33. The use according to claim 31, wherein said primers have the same sequences as the primers used in the method of claim 1 to provide the immobilised nucleic acid molecules for sequencing.
34. The use according to claim 30, wherein nicks are provided in double-stranded nucleic acid molecules, nick translation is performed and the nucleotides used in nick translation are detected.
35. The use according to claim 30, wherein an RNA polymerase is used to synthesise an RNA strand from a DNA molecule and the nucleotides used to produce said RNA strand are detected.
36. The use according to any of claims 31 to 35, wherein all or at least some of said nucleotides are labelled nucleotides .
37. The use according to claim 36, wherein said labelled nucleotides all have the same label.
38. The use according to claim 36 or claim 37, wherein said labelled nucleotides are fluorescence labelled
39. The use according to any of claims 36 to 38, wherein a mixture of labelled and non-labelled nucleotides are used.
40. The use according to claim 39, wherein the labelled nucleotides comprise less than 50 % of the nucleotides used.
41. The use according to claim 40, wherein the labelled nucleotides comprise less than 10 % of the nucleotides used.
42. The use according to any of claims 30 to 41, wherein the sequencing is parallel sequencing of nucleic acid molecules present in at least 2 different distinct areas.
43. The use according to any of claims 30 to 41, wherein the sequencing is parallel sequencing of nucleic acid molecules present in over 10 different distinct areas.
44. The use according to any of claims 30 to 41, wherein the sequencing is parallel sequencing of nucleic acid molecules present in over 100 different distinct areas.
45. The use according to any of claims 30 to 41, wherein the sequencing is parallel sequencing of nucleic acid molecules present in over 1000 different distinct areas.
46. The use according to any of claims 30 to 41, wherein the sequencing is parallel sequencing of nucleic acid molecules present in over 1000000 different distinct areas.
47. The use according to any of claims 30 to 46, wherein a plurality of different sequences are determined in parallel.
48. The use of a method according to any of claims 1 to 25 or of a plurality of immobilised nucleic acid molecules according to any of claims 26 to 29 in providing amplified nucleic acid molecules for diagnosis .
49. The use of a method according to any of claims 1 to 25 or of a plurality of immobilised nucleic acid molecules according to any of claims 26 to 29 in providing amplified nucleic acid molecules for screening.
50. The use of a method according to any of claims 1 to 25 or of a plurality of immobilised nucleic acid molecules according to any of claims 26 to 29 in providing amplified nucleic acid molecules to be used as a support for other components.
51. The use of a method according to any of claims 1 to 25 or of a plurality of immobilised nucleic acid molecules according to any of claims 26 to 29 in generating additional nucleic acid molecules in free (rather than immobilised) form.
52. The use of a method according to claim 51 in in situ RNA synthesis
53. The use of a method according to any of claims 1 to 25 or of a plurality of immobilised nucleic acid molecules according to any of claims 26 to 29 in monitoring gene expression
54. The use of a method according to any of claims 1 to 25 or of a plurality of immobilised nucleic acid molecules according to any of claims 26 to 29 in identifying nucleic acid molecules with gene products that are rarely expressed.
55. The use of a method according to any of claims 1 to 25 or of a plurality of immobilised nucleic acid molecules according to any of claims 26 to 29 in identifying heterozygous individuals
56. The use of a method according to any of claims 1 to 25 or of a plurality of immobilised nucleic acid molecules according to any of claims 26 to 29 in nucleic acid fingerprinting
57. An apparatus for performing a method as described in any of claims 1 to 25; comprising a plurality of immobilised primers, a nucleic acid polymerase, a plurality of nucleotides and means for separating annealed nucleic acid strands.
58. An apparatus according to claim 57, wherein the means for separating annealed nucleic acid strands comprises a controlled heating means.
59. An apparatus for analysing a plurality of nucleic acid molecules according to any of claims 26 to 29, wherein said apparatus comprises a source of reactants and detector means for detecting one or more signals produced after said reactants have been applied to said nucleic acid molecules.
60. An apparatus according to claim 59 wherein said detector means has sufficient resolution to distinguish between the distinct areas referred to in claim 26.
61. An apparatus according to claim 59 or claim 60 comprising a charge coupled device (CCD) .
62. An apparatus according claim 61 wherein said charge coupled device (CCD) is operatively connected with a magnifying device (e.g. a microscope) .
63. A kit for use in screening, diagnosis or in nucleic acid sequencing; comprising a plurality of immobilised nucleic acid according to any of claims 26 to 29.
64. The invention substantially as hereinbefore described.
PCT/GB1998/000961 1997-04-01 1998-04-01 Method of nucleic acid amplification Ceased WO1998044151A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
AU68466/98A AU6846698A (en) 1997-04-01 1998-04-01 Method of nucleic acid amplification
JP54130898A JP2002503954A (en) 1997-04-01 1998-04-01 Nucleic acid amplification method
DE69837913T DE69837913T2 (en) 1997-04-01 1998-04-01 PROCESS FOR THE MAKING OF NUCLEIC ACID
EP98913952A EP0972081B1 (en) 1997-04-01 1998-04-01 Method of nucleic acid amplification
US10/449,010 US7985565B2 (en) 1997-04-01 2003-06-02 Method of nucleic acid amplification
US12/148,133 US8476044B2 (en) 1997-04-01 2008-04-16 Method of nucleic acid amplification
US12/771,324 US8143008B2 (en) 1997-04-01 2010-04-30 Method of nucleic acid amplification
US13/828,047 US8993271B2 (en) 1997-04-01 2013-03-14 Method of nucleic acid amplification
US13/886,234 US9902951B2 (en) 1997-04-01 2013-05-02 Method of nucleic acid amplification
US14/465,685 US20140371100A1 (en) 1997-04-01 2014-08-21 Method of nucleic acid amplification
US14/555,036 US20150087531A1 (en) 1997-04-01 2014-11-26 Method of nucleic acid amplification
US14/601,013 US9593328B2 (en) 1997-04-01 2015-01-20 Method of nucleic acid amplification

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
GB9706529.6 1997-04-01
GB9706528.8 1997-04-01
GBGB9706528.8A GB9706528D0 (en) 1997-04-01 1997-04-01 Invention
GBGB9706529.6A GB9706529D0 (en) 1997-04-01 1997-04-01 Invention
GBGB9713238.5A GB9713238D0 (en) 1997-06-23 1997-06-23 Invention
GB9713238.5 1997-06-23
GBGB9713236.9A GB9713236D0 (en) 1997-06-23 1997-06-23 Invention
GB9713236.9 1997-06-23

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US09402277 A-371-Of-International 1998-04-01
US10/449,010 Continuation US7985565B2 (en) 1997-04-01 2003-06-02 Method of nucleic acid amplification

Publications (1)

Publication Number Publication Date
WO1998044151A1 true WO1998044151A1 (en) 1998-10-08

Family

ID=27451621

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1998/000961 Ceased WO1998044151A1 (en) 1997-04-01 1998-04-01 Method of nucleic acid amplification

Country Status (8)

Country Link
US (8) US7985565B2 (en)
EP (4) EP1591541B1 (en)
JP (1) JP2002503954A (en)
AT (2) ATE364718T1 (en)
AU (1) AU6846698A (en)
DE (1) DE69837913T2 (en)
ES (1) ES2563643T3 (en)
WO (1) WO1998044151A1 (en)

Cited By (452)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0975808A2 (en) * 1997-11-21 2000-02-02 Claas Junghans Topologically fixed matrix bonded nucleic acid molecule
WO2000018957A1 (en) * 1998-09-30 2000-04-06 Applied Research Systems Ars Holding N.V. Methods of nucleic acid amplification and sequencing
WO2000023616A3 (en) * 1998-10-21 2000-08-17 Noxxon Pharma Ag Method for the exponential amplification of molecular matrices
WO2000075374A1 (en) * 1999-06-04 2000-12-14 Mosaic Technologies Solid phase methods for amplifying multiple nucleic acids
US6274320B1 (en) 1999-09-16 2001-08-14 Curagen Corporation Method of sequencing a nucleic acid
WO2001032935A3 (en) * 1999-11-02 2002-05-02 Celine Hu Molecular microarrays and methods for production and use thereof
WO2002046456A1 (en) * 2000-12-08 2002-06-13 Applied Research Systems Ars Holding N.V. Isothermal amplification of nucleic acids on a solid support
WO2001048242A3 (en) * 1999-12-29 2002-07-18 Mergen Ltd Methods for amplifying and detecting multiple polynucleotides on a solid phase support
US6432360B1 (en) 1997-10-10 2002-08-13 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
WO2001062960A3 (en) * 2000-02-25 2002-08-29 Epigenomics Ag Method for detecting cytosine methylation in dna samples
WO2001062982A3 (en) * 2000-02-25 2002-09-19 Mosaic Technologies Inc Methods for multi-stage solid phase amplification of nucleic acids
WO2001062064A3 (en) * 2000-02-25 2002-10-03 Epigenomics Ag Method for detecting cytosine methylation in dna samples
US6485944B1 (en) 1997-10-10 2002-11-26 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
WO2001068921A3 (en) * 2000-03-14 2003-01-23 Investigen Compositions and methods for simultaneous detection of multiple biological entities
WO2002061126A3 (en) * 2001-01-30 2003-02-06 Solexa Ltd The preparation of polynucleotide arrays
WO2002081743A3 (en) * 2001-04-02 2003-04-03 Brendan Hamill Polynucleotide analysis using combinatorial pcr
WO2001092568A3 (en) * 2000-06-02 2003-06-05 Axaron Bioscience Ag Method for producing dna-arrays
WO2002072879A3 (en) * 2001-02-09 2003-10-02 Axaron Bioscience Ag Production and use of random arrangements of clonal nuclear acid islands on a surface
EP1256632A3 (en) * 2001-05-07 2004-01-02 Smithkline Beecham Corporation High throughput polymorphism screening
WO2004067759A3 (en) * 2003-01-29 2004-11-18 Univ Cranfield Replication of nucleic acid arrays
WO2005068656A1 (en) * 2004-01-12 2005-07-28 Solexa Limited Nucleic acid characterisation
WO2005078130A1 (en) * 2004-02-10 2005-08-25 Solexa Limited Arrayed polynucleotides
US7211390B2 (en) 1999-09-16 2007-05-01 454 Life Sciences Corporation Method of sequencing a nucleic acid
WO2007060456A1 (en) 2005-11-25 2007-05-31 Solexa Limited Preparation of nucleic acid templates for solid phase amplification
US7244559B2 (en) 1999-09-16 2007-07-17 454 Life Sciences Corporation Method of sequencing a nucleic acid
WO2007123744A2 (en) 2006-03-31 2007-11-01 Solexa, Inc. Systems and devices for sequence by synthesis analysis
US7323305B2 (en) 2003-01-29 2008-01-29 454 Life Sciences Corporation Methods of amplifying and sequencing nucleic acids
WO2009034181A3 (en) * 2007-09-14 2009-04-30 Twof Inc Methods for the preparation of dna microarrays with linear high density probes
US7575865B2 (en) 2003-01-29 2009-08-18 454 Life Sciences Corporation Methods of amplifying and sequencing nucleic acids
FR2936246A1 (en) * 2008-09-24 2010-03-26 Haploys New compound comprising a duplicable nucleic acid (amplified fragment), where compound comprises a means of locking of polymerization (loop linkage), useful e.g. in complex for diagnosing the amplification of the nucleic acids
EP2189540A1 (en) 2005-07-20 2010-05-26 Illumina Cambridge Limited Methods for sequencing a polynucleotide template
WO2010062775A2 (en) 2008-11-03 2010-06-03 The Regents Of The University Of California Methods for detecting modification resistant nucleic acids
US7741463B2 (en) 2005-11-01 2010-06-22 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US7754429B2 (en) 2006-10-06 2010-07-13 Illumina Cambridge Limited Method for pair-wise sequencing a plurity of target polynucleotides
US7771934B2 (en) 2000-12-13 2010-08-10 Nugen Technologies, Inc. Methods and compositions for generation of multiple copies of nucleic acid sequences and methods of detection thereof
US7771946B2 (en) 2001-03-09 2010-08-10 Nugen Technologies, Inc. Methods, kits and compositions for single primer linear isothermal amplification of nucleic acid sequences
US7785790B1 (en) 1997-10-10 2010-08-31 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
EP2248914A1 (en) 2009-05-05 2010-11-10 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. The use of class IIB restriction endonucleases in 2nd generation sequencing applications
US7846733B2 (en) 2000-06-26 2010-12-07 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
US7846666B2 (en) 2008-03-21 2010-12-07 Nugen Technologies, Inc. Methods of RNA amplification in the presence of DNA
EP2298930A1 (en) 2005-07-20 2011-03-23 Illumina Cambridge Limited Preparation of templates for nucleic acid sequencing
US7939258B2 (en) 2005-09-07 2011-05-10 Nugen Technologies, Inc. Nucleic acid amplification procedure using RNA and DNA composite primers
WO2011034690A3 (en) * 2009-09-15 2011-06-16 Illumina Cambridge, Ltd. Centroid markers for image analysis of high density clusters in complex polynucleotide sequencing
WO2011071923A2 (en) 2009-12-07 2011-06-16 Illumina, Inc. Multi-sample indexing for multiplex genotyping
US7985565B2 (en) 1997-04-01 2011-07-26 Illumina, Inc. Method of nucleic acid amplification
WO2011090559A1 (en) 2010-01-19 2011-07-28 Verinata Health, Inc. Sequencing methods and compositions for prenatal diagnoses
WO2011091046A1 (en) 2010-01-19 2011-07-28 Verinata Health, Inc. Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing
US8017335B2 (en) 2005-07-20 2011-09-13 Illumina Cambridge Limited Method for sequencing a polynucleotide template
US8034568B2 (en) 2008-02-12 2011-10-11 Nugen Technologies, Inc. Isothermal nucleic acid amplification methods and compositions
US8039817B2 (en) 2008-05-05 2011-10-18 Illumina, Inc. Compensator for multiple surface imaging
EP2201021A4 (en) * 2007-08-29 2012-01-25 Applied Biosystems Llc Alternative nucleic acid sequencing methods
WO2012025250A1 (en) 2010-08-27 2012-03-01 Illumina Cambridge Ltd. Methods for paired - end sequencing of polynucleotides
EP2431481A1 (en) * 2003-10-20 2012-03-21 Kalim Mir Parallel polymer sequencing methods
WO2012050920A1 (en) 2010-09-29 2012-04-19 Illumina, Inc. Compositions and methods for sequencing nucleic acids
WO2012055929A1 (en) 2010-10-26 2012-05-03 Illumina, Inc. Sequencing methods
WO2012061036A1 (en) 2010-11-03 2012-05-10 Illumina, Inc. Reducing adapter dimer formation
US8192930B2 (en) 2006-02-08 2012-06-05 Illumina Cambridge Limited Method for sequencing a polynucleotide template
WO2012096703A1 (en) 2011-01-10 2012-07-19 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
US8318430B2 (en) 2010-01-23 2012-11-27 Verinata Health, Inc. Methods of fetal abnormality detection
EP2470669A4 (en) * 2009-08-25 2013-01-30 Illumina Inc METHODS FOR SELECTING AND AMPLIFYING POLYNUCLEOTIDES
WO2013044018A1 (en) 2011-09-23 2013-03-28 Illumina, Inc. Methods and compositions for nucleic acid sequencing
WO2013049135A1 (en) 2011-09-26 2013-04-04 Gen-Probe Incorporated Algorithms for sequence determinations
US8465950B2 (en) 2003-04-14 2013-06-18 Nugen Technologies, Inc. Global amplification using a randomly primed composite primer
WO2013117595A2 (en) 2012-02-07 2013-08-15 Illumina Cambridge Limited Targeted enrichment and amplification of nucleic acids on a support
WO2013123442A1 (en) 2012-02-17 2013-08-22 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
US8532936B2 (en) 2011-04-14 2013-09-10 Verinata Health, Inc. Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies
WO2013131962A1 (en) 2012-03-06 2013-09-12 Illumina Cambridge Limited Improved methods of nucleic acid sequencing
WO2013148970A1 (en) 2012-03-30 2013-10-03 Illumina, Inc. Methods and systems for determining fetal chromosomal abnormalities
US8563477B2 (en) 2004-01-07 2013-10-22 Illumina Cambridge Limited Modified molecular arrays
US8568979B2 (en) 2006-10-10 2013-10-29 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US20130344540A1 (en) * 2011-02-03 2013-12-26 Mark T. Reed Methods for minimizing sequence specific bias
WO2013191775A2 (en) 2012-06-18 2013-12-27 Nugen Technologies, Inc. Compositions and methods for negative selection of non-desired nucleic acid sequences
US8617816B2 (en) 2007-03-16 2013-12-31 454 Life Sciences, A Roche Company System and method for detection of HIV drug resistant variants
WO2014008448A1 (en) 2012-07-03 2014-01-09 Sloan Kettering Institute For Cancer Research Quantitative assessment of human t-cell repertoire recovery after allogeneic hematopoietic stem cell transplantation
US20140024027A1 (en) * 1999-06-23 2014-01-23 Catalyst Assets Llc Methods of enriching for and identifying polymorphisms
WO2014013218A1 (en) 2012-07-18 2014-01-23 Illumina Cambridge Limited Methods and systems for determining haplotypes and phasing of haplotypes
US8728764B2 (en) 2008-10-02 2014-05-20 Illumina Cambridge Limited Nucleic acid sample enrichment for sequencing applications
GB2497912B (en) * 2010-10-08 2014-06-04 Harvard College High-throughput single cell barcoding
WO2014108850A2 (en) 2013-01-09 2014-07-17 Yeda Research And Development Co. Ltd. High throughput transcriptome analysis
US8812422B2 (en) 2012-04-09 2014-08-19 Good Start Genetics, Inc. Variant database
WO2014135221A1 (en) 2013-03-08 2014-09-12 Illumina Cambridge Ltd Polymethine compounds and their use as fluorescent labels
WO2014135223A1 (en) 2013-03-08 2014-09-12 Illumina Cambridge Ltd Rhodamine compounds and their use as fluorescent labels
WO2014150435A1 (en) 2013-03-15 2014-09-25 Illumina, Inc. METHODS FOR PRODUCING STRANDED cDNA LIBRARIES
WO2014108810A3 (en) * 2013-01-09 2014-12-04 Illumina Cambridge Limited Sample preparation on a solid support
US8921073B2 (en) 2006-06-23 2014-12-30 Illumina, Inc. Devices and systems for creation of DNA cluster arrays
WO2015013465A2 (en) 2013-07-25 2015-01-29 Dch Molecular Diagnostics, Inc. Methods and compositions for detecting bacterial contamination
US8951939B2 (en) 2011-07-12 2015-02-10 Bio-Rad Laboratories, Inc. Digital assays with multiplexed detection of two or more targets in the same optical channel
US8986958B2 (en) 2009-03-30 2015-03-24 Life Technologies Corporation Methods for generating target specific probes for solution based capture
US20150099642A1 (en) * 2011-07-21 2015-04-09 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Methods and devices for dna sequencing and molecular diagnostics
US9012022B2 (en) 2012-06-08 2015-04-21 Illumina, Inc. Polymer coatings
WO2015103225A1 (en) 2013-12-31 2015-07-09 Illumina, Inc. Addressable flow cell using patterned electrodes
WO2015108663A1 (en) 2014-01-16 2015-07-23 Illumina, Inc. Amplicon preparation and sequencing on solid supports
US9089844B2 (en) 2010-11-01 2015-07-28 Bio-Rad Laboratories, Inc. System for forming emulsions
US9092401B2 (en) 2012-10-31 2015-07-28 Counsyl, Inc. System and methods for detecting genetic variation
US9115163B2 (en) 2007-10-19 2015-08-25 The Trustees Of Columbia University In The City Of New York DNA sequence with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US9115401B2 (en) 2010-01-19 2015-08-25 Verinata Health, Inc. Partition defined detection methods
US9115387B2 (en) 2013-03-14 2015-08-25 Good Start Genetics, Inc. Methods for analyzing nucleic acids
US9126160B2 (en) 2008-09-23 2015-09-08 Bio-Rad Laboratories, Inc. System for forming an array of emulsions
US9132394B2 (en) 2008-09-23 2015-09-15 Bio-Rad Laboratories, Inc. System for detection of spaced droplets
US9133511B2 (en) 2000-10-06 2015-09-15 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
EP2921556A1 (en) 2014-03-21 2015-09-23 Lexogen GmbH Copy number preserving RNA analysis method
US9150905B2 (en) 2012-05-08 2015-10-06 Adaptive Biotechnologies Corporation Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions
US9175342B2 (en) 2007-10-19 2015-11-03 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US9181590B2 (en) 2011-10-21 2015-11-10 Adaptive Biotechnologies Corporation Quantification of adaptive immune cell genomes in a complex mixture of cells
US9194861B2 (en) 2009-09-02 2015-11-24 Bio-Rad Laboratories, Inc. Method of mixing fluids by coalescence of multiple emulsions
US9206418B2 (en) 2011-10-19 2015-12-08 Nugen Technologies, Inc. Compositions and methods for directional nucleic acid amplification and sequencing
WO2015189637A1 (en) * 2014-06-14 2015-12-17 Illumina Cambridge Limited Methods of increasing sequencing accuracy
US9222128B2 (en) 2011-03-18 2015-12-29 Bio-Rad Laboratories, Inc. Multiplexed digital assays with combinatorial use of signals
US9228233B2 (en) 2011-10-17 2016-01-05 Good Start Genetics, Inc. Analysis methods
US9260745B2 (en) 2010-01-19 2016-02-16 Verinata Health, Inc. Detecting and classifying copy number variation
US9284604B2 (en) 2010-11-22 2016-03-15 The Regents Of The University Of California Methods of identifying a cellular nascent RNA transcript
US9309566B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US9309558B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Nucleic acid amplification
US9322059B2 (en) 2001-04-20 2016-04-26 The Penn State Research Foundation Methods for nucleic acid manipulation
US9323888B2 (en) 2010-01-19 2016-04-26 Verinata Health, Inc. Detecting and classifying copy number variation
US9334531B2 (en) 2010-12-17 2016-05-10 Life Technologies Corporation Nucleic acid amplification
US9347099B2 (en) 2008-11-07 2016-05-24 Adaptive Biotechnologies Corp. Single cell analysis by polymerase cycling assembly
US9347059B2 (en) 2011-04-25 2016-05-24 Bio-Rad Laboratories, Inc. Methods and compositions for nucleic acid analysis
US9365901B2 (en) 2008-11-07 2016-06-14 Adaptive Biotechnologies Corp. Monitoring immunoglobulin heavy chain evolution in B-cell acute lymphoblastic leukemia
US9393560B2 (en) 2010-03-25 2016-07-19 Bio-Rad Laboratories, Inc. Droplet transport system for detection
US9399215B2 (en) 2012-04-13 2016-07-26 Bio-Rad Laboratories, Inc. Sample holder with a well having a wicking promoter
US9411937B2 (en) 2011-04-15 2016-08-09 Verinata Health, Inc. Detecting and classifying copy number variation
US9416420B2 (en) 2008-11-07 2016-08-16 Adaptive Biotechnologies Corp. Monitoring health and disease status using clonotype profiles
US9417190B2 (en) 2008-09-23 2016-08-16 Bio-Rad Laboratories, Inc. Calibrations and controls for droplet-based assays
US9447453B2 (en) 2011-04-12 2016-09-20 Verinata Health, Inc. Resolving genome fractions using polymorphism counts
EP1907583B1 (en) 2005-06-15 2016-10-05 Complete Genomics Inc. Single molecule arrays for genetic and chemical analysis
WO2016156845A1 (en) * 2015-03-31 2016-10-06 Illumina Cambridge Limited Surface concatamerization of templates
US9476080B2 (en) 2010-12-17 2016-10-25 Life Technologies Corporation Clonal amplification of nucleic acid on solid surface with template walking
US9492797B2 (en) 2008-09-23 2016-11-15 Bio-Rad Laboratories, Inc. System for detection of spaced droplets
US9493828B2 (en) 2010-01-19 2016-11-15 Verinata Health, Inc. Methods for determining fraction of fetal nucleic acids in maternal samples
US9500664B2 (en) 2010-03-25 2016-11-22 Bio-Rad Laboratories, Inc. Droplet generation for droplet-based assays
US9499865B2 (en) 2011-12-13 2016-11-22 Adaptive Biotechnologies Corp. Detection and measurement of tissue-infiltrating lymphocytes
US9506119B2 (en) 2008-11-07 2016-11-29 Adaptive Biotechnologies Corp. Method of sequence determination using sequence tags
EP3098324A1 (en) 2015-05-29 2016-11-30 Molecular Cloning Laboratories (MCLAB) LLC Compositions and methods for preparing sequencing libraries
US9512487B2 (en) 2008-11-07 2016-12-06 Adaptive Biotechnologies Corp. Monitoring health and disease status using clonotype profiles
US9512478B2 (en) 2007-02-02 2016-12-06 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple polynucleotide templates
US9528151B2 (en) 2006-12-01 2016-12-27 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US9528160B2 (en) 2008-11-07 2016-12-27 Adaptive Biotechnolgies Corp. Rare clonotypes and uses thereof
US9535920B2 (en) 2013-06-03 2017-01-03 Good Start Genetics, Inc. Methods and systems for storing sequence read data
DE102015011970A1 (en) 2015-09-09 2017-03-09 Scienion Ag Dispenser and dispensing method
US9598725B2 (en) 2010-03-02 2017-03-21 Bio-Rad Laboratories, Inc. Emulsion chemistry for encapsulated droplets
US9650628B2 (en) 2012-01-26 2017-05-16 Nugen Technologies, Inc. Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library regeneration
WO2017096322A1 (en) 2015-12-03 2017-06-08 Accuragen Holdings Limited Methods and compositions for forming ligation products
US9708657B2 (en) 2013-07-01 2017-07-18 Adaptive Biotechnologies Corp. Method for generating clonotype profiles using sequence tags
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9745614B2 (en) 2014-02-28 2017-08-29 Nugen Technologies, Inc. Reduced representation bisulfite sequencing with diversity adaptors
US9764322B2 (en) 2008-09-23 2017-09-19 Bio-Rad Laboratories, Inc. System for generating droplets with pressure monitoring
US9783847B2 (en) 2009-04-30 2017-10-10 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
WO2017182578A1 (en) 2016-04-20 2017-10-26 Qiagen Gmbh Method for generating a stranded rna library
US9809813B2 (en) 2009-06-25 2017-11-07 Fred Hutchinson Cancer Research Center Method of measuring adaptive immunity
US9816088B2 (en) 2013-03-15 2017-11-14 Abvitro Llc Single cell bar-coding for antibody discovery
EP3243937A1 (en) 2012-07-17 2017-11-15 Counsyl, Inc. System and methods for detecting genetic variation
US9822408B2 (en) 2013-03-15 2017-11-21 Nugen Technologies, Inc. Sequential sequencing
US9824179B2 (en) 2011-12-09 2017-11-21 Adaptive Biotechnologies Corp. Diagnosis of lymphoid malignancies and minimal residual disease detection
US9868982B2 (en) 2007-02-07 2018-01-16 Illumina Cambridge Limited Preparation of templates for methylation analysis
WO2018018008A1 (en) 2016-07-22 2018-01-25 Oregon Health & Science University Single cell whole genome libraries and combinatorial indexing methods of making thereof
WO2018060482A1 (en) 2016-09-30 2018-04-05 Illumina Cambridge Limited New fluorescent dyes and their uses as biomarkers
US9951384B2 (en) 2012-01-13 2018-04-24 Data2Bio Genotyping by next-generation sequencing
DE102016120124A1 (en) 2016-10-21 2018-04-26 Gna Biosolutions Gmbh A method of conducting a polymerase chain reaction and apparatus for carrying out the method
WO2018114710A1 (en) 2016-12-22 2018-06-28 Illumina Cambridge Limited Coumarin compounds and their uses as fluorescent labels
US10036063B2 (en) 2009-07-24 2018-07-31 Illumina, Inc. Method for sequencing a polynucleotide template
WO2018148727A1 (en) 2017-02-13 2018-08-16 Qiagen Waltham Inc. Polymerase enzyme from 9°n
WO2018148724A1 (en) 2017-02-13 2018-08-16 Qiagen Waltham Inc. Polymerase enzyme from pyrococcus furiosus
WO2018148726A1 (en) 2017-02-13 2018-08-16 Qiagen Waltham Inc. Polymerase enzyme from phage t4
WO2018148723A1 (en) 2017-02-13 2018-08-16 Qiagen Waltham Inc. Polymerase enzyme from pyrococcus abyssi
US10066259B2 (en) 2015-01-06 2018-09-04 Good Start Genetics, Inc. Screening for structural variants
US10066265B2 (en) 2014-04-01 2018-09-04 Adaptive Biotechnologies Corp. Determining antigen-specific t-cells
US10077478B2 (en) 2012-03-05 2018-09-18 Adaptive Biotechnologies Corp. Determining paired immune receptor chains from frequency matched subunits
US10102337B2 (en) 2014-08-06 2018-10-16 Nugen Technologies, Inc. Digital measurements from targeted sequencing
WO2018200380A1 (en) 2017-04-23 2018-11-01 Illumina, Inc. Compositions and methods for improving sample identification in indexed nucleic acid libraries
WO2018197945A1 (en) 2017-04-23 2018-11-01 Illumina Cambridge Limited Compositions and methods for improving sample identification in indexed nucleic acid libraries
WO2018200386A1 (en) 2017-04-23 2018-11-01 Illumina, Inc. Compositions and methods for improving sample identification in indexed nucleic acid libraries
WO2018197950A1 (en) 2017-04-23 2018-11-01 Illumina Cambridge Limited Compositions and methods for improving sample identification in indexed nucleic acid libraries
WO2018204423A1 (en) 2017-05-01 2018-11-08 Illumina, Inc. Optimal index sequences for multiplex massively parallel sequencing
WO2018208699A1 (en) 2017-05-08 2018-11-15 Illumina, Inc. Universal short adapters for indexing of polynucleotide samples
WO2018213803A1 (en) 2017-05-19 2018-11-22 Neon Therapeutics, Inc. Immunogenic neoantigen identification
US10150996B2 (en) 2012-10-19 2018-12-11 Adaptive Biotechnologies Corp. Quantification of adaptive immune cell genomes in a complex mixture of cells
WO2018226708A1 (en) 2017-06-07 2018-12-13 Oregon Health & Science University Single cell whole genome libraries for methylation sequencing
US10155980B2 (en) 2016-08-15 2018-12-18 Accuragen Holdings Limited Compositions and methods for detecting rare sequence variants
WO2019027767A1 (en) 2017-07-31 2019-02-07 Illumina Inc. Sequencing system with multiplexed biological sample aggregation
WO2019028047A1 (en) 2017-08-01 2019-02-07 Illumina, Inc Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells
EP3447153A1 (en) 2017-08-24 2019-02-27 Marian Grendár Method for determining the qualification of a sample for fetal aneuploidy status determination in non-invasive prenatal testing
US10221461B2 (en) 2012-10-01 2019-03-05 Adaptive Biotechnologies Corp. Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization
US10227647B2 (en) 2015-02-17 2019-03-12 Complete Genomics, Inc. DNA sequencing using controlled strand displacement
US10227635B2 (en) 2012-04-16 2019-03-12 Molecular Loop Biosolutions, Llc Capture reactions
WO2019055715A1 (en) 2017-09-15 2019-03-21 Illumina, Inc. Universal short adapters with variable length non-random unique molecular identifiers
US10239909B2 (en) 2015-05-22 2019-03-26 Illumina Cambridge Limited Polymethine compounds with long stokes shifts and their use as fluorescent labels
US10246701B2 (en) 2014-11-14 2019-04-02 Adaptive Biotechnologies Corp. Multiplexed digital quantitation of rearranged lymphoid receptors in a complex mixture
US10246746B2 (en) 2013-12-20 2019-04-02 Illumina, Inc. Preserving genomic connectivity information in fragmented genomic DNA samples
US10246705B2 (en) 2011-02-10 2019-04-02 Ilumina, Inc. Linking sequence reads using paired code tags
CN109790575A (en) * 2016-07-20 2019-05-21 吉纳普赛斯股份有限公司 Systems and methods for nucleic acid sequencing
US10308982B2 (en) 2010-04-05 2019-06-04 Prognosys Biosciences, Inc. Spatially encoded biological assays
EP3495506A1 (en) 2013-12-11 2019-06-12 AccuraGen Holdings Limited Methods for detecting rare sequence variants
US10323276B2 (en) 2009-01-15 2019-06-18 Adaptive Biotechnologies Corporation Adaptive immunity profiling and methods for generation of monoclonal antibodies
US10385335B2 (en) * 2013-12-05 2019-08-20 Centrillion Technology Holdings Corporation Modified surfaces
US10388403B2 (en) 2010-01-19 2019-08-20 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
US10385475B2 (en) 2011-09-12 2019-08-20 Adaptive Biotechnologies Corp. Random array sequencing of low-complexity libraries
US10391467B2 (en) 2013-12-05 2019-08-27 Centrillion Technology Holdings Corporation Fabrication of patterned arrays
US10392663B2 (en) 2014-10-29 2019-08-27 Adaptive Biotechnologies Corp. Highly-multiplexed simultaneous detection of nucleic acids encoding paired adaptive immune receptor heterodimers from a large number of samples
US10429399B2 (en) 2014-09-24 2019-10-01 Good Start Genetics, Inc. Process control for increased robustness of genetic assays
US10428325B1 (en) 2016-09-21 2019-10-01 Adaptive Biotechnologies Corporation Identification of antigen-specific B cell receptors
WO2019195225A1 (en) 2018-04-02 2019-10-10 Illumina, Inc. Compositions and methods for making controls for sequence-based genetic testing
US10457936B2 (en) 2011-02-02 2019-10-29 University Of Washington Through Its Center For Commercialization Massively parallel contiguity mapping
WO2019222688A1 (en) 2018-05-17 2019-11-21 Illumina, Inc. High-throughput single-cell sequencing with reduced amplification bias
WO2019222264A1 (en) 2018-05-15 2019-11-21 Illumina, Inc. Compositions and methods for chemical cleavage and deprotection of surface-bound oligonucleotides
US10486153B2 (en) 2013-09-27 2019-11-26 Illumina, Inc. Method to produce chemical pattern in micro-fluidic structure
US10512910B2 (en) 2008-09-23 2019-12-24 Bio-Rad Laboratories, Inc. Droplet-based analysis method
US10526648B2 (en) 2017-07-12 2020-01-07 Illumina Cambridge Limited Short pendant arm linkers for nucleotides in sequencing applications
US10557133B2 (en) 2013-03-13 2020-02-11 Illumina, Inc. Methods and compositions for nucleic acid sequencing
WO2020036991A1 (en) 2018-08-15 2020-02-20 Illumina, Inc. Compositions and methods for improving library enrichment
US10570448B2 (en) 2013-11-13 2020-02-25 Tecan Genomics Compositions and methods for identification of a duplicate sequencing read
US10577601B2 (en) 2008-09-12 2020-03-03 University Of Washington Error detection in sequence tag directed subassemblies of short sequencing reads
US10590483B2 (en) 2014-09-15 2020-03-17 Abvitro Llc High-throughput nucleotide library sequencing
US10597715B2 (en) 2013-12-05 2020-03-24 Centrillion Technology Holdings Methods for sequencing nucleic acids
US10604799B2 (en) 2012-04-04 2020-03-31 Molecular Loop Biosolutions, Llc Sequence assembly
EP3663290A1 (en) 2015-09-25 2020-06-10 Illumina Cambridge Limited Polymethine compounds and their use as fluorescent labels
WO2020114918A1 (en) 2018-12-05 2020-06-11 Illumina Cambridge Limited Methods and compositions for cluster generation by bridge amplification
WO2020120179A1 (en) 2018-12-14 2020-06-18 Illumina Cambridge Limited Decreasing phasing with unlabeled nucleotides during sequencing
WO2020126602A1 (en) 2018-12-18 2020-06-25 Illumina Cambridge Limited Methods and compositions for paired end sequencing using a single surface primer
WO2020126595A1 (en) 2018-12-17 2020-06-25 Illumina Cambridge Limited Primer oligonucleotide for sequencing
WO2020126593A1 (en) 2018-12-17 2020-06-25 Illumina Cambridge Limited Compositions for use in polyunucleotide sequencing
WO2020132103A1 (en) 2018-12-19 2020-06-25 Illumina, Inc. Methods for improving polynucleotide cluster clonality priority
WO2020136170A2 (en) 2018-12-26 2020-07-02 Illumina Cambridge Limited Nucleosides and nucleotides with 3'-hydroxy blocking groups
US10752942B2 (en) 2015-10-09 2020-08-25 Accuragen Holdings Limited Methods and compositions for enrichment of amplification products
WO2020169635A1 (en) 2019-02-20 2020-08-27 Grendar Marian Method for determining the uncertainty of the degree of placental mosaicism of a sample in non-invasive prenatal screening
WO2020180778A1 (en) 2019-03-01 2020-09-10 Illumina, Inc. High-throughput single-nuclei and single-cell libraries and methods of making and of using
WO2020178165A1 (en) 2019-03-01 2020-09-10 Illumina Cambridge Limited Tertiary amine substituted coumarin compounds and their uses as fluorescent labels
WO2020178162A1 (en) 2019-03-01 2020-09-10 Illumina Cambridge Limited Exocyclic amine-substituted coumarin compounds and their uses as fluorescent labels
WO2020178231A1 (en) 2019-03-01 2020-09-10 Illumina, Inc. Multiplexed fluorescent detection of analytes
US10774374B2 (en) 2015-04-10 2020-09-15 Spatial Transcriptomics AB and Illumina, Inc. Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US10774372B2 (en) 2013-06-25 2020-09-15 Prognosy s Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
NL2023327B1 (en) 2019-03-01 2020-09-17 Illumina Inc Multiplexed fluorescent detection of analytes
WO2020191389A1 (en) 2019-03-21 2020-09-24 Illumina, Inc. Training data generation for artificial intelligence-based sequencing
NL2023311B1 (en) 2019-03-21 2020-09-28 Illumina Inc Artificial intelligence-based generation of sequencing metadata
NL2023310B1 (en) 2019-03-21 2020-09-28 Illumina Inc Training data generation for artificial intelligence-based sequencing
NL2023316B1 (en) 2019-03-21 2020-09-28 Illumina Inc Artificial intelligence-based sequencing
US10787701B2 (en) 2010-04-05 2020-09-29 Prognosys Biosciences, Inc. Spatially encoded biological assays
WO2020193765A1 (en) 2019-03-28 2020-10-01 Illumina Cambridge Limited Methods and compositions for nucleic acid sequencing using photoswitchable labels
US10844428B2 (en) 2015-04-28 2020-11-24 Illumina, Inc. Error suppression in sequenced DNA fragments using redundant reads with unique molecular indices (UMIS)
US10844429B2 (en) 2017-01-18 2020-11-24 Illumina, Inc. Methods and systems for generation and error-correction of unique molecular index sets with heterogeneous molecular lengths
US10851414B2 (en) 2013-10-18 2020-12-01 Good Start Genetics, Inc. Methods for determining carrier status
US10858696B2 (en) 2014-06-02 2020-12-08 Illumina Cambridge Limited Methods of reducing density-dependent GC bias in amplification
EP3143161B1 (en) * 2014-05-16 2021-04-21 Illumina, Inc. Nucleic acid synthesis techniques
EP3828167A1 (en) 2014-05-07 2021-06-02 Illumina Cambridge Limited Polymethine compounds and their use as fluorescent labels
WO2021104845A1 (en) 2019-11-27 2021-06-03 Illumina Cambridge Limited Cyclooctatetraene containing dyes and compositions
US11028430B2 (en) 2012-07-09 2021-06-08 Nugen Technologies, Inc. Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
US11041202B2 (en) 2015-04-01 2021-06-22 Adaptive Biotechnologies Corporation Method of identifying human compatible T cell receptors specific for an antigenic target
US11041851B2 (en) 2010-12-23 2021-06-22 Molecular Loop Biosciences, Inc. Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction
US11041203B2 (en) 2013-10-18 2021-06-22 Molecular Loop Biosolutions, Inc. Methods for assessing a genomic region of a subject
WO2021127436A2 (en) 2019-12-19 2021-06-24 Illumina, Inc. High-throughput single-cell libraries and methods of making and of using
US11047008B2 (en) 2015-02-24 2021-06-29 Adaptive Biotechnologies Corporation Methods for diagnosing infectious disease and determining HLA status using immune repertoire sequencing
WO2021128441A1 (en) 2019-12-23 2021-07-01 Mgi Tech Co.,Ltd. Controlled strand-displacement for paired-end sequencing
US20210198733A1 (en) 2018-07-03 2021-07-01 Natera, Inc. Methods for detection of donor-derived cell-free dna
US11053548B2 (en) 2014-05-12 2021-07-06 Good Start Genetics, Inc. Methods for detecting aneuploidy
US11060139B2 (en) 2014-03-28 2021-07-13 Centrillion Technology Holdings Corporation Methods for sequencing nucleic acids
US11066705B2 (en) 2014-11-25 2021-07-20 Adaptive Biotechnologies Corporation Characterization of adaptive immune response to vaccination or infection using immune repertoire sequencing
US11098356B2 (en) 2008-01-28 2021-08-24 Complete Genomics, Inc. Methods and compositions for nucleic acid sequencing
US11099202B2 (en) 2017-10-20 2021-08-24 Tecan Genomics, Inc. Reagent delivery system
US11111543B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US11111544B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US11111545B2 (en) 2010-05-18 2021-09-07 Natera, Inc. Methods for simultaneous amplification of target loci
WO2021180724A1 (en) 2020-03-09 2021-09-16 Illumina, Inc. Improvements in nucleic acid sequencing
WO2021180733A1 (en) 2020-03-09 2021-09-16 Illumina, Inc. Methods for sequencing polynucleotides
US11130128B2 (en) 2008-09-23 2021-09-28 Bio-Rad Laboratories, Inc. Detection method for a target nucleic acid
WO2021231477A2 (en) 2020-05-12 2021-11-18 Illumina, Inc. Generating nucleic acids with modified bases using recombinant terminal deoxynucleotidyl transferase
US11186863B2 (en) 2019-04-02 2021-11-30 Progenity, Inc. Methods, systems, and compositions for counting nucleic acid molecules
WO2021252375A1 (en) 2020-06-08 2021-12-16 The Broad Institute, Inc. Single cell combinatorial indexing from amplified nucleic acids
WO2021252617A1 (en) 2020-06-09 2021-12-16 Illumina, Inc. Methods for increasing yield of sequencing libraries
US11203782B2 (en) 2018-03-29 2021-12-21 Accuragen Holdings Limited Compositions and methods comprising asymmetric barcoding
WO2021259881A1 (en) 2020-06-22 2021-12-30 Illumina Cambridge Limited Nucleosides and nucleotides with 3' acetal blocking group
WO2022006081A1 (en) 2020-06-30 2022-01-06 Illumina, Inc. Catalytically controlled sequencing by synthesis to produce scarless dna
WO2022006495A1 (en) 2020-07-02 2022-01-06 Illumina, Inc. A method to calibrate nucleic acid library seeding efficiency in flowcells
US11220707B1 (en) 2021-06-17 2022-01-11 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
WO2022010965A1 (en) 2020-07-08 2022-01-13 Illumina, Inc. Beads as transposome carriers
US11230731B2 (en) 2018-04-02 2022-01-25 Progenity, Inc. Methods, systems, and compositions for counting nucleic acid molecules
WO2022023353A1 (en) 2020-07-28 2022-02-03 Illumina Cambridge Limited Substituted coumarin dyes and uses as fluorescent labels
US11248253B2 (en) 2014-03-05 2022-02-15 Adaptive Biotechnologies Corporation Methods using randomer-containing synthetic molecules
US11254980B1 (en) 2017-11-29 2022-02-22 Adaptive Biotechnologies Corporation Methods of profiling targeted polynucleotides while mitigating sequencing depth requirements
US11286519B2 (en) 2013-12-11 2022-03-29 Accuragen Holdings Limited Methods and compositions for enrichment of amplification products
US11286530B2 (en) 2010-05-18 2022-03-29 Natera, Inc. Methods for simultaneous amplification of target loci
US11286522B2 (en) 2011-12-01 2022-03-29 Genapsys, Inc. Systems and methods for high efficiency electronic sequencing and detection
US11306357B2 (en) 2010-05-18 2022-04-19 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11306359B2 (en) 2005-11-26 2022-04-19 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US11319596B2 (en) 2014-04-21 2022-05-03 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11322224B2 (en) 2010-05-18 2022-05-03 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11326208B2 (en) 2010-05-18 2022-05-10 Natera, Inc. Methods for nested PCR amplification of cell-free DNA
US11332793B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for simultaneous amplification of target loci
US11332774B2 (en) 2010-10-26 2022-05-17 Verinata Health, Inc. Method for determining copy number variations
US11332785B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11339429B2 (en) 2010-05-18 2022-05-24 Natera, Inc. Methods for non-invasive prenatal ploidy calling
EP4006150A1 (en) 2015-09-09 2022-06-01 QIAGEN GmbH Polymerase enzyme
US11352659B2 (en) 2011-04-13 2022-06-07 Spatial Transcriptomics Ab Methods of detecting analytes
WO2022129437A1 (en) 2020-12-17 2022-06-23 Illumina Cambridge Limited Long stokes shift chromenoquinoline dyes and uses in sequencing applications
WO2022129439A1 (en) 2020-12-17 2022-06-23 Illumina Cambridge Limited Methods, systems and compositions for nucleic acid sequencing
WO2022129930A1 (en) 2020-12-17 2022-06-23 Illumina Cambridge Limited Alkylpyridinium coumarin dyes and uses in sequencing applications
WO2022136402A1 (en) 2020-12-22 2022-06-30 Illumina Cambridge Limited Methods and compositions for nucleic acid sequencing
US11390916B2 (en) 2014-04-21 2022-07-19 Natera, Inc. Methods for simultaneous amplification of target loci
US11390619B2 (en) 2017-10-16 2022-07-19 Illumina Cambridge Limited Secondary amine-substituted coumarin compounds and their uses as fluorescent labels
WO2022165188A1 (en) 2021-01-29 2022-08-04 Illumina, Inc. Methods, compositions and kits to improve seeding efficiency of flow cells with polynucleotides
US11408031B2 (en) 2010-05-18 2022-08-09 Natera, Inc. Methods for non-invasive prenatal paternity testing
US11408024B2 (en) 2014-09-10 2022-08-09 Molecular Loop Biosciences, Inc. Methods for selectively suppressing non-target sequences
US11427866B2 (en) 2016-05-16 2022-08-30 Accuragen Holdings Limited Method of improved sequencing by strand identification
WO2022204032A1 (en) 2021-03-22 2022-09-29 Illumina Cambridge Limited Methods for improving nucleic acid cluster clonality
US11479812B2 (en) 2015-05-11 2022-10-25 Natera, Inc. Methods and compositions for determining ploidy
US11485996B2 (en) 2016-10-04 2022-11-01 Natera, Inc. Methods for characterizing copy number variation using proximity-litigation sequencing
WO2022233795A1 (en) 2021-05-05 2022-11-10 Illumina Cambridge Limited Fluorescent dyes containing bis-boron fused heterocycles and uses in sequencing
WO2022243480A1 (en) 2021-05-20 2022-11-24 Illumina, Inc. Compositions and methods for sequencing by synthesis
US11519028B2 (en) 2016-12-07 2022-12-06 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
WO2022271954A1 (en) 2021-06-24 2022-12-29 Illumina, Inc. Methods and compositions for combinatorial indexing of bead-based nucleic acids
WO2022272260A1 (en) 2021-06-23 2022-12-29 Illumina, Inc. Compositions, methods, kits, cartridges, and systems for sequencing reagents
WO2023278608A1 (en) 2021-06-29 2023-01-05 Illumina, Inc. Self-learned base caller, trained using oligo sequences
WO2023003757A1 (en) 2021-07-19 2023-01-26 Illumina Software, Inc. Intensity extraction with interpolation and adaptation for base calling
WO2023009758A1 (en) 2021-07-28 2023-02-02 Illumina, Inc. Quality score calibration of basecalling systems
WO2023014741A1 (en) 2021-08-03 2023-02-09 Illumina Software, Inc. Base calling using multiple base caller models
US11584958B2 (en) 2017-03-31 2023-02-21 Grail, Llc Library preparation and use thereof for sequencing based error correction and/or variant identification
US11618897B2 (en) 2020-12-21 2023-04-04 10X Genomics, Inc. Methods, compositions, and systems for capturing probes and/or barcodes
WO2023052427A1 (en) 2021-09-30 2023-04-06 Illumina Cambridge Limited Polynucleotide sequencing
WO2023114397A1 (en) 2021-12-16 2023-06-22 Illumina, Inc. Hybrid clustering
WO2023114896A1 (en) 2021-12-16 2023-06-22 Illumina Cambridge Limited Methods for metal directed cleavage of surface-bound polynucleotides
WO2023114394A1 (en) 2021-12-17 2023-06-22 Illumina, Inc. Orthogonal hybridization
WO2023122491A1 (en) 2021-12-20 2023-06-29 Illumina Cambridge Limited Periodate compositions and methods for chemical cleavage of surface-bound polynucleotides
WO2023122499A1 (en) 2021-12-20 2023-06-29 Illumina Cambridge Limited Periodate compositions and methods for chemical cleavage of surface-bound polynucleotides
WO2023126457A1 (en) 2021-12-29 2023-07-06 Illumina Cambridge Ltd. Methods of nucleic acid sequencing using surface-bound primers
US11733238B2 (en) 2010-04-05 2023-08-22 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11753673B2 (en) 2021-09-01 2023-09-12 10X Genomics, Inc. Methods, compositions, and kits for blocking a capture probe on a spatial array
US11761038B1 (en) 2020-07-06 2023-09-19 10X Genomics, Inc. Methods for identifying a location of an RNA in a biological sample
WO2023175024A1 (en) * 2022-03-15 2023-09-21 Illumina, Inc. Paired-end sequencing
WO2023175040A2 (en) 2022-03-15 2023-09-21 Illumina, Inc. Concurrent sequencing of forward and reverse complement strands on concatenated polynucleotides for methylation detection
WO2023186819A1 (en) 2022-03-29 2023-10-05 Illumina Cambridge Limited Chromenoquinoline dyes and uses in sequencing
WO2023187061A1 (en) 2022-03-31 2023-10-05 Illumina Cambridge Limited Paired-end re-synthesis using blocked p5 primers
WO2023186982A1 (en) 2022-03-31 2023-10-05 Illumina, Inc. Compositions and methods for improving sequencing signals
WO2023192900A1 (en) 2022-03-31 2023-10-05 Illumina Singapore Pte. Ltd. Nucleosides and nucleotides with 3' vinyl blocking group useful in sequencing by synthesis
WO2023186872A1 (en) 2022-03-30 2023-10-05 Illumina Cambridge Limited Methods for chemical cleavage of surface-bound polynucleotides
WO2023186815A1 (en) 2022-03-28 2023-10-05 Illumina Cambridge Limited Labeled avidin and methods for sequencing
WO2023196572A1 (en) 2022-04-07 2023-10-12 Illumina Singapore Pte. Ltd. Altered cytidine deaminases and methods of use
EP3707723B1 (en) 2017-11-06 2023-10-25 Illumina, Inc. Nucleic acid indexing techniques
EP4269618A2 (en) 2018-06-04 2023-11-01 Illumina, Inc. Methods of making high-throughput single-cell transcriptome libraries
WO2023209606A1 (en) 2022-04-29 2023-11-02 Illumina Cambridge Limited Methods and systems for encapsulating lyophilised microspheres
EP3963104A4 (en) * 2019-05-03 2023-11-08 Ultima Genomics, Inc. FAST-FORWARDING SEQUENCING THROUGH SYNTHESIS METHODS
EP4276769A2 (en) 2019-03-21 2023-11-15 Illumina, Inc. Training data generation for artificial intelligence-based sequencing
US11827935B1 (en) 2020-11-19 2023-11-28 10X Genomics, Inc. Methods for spatial analysis using rolling circle amplification and detection probes
WO2023232829A1 (en) 2022-05-31 2023-12-07 Illumina, Inc Compositions and methods for nucleic acid sequencing
US11840730B1 (en) 2009-04-30 2023-12-12 Molecular Loop Biosciences, Inc. Methods and compositions for evaluating genetic markers
US11859246B2 (en) 2013-12-11 2024-01-02 Accuragen Holdings Limited Methods and compositions for enrichment of amplification products
US11859241B2 (en) 2021-06-17 2024-01-02 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
WO2024003087A1 (en) 2022-06-28 2024-01-04 Illumina, Inc. Fluorescent dyes containing fused tetracyclic bis-boron heterocycle and uses in sequencing
US11866741B2 (en) 2017-02-13 2024-01-09 IsoPlexis Corporation Polymerase enzyme from 9°N
US11873480B2 (en) 2014-10-17 2024-01-16 Illumina Cambridge Limited Contiguity preserving transposition
WO2024039516A1 (en) 2022-08-19 2024-02-22 Illumina, Inc. Third dna base pair site-specific dna detection
US11926822B1 (en) 2020-09-23 2024-03-12 10X Genomics, Inc. Three-dimensional spatial analysis
WO2024059852A1 (en) 2022-09-16 2024-03-21 Illumina, Inc. Cluster segmentation and conditional base calling
US11940413B2 (en) 2007-02-05 2024-03-26 IsoPlexis Corporation Methods and devices for sequencing nucleic acids in smaller batches
US11939634B2 (en) 2010-05-18 2024-03-26 Natera, Inc. Methods for simultaneous amplification of target loci
WO2024061799A1 (en) 2022-09-19 2024-03-28 Illumina, Inc. Deformable polymers comprising immobilised primers
WO2024073713A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Mesophilic compositions for nucleic acid amplification
WO2024073043A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Methods of using cpg binding proteins in mapping modified cytosine nucleotides
WO2024068889A2 (en) 2022-09-30 2024-04-04 Illumina, Inc. Compositions and methods for reducing photo damage during sequencing
WO2024068641A1 (en) 2022-09-26 2024-04-04 Illumina, Inc. Resynthesis kits and methods
WO2024069581A1 (en) 2022-09-30 2024-04-04 Illumina Singapore Pte. Ltd. Helicase-cytidine deaminase complexes and methods of use
WO2024073712A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Thermophilic compositions for nucleic acid amplification
WO2024073047A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Cytidine deaminases and methods of use in mapping modified cytosine nucleotides
WO2024073663A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Amplification compositions and methods
WO2024073714A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Methods of modulating clustering kinetics
US11981960B1 (en) 2020-07-06 2024-05-14 10X Genomics, Inc. Spatial analysis utilizing degradable hydrogels
US11981958B1 (en) 2020-08-20 2024-05-14 10X Genomics, Inc. Methods for spatial analysis using DNA capture
WO2024118903A1 (en) 2022-11-30 2024-06-06 Illumina, Inc. Chemoenzymatic correction of false positive uracil transformations
WO2024123866A1 (en) 2022-12-09 2024-06-13 Illumina, Inc. Nucleosides and nucleotides with 3´ blocking groups and cleavable linkers
WO2024123917A1 (en) 2022-12-07 2024-06-13 Illumina, Inc. Monoclonal clustering using double stranded dna size exclusion with patterned seeding
US12020778B2 (en) 2010-05-18 2024-06-25 Natera, Inc. Methods for non-invasive prenatal ploidy calling
WO2024137886A1 (en) 2022-12-21 2024-06-27 Illumina, Inc. Context-dependent base calling
WO2024137774A1 (en) 2022-12-22 2024-06-27 Illumina, Inc. Palladium catalyst compositions and methods for sequencing by synthesis
WO2024137765A1 (en) 2022-12-22 2024-06-27 Illumina, Inc. Transition-metal catalyst compositions and methods for sequencing by synthesis
US12024738B2 (en) 2018-04-14 2024-07-02 Natera, Inc. Methods for cancer detection and monitoring
WO2024145154A1 (en) 2022-12-27 2024-07-04 Illumina, Inc. Methods of sequencing using 3´ allyl blocked nucleotides
WO2024147904A1 (en) 2023-01-06 2024-07-11 Illumina, Inc. Reducing uracils by polymerase
USRE50065E1 (en) 2012-10-17 2024-07-30 10X Genomics Sweden Ab Methods and product for optimising localised or spatial detection of gene expression in a tissue sample
US12049665B2 (en) 2018-06-12 2024-07-30 Accuragen Holdings Limited Methods and compositions for forming ligation products
US12059674B2 (en) 2020-02-03 2024-08-13 Tecan Genomics, Inc. Reagent storage system
US12060554B2 (en) 2008-03-10 2024-08-13 Illumina, Inc. Method for selecting and amplifying polynucleotides
US12071655B2 (en) 2021-06-03 2024-08-27 10X Genomics, Inc. Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis
US12076701B2 (en) 2020-01-31 2024-09-03 10X Genomics, Inc. Capturing oligonucleotides in spatial transcriptomics
US12083514B2 (en) 2018-07-03 2024-09-10 Illumina, Inc. Interposer with first and second adhesive layers
US12084720B2 (en) 2017-12-14 2024-09-10 Natera, Inc. Assessing graft suitability for transplantation
US12090480B2 (en) 2008-09-23 2024-09-17 Bio-Rad Laboratories, Inc. Partition-based method of analysis
US12097495B2 (en) 2011-02-18 2024-09-24 Bio-Rad Laboratories, Inc. Methods and compositions for detecting genetic material
US12100478B2 (en) 2012-08-17 2024-09-24 Natera, Inc. Method for non-invasive prenatal testing using parental mosaicism data
WO2024206394A1 (en) 2023-03-30 2024-10-03 Illumina, Inc. Compositions and methods for nucleic acid sequencing
WO2024206407A2 (en) 2023-03-29 2024-10-03 Illumina, Inc. Naphthalimide dyes and uses in nucleic acid sequencing
US12117439B2 (en) 2019-12-23 2024-10-15 10X Genomics, Inc. Compositions and methods for using fixed biological samples
US12129514B2 (en) 2009-04-30 2024-10-29 Molecular Loop Biosolutions, Llc Methods and compositions for evaluating genetic markers
US12129516B2 (en) 2020-02-07 2024-10-29 10X Genomics, Inc. Quantitative and automated permeabilization performance evaluation for spatial transcriptomics
US12146195B2 (en) 2016-04-15 2024-11-19 Natera, Inc. Methods for lung cancer detection
US12152275B2 (en) 2010-05-18 2024-11-26 Natera, Inc. Methods for non-invasive prenatal ploidy calling
WO2024249466A1 (en) 2023-05-31 2024-12-05 Illumina, Inc. False positive reduction by translesion polymerase repair
WO2024249200A1 (en) 2023-05-26 2024-12-05 Illumina, Inc. Methods for preserving methylation status during clustering
WO2024249591A1 (en) 2023-05-31 2024-12-05 Illumina, Inc. Methods for double-stranded sequencing by synthesis
US12162008B2 (en) 2008-09-23 2024-12-10 Bio-Rad Laboratories, Inc. Partition-based method of analysis
US12168231B2 (en) 2008-09-23 2024-12-17 Bio-Rad Laboratories, Inc. Method of analysis
WO2024256581A1 (en) 2023-06-14 2024-12-19 Illumina, Inc. Determination of modified cytosines
WO2024256580A1 (en) 2023-06-14 2024-12-19 Illumina, Inc. Concurrent sequencing with spatially separated rings
US12195790B2 (en) 2021-12-01 2025-01-14 10X Genomics, Inc. Methods for improved in situ detection of nucleic acids and spatial analysis
US12203134B2 (en) 2021-04-14 2025-01-21 10X Genomics, Inc. Methods of measuring mislocalization of an analyte
US12209282B2 (en) 2008-11-07 2025-01-28 Adaptive Biotechnologies Corporation Monitoring health and disease status using clonotype profiles
US12209280B1 (en) 2020-07-06 2025-01-28 10X Genomics, Inc. Methods of identifying abundance and location of an analyte in a biological sample using second strand synthesis
US12221653B2 (en) 2010-05-18 2025-02-11 Natera, Inc. Methods for simultaneous amplification of target loci
US12227798B2 (en) 2008-03-19 2025-02-18 IsoPlexis Corporation Methods and compositions for incorporating nucleotides
WO2025049700A1 (en) 2023-08-31 2025-03-06 Illumina, Inc. Compositions and methods for nucleic acid sequencing
US12260934B2 (en) 2014-06-05 2025-03-25 Natera, Inc. Systems and methods for detection of aneuploidy
WO2025062002A1 (en) 2023-09-20 2025-03-27 Illumina, Inc. Concurrent sequencing using nick translation
WO2025062001A1 (en) 2023-09-20 2025-03-27 Illumina, Inc. Optimised nucleic acid sequencing
WO2025072793A1 (en) 2023-09-28 2025-04-03 Illumina, Inc. Altered cytidine deaminases and methods of use
WO2025072683A1 (en) 2023-09-29 2025-04-03 Illumina, Inc. Solid supports and methods for strand invasion-based amplification
US12275988B2 (en) 2021-11-10 2025-04-15 10X Genomics, Inc. Methods, compositions, and kits for determining the location of an analyte in a biological sample
WO2025081064A2 (en) 2023-10-11 2025-04-17 Illumina, Inc. Thermophilic deaminase and methods for identifying modified cytosine
WO2025090596A1 (en) 2023-10-26 2025-05-01 Illumina, Inc. 4,5-substituted naphthalimide dyes and uses in nucleic acid sequencing
US12305235B2 (en) 2019-06-06 2025-05-20 Natera, Inc. Methods for detecting immune cell DNA and monitoring immune system
WO2025106715A1 (en) 2023-11-17 2025-05-22 Illumina, Inc. Conjugated polymers or polymer dots as fluorescent labels
WO2025117738A1 (en) 2023-11-28 2025-06-05 Illumina, Inc. Methods of improving unique molecular index ligation efficiency
WO2025137479A1 (en) 2023-12-22 2025-06-26 Illumina, Inc. Reusable flow cells and methods of using them for nucleic acid sequencing
WO2025136890A1 (en) 2023-12-18 2025-06-26 Illumina, Inc. Hydrogel nanoparticles as labeling scaffold in sequencing
WO2025137222A1 (en) 2023-12-19 2025-06-26 Illumina, Inc. Methylation detection assay
US12344892B2 (en) 2018-08-28 2025-07-01 10X Genomics, Inc. Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample
WO2025144626A1 (en) 2023-12-28 2025-07-03 Illumina, Inc. Sequencing with single-stranded binding proteins
WO2025144711A1 (en) 2023-12-29 2025-07-03 Illumina, Inc. Tricyclic polymethine dyes for nucleic acid sequencing
WO2025144716A1 (en) 2023-12-28 2025-07-03 Illumina, Inc. Nucleotides with enzymatically cleavable 3'-o-glycoside blocking groups for sequencing
US12365935B2 (en) 2021-05-06 2025-07-22 10X Genomics, Inc. Methods for increasing resolution of spatial analysis
WO2025153496A1 (en) 2024-01-15 2025-07-24 Benson Erik Mesh chip
US12371690B2 (en) 2014-06-30 2025-07-29 Illumina, Inc. Methods and compositions using one-sided transposition
US12386895B2 (en) 2014-08-15 2025-08-12 Laboratory Corporation Of America Holdings Systems and methods for genetic analysis
WO2025184226A1 (en) 2024-02-28 2025-09-04 Illumina, Inc. Nucleotides with terminal phosphate capping
WO2025188906A1 (en) 2024-03-08 2025-09-12 Illumina, Inc. Modified adenosine nucleotides
WO2025207535A1 (en) 2024-03-26 2025-10-02 Illumina, Inc. Photo-switchable surfaces
WO2025221895A1 (en) 2024-04-19 2025-10-23 Illumina, Inc. Water soluble polymer scaffolds for dye labeling
US12460264B2 (en) 2016-11-02 2025-11-04 Natera, Inc. Method of detecting tumour recurrence
WO2025230914A1 (en) 2024-04-29 2025-11-06 Illumina, Inc. Nucleotides with enzyme-triggered self-immolative linkers for sequencing by synthesis
US12492430B2 (en) 2017-04-11 2025-12-09 Tecan Genomics, Inc. Library quantitation and qualification
WO2025264831A1 (en) 2024-06-18 2025-12-26 Illumina, Inc. Methods for increasing sequencing quality of gc-rich regions
WO2025264836A1 (en) 2024-06-18 2025-12-26 Illumina, Inc. Methods for increasing sequencing quality of gc-rich regions
WO2026006314A1 (en) 2024-06-28 2026-01-02 Illumina, Inc. Tagging target regions prior to nucleotide sequencing
WO2026006746A2 (en) 2024-06-28 2026-01-02 Illumina, Inc. Nucleic acid preparation and analysis techniques
WO2026006774A1 (en) 2024-06-28 2026-01-02 Illumina, Inc. Altered cytidine deaminases and methods of use
US12540350B2 (en) 2022-08-15 2026-02-03 Element Biosciences, Inc. Spatially resolved surface capture of nucleic acids
WO2026035914A1 (en) 2024-08-09 2026-02-12 Illumina, Inc. Nucleotides having 3'-hydroxy blocking groups
WO2026033007A1 (en) * 2024-08-07 2026-02-12 F. Hoffmann-La Roche Ag Automated solid-state amplification of library constructs for duplex sequencing
US12553083B2 (en) 2010-05-18 2026-02-17 Natera, Inc. Methods for enriching and sequencing nucleic acids for non-invasive cancer testing
US12566113B2 (en) 2019-12-23 2026-03-03 10X Genomics, Inc. Reversible fixing reagents and methods of use thereof
US12569847B2 (en) 2021-01-08 2026-03-10 Cellanome, Inc. Methods for detecting intercellular interactions of cells in a compartment of a fluidic device
US12571029B1 (en) 2022-11-09 2026-03-10 10X Genomics, Inc. Methods, compositions, and kits for determining the location of multiple analytes in a biological sample
US12576400B2 (en) 2021-01-08 2026-03-17 Cellanome, Inc. Methods for incubating and analyzing a cell in a compartment of a fluidic device
US12600963B2 (en) 2020-01-20 2026-04-14 Tecan Genomics, Inc. Depletion of abundant uninformative sequences
WO2026097017A2 (en) 2024-11-01 2026-05-07 Illumina, Inc. Methods of improving sequencing accuracy
US12624475B1 (en) 2022-08-22 2026-05-12 10X Genomics, Inc. Capturing genetic targets using a hybridization approach

Families Citing this family (374)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1587940A4 (en) * 2002-12-20 2006-06-07 Caliper Life Sciences Inc Single molecule amplification and detection of dna
EP1682680B2 (en) * 2003-10-31 2018-03-21 AB Advanced Genetic Analysis Corporation Methods for producing a paired tag from a nucleic acid sequence and methods of use thereof
JP4541731B2 (en) * 2004-03-12 2010-09-08 キヤノン株式会社 Nucleic acid detection method
US20060228721A1 (en) 2005-04-12 2006-10-12 Leamon John H Methods for determining sequence variants using ultra-deep sequencing
EP1877576B1 (en) * 2005-04-12 2013-01-23 454 Life Sciences Corporation Methods for determining sequence variants using ultra-deep sequencing
GB0514909D0 (en) * 2005-07-20 2005-08-24 Solexa Ltd Methods of nucleic acid amplification and sequencing
US7932029B1 (en) * 2006-01-04 2011-04-26 Si Lok Methods for nucleic acid mapping and identification of fine-structural-variations in nucleic acids and utilities
EP2021503A1 (en) * 2006-03-17 2009-02-11 Solexa Ltd. Isothermal methods for creating clonal single molecule arrays
EP2001907A2 (en) * 2006-03-21 2008-12-17 Wyeth a Corporation of the State of Delaware Methods and compositions for antagonism of rage
US20070231823A1 (en) * 2006-03-23 2007-10-04 Mckernan Kevin J Directed enrichment of genomic DNA for high-throughput sequencing
EP2049682A2 (en) * 2006-07-31 2009-04-22 Illumina Cambridge Limited Method of library preparation avoiding the formation of adaptor dimers
JP5020734B2 (en) * 2007-07-31 2012-09-05 株式会社日立ハイテクノロジーズ Nucleic acid analysis method and apparatus
US20090093378A1 (en) * 2007-08-29 2009-04-09 Helen Bignell Method for sequencing a polynucleotide template
EP2235217B1 (en) 2008-01-09 2016-04-20 Life Technologies Corporation Method of making a paired tag library for nucleic acid sequencing
WO2012044847A1 (en) 2010-10-01 2012-04-05 Life Technologies Corporation Nucleic acid adaptors and uses thereof
US8202691B2 (en) * 2008-01-25 2012-06-19 Illumina, Inc. Uniform fragmentation of DNA using binding proteins
US20090226975A1 (en) * 2008-03-10 2009-09-10 Illumina, Inc. Constant cluster seeding
EP2294214A2 (en) * 2008-05-07 2011-03-16 Illumina, Inc. Compositions and methods for providing substances to and from an array
US8583380B2 (en) 2008-09-05 2013-11-12 Aueon, Inc. Methods for stratifying and annotating cancer drug treatment options
US20100087325A1 (en) * 2008-10-07 2010-04-08 Illumina, Inc. Biological sample temperature control system and method
US9394567B2 (en) 2008-11-07 2016-07-19 Adaptive Biotechnologies Corporation Detection and quantification of sample contamination in immune repertoire analysis
GB0821981D0 (en) * 2008-12-02 2009-01-07 Genome Res Ltd Method for use in polynucleotide sequencing
US8993230B2 (en) * 2008-12-04 2015-03-31 Pacific Biosciences of Californ, Inc. Asynchronous sequencing of biological polymers
EP2607496B1 (en) 2008-12-23 2014-07-16 Illumina, Inc. Methods useful in nucleic acid sequencing protocols
US20100279882A1 (en) * 2009-05-01 2010-11-04 Mostafa Ronaghi Sequencing methods
JP2013509863A (en) * 2009-11-03 2013-03-21 エイチティージー モレキュラー ダイアグノスティクス, インコーポレイテッド Quantitative nuclease protection sequencing (qNPS)
EP2539464B1 (en) 2010-02-23 2016-11-16 Illumina, Inc. Amplification methods to minimise sequence specific bias
US8951940B2 (en) 2010-04-01 2015-02-10 Illumina, Inc. Solid-phase clonal amplification and related methods
WO2011139372A1 (en) * 2010-05-06 2011-11-10 Sequenta, Inc. Sequence analysis of complex amplicons
US8483969B2 (en) 2010-09-17 2013-07-09 Illuminia, Inc. Variation analysis for multiple templates on a solid support
RU2565550C2 (en) 2010-09-24 2015-10-20 Те Борд Оф Трастиз Оф Те Лилэнд Стэнфорд Джуниор Юниверсити Direct capture, amplification and sequencing of target dna using immobilised primers
US9184099B2 (en) 2010-10-04 2015-11-10 The Board Of Trustees Of The Leland Stanford Junior University Biosensor devices, systems and methods therefor
US9399217B2 (en) 2010-10-04 2016-07-26 Genapsys, Inc. Chamber free nanoreactor system
NZ610129A (en) 2010-10-04 2014-08-29 Genapsys Inc Systems and methods for automated reusable parallel biological reactions
EP2632593B1 (en) 2010-10-27 2021-09-29 Illumina, Inc. Flow cells for biological or chemical analysis
EP2635679B1 (en) 2010-11-05 2017-04-19 Illumina, Inc. Linking sequence reads using paired code tags
AU2012242847B2 (en) 2011-04-15 2017-01-19 The Johns Hopkins University Safe sequencing system
AU2012251027B2 (en) 2011-05-04 2015-03-26 Htg Molecular Diagnostics, Inc. Quantitative nuclease protection Assay (qNPA) and sequencing (qNPS) improvements
US9926596B2 (en) 2011-05-27 2018-03-27 Genapsys, Inc. Systems and methods for genetic and biological analysis
US8585973B2 (en) 2011-05-27 2013-11-19 The Board Of Trustees Of The Leland Stanford Junior University Nano-sensor array
KR102003660B1 (en) 2011-07-13 2019-07-24 더 멀티플 마이얼로머 리서치 파운데이션, 인크. Methods for data collection and distribution
GB2495909A (en) * 2011-10-19 2013-05-01 Genome Analysis Ct Arrays comprising immobilized primer pair spots for amplifying target nucleic acids
CA2854023A1 (en) 2011-11-07 2013-05-16 Illumina, Inc. Integrated sequencing apparatuses and methods of use
DK2788499T3 (en) 2011-12-09 2016-03-21 Illumina Inc Enhanced root for polymer tags
US9823246B2 (en) 2011-12-28 2017-11-21 The Board Of Trustees Of The Leland Stanford Junior University Fluorescence enhancing plasmonic nanoscopic gold films and assays based thereon
ES2828661T3 (en) 2012-03-20 2021-05-27 Univ Washington Through Its Center For Commercialization Methods to Reduce the Error Rate of Parallel Massive DNA Sequencing Using Double-stranded Consensus Sequence Sequencing
US9444880B2 (en) 2012-04-11 2016-09-13 Illumina, Inc. Cloud computing environment for biological data
NL2017959B1 (en) 2016-12-08 2018-06-19 Illumina Inc Cartridge assembly
US9365896B2 (en) 2012-10-19 2016-06-14 Agilent Technologies, Inc. Addition of an adaptor by invasive cleavage
ES2701742T3 (en) 2012-10-29 2019-02-25 Univ Johns Hopkins Papanicolaou test for ovarian and endometrial cancers
US9116139B2 (en) 2012-11-05 2015-08-25 Illumina, Inc. Sequence scheduling and sample distribution techniques
EP2746405B1 (en) 2012-12-23 2015-11-04 HS Diagnomics GmbH Methods and primer sets for high throughput PCR sequencing
US9805407B2 (en) 2013-01-25 2017-10-31 Illumina, Inc. Methods and systems for using a cloud computing environment to configure and sell a biological sample preparation cartridge and share related data
US9809852B2 (en) 2013-03-15 2017-11-07 Genapsys, Inc. Systems and methods for biological analysis
EP2986762B1 (en) 2013-04-19 2019-11-06 Bio-Rad Laboratories, Inc. Digital analyte analysis
US10415083B2 (en) 2013-10-28 2019-09-17 The Translational Genomics Research Institute Long insert-based whole genome sequencing
US10540783B2 (en) * 2013-11-01 2020-01-21 Illumina, Inc. Image analysis useful for patterned objects
PL3077943T3 (en) 2013-12-03 2020-11-30 Illumina, Inc. Methods and systems for analyzing image data
CN110411998B (en) 2013-12-10 2022-06-07 伊鲁米那股份有限公司 Biosensors for biological or chemical analysis and methods for their manufacture
EP3792921A1 (en) 2013-12-11 2021-03-17 Genapsys, Inc. Systems and methods for biological analysis and computation
US9944924B2 (en) 2014-01-16 2018-04-17 Illumina, Inc. Polynucleotide modification on solid support
US9677132B2 (en) 2014-01-16 2017-06-13 Illumina, Inc. Polynucleotide modification on solid support
BR112016018547B1 (en) 2014-02-13 2023-12-12 Illumina, Inc METHOD FOR PROCESSING GENOMIC INFORMATION
JP7011392B2 (en) 2014-02-18 2022-01-26 イラミーナ インコーポレーテッド Methods and compositions for DNA profiling
JP6822841B2 (en) 2014-03-09 2021-01-27 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Compositions useful in the treatment of ornithine transcarbamylase (OTC) deficiency
CN110982689A (en) 2014-03-11 2020-04-10 伊鲁米那股份有限公司 Disposable integrated microfluidic cartridge and methods of making and using same
US11390921B2 (en) 2014-04-01 2022-07-19 Adaptive Biotechnologies Corporation Determining WT-1 specific T cells and WT-1 specific T cell receptors (TCRs)
WO2015161054A2 (en) 2014-04-18 2015-10-22 Genapsys, Inc. Methods and systems for nucleic acid amplification
JP6593710B2 (en) * 2014-05-02 2019-10-23 Idacセラノスティクス株式会社 Method for analyzing nucleic acid derived from a single cell
US20150337295A1 (en) * 2014-05-08 2015-11-26 Fluidigm Corporation Integrated single cell sequencing
CA2949984C (en) 2014-05-27 2021-10-19 Illumina, Inc. Systems and methods for biochemical analysis including a base instrument and a removable cartridge
US20150353989A1 (en) 2014-06-09 2015-12-10 Illumina Cambridge Limited Sample preparation for nucleic acid amplification
GB201410420D0 (en) 2014-06-11 2014-07-23 Illumina Cambridge Ltd Methods for estimating cluster numbers
US10017759B2 (en) 2014-06-26 2018-07-10 Illumina, Inc. Library preparation of tagged nucleic acid
CA2956723C (en) 2014-08-12 2023-04-11 Nextgen Jane, Inc. System and method for monitoring health based on collected bodily fluid
US10174383B2 (en) 2014-08-13 2019-01-08 Vanadis Diagnostics Method of estimating the amount of a methylated locus in a sample
WO2016040602A1 (en) 2014-09-11 2016-03-17 Epicentre Technologies Corporation Reduced representation bisulfite sequencing using uracil n-glycosylase (ung) and endonuclease iv
US9574991B2 (en) 2014-10-14 2017-02-21 Omnivision Technologies, Inc. High-throughput fluorescence imaging system and device with sample heating capability, and associated methods
US9897791B2 (en) 2014-10-16 2018-02-20 Illumina, Inc. Optical scanning systems for in situ genetic analysis
WO2016073778A2 (en) 2014-11-05 2016-05-12 Nirmidas Biotech, Inc. Metal composites for enhanced imaging
GB201419731D0 (en) 2014-11-05 2014-12-17 Illumina Cambridge Ltd Sequencing from multiple primers to increase data rate and density
ES2768762T3 (en) 2014-11-05 2020-06-23 Illumina Cambridge Ltd Reduction of DNA damage during sample preparation and sequencing using siderophore chelating agents
WO2016075204A1 (en) 2014-11-11 2016-05-19 Illumina, Inc. Methods and arrays for producing and sequencing monoclonal clusters of nucleic acid
CN107109495B (en) 2014-11-11 2021-12-24 伊鲁米那股份有限公司 Polynucleotide amplification using CRISPR-CAS system
US11789906B2 (en) 2014-11-19 2023-10-17 Arc Bio, Llc Systems and methods for genomic manipulations and analysis
US20180127804A1 (en) 2014-12-05 2018-05-10 Amyris, Inc. High-throughput sequencing of polynucleotides
BR112017017025B1 (en) 2015-02-10 2024-01-02 Illumina, Inc METHODS AND COMPOSITIONS FOR ANALYZING CELLULAR COMPONENTS
US10576471B2 (en) 2015-03-20 2020-03-03 Illumina, Inc. Fluidics cartridge for use in the vertical or substantially vertical position
JP6609641B2 (en) 2015-05-29 2019-11-20 イルミナ ケンブリッジ リミテッド Advanced use of surface primers in clusters
WO2016196358A1 (en) 2015-05-29 2016-12-08 Epicentre Technologies Corporation Methods of analyzing nucleic acids
JP6698708B2 (en) 2015-06-09 2020-05-27 ライフ テクノロジーズ コーポレーション Methods, systems, compositions, kits, devices, and computer-readable media for molecular tagging
US10941423B2 (en) * 2015-06-26 2021-03-09 Global Bioenergies Method for the production of isoamyl alcohol
CN107922966B (en) 2015-07-06 2022-06-28 伊卢米纳剑桥有限公司 Sample preparation for nucleic acid amplification
WO2017019456A2 (en) 2015-07-27 2017-02-02 Illumina, Inc. Spatial mapping of nucleic acid sequence information
AU2016301354B2 (en) 2015-08-06 2022-06-30 Arc Bio, Llc Systems and methods for genomic analysis
WO2017027653A1 (en) 2015-08-11 2017-02-16 The Johns Hopkins University Assaying ovarian cyst fluid
ES2868195T3 (en) 2015-08-14 2021-10-21 Illumina Inc Systems and methods that use magnetically sensitive sensors to determine a genetic trait
CN108474805A (en) 2015-08-24 2018-08-31 亿明达股份有限公司 In-line accumulators and flow control systems for biological and chemical assays
US10450598B2 (en) 2015-09-11 2019-10-22 Illumina, Inc. Systems and methods for obtaining a droplet having a designated concentration of a substance-of-interest
KR102165931B1 (en) * 2015-09-24 2020-10-14 주식회사 씨젠 Multiple data set assays to determine the presence or absence of a target analyte
WO2017062343A1 (en) 2015-10-06 2017-04-13 Pierce Biotechnology, Inc. Devices and methods for producing nucleic acids and proteins
US10577643B2 (en) 2015-10-07 2020-03-03 Illumina, Inc. Off-target capture reduction in sequencing techniques
US10253352B2 (en) 2015-11-17 2019-04-09 Omniome, Inc. Methods for determining sequence profiles
US9988624B2 (en) 2015-12-07 2018-06-05 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
US11208649B2 (en) 2015-12-07 2021-12-28 Zymergen Inc. HTP genomic engineering platform
CA3007840C (en) 2015-12-07 2020-09-15 Zymergen Inc. Microbial strain improvement by a htp genomic engineering platform
CA3007635A1 (en) 2015-12-07 2017-06-15 Zymergen Inc. Promoters from corynebacterium glutamicum
PL3387152T3 (en) * 2015-12-08 2022-05-09 Twinstrand Biosciences, Inc. IMPROVED ADAPTERS, METHODS AND COMPOSITIONS FOR DUPLEX SEQUENCING
EP3433373B1 (en) 2016-03-22 2022-01-12 Myriad Women's Health, Inc. Combinatorial dna screening
EP3442706B1 (en) 2016-04-13 2025-07-23 NextGen Jane, Inc. Sample collection and preservation methods
EP3455372B1 (en) 2016-05-11 2019-10-30 Illumina, Inc. Polynucleotide enrichment and amplification using argonaute systems
US11708574B2 (en) 2016-06-10 2023-07-25 Myriad Women's Health, Inc. Nucleic acid sequencing adapters and uses thereof
WO2018005793A1 (en) 2016-06-30 2018-01-04 Zymergen Inc. Methods for generating a glucose permease library and uses thereof
JP2019519242A (en) 2016-06-30 2019-07-11 ザイマージェン インコーポレイテッド Method for generating a bacterial hemoglobin library and its use
AU2017315252B2 (en) 2016-08-22 2023-03-16 Biolumic Limited System, device and methods of seed treatment
KR102711907B1 (en) 2016-09-22 2024-09-27 일루미나, 인코포레이티드 Somatic copy number variation detection
EP4439045A3 (en) 2016-10-14 2024-11-27 Illumina, Inc. Cartridge assembly
US10650312B2 (en) 2016-11-16 2020-05-12 Catalog Technologies, Inc. Nucleic acid-based data storage
ES2979182T3 (en) 2016-11-16 2024-09-24 Catalog Tech Inc Nucleic acid-based data storage
MX2019008055A (en) 2017-01-06 2019-11-05 Illumina Inc Phasing correction.
CN110178184B (en) 2017-01-17 2024-04-19 Illumina公司 Oncogenic splice variant determination
EP3565900B1 (en) 2017-01-20 2021-04-07 Omniome, Inc. Genotyping by polymerase binding
CA3050241C (en) 2017-01-20 2022-11-29 Omniome, Inc. Allele-specific capture of nucleic acids
WO2018144217A1 (en) 2017-01-31 2018-08-09 Counsyl, Inc. Methods and compositions for enrichment of target polynucleotides
US10968447B2 (en) 2017-01-31 2021-04-06 Myriad Women's Health, Inc. Methods and compositions for enrichment of target polynucleotides
MX2019010275A (en) 2017-02-28 2019-10-15 Univ Pennsylvania Adeno-associated virus (aav) clade f vector and uses therefor.
JOP20190200A1 (en) 2017-02-28 2019-08-27 Univ Pennsylvania Compositions useful in treatment of spinal muscular atrophy
EP4053294A1 (en) 2017-03-24 2022-09-07 Life Technologies Corporation Polynucleotide adapters and methods of use thereof
BR112019023303A2 (en) 2017-05-11 2020-06-16 The Trustees Of The University Of Pennsylvania GENE THERAPY FOR NEURONAL CEROID LIPOFUSCINOSES
KR20200010285A (en) 2017-05-19 2020-01-30 지머젠 인코포레이티드 Genomic Engineering of Biosynthetic Pathways Inducing Increased NADPH
EP3635111A1 (en) 2017-06-06 2020-04-15 Zymergen, Inc. High throughput transposon mutagenesis
KR20200026874A (en) 2017-06-06 2020-03-11 지머젠 인코포레이티드 HTP Genome Engineering Platform for E. Coli Improvement
JP7350659B2 (en) 2017-06-06 2023-09-26 ザイマージェン インコーポレイテッド High-throughput (HTP) genome manipulation platform for the improvement of Saccharopolyspora spinosa
KR20200026878A (en) 2017-06-06 2020-03-11 지머젠 인코포레이티드 HTP Genome Engineering Platform to Improve Fungal Strains
US11702654B2 (en) 2017-06-20 2023-07-18 Illumina, Inc. Methods and compositions for addressing inefficiencies in amplification reactions
JP2020525002A (en) 2017-06-29 2020-08-27 バイオルミック リミテッド Methods for improving crop yield and/or quality
KR102480894B1 (en) 2017-08-01 2022-12-23 일루미나, 인코포레이티드 Hydrogel beads for nucleotide sequencing
JP6998404B2 (en) 2017-08-01 2022-02-04 深▲セン▼恒特基因有限公司 Method for enriching and determining the target nucleotide sequence
CN120400338A (en) 2017-08-07 2025-08-01 约翰斯霍普金斯大学 Methods and materials for assessing and treating cancer
WO2019038594A2 (en) 2017-08-21 2019-02-28 Biolumic Limited High growth and high hardiness transgenic plants
CA3076378A1 (en) 2017-09-21 2019-03-28 Genapsys, Inc. Systems and methods for nucleic acid sequencing
ES2977793T3 (en) 2017-11-08 2024-08-30 Twinstrand Biosciences Inc Reagents and adapters for nucleic acid sequencing and methods for making such reagents and adapters
MX389484B (en) 2017-11-13 2025-03-20 The Multiple Myeloma Res Foundation Inc Integrated, molecular, omics, immunotherapy, metabolic, epigenetic, and clinical database
AU2018367488B2 (en) 2017-11-16 2021-09-16 Illumina, Inc. Systems and methods for determining microsatellite instability
IL271235B2 (en) 2017-11-30 2024-12-01 Illumina Inc Validation methods and systems for sequence variant calls
CA3279137A1 (en) 2018-01-08 2025-10-30 Illumina, Inc. Systems and devices for high-throughput sequencing with semiconductor-based detection
WO2019136376A1 (en) 2018-01-08 2019-07-11 Illumina, Inc. High-throughput sequencing with semiconductor-based detection
EP4253562A3 (en) 2018-02-13 2023-10-25 Illumina, Inc. Dna sequencing using hydrogel beads
KR20200132921A (en) 2018-03-16 2020-11-25 카탈로그 테크놀로지스, 인크. Chemical methods for storing nucleic acid-based data
CA3091228A1 (en) 2018-03-20 2019-09-26 Zymergen Inc. A htp platform for the genetic engineering of chinese hamster ovary cells
EP3553182A1 (en) 2018-04-11 2019-10-16 Université de Bourgogne Detection method of somatic genetic anomalies, combination of capture probes and kit of detection
AU2019257320B2 (en) 2018-04-20 2022-04-07 Illumina, Inc. Methods of encapsulating single cells, the encapsulated cells and uses thereof
KR102956991B1 (en) 2018-05-16 2026-04-24 카탈로그 테크놀로지스, 인크. Composition and method for storing nucleic acid-based data
WO2020014693A1 (en) 2018-07-12 2020-01-16 Twinstrand Biosciences, Inc. Methods and reagents for characterizing genomic editing, clonal expansion, and associated applications
KR20210053292A (en) 2018-08-03 2021-05-11 카탈로그 테크놀로지스, 인크. Nucleic acid-based data storage and reading system and method with error protection
EP3844300A1 (en) 2018-08-28 2021-07-07 Sophia Genetics S.A. Methods for asymmetric dna library generation and optionally integrated duplex sequencing
EP4603594A3 (en) 2018-08-28 2025-11-12 10X Genomics, Inc. Increasing spatial array resolution
EP3844308A1 (en) 2018-08-28 2021-07-07 10X Genomics, Inc. Resolving spatial arrays
WO2020060811A1 (en) 2018-09-17 2020-03-26 Omniome, Inc. Engineered polymerases for improved sequencing
AU2019364418B2 (en) 2018-10-25 2025-11-13 Illumina, Inc. Methods and compositions for identifying ligands on arrays using indexes and barcodes
CA3113271A1 (en) 2018-10-26 2020-04-30 Illumina, Inc. Modulating polymer beads for dna processing
NL2022043B1 (en) 2018-11-21 2020-06-03 Akershus Univ Hf Tagmentation-Associated Multiplex PCR Enrichment Sequencing
MX2021003771A (en) 2018-11-30 2021-05-27 Illumina Inc Analysis of multiple analytes using a single assay.
US20220290217A1 (en) 2018-12-10 2022-09-15 10X Genomics, Inc. Resolving spatial arrays using deconvolution
US12529094B2 (en) 2018-12-10 2026-01-20 10X Genomics, Inc. Imaging system hardware
US11649485B2 (en) 2019-01-06 2023-05-16 10X Genomics, Inc. Generating capture probes for spatial analysis
US11926867B2 (en) 2019-01-06 2024-03-12 10X Genomics, Inc. Generating capture probes for spatial analysis
EP3908678A1 (en) 2019-01-10 2021-11-17 Iovance Biotherapeutics, Inc. System and methods for monitoring adoptive cell therapy clonality and persistence
CN114174531A (en) 2019-02-28 2022-03-11 10X基因组学有限公司 Profiling of biological analytes with spatially barcoded oligonucleotide arrays
CN114127309A (en) 2019-03-15 2022-03-01 10X基因组学有限公司 Method for single cell sequencing using spatial arrays
NL2023312B1 (en) 2019-03-21 2020-09-28 Illumina Inc Artificial intelligence-based base calling
WO2020198071A1 (en) 2019-03-22 2020-10-01 10X Genomics, Inc. Three-dimensional spatial analysis
GB201905303D0 (en) 2019-04-15 2019-05-29 Thermo Fisher Scient Geneart Gmbh Multiplex assembly of nucleic acid molecules
WO2020227718A1 (en) 2019-05-09 2020-11-12 Catalog Technologies, Inc. Data structures and operations for searching, computing, and indexing in dna-based data storage
EP3976820A1 (en) 2019-05-30 2022-04-06 10X Genomics, Inc. Methods of detecting spatial heterogeneity of a biological sample
SG11202105836XA (en) 2019-07-12 2021-07-29 Illumina Cambridge Ltd Compositions and methods for preparing nucleic acid sequencing libraries using crispr/cas9 immobilized on a solid support
EP4031682A1 (en) 2019-09-20 2022-07-27 Illumina, Inc. Methods and compositions for identifying ligands on arrays using indexes and barcodes
US11111507B2 (en) 2019-09-23 2021-09-07 Zymergen Inc. Method for counterselection in microorganisms
CN117036248A (en) 2019-10-01 2023-11-10 10X基因组学有限公司 Systems and methods for identifying morphological patterns in tissue samples
JP7726874B2 (en) 2019-10-11 2025-08-20 カタログ テクノロジーズ, インコーポレイテッド Nucleic Acid Security and Authentication
WO2021092433A2 (en) 2019-11-08 2021-05-14 10X Genomics, Inc. Enhancing specificity of analyte binding
EP4055155A1 (en) 2019-11-08 2022-09-14 Pacific Biosciences of California, Inc. Engineered polymerases for improved sequencing by binding
EP4055185A1 (en) 2019-11-08 2022-09-14 10X Genomics, Inc. Spatially-tagged analyte capture agents for analyte multiplexing
CA3158603A1 (en) 2019-11-18 2021-05-27 Neil Ira WEISENFELD Systems and methods for tissue classification
US20210155982A1 (en) 2019-11-21 2021-05-27 10X Genomics, Inc. Pipeline for spatial analysis of analytes
CN121022991A (en) 2019-12-23 2025-11-28 10X基因组学有限公司 Spatial analysis using RNA templated ligation
US12365942B2 (en) 2020-01-13 2025-07-22 10X Genomics, Inc. Methods of decreasing background on a spatial array
US12405264B2 (en) 2020-01-17 2025-09-02 10X Genomics, Inc. Electrophoretic system and method for analyte capture
US11702693B2 (en) 2020-01-21 2023-07-18 10X Genomics, Inc. Methods for printing cells and generating arrays of barcoded cells
US11732299B2 (en) 2020-01-21 2023-08-22 10X Genomics, Inc. Spatial assays with perturbed cells
US20210230681A1 (en) 2020-01-24 2021-07-29 10X Genomics, Inc. Methods for spatial analysis using proximity ligation
US11821035B1 (en) 2020-01-29 2023-11-21 10X Genomics, Inc. Compositions and methods of making gene expression libraries
US11898205B2 (en) 2020-02-03 2024-02-13 10X Genomics, Inc. Increasing capture efficiency of spatial assays
US12110541B2 (en) 2020-02-03 2024-10-08 10X Genomics, Inc. Methods for preparing high-resolution spatial arrays
US12112833B2 (en) 2020-02-04 2024-10-08 10X Genomics, Inc. Systems and methods for index hopping filtering
US11732300B2 (en) 2020-02-05 2023-08-22 10X Genomics, Inc. Increasing efficiency of spatial analysis in a biological sample
US11835462B2 (en) 2020-02-11 2023-12-05 10X Genomics, Inc. Methods and compositions for partitioning a biological sample
EP4103580A4 (en) 2020-02-13 2024-03-06 Zymergen Inc. METAGENOME LIBRARY AND PLATFORM FOR THE DISCOVERY OF NATURAL PRODUCTS
US12421558B2 (en) 2020-02-13 2025-09-23 10X Genomics, Inc. Systems and methods for joint interactive visualization of gene expression and DNA chromatin accessibility
US12399123B1 (en) 2020-02-14 2025-08-26 10X Genomics, Inc. Spatial targeting of analytes
US12281357B1 (en) 2020-02-14 2025-04-22 10X Genomics, Inc. In situ spatial barcoding
IL295297A (en) 2020-02-14 2022-10-01 Univ Johns Hopkins Methods and Materials for the Evaluation of Nucleic Acids
CN115485391A (en) 2020-02-17 2022-12-16 10X基因组学有限公司 In situ analysis of chromatin interactions
EP4484571A3 (en) 2020-02-21 2025-03-19 10X Genomics, Inc. Methods and compositions for integrated in situ spatial assay
US11891654B2 (en) 2020-02-24 2024-02-06 10X Genomics, Inc. Methods of making gene expression libraries
US11926863B1 (en) 2020-02-27 2024-03-12 10X Genomics, Inc. Solid state single cell method for analyzing fixed biological cells
US11768175B1 (en) 2020-03-04 2023-09-26 10X Genomics, Inc. Electrophoretic methods for spatial analysis
WO2021216708A1 (en) 2020-04-22 2021-10-28 10X Genomics, Inc. Methods for spatial analysis using targeted rna depletion
IL297920A (en) 2020-05-08 2023-01-01 Illumina Inc Genome sequencing and detection techniques
EP4150622B1 (en) 2020-05-11 2024-09-25 Catalog Technologies, Inc. Programs and functions in dna-based data storage
CN116134308B (en) 2020-05-19 2025-05-27 10X基因组学有限公司 Electrophoresis cartridge and instrument
WO2021237087A1 (en) 2020-05-22 2021-11-25 10X Genomics, Inc. Spatial analysis to detect sequence variants
EP4414459B1 (en) 2020-05-22 2025-09-03 10X Genomics, Inc. Simultaneous spatio-temporal measurement of gene expression and cellular activity
WO2021242834A1 (en) 2020-05-26 2021-12-02 10X Genomics, Inc. Method for resetting an array
WO2021247543A2 (en) 2020-06-02 2021-12-09 10X Genomics, Inc. Nucleic acid library methods
US12265079B1 (en) 2020-06-02 2025-04-01 10X Genomics, Inc. Systems and methods for detecting analytes from captured single biological particles
EP4158054B1 (en) 2020-06-02 2025-04-16 10X Genomics, Inc. Spatial transcriptomics for antigen-receptors
US12031177B1 (en) 2020-06-04 2024-07-09 10X Genomics, Inc. Methods of enhancing spatial resolution of transcripts
WO2021252499A1 (en) 2020-06-08 2021-12-16 10X Genomics, Inc. Methods of determining a surgical margin and methods of use thereof
WO2021252747A1 (en) 2020-06-10 2021-12-16 1Ox Genomics, Inc. Fluid delivery methods
EP4446430A3 (en) 2020-06-10 2024-12-18 10X Genomics, Inc. Methods for determining a location of an analyte in a biological sample
US12435363B1 (en) 2020-06-10 2025-10-07 10X Genomics, Inc. Materials and methods for spatial transcriptomics
WO2021263111A1 (en) 2020-06-25 2021-12-30 10X Genomics, Inc. Spatial analysis of dna methylation
US12168801B1 (en) 2020-07-02 2024-12-17 10X Genomics, Inc. Hybrid/capture probe designs for full-length cDNA
CA3190588A1 (en) 2020-08-06 2022-02-10 Illumina, Inc. Preparation of rna and dna sequencing libraries using bead-linked transposomes
US12553898B1 (en) 2020-08-10 2026-02-17 10X Genomics, Inc. Fluorescent hybridization of antibody-oligonucleotide for multiplexing and signal amplification
IL299783A (en) 2020-08-18 2023-03-01 Illumina Inc Sequence-specific targeted transposition and selection and sorting of nucleic acids
US12580044B1 (en) 2020-09-02 2026-03-17 10X Genomics, Inc. Systems and methods for identifying cells that are antigen-specific for an immunogenic feature
IL300983A (en) 2020-09-11 2023-04-01 Illumina Cambridge Ltd Methods of enriching a target sequence from a sequencing library using hairpin adaptors
WO2022061150A2 (en) 2020-09-18 2022-03-24 10X Geonomics, Inc. Sample handling apparatus and image registration methods
AU2021366658A1 (en) 2020-10-21 2023-06-22 Illumina Cambridge Limited Sequencing templates comprising multiple inserts and compositions and methods for improving sequencing throughput
US12071667B2 (en) 2020-11-04 2024-08-27 10X Genomics, Inc. Sequence analysis using meta-stable nucleic acid molecules
JP2023552015A (en) 2020-12-02 2023-12-14 イルミナ ソフトウェア, インコーポレイテッド Systems and methods for detecting genetic mutations
US12509717B2 (en) 2020-12-11 2025-12-30 10X Genomics, Inc. Methods and compositions for multimodal in situ analysis
US12060603B2 (en) 2021-01-19 2024-08-13 10X Genomics, Inc. Methods for internally controlled in situ assays using padlock probes
EP4284945B1 (en) 2021-01-26 2024-10-23 10X Genomics, Inc. Nucleic acid analog probes for in situ analysis
EP4284335A1 (en) 2021-02-01 2023-12-06 RegenxBio Inc. Gene therapy for neuronal ceroid lipofuscinoses
ES3015114T3 (en) 2021-02-04 2025-04-29 Illumina Inc Long indexed-linked read generation on transposome bound beads
EP4421491A3 (en) 2021-02-19 2024-11-27 10X Genomics, Inc. Method of using a modular assay support device
EP4301873A1 (en) 2021-03-03 2024-01-10 10X Genomics, Inc. Analyte detection in situ using nucleic acid origami
AU2022238446A1 (en) 2021-03-18 2023-09-07 10X Genomics, Inc. Multiplex capture of gene and protein expression from a biological sample
EP4315336A1 (en) 2021-03-24 2024-02-07 Catalog Technologies, Inc. Fixed point number representation and computation circuits
JP2024511766A (en) 2021-03-29 2024-03-15 イルミナ インコーポレイテッド Improved library preparation method
CA3214282A1 (en) 2021-03-29 2022-10-06 Illumina, Inc. Compositions and methods for assessing dna damage in a library and normalizing amplicon size bias
MX2023010495A (en) 2021-03-30 2023-09-18 Illumina Inc Improved methods of isothermal complementary dna and library preparation.
KR20230165273A (en) 2021-03-31 2023-12-05 일루미나 케임브리지 리미티드 Nucleic acid library sequencing technology with adapter dimer detection
KR20230164668A (en) 2021-03-31 2023-12-04 일루미나, 인코포레이티드 Method for manufacturing directed tagged sequencing libraries using transposon-based technology using unique molecular identifiers for error correction
JP7719206B2 (en) 2021-04-02 2025-08-05 イルミナ インコーポレイテッド Nucleotide for sequencing - Machine learning model for detecting bubbles in specimen slides
US11578320B2 (en) 2021-04-27 2023-02-14 Singular Genomics Systems, Inc. High density sequencing and multiplexed priming
KR20240004473A (en) 2021-04-29 2024-01-11 일루미나, 인코포레이티드 Amplification techniques for nucleic acid characterization
CN113293205B (en) 2021-05-24 2024-11-26 深圳市真迈生物科技有限公司 Sequencing methods
CA3220708A1 (en) 2021-05-28 2022-12-01 Niall Anthony Gormley Oligo-modified nucleotide analogues for nucleic acid preparation
EP4347877A1 (en) 2021-06-01 2024-04-10 10X Genomics, Inc. Methods and compositions for analyte detection and probe resolution
EP4347880B1 (en) 2021-06-02 2026-02-04 10X Genomics, Inc. Sample analysis using asymmetric circularizable probes
US20220403450A1 (en) 2021-06-03 2022-12-22 Illumina Software, Inc. Systems and methods for sequencing nucleotides using two optical channels
EP4364149A1 (en) 2021-06-29 2024-05-08 Illumina, Inc. Machine-learning model for generating confidence classifications for genomic coordinates
KR20240022490A (en) 2021-06-29 2024-02-20 일루미나, 인코포레이티드 Signal-to-noise ratio metrics for determining nucleotide base calling and base calling quality
WO2023278184A1 (en) 2021-06-29 2023-01-05 Illumina, Inc. Methods and systems to correct crosstalk in illumination emitted from reaction sites
US12530882B2 (en) 2021-07-01 2026-01-20 Illumina, Inc. Efficient artificial intelligence-based base calling of index sequences
US20230026886A1 (en) 2021-07-13 2023-01-26 10X Genomics, Inc. Methods for preparing polymerized matrix with controllable thickness
US12423815B2 (en) 2021-07-13 2025-09-23 Illumina, Inc. Methods and systems for real time extraction of crosstalk in illumination emitted from reaction sites
US20230021577A1 (en) 2021-07-23 2023-01-26 Illumina Software, Inc. Machine-learning model for recalibrating nucleotide-base calls
CA3224093A1 (en) 2021-07-30 2023-02-02 Jorge Ivan Hernandez Neuta Methods and compositions for synchronizing reactions in situ
US12139751B2 (en) 2021-07-30 2024-11-12 10X Genomics, Inc. Circularizable probes for in situ analysis
US12553805B2 (en) 2021-08-02 2026-02-17 10X Genomics, Inc. Methods of preserving a biological sample
WO2023015192A1 (en) 2021-08-03 2023-02-09 10X Genomics, Inc. Nucleic acid concatemers and methods for stabilizing and/or compacting the same
US12391984B2 (en) 2021-08-03 2025-08-19 10X Genomics, Inc. Compositions and methods for rolling circle amplification
US12529096B2 (en) 2021-08-03 2026-01-20 10X Genomics, Inc. Stabilization and/or compaction of nucleic acid structures
US12460251B2 (en) 2021-08-03 2025-11-04 10X Genomics, Inc. Stabilization and/or compaction of nucleic acid molecules
WO2023023484A1 (en) 2021-08-16 2023-02-23 10X Genomics, Inc. Probes comprising a split barcode region and methods of use
WO2023034079A1 (en) 2021-09-01 2023-03-09 Illumina Software, Inc. Amplitude modulation for accelerated base calling
JP2024535663A (en) 2021-09-17 2024-10-02 イルミナ インコーポレイテッド Automatic Identification of Sources of Faults from Base Call Error Patterns in Nucleotide Sequencing
US20230095961A1 (en) 2021-09-21 2023-03-30 Illumina, Inc. Graph reference genome and base-calling approach using imputed haplotypes
WO2023056328A2 (en) 2021-09-30 2023-04-06 Illumina, Inc. Solid supports and methods for depleting and/or enriching library fragments prepared from biosamples
KR20240113772A (en) 2021-11-19 2024-07-23 카탈로그 테크놀로지스, 인크. Nucleic acid storage for blockchain and non-fungible tokens
EP4441743A1 (en) 2021-12-02 2024-10-09 Illumina, Inc. Generating cluster-specific-signal corrections for determining nucleotide-base calls
US20230183799A1 (en) 2021-12-10 2023-06-15 Illumina, Inc. Parallel sample and index sequencing
EP4441711A1 (en) 2021-12-20 2024-10-09 10X Genomics, Inc. Self-test for pathology/histology slide imaging device
WO2023119164A1 (en) 2021-12-21 2023-06-29 Illumina Cambridge Limited Wax-microsphere matrix compositions and methods of making and using the same
US20230215515A1 (en) 2021-12-23 2023-07-06 Illumina Software, Inc. Facilitating secure execution of external workflows for genomic sequencing diagnostics
WO2023122363A1 (en) 2021-12-23 2023-06-29 Illumina Software, Inc. Dynamic graphical status summaries for nucelotide sequencing
US20230242974A1 (en) 2021-12-27 2023-08-03 10X Genomics, Inc. Methods and compositions for rolling circle amplification
US20230207050A1 (en) 2021-12-28 2023-06-29 Illumina Software, Inc. Machine learning model for recalibrating nucleotide base calls corresponding to target variants
EP4457814A1 (en) 2021-12-29 2024-11-06 Illumina, Inc. Automatically switching variant analysis model versions for genomic analysis applications
WO2023141588A1 (en) 2022-01-21 2023-07-27 10X Genomics, Inc. Multiple readout signals for analyzing a sample
AU2023223467A1 (en) 2022-02-23 2024-08-08 Insitro, Inc. Pooled optical screening and transcriptional measurements of cells comprising barcoded genetic perturbations
US20230410944A1 (en) 2022-02-25 2023-12-21 Illumina, Inc. Calibration sequences for nucelotide sequencing
EP4483371A1 (en) 2022-02-25 2025-01-01 Illumina, Inc. Machine-learning models for detecting and adjusting values for nucleotide methylation levels
CA3245407A1 (en) 2022-03-04 2023-09-07 Catalog Technologies, Inc. Dna microarrays and component level sequencing for nucleic acid-based data storage and processing
AU2023243205A1 (en) 2022-04-01 2024-09-19 10X Genomics, Inc. Compositions and methods for targeted masking of autofluorescence
EP4504969A1 (en) 2022-04-06 2025-02-12 10X Genomics, Inc. Methods for multiplex cell analysis
EP4504966A1 (en) 2022-04-08 2025-02-12 Illumina, Inc. Aptamer dynamic range compression and detection techniques
EP4515547A1 (en) 2022-04-26 2025-03-05 Illumina, Inc. Machine-learning models for selecting oligonucleotide probes for array technologies
EP4519674A1 (en) 2022-05-06 2025-03-12 10X Genomics, Inc. Analysis of antigen and antigen receptor interactions
EP4523215A1 (en) 2022-05-10 2025-03-19 Illumina Inc. Adaptive neural network for nucelotide sequencing
US20250320487A1 (en) 2022-05-18 2025-10-16 Illumina, Inc. Preparation Of Size-Controlled Nucleic Acid Fragments
EP4540607A1 (en) 2022-06-17 2025-04-23 10X Genomics, Inc. Catalytic de-crosslinking of samples for in situ analysis
EP4519457A4 (en) * 2022-06-18 2025-09-03 Nanogami GmbH Methods for single-cell sequencing and error rate reduction
KR20250034034A (en) 2022-06-24 2025-03-10 일루미나, 인코포레이티드 How to improve split-read alignment by intelligently identifying and scoring candidate split groups
IL317959A (en) 2022-06-27 2025-02-01 Illumina Inc Generating and implementing a structural variation graph genome
EP4544554A1 (en) 2022-06-27 2025-04-30 Illumina, Inc. Improved human leukocyte antigen (hla) genotyping
CA3260497A1 (en) 2022-06-27 2024-01-04 Illumina, Inc. Accelerators for a genotype imputation model
US20240038327A1 (en) 2022-07-26 2024-02-01 Illumina Software, Inc. Rapid single-cell multiomics processing using an executable file
WO2024036304A1 (en) 2022-08-12 2024-02-15 10X Genomics, Inc. Puma1 polymerases and uses thereof
US12116626B2 (en) 2022-08-16 2024-10-15 10X Genomics, Inc. AP50 polymerases and uses thereof
EP4595060A1 (en) 2022-09-29 2025-08-06 Illumina, Inc. A target-variant-reference panel for imputing target variants
WO2024073519A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Machine-learning model for refining structural variant calls
WO2024077096A1 (en) 2022-10-05 2024-04-11 Illumina, Inc. Integrating variant calls from multiple sequencing pipelines utilizing a machine learning architecture
US20240127906A1 (en) 2022-10-11 2024-04-18 Illumina, Inc. Detecting and correcting methylation values from methylation sequencing assays
CN120129825A (en) 2022-10-14 2025-06-10 10X基因组学有限公司 Methods, compositions and systems for assessing the quality of biological samples
GB202215624D0 (en) 2022-10-21 2022-12-07 Dnae Diagnostics Ltd Clonal amplification
WO2024102736A1 (en) 2022-11-08 2024-05-16 10X Genomics, Inc. Immobilization methods and compositions for in situ detection
EP4573210B1 (en) 2022-11-16 2026-05-06 10X Genomics, Inc. Method for analysing gene expression in cells in a pellet
WO2024107727A1 (en) 2022-11-18 2024-05-23 10X Genomics, Inc. Systems and methods for actively mitigating vibrations
EP4622746A1 (en) 2022-11-22 2025-10-01 10X Genomics, Inc. Systems and methods for interfacing with a bottle
US12581050B2 (en) 2022-11-23 2026-03-17 10X Genomics, Inc. Optical assemblies for machine vision calibration
EP4627583A1 (en) 2022-11-30 2025-10-08 Illumina, Inc. Accurately predicting variants from methylation sequencing data
US20240218437A1 (en) 2022-12-16 2024-07-04 10X Genomics, Inc. Methods and compositions for assessing performance
EP4638789A1 (en) 2022-12-21 2025-10-29 10X Genomics, Inc. Methods for tethering ribonucleic acids in biological samples
EP4592831A1 (en) 2022-12-30 2025-07-30 GeneMind Biosciences Company Limited Method and apparatus for controlling chip loading, sequencing system, and storage medium
EP4646492A1 (en) 2023-01-06 2025-11-12 10X Genomics, Inc. Methods and compositions for in situ analysis of variant sequences
JP2026506415A (en) 2023-02-06 2026-02-25 イルミナ インコーポレイテッド Determination and removal of intercluster optical interference
WO2024168196A1 (en) * 2023-02-08 2024-08-15 University Of Washington Systems and methods for enzymatic synthesis of polynucleotides containing non-standard nucleotide basepairs
EP4673167A1 (en) 2023-02-27 2026-01-07 Adaptive Biotechnologies Corp. Therapeutic t cell receptors targeting kras g12d
US20250369046A1 (en) 2023-03-10 2025-12-04 Illumina, Inc. Aptamer detection techniques
EP4706045A1 (en) 2023-03-30 2026-03-11 Illumina, Inc. Tandem repeat genotyping
WO2024229260A1 (en) 2023-05-03 2024-11-07 10X Genomics, Inc. Methods and compositions for spatial assay
US20240404624A1 (en) 2023-05-31 2024-12-05 Illumina, Inc. Structural variant alignment and variant calling by utilizing a structural-variant reference genome
WO2024249973A2 (en) 2023-06-02 2024-12-05 Illumina, Inc. Linking human genes to clinical phenotypes using graph neural networks
WO2024254003A1 (en) 2023-06-05 2024-12-12 Illumina, Inc. Identification and mapping of methylation sites
CN121359206A (en) 2023-06-27 2026-01-16 因美纳有限公司 Variant detection using methylation level estimation
EP4735636A1 (en) 2023-06-30 2026-05-06 Illumina, Inc. Systems and methods of sequencing polynucleotides with four labeled nucleotides
EP4735635A1 (en) 2023-06-30 2026-05-06 Illumina, Inc. Systems and methods of sequencing polynucleotides with alternative scatterplots
EP4735634A1 (en) 2023-06-30 2026-05-06 Illumina, Inc. Systems and methods of sequencing polynucleotides with modified bases
WO2025006874A1 (en) 2023-06-30 2025-01-02 Illumina, Inc. Machine-learning model for recalibrating genotype calls corresponding to germline variants and somatic mosaic variants
WO2025029831A1 (en) 2023-07-31 2025-02-06 10X Genomics, Inc. Methods and systems for targeted rna cleavage and target rna-primed rolling circle amplification
WO2025035143A1 (en) 2023-08-10 2025-02-13 The Trustees Of The University Of Pennsylvania Compositions and methods for treatment of spinal muscular atrophy
CN121969766A (en) 2023-08-31 2026-05-01 因美纳有限公司 Fittest technology
CN121752734A (en) 2023-08-31 2026-03-27 因美纳有限公司 Aptamer dynamic range compression and detection techniques
WO2025054389A1 (en) 2023-09-07 2025-03-13 Illumina, Inc. Identification of methylated cytosine using landmarks
EP4520821A1 (en) 2023-09-08 2025-03-12 The Regents Of The University Of Michigan Microrna-derived rnas and polypeptides and uses thereof
WO2025061942A1 (en) 2023-09-20 2025-03-27 Illumina, Inc. Sequencing error identification and correction
WO2025061922A1 (en) 2023-09-20 2025-03-27 Illumina, Inc. Methods for sequencing
US20250111899A1 (en) 2023-09-29 2025-04-03 Illumina, Inc. Predicting insert lengths using primary analysis metrics
US20250163502A1 (en) 2023-11-22 2025-05-22 10X Genomics, Inc. Methods for processing ribonucleic acids in biological samples
WO2025123005A2 (en) 2023-12-07 2025-06-12 Illumina, Inc. Preparation and compositions of cot-1 nucleic acid
WO2025129157A1 (en) 2023-12-15 2025-06-19 The Trustees Of The University Of Pennsylvania Gene therapy for treatment of canavan disease
US20250210137A1 (en) 2023-12-20 2025-06-26 Illumina, Inc. Directly determining signal-to-noise-ratio metrics for accelerated convergence in determining nucleotide-base calls and base-call quality
US20250207203A1 (en) 2023-12-20 2025-06-26 10X Genomics, Inc. In situ detection of copy number variations in biological samples
CN121359207A (en) 2023-12-21 2026-01-16 因美纳有限公司 Enhanced nucleotide read mapping and alignment using improved haplotype data structures with allele-variant differences.
WO2025160089A1 (en) 2024-01-26 2025-07-31 Illumina, Inc. Custom multigenome reference construction for improved sequencing analysis of genomic samples
WO2025174708A1 (en) 2024-02-13 2025-08-21 Illumina, Inc. Design and method for cross-sequencing platform compatibility of flow cells
WO2025178951A1 (en) 2024-02-22 2025-08-28 Illumina, Inc. Techniques for dynamic range compression grouping in analyte assays
CN121359209A (en) 2024-02-28 2026-01-16 因美纳有限公司 Personalized haplotype database for improving nucleotide read mapping and alignment, and for improving genotype detection.
WO2025193747A1 (en) 2024-03-12 2025-09-18 Illumina, Inc. Machine-learning models for ordering and expediting sequencing tasks or corresponding nucleotide-sample slides
WO2025194033A1 (en) 2024-03-15 2025-09-18 10X Genomics, Inc. Systems and methods for covering and sealing an open well
WO2025217057A1 (en) 2024-04-08 2025-10-16 Illumina, Inc. Variant detection using improved sequence data alignments
CN121359208A (en) 2024-05-13 2026-01-16 因美纳有限公司 The sequencing cycle was modified during sequencing run to meet customized coverage estimation for the target genome region.
WO2025240918A1 (en) 2024-05-17 2025-11-20 10X Genomics, Inc. Systems and methods for generating codebooks
WO2025240924A1 (en) 2024-05-17 2025-11-20 Illumina, Inc. Blind equalization systems for base calling applications
WO2025250996A2 (en) 2024-05-31 2025-12-04 Illumina, Inc. Call generation and recalibration models for implementing personalized diploid reference haplotypes in genotype calling
WO2025250794A1 (en) 2024-05-31 2025-12-04 Illumina, Inc. Two-copy allele detection
WO2025255457A1 (en) 2024-06-07 2025-12-11 10X Genomics, Inc. Compositions and methods for improved on-target spatial profiling
WO2025264702A1 (en) 2024-06-18 2025-12-26 10X Genomics, Inc. 3d hydrogels for nucleic acid sequencing
WO2026006771A1 (en) 2024-06-28 2026-01-02 Illumina, Inc. Cluster-filtering scores
WO2026030370A1 (en) 2024-07-30 2026-02-05 Illumina, Inc. Generating adaptive intensity value decision boundaries for nucleotide sequencing
WO2026030369A1 (en) 2024-07-31 2026-02-05 10X Genomics, Inc. Methods and compositions for in situ analyte detection
WO2026043885A1 (en) 2024-08-20 2026-02-26 10X Genomics, Inc. Methods and systems for preparing a nucleic acid library
WO2026055487A1 (en) 2024-09-06 2026-03-12 10X Genomics, Inc. Modified nucleotides with oligomer spacers
WO2026072725A1 (en) 2024-09-25 2026-04-02 Illumina, Inc. Adjusting oligonucleotide-cluster location in images in real time using band-edge spectral regions
WO2026072436A1 (en) 2024-09-27 2026-04-02 Illumina, Inc. Systems and methods for quantifying sequence read connectivity
WO2026072464A1 (en) 2024-09-27 2026-04-02 Illumina, Inc. Read mapping enhanced by spatial information
WO2026073207A1 (en) 2024-09-30 2026-04-02 Illumina, Inc. Affinity-binder-based assay compositions and methods
WO2026097020A1 (en) 2024-11-04 2026-05-07 10X Genomics, Inc. Polymerase for sequencing by synthesis

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991006678A1 (en) * 1989-10-26 1991-05-16 Sri International Dna sequencing
WO1993004199A2 (en) * 1991-08-20 1993-03-04 Scientific Generics Limited Methods of detecting or quantitating nucleic acids and of producing labelled immobilised nucleic acids
EP0665293A2 (en) * 1994-01-26 1995-08-02 Hamamatsu Photonics K.K. Method of determining base sequence of nucleic acid
WO1996004404A1 (en) * 1994-08-03 1996-02-15 Mosaic Technologies, Inc. Method and apparatus for performing amplification of nucleic acid on supports
WO1996032504A2 (en) * 1995-04-11 1996-10-17 Trustees Of Boston University Solid phase sequencing of biopolymers
US5589332A (en) * 1992-12-04 1996-12-31 Innovir Laboratories, Inc. Ribozyme amplified diagnostics

Family Cites Families (101)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4957858A (en) 1986-04-16 1990-09-18 The Salk Instute For Biological Studies Replicative RNA reporter systems
EP0224126A3 (en) 1985-11-25 1989-02-01 The University of Calgary Covalently linked complementary oligodeoxynucleotides as universal nucleic acid sequencing primer linkers
IL86724A (en) 1987-06-19 1995-01-24 Siska Diagnostics Inc Method and kits for the amplification and detection of nucleic acid sequences
CA1340843C (en) 1987-07-31 1999-12-07 J. Lawrence Burg Selective amplification of target polynucleotide sequences
SE8801070D0 (en) * 1988-03-23 1988-03-23 Pharmacia Ab METHOD FOR IMMOBILIZING A DNA SEQUENCE ON A SOLID SUPPORT
US6107023A (en) * 1988-06-17 2000-08-22 Genelabs Technologies, Inc. DNA amplification and subtraction techniques
GB8818020D0 (en) 1988-07-28 1988-09-01 Ici Plc Method for amplification of nucleotide sequences
WO1990002205A1 (en) 1988-08-25 1990-03-08 Angenics, Inc. Detection of nucleic acid sequences using particle agglutination
GB8827160D0 (en) 1988-11-21 1988-12-29 Apothekernes Lab Detection & quantitative determination of rna & dna
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
CA2004326A1 (en) 1988-12-23 1990-06-23 Nanibushan Dattagupta Assay of sequences using amplified genes
AU656514B2 (en) 1989-02-13 1995-02-09 Geneco Pty Ltd Detection of a nucleic acid sequence or a change therein
KR920700360A (en) 1989-03-22 1992-02-19 하리크 프리드리히 Sliding bearing
US5629158A (en) * 1989-03-22 1997-05-13 Cemu Bitecknik Ab Solid phase diagnosis of medical conditions
US5800992A (en) * 1989-06-07 1998-09-01 Fodor; Stephen P.A. Method of detecting nucleic acids
US5547839A (en) * 1989-06-07 1996-08-20 Affymax Technologies N.V. Sequencing of surface immobilized polymers utilizing microflourescence detection
GB2233654A (en) 1989-07-07 1991-01-16 Nat Res Dev Immobilised polynucleotides
US5302509A (en) 1989-08-14 1994-04-12 Beckman Instruments, Inc. Method for sequencing polynucleotides
CA2036946C (en) * 1990-04-06 2001-10-16 Kenneth V. Deugau Indexing linkers
US5326692B1 (en) * 1992-05-13 1996-04-30 Molecular Probes Inc Fluorescent microparticles with controllable enhanced stokes shift
US5645994A (en) * 1990-07-05 1997-07-08 University Of Utah Research Foundation Method and compositions for identification of species in a sample using type II topoisomerase sequences
GB9019512D0 (en) 1990-09-06 1990-10-24 Ici Plc Assay method
CA2055755A1 (en) 1990-11-22 1992-05-23 Toshihiko Kishimoto Method of immobilizing single-stranded dna on carrier at terminal
ES2130177T3 (en) * 1991-08-10 1999-07-01 Medical Res Council TREATMENT OF CELL POPULATIONS.
CA2077135A1 (en) 1991-08-30 1993-03-01 Joh-E Ikeda A method of dna amplification
US5474796A (en) * 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
HU223760B1 (en) 1991-09-24 2005-01-28 Keygene N.V. Selective restriction fragment amplification, a general method for dna fingerprinting
WO1993009245A1 (en) * 1991-10-31 1993-05-13 University Of Pittsburgh Reverse dot blot hybridization using tandem head-to-tail monomers containing probes synthesized by staggered complementary primers
WO1993009250A1 (en) 1991-11-01 1993-05-13 Adelaide Children's Hospital Solid phase amplification process
DE4141178A1 (en) 1991-12-13 1993-06-17 Europ Lab Molekularbiolog New nucleic acid sequencing method - using one labelled nucleotide at one time in cycles comprising elongation, wash, label detection and removal of the label, then repeating
AU3728093A (en) * 1992-02-19 1993-09-13 Public Health Research Institute Of The City Of New York, Inc., The Novel oligonucleotide arrays and their use for sorting, isolating, sequencing, and manipulating nucleic acids
GB9208733D0 (en) 1992-04-22 1992-06-10 Medical Res Council Dna sequencing method
GB9214873D0 (en) 1992-07-13 1992-08-26 Medical Res Council Process for categorising nucleotide sequence populations
WO1994002634A1 (en) 1992-07-24 1994-02-03 University Of South Australia Amplification and detection process
US5639423A (en) 1992-08-31 1997-06-17 The Regents Of The University Of Calfornia Microfabricated reactor
RU2048522C1 (en) * 1992-10-14 1995-11-20 Институт белка РАН Method of nucleic acid copying, method of their expression and a medium for their realization
US5795714A (en) * 1992-11-06 1998-08-18 Trustees Of Boston University Method for replicating an array of nucleic acid probes
US5432065A (en) * 1993-03-30 1995-07-11 United States Biochemical Corporation Cycle sequencing with non-thermostable DNA polymerases
US5462854A (en) 1993-04-19 1995-10-31 Beckman Instruments, Inc. Inverse linkage oligonucleotides for chemical and enzymatic processes
WO1994025603A1 (en) 1993-05-05 1994-11-10 Boehringer Mannheim Gmbh Cholesterol-oxidase from brevibacterium sterolicum
US5514539A (en) * 1993-06-29 1996-05-07 The United States Of America As Represented By The Department Of Health And Human Services Nucleotide and deduced amino acid sequences of the envelope 1 gene of 51 isolates of hepatitis C virus and the use of reagents derived from these sequences in diagnostic methods and vaccines
WO1995009174A1 (en) 1993-09-29 1995-04-06 Miami Children's Hospital Research Institute, Inc. Aspartoacylase gene, protein, and methods of screening for mutations associated with canavan disease
US5645801A (en) * 1993-10-21 1997-07-08 Abbott Laboratories Device and method for amplifying and detecting target nucleic acids
HUT74275A (en) 1993-11-02 1996-11-28 Neurobiological Technologies Process for treatment of rheumatoid arthritis
WO1995025538A1 (en) * 1994-03-18 1995-09-28 The General Hospital Corporation Cleaved amplified rflp detection methods
US5552278A (en) 1994-04-04 1996-09-03 Spectragen, Inc. DNA sequencing by stepwise ligation and cleavage
US6689561B1 (en) 1994-04-14 2004-02-10 The Regents Of The University Of California Tumor suppressor gene and methods for detection of cancer, monitoring of tumor progression and cancer treatment
AU707391B2 (en) 1994-05-28 1999-07-08 Tepnel Medical Limited Producing copies of nucleic acids
US5589330A (en) 1994-07-28 1996-12-31 Genzyme Corporation High-throughput screening method for sequence or genetic alterations in nucleic acids using elution and sequencing of complementary oligonucleotides
US6060288A (en) 1994-08-03 2000-05-09 Mosaic Technologies Method for performing amplification of nucleic acid on supports
US6090592A (en) * 1994-08-03 2000-07-18 Mosaic Technologies, Inc. Method for performing amplification of nucleic acid on supports
US6468751B1 (en) * 1994-08-03 2002-10-22 Mosaic Technologies, Inc. Method and apparatus for performing amplification of nucleic acid on supports
JP3612092B2 (en) 1994-09-07 2005-01-19 株式会社日立製作所 DNA separation / sorting method and analysis method
US5843660A (en) * 1994-09-30 1998-12-01 Promega Corporation Multiplex amplification of short tandem repeat loci
FR2726286B1 (en) 1994-10-28 1997-01-17 Genset Sa SOLID PHASE NUCLEIC ACID AMPLIFICATION PROCESS AND REAGENT KIT USEFUL FOR CARRYING OUT SAID PROCESS
US5512441A (en) * 1994-11-15 1996-04-30 American Health Foundation Quantative method for early detection of mutant alleles and diagnostic kits for carrying out the method
EP0804618B1 (en) 1994-11-28 1999-01-27 E.I. Du Pont De Nemours And Company Compound microsatellite primers for the detection of genetic polymorphisms
AU4701396A (en) 1995-02-07 1996-08-27 Mosaic Technologies Diagnostics based on dna duplex repair
AU5171696A (en) * 1995-02-27 1996-09-18 Ely Michael Rabani Device, compounds, algorithms, and methods of molecular characterization and manipulation with molecular parallelism
DE69621507T2 (en) 1995-03-28 2003-01-09 Japan Science And Technology Corp., Kawaguchi Method for molecular indexing of genes using restriction enzymes
US5750341A (en) 1995-04-17 1998-05-12 Lynx Therapeutics, Inc. DNA sequencing by parallel oligonucleotide extensions
DE19515552A1 (en) 1995-04-27 1996-10-31 Europ Lab Molekularbiolog Simultaneous sequencing of nucleic acids
AU5797696A (en) * 1995-05-19 1996-11-29 Ely Michael Rabani Parallel multiplex polynucleotide sequencing
US5753439A (en) * 1995-05-19 1998-05-19 Trustees Of Boston University Nucleic acid detection methods
US5690894A (en) * 1995-05-23 1997-11-25 The Regents Of The University Of California High density array fabrication and readout method for a fiber optic biosensor
US5882856A (en) * 1995-06-07 1999-03-16 Genzyme Corporation Universal primer sequence for multiplex DNA amplification
AT402203B (en) 1995-06-13 1997-03-25 Himmler Gottfried Dipl Ing Dr METHOD FOR TRANSCRIPTION-FREE AMPLIFICATION OF NUCLEIC ACIDS
SE9504099D0 (en) 1995-11-16 1995-11-16 Pharmacia Biotech Ab A method of sequencing
US6143495A (en) 1995-11-21 2000-11-07 Yale University Unimolecular segment amplification and sequencing
AU2264197A (en) 1996-02-09 1997-08-28 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Restriction display (rd-pcr) of differentially expressed mrnas
US5759780A (en) 1996-03-29 1998-06-02 Pathogenesis Corporation Methods for enriching target nucleic acid sequences
US6458530B1 (en) 1996-04-04 2002-10-01 Affymetrix Inc. Selecting tag nucleic acids
US5955268A (en) 1996-04-26 1999-09-21 Abbott Laboratories Method and reagent for detecting multiple nucleic acid sequences in a test sample
CA2255774C (en) 1996-05-29 2008-03-18 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
US6203978B1 (en) 1996-05-31 2001-03-20 Du Vergier Ltd. Capture of single stranded nucleic acids
US5939291A (en) * 1996-06-14 1999-08-17 Sarnoff Corporation Microfluidic method for nucleic acid amplification
GB9620209D0 (en) 1996-09-27 1996-11-13 Cemu Bioteknik Ab Method of sequencing DNA
US5837466A (en) * 1996-12-16 1998-11-17 Vysis, Inc. Devices and methods for detecting nucleic acid analytes in samples
US5876936A (en) 1997-01-15 1999-03-02 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators
US6309824B1 (en) 1997-01-16 2001-10-30 Hyseq, Inc. Methods for analyzing a target nucleic acid using immobilized heterogeneous mixtures of oligonucleotide probes
EP1498494A3 (en) 1997-04-01 2007-06-20 Solexa Ltd. Method of nucleic acid sequencing
EP1591541B1 (en) 1997-04-01 2012-02-15 Illumina Cambridge Limited Method of nucleic acid sequencing
WO1998045474A1 (en) 1997-04-04 1998-10-15 Innogenetics N.V. Isothermal polymerase chain reaction by cycling the concentration of divalent metal ions
US6235471B1 (en) * 1997-04-04 2001-05-22 Caliper Technologies Corp. Closed-loop biochemical analyzers
ES2283936T3 (en) 1997-07-07 2007-11-01 Medical Research Council IN VITRO CLASSIFICATION PROCEDURE.
US6326489B1 (en) * 1997-08-05 2001-12-04 Howard Hughes Medical Institute Surface-bound, bimolecular, double-stranded DNA arrays
US6124120A (en) * 1997-10-08 2000-09-26 Yale University Multiple displacement amplification
US6511803B1 (en) * 1997-10-10 2003-01-28 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
CA2305449A1 (en) 1997-10-10 1999-04-22 President & Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6248558B1 (en) * 1998-03-31 2001-06-19 Vanderbilt University Sequence and method for genetic engineering of proteins with cell membrane translocating activity
US5928875A (en) * 1998-05-27 1999-07-27 Betzdearborn Inc. Primers for the detection of spore forming bacteria
EP1098996A1 (en) * 1998-07-20 2001-05-16 Yale University Method for detecting nucleic acids using target-mediated ligation of bipartite primers
AR021833A1 (en) 1998-09-30 2002-08-07 Applied Research Systems METHODS OF AMPLIFICATION AND SEQUENCING OF NUCLEIC ACID
CA2375769A1 (en) 1999-01-11 2000-07-20 President And Fellows Of Harvard College Isothermal amplification of dna
US6300070B1 (en) 1999-06-04 2001-10-09 Mosaic Technologies, Inc. Solid phase methods for amplifying multiple nucleic acids
US20020119448A1 (en) 1999-06-23 2002-08-29 Joseph A. Sorge Methods of enriching for and identifying polymorphisms
US6107061A (en) 1999-09-18 2000-08-22 The Perkin-Elmer Corporation Modified primer extension reactions for polynucleotide sequence detection
US7078225B2 (en) * 2000-06-02 2006-07-18 Nippon Shokubai Co., Ltd. Method for enzymatically producing an optically active cyanohydrin
AR031640A1 (en) 2000-12-08 2003-09-24 Applied Research Systems ISOTHERMAL AMPLIFICATION OF NUCLEIC ACIDS IN A SOLID SUPPORT
EP2518162B1 (en) 2006-11-15 2018-03-07 Biospherex LLC Multitag sequencing and ecogenomics analysis
US7792820B2 (en) 2007-09-25 2010-09-07 International Business Machines Corporation System for intelligent consumer earcons

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991006678A1 (en) * 1989-10-26 1991-05-16 Sri International Dna sequencing
WO1993004199A2 (en) * 1991-08-20 1993-03-04 Scientific Generics Limited Methods of detecting or quantitating nucleic acids and of producing labelled immobilised nucleic acids
US5589332A (en) * 1992-12-04 1996-12-31 Innovir Laboratories, Inc. Ribozyme amplified diagnostics
EP0665293A2 (en) * 1994-01-26 1995-08-02 Hamamatsu Photonics K.K. Method of determining base sequence of nucleic acid
WO1996004404A1 (en) * 1994-08-03 1996-02-15 Mosaic Technologies, Inc. Method and apparatus for performing amplification of nucleic acid on supports
WO1996032504A2 (en) * 1995-04-11 1996-10-17 Trustees Of Boston University Solid phase sequencing of biopolymers

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FU D -J ET AL: "SEQUENCING DOUBLE-STRANDED DNA BY STRAND DISPLACEMENT", NUCLEIC ACIDS RESEARCH, vol. 25, no. 3, 1997, pages 677 - 679, XP000196977 *
LOCKHART ET AL.: "EXPRESSION MONITORING BY HYBRIDIZATION TO HIGH-DENSITY OLIGONUCLEOTIDE ARRAYS", NATURE BIOTECHNOLOGY, vol. 14, 14 December 1996 (1996-12-14), pages 1675 - 1680, XP002074420 *
OROSKAR ET AL.: "DETECTION OF IMMOBILIZED AMPLICONS BY ELISA-LIKE TECHNIQUES", CLIN.CHEM., vol. 42, no. 9, 1996, pages 1547 - 1555, XP002074418 *
YERSHOV ET AL.: "DNA ANALYSIS AND DIAGNOSTIC ON OLIGONUCLEOTIDE MICROCHIPS", PNAS, vol. 93, May 1996 (1996-05-01), pages 4913 - 4918, XP002074419 *

Cited By (1012)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8476044B2 (en) 1997-04-01 2013-07-02 Illumina, Inc. Method of nucleic acid amplification
US9593328B2 (en) 1997-04-01 2017-03-14 Illumina, Inc. Method of nucleic acid amplification
US8993271B2 (en) 1997-04-01 2015-03-31 Illumina, Inc. Method of nucleic acid amplification
US9902951B2 (en) 1997-04-01 2018-02-27 Illumina, Inc. Method of nucleic acid amplification
US8143008B2 (en) 1997-04-01 2012-03-27 Illumina, Inc. Method of nucleic acid amplification
US7985565B2 (en) 1997-04-01 2011-07-26 Illumina, Inc. Method of nucleic acid amplification
US6485944B1 (en) 1997-10-10 2002-11-26 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US7785790B1 (en) 1997-10-10 2010-08-31 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6432360B1 (en) 1997-10-10 2002-08-13 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
EP0975808A2 (en) * 1997-11-21 2000-02-02 Claas Junghans Topologically fixed matrix bonded nucleic acid molecule
US7115400B1 (en) 1998-09-30 2006-10-03 Solexa Ltd. Methods of nucleic acid amplification and sequencing
AU771073B2 (en) * 1998-09-30 2004-03-11 Lynx Therapeutics, Inc. Methods of nucleic acid amplification and sequencing
EP1634963A1 (en) * 1998-09-30 2006-03-15 Solexa Ltd. Methods of nucleic acid amplification and sequencing
WO2000018957A1 (en) * 1998-09-30 2000-04-06 Applied Research Systems Ars Holding N.V. Methods of nucleic acid amplification and sequencing
US8652810B2 (en) 1998-09-30 2014-02-18 Illumina, Inc. Methods of nucleic acid amplification and sequencing
US9297006B2 (en) 1998-09-30 2016-03-29 Illumina, Inc. Methods of nucleic acid amplification and sequencing
US10370652B2 (en) 1998-09-30 2019-08-06 Illumina, Inc. Methods of nucleic acid amplification and sequencing
WO2000023616A3 (en) * 1998-10-21 2000-08-17 Noxxon Pharma Ag Method for the exponential amplification of molecular matrices
US6300070B1 (en) 1999-06-04 2001-10-09 Mosaic Technologies, Inc. Solid phase methods for amplifying multiple nucleic acids
WO2000075374A1 (en) * 1999-06-04 2000-12-14 Mosaic Technologies Solid phase methods for amplifying multiple nucleic acids
US20140031237A1 (en) * 1999-06-23 2014-01-30 Catalyst Assets Llc Methods of enriching for and identifying polymorphisms
US20140024027A1 (en) * 1999-06-23 2014-01-23 Catalyst Assets Llc Methods of enriching for and identifying polymorphisms
US6274320B1 (en) 1999-09-16 2001-08-14 Curagen Corporation Method of sequencing a nucleic acid
US7244559B2 (en) 1999-09-16 2007-07-17 454 Life Sciences Corporation Method of sequencing a nucleic acid
US7264929B2 (en) 1999-09-16 2007-09-04 454 Life Sciences Corporation Method of sequencing a nucleic acid
US7211390B2 (en) 1999-09-16 2007-05-01 454 Life Sciences Corporation Method of sequencing a nucleic acid
US7335762B2 (en) 1999-09-16 2008-02-26 454 Life Sciences Corporation Apparatus and method for sequencing a nucleic acid
WO2001032935A3 (en) * 1999-11-02 2002-05-02 Celine Hu Molecular microarrays and methods for production and use thereof
WO2001048242A3 (en) * 1999-12-29 2002-07-18 Mergen Ltd Methods for amplifying and detecting multiple polynucleotides on a solid phase support
JP2003523183A (en) * 1999-12-29 2003-08-05 マーゲン リミティド Method for amplifying and detecting a plurality of polynucleotides on a solid support
JP4860869B2 (en) * 1999-12-29 2012-01-25 オックスフォード ジーン テクノロジー アイピー リミティド Method for amplifying and detecting a plurality of polynucleotides on a solid support
US7524629B2 (en) 2000-02-25 2009-04-28 Epigenomics Ag Method for detecting cytosine methylation in DNA samples
US7824852B2 (en) 2000-02-25 2010-11-02 Epigenomics Ag Method for detecting cytosine methylation in DNA samples
WO2001062982A3 (en) * 2000-02-25 2002-09-19 Mosaic Technologies Inc Methods for multi-stage solid phase amplification of nucleic acids
WO2001062960A3 (en) * 2000-02-25 2002-08-29 Epigenomics Ag Method for detecting cytosine methylation in dna samples
WO2001062064A3 (en) * 2000-02-25 2002-10-03 Epigenomics Ag Method for detecting cytosine methylation in dna samples
EP1921171A1 (en) * 2000-02-25 2008-05-14 Epigenomics AG Method for detecting cytosine methylation in DNA
WO2001068921A3 (en) * 2000-03-14 2003-01-23 Investigen Compositions and methods for simultaneous detection of multiple biological entities
WO2001092568A3 (en) * 2000-06-02 2003-06-05 Axaron Bioscience Ag Method for producing dna-arrays
US7846733B2 (en) 2000-06-26 2010-12-07 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
US10662472B2 (en) 2000-10-06 2020-05-26 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10577652B2 (en) 2000-10-06 2020-03-03 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9719139B2 (en) 2000-10-06 2017-08-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9868985B2 (en) 2000-10-06 2018-01-16 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9133511B2 (en) 2000-10-06 2015-09-15 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10633700B2 (en) 2000-10-06 2020-04-28 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10648028B2 (en) 2000-10-06 2020-05-12 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10669577B2 (en) 2000-10-06 2020-06-02 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9725480B2 (en) 2000-10-06 2017-08-08 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10457984B2 (en) 2000-10-06 2019-10-29 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10428380B2 (en) 2000-10-06 2019-10-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10435742B2 (en) 2000-10-06 2019-10-08 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10407459B2 (en) 2000-10-06 2019-09-10 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10407458B2 (en) 2000-10-06 2019-09-10 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9718852B2 (en) 2000-10-06 2017-08-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10570446B2 (en) 2000-10-06 2020-02-25 The Trustee Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10669582B2 (en) 2000-10-06 2020-06-02 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US7972820B2 (en) 2000-12-08 2011-07-05 Illumina Cambridge Limited Isothermal amplification of nucleic acids on a solid support
US7790418B2 (en) 2000-12-08 2010-09-07 Illumina Cambridge Limited Isothermal amplification of nucleic acids on a solid support
WO2002046456A1 (en) * 2000-12-08 2002-06-13 Applied Research Systems Ars Holding N.V. Isothermal amplification of nucleic acids on a solid support
US7771934B2 (en) 2000-12-13 2010-08-10 Nugen Technologies, Inc. Methods and compositions for generation of multiple copies of nucleic acid sequences and methods of detection thereof
US8334116B2 (en) 2000-12-13 2012-12-18 Nugen Technologies, Inc. Methods and compositions for generation of multiple copies of nucleic acid sequences and methods of detection thereof
EP1808496A1 (en) * 2001-01-30 2007-07-18 Solexa Limited Preparation of polynucleotide arrays
WO2002061126A3 (en) * 2001-01-30 2003-02-06 Solexa Ltd The preparation of polynucleotide arrays
WO2002072879A3 (en) * 2001-02-09 2003-10-02 Axaron Bioscience Ag Production and use of random arrangements of clonal nuclear acid islands on a surface
US9181582B2 (en) 2001-03-09 2015-11-10 Nugen Technologies, Inc. Compositions for amplification of RNA sequences using composite primers
US7771946B2 (en) 2001-03-09 2010-08-10 Nugen Technologies, Inc. Methods, kits and compositions for single primer linear isothermal amplification of nucleic acid sequences
US8071311B2 (en) 2001-03-09 2011-12-06 Nugen Technologies, Inc. Methods and compositions for amplification of RNA sequences
WO2002081743A3 (en) * 2001-04-02 2003-04-03 Brendan Hamill Polynucleotide analysis using combinatorial pcr
AU2002241168B2 (en) * 2001-04-02 2007-10-25 Point-2-Point Genomics Ltd. Polynucleotide analysis using combinatorial PCR
US7771975B2 (en) 2001-04-02 2010-08-10 Point-2-Point Genomics Limited Polynucleotide analysis using combinatorial PCR
US9322057B2 (en) 2001-04-20 2016-04-26 The Penn State Research Foundation Methods for nucleic acid manipulation
US10017803B2 (en) 2001-04-20 2018-07-10 The Penn State Research Foundation Methods for nucleic acid manipulation
US9562250B2 (en) 2001-04-20 2017-02-07 The Penn State Research Foundation Methods for nucleic acid manipulation
US10000781B2 (en) 2001-04-20 2018-06-19 The Penn State Research Foundation Methods for nucleic acid manipulation
US9322059B2 (en) 2001-04-20 2016-04-26 The Penn State Research Foundation Methods for nucleic acid manipulation
EP1256632A3 (en) * 2001-05-07 2004-01-02 Smithkline Beecham Corporation High throughput polymorphism screening
EP2159285B1 (en) * 2003-01-29 2012-09-26 454 Life Sciences Corporation Methods of amplifying and sequencing nucleic acids
US7575865B2 (en) 2003-01-29 2009-08-18 454 Life Sciences Corporation Methods of amplifying and sequencing nucleic acids
US7323305B2 (en) 2003-01-29 2008-01-29 454 Life Sciences Corporation Methods of amplifying and sequencing nucleic acids
US10982274B2 (en) 2003-01-29 2021-04-20 Roche Molecular Systems, Inc. Bead emulsion nucleic acid amplification
US8765380B2 (en) 2003-01-29 2014-07-01 454 Life Sciences Corporation Bead emulsion nucleic acid amplification
GB2413555A (en) * 2003-01-29 2005-11-02 Univ Cranfield Replication of nucleic acid arrays
WO2004067759A3 (en) * 2003-01-29 2004-11-18 Univ Cranfield Replication of nucleic acid arrays
US10240192B2 (en) 2003-01-29 2019-03-26 454 Life Sciences Corporation Bead emulsion nucleic acid amplification
US8465950B2 (en) 2003-04-14 2013-06-18 Nugen Technologies, Inc. Global amplification using a randomly primed composite primer
US9175325B2 (en) 2003-04-14 2015-11-03 Nugen Technologies, Inc. Global amplification using a randomly primed composite primer
EP2431481A1 (en) * 2003-10-20 2012-03-21 Kalim Mir Parallel polymer sequencing methods
US9376710B2 (en) 2004-01-07 2016-06-28 Illumina Cambridge Ltd. Methods of localizing nucleic acids to arrays
US8563477B2 (en) 2004-01-07 2013-10-22 Illumina Cambridge Limited Modified molecular arrays
US10953379B2 (en) 2004-01-07 2021-03-23 Illumina Cambridge Limited Methods and compositions of localizing nucleic acids to arrays
US10525437B2 (en) 2004-01-07 2020-01-07 Illumina Cambridge Limited Methods and compositions of localizing nucleic acids to arrays
EP3673986A1 (en) 2004-01-07 2020-07-01 Illumina Cambridge Limited Improvements in or relating to molecular arrays
US9889422B2 (en) 2004-01-07 2018-02-13 Illumina Cambridge Limited Methods of localizing nucleic acids to arrays
EP3175914A1 (en) 2004-01-07 2017-06-07 Illumina Cambridge Limited Improvements in or relating to molecular arrays
US8969258B2 (en) 2004-01-07 2015-03-03 Illumina Cambridge Limited Methods of localizing nucleic acids to arrays
EP2789383A1 (en) 2004-01-07 2014-10-15 Illumina Cambridge Limited Improvements in or relating to molecular arrays
US11654411B2 (en) 2004-01-07 2023-05-23 Illumina Cambridge Limited Methods and compositions of localizing nucleic acids to arrays
WO2005068656A1 (en) * 2004-01-12 2005-07-28 Solexa Limited Nucleic acid characterisation
WO2005078130A1 (en) * 2004-02-10 2005-08-25 Solexa Limited Arrayed polynucleotides
US9944984B2 (en) 2005-06-15 2018-04-17 Complete Genomics, Inc. High density DNA array
US12331354B2 (en) 2005-06-15 2025-06-17 Complete Genomics, Inc. DNA array
US10351909B2 (en) 2005-06-15 2019-07-16 Complete Genomics, Inc. DNA sequencing from high density DNA arrays using asynchronous reactions
EP2620510B1 (en) 2005-06-15 2016-10-12 Complete Genomics Inc. Single molecule arrays for genetic and chemical analysis
EP1907583B2 (en) 2005-06-15 2019-10-23 Complete Genomics Inc. Single molecule arrays for genetic and chemical analysis
EP1907583B1 (en) 2005-06-15 2016-10-05 Complete Genomics Inc. Single molecule arrays for genetic and chemical analysis
US12331353B2 (en) 2005-06-15 2025-06-17 Complete Genomics, Inc. DNA concatemers on a surface
US9637786B2 (en) 2005-07-20 2017-05-02 Illumina Cambridge Limited Method for sequencing a polynucleotide template
US11781184B2 (en) 2005-07-20 2023-10-10 Illumina Cambridge Limited Method for sequencing a polynucleotide template
US9085802B2 (en) 2005-07-20 2015-07-21 Illumina Cambridge Limited Preparation of templates for nucleic acid sequencing
US8247177B2 (en) 2005-07-20 2012-08-21 Illumina Cambridge Limited Method for sequencing a polynucleotide template
US10793904B2 (en) 2005-07-20 2020-10-06 Illumina Cambridge Limited Methods for sequencing a polynucleotide template
US9297043B2 (en) 2005-07-20 2016-03-29 Illumina Cambridge Limited Method for sequencing a polynucleotide template
US9999866B2 (en) 2005-07-20 2018-06-19 Illumina Cambridge Limited Preparation of templates for nucleic acid sequencing
US11542553B2 (en) 2005-07-20 2023-01-03 Illumina Cambridge Limited Methods for sequencing a polynucleotide template
US10563256B2 (en) 2005-07-20 2020-02-18 Illumina Cambridge Limited Method for sequencing a polynucleotide template
US9017945B2 (en) 2005-07-20 2015-04-28 Illumina Cambridge Limited Method for sequencing a polynucleotide template
EP2298930A1 (en) 2005-07-20 2011-03-23 Illumina Cambridge Limited Preparation of templates for nucleic acid sequencing
EP2189540A1 (en) 2005-07-20 2010-05-26 Illumina Cambridge Limited Methods for sequencing a polynucleotide template
US10710046B2 (en) 2005-07-20 2020-07-14 Illumina Cambridge Limited Preparation of templates for nucleic acid sequencing
US8715966B2 (en) 2005-07-20 2014-05-06 Illumina Cambridge Limited Preparation of templates for nucleic acid sequencing
EP2298930B2 (en) 2005-07-20 2022-06-29 Illumina Cambridge Limited Preparation of templates for nucleic acid sequencing
US9498763B2 (en) 2005-07-20 2016-11-22 Illumina Cambridge Limited Preparation of templates for nucleic acid sequencing
US8017335B2 (en) 2005-07-20 2011-09-13 Illumina Cambridge Limited Method for sequencing a polynucleotide template
US9765391B2 (en) 2005-07-20 2017-09-19 Illumina Cambridge Limited Methods for sequencing a polynucleotide template
US11111543B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US11111544B2 (en) 2005-07-29 2021-09-07 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US12065703B2 (en) 2005-07-29 2024-08-20 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US12553087B2 (en) 2005-07-29 2026-02-17 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US12571047B2 (en) 2005-07-29 2026-03-10 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US12509728B2 (en) 2005-07-29 2025-12-30 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US7939258B2 (en) 2005-09-07 2011-05-10 Nugen Technologies, Inc. Nucleic acid amplification procedure using RNA and DNA composite primers
US8852867B2 (en) 2005-09-07 2014-10-07 Nugen Technologies, Inc. Nucleic acid amplification procedure using RNA and DNA composite primers
US11142789B2 (en) 2005-11-01 2021-10-12 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US8563478B2 (en) 2005-11-01 2013-10-22 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
EP2423325A1 (en) 2005-11-01 2012-02-29 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
EP3564394A1 (en) 2005-11-01 2019-11-06 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US7741463B2 (en) 2005-11-01 2010-06-22 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US12071711B2 (en) 2005-11-01 2024-08-27 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
EP4249602A2 (en) 2005-11-01 2023-09-27 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US9376678B2 (en) 2005-11-01 2016-06-28 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US10253359B2 (en) 2005-11-01 2019-04-09 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US8168388B2 (en) 2005-11-25 2012-05-01 Illumina Cambridge Ltd Preparation of nucleic acid templates for solid phase amplification
EP1957668B1 (en) 2005-11-25 2015-04-08 Illumina Cambridge Limited Preparation of nucleic acid templates for solid phase amplification
WO2007060456A1 (en) 2005-11-25 2007-05-31 Solexa Limited Preparation of nucleic acid templates for solid phase amplification
EP2918686A1 (en) 2005-11-25 2015-09-16 Illumina Cambridge Limited Preparation of nucleic acid templates for solid phase amplification
US11306359B2 (en) 2005-11-26 2022-04-19 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US12571043B2 (en) 2005-11-26 2026-03-10 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US9994896B2 (en) 2006-02-08 2018-06-12 Illumina Cambridge Limited Method for sequencing a polynucelotide template
US8945835B2 (en) 2006-02-08 2015-02-03 Illumina Cambridge Limited Method for sequencing a polynucleotide template
US8192930B2 (en) 2006-02-08 2012-06-05 Illumina Cambridge Limited Method for sequencing a polynucleotide template
US10876158B2 (en) 2006-02-08 2020-12-29 Illumina Cambridge Limited Method for sequencing a polynucleotide template
EP3373174A1 (en) 2006-03-31 2018-09-12 Illumina, Inc. Systems and devices for sequence by synthesis analysis
WO2007123744A2 (en) 2006-03-31 2007-11-01 Solexa, Inc. Systems and devices for sequence by synthesis analysis
EP3722409A1 (en) 2006-03-31 2020-10-14 Illumina, Inc. Systems and devices for sequence by synthesis analysis
EP4105644A2 (en) 2006-03-31 2022-12-21 Illumina, Inc. Systems and devices for sequence by synthesis analysis
US8921073B2 (en) 2006-06-23 2014-12-30 Illumina, Inc. Devices and systems for creation of DNA cluster arrays
US9415368B2 (en) 2006-06-23 2016-08-16 Illumina, Inc. Devices and systems for creation of DNA cluster arrays
US8765381B2 (en) 2006-10-06 2014-07-01 Illumina Cambridge Limited Method for pairwise sequencing of target polynucleotides
US8105784B2 (en) 2006-10-06 2012-01-31 Illumina Cambridge Limited Method for pairwise sequencing of target polynucleotides
US9267173B2 (en) 2006-10-06 2016-02-23 Illumina Cambridge Limited Method for pairwise sequencing of target polynucleotides
US8431348B2 (en) 2006-10-06 2013-04-30 Illumina Cambridge Limited Method for pairwise sequencing of target polynucleotides
US7754429B2 (en) 2006-10-06 2010-07-13 Illumina Cambridge Limited Method for pair-wise sequencing a plurity of target polynucleotides
US10221452B2 (en) 2006-10-06 2019-03-05 Illumina Cambridge Limited Method for pairwise sequencing of target polynucleotides
US7960120B2 (en) 2006-10-06 2011-06-14 Illumina Cambridge Ltd. Method for pair-wise sequencing a plurality of double stranded target polynucleotides
US8236505B2 (en) 2006-10-06 2012-08-07 Illumina Cambridge Limited Method for pairwise sequencing of target polynucleotides
EP3670672A1 (en) 2006-10-06 2020-06-24 Illumina Cambridge Limited Method for sequencing a polynucleotide template
US9587273B2 (en) 2006-10-10 2017-03-07 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US8916350B2 (en) 2006-10-10 2014-12-23 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US9340781B2 (en) 2006-10-10 2016-05-17 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US9139826B2 (en) 2006-10-10 2015-09-22 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US10538759B2 (en) 2006-10-10 2020-01-21 Illumina, Inc. Compounds and method for representational selection of nucleic acids from complex mixtures using hybridization
US8568979B2 (en) 2006-10-10 2013-10-29 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US12559797B2 (en) 2006-12-01 2026-02-24 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US9528151B2 (en) 2006-12-01 2016-12-27 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US11098353B2 (en) 2006-12-01 2021-08-24 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US11939631B2 (en) 2006-12-01 2024-03-26 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US12590330B2 (en) 2007-02-02 2026-03-31 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple polynucleotide templates
US9512478B2 (en) 2007-02-02 2016-12-06 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple polynucleotide templates
US11634768B2 (en) 2007-02-02 2023-04-25 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple polynucleotide templates
US10988806B2 (en) 2007-02-02 2021-04-27 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple polynucleotide templates
US10457985B2 (en) 2007-02-02 2019-10-29 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple polynucleotide templates
US11940413B2 (en) 2007-02-05 2024-03-26 IsoPlexis Corporation Methods and devices for sequencing nucleic acids in smaller batches
US10954554B2 (en) 2007-02-07 2021-03-23 Illumina Cambridge Limited Preparation of templates for methylation analysis
US11827927B2 (en) 2007-02-07 2023-11-28 Illumina Cambridge Limited Preparation of templates for methylation analysis
US9868982B2 (en) 2007-02-07 2018-01-16 Illumina Cambridge Limited Preparation of templates for methylation analysis
US12385085B2 (en) 2007-02-07 2025-08-12 Illumina Cambridge Limited Preparation of templates for methylation analysis
US8617816B2 (en) 2007-03-16 2013-12-31 454 Life Sciences, A Roche Company System and method for detection of HIV drug resistant variants
EP2201021A4 (en) * 2007-08-29 2012-01-25 Applied Biosystems Llc Alternative nucleic acid sequencing methods
EP2657869A2 (en) 2007-08-29 2013-10-30 Applied Biosystems, LLC Alternative nucleic acid sequencing methods
WO2009034181A3 (en) * 2007-09-14 2009-04-30 Twof Inc Methods for the preparation of dna microarrays with linear high density probes
US10260094B2 (en) 2007-10-19 2019-04-16 The Trustees Of Columbia University In The City Of New York DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US9670539B2 (en) 2007-10-19 2017-06-06 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US9175342B2 (en) 2007-10-19 2015-11-03 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US11208691B2 (en) 2007-10-19 2021-12-28 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US12180544B2 (en) 2007-10-19 2024-12-31 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US12331352B2 (en) 2007-10-19 2025-06-17 The Trustees Of Columbia University In The City Of New York DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US9115163B2 (en) 2007-10-19 2015-08-25 The Trustees Of Columbia University In The City Of New York DNA sequence with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US10144961B2 (en) 2007-10-19 2018-12-04 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US11242561B2 (en) 2007-10-19 2022-02-08 The Trustees Of Columbia University In The City Of New York DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US11214832B2 (en) 2008-01-28 2022-01-04 Complete Genomics, Inc. Methods and compositions for efficient base calling in sequencing reactions
US12227803B2 (en) 2008-01-28 2025-02-18 Complete Genomics, Inc. Methods and compositions for efficient base calling in sequencing reactions
US11098356B2 (en) 2008-01-28 2021-08-24 Complete Genomics, Inc. Methods and compositions for nucleic acid sequencing
US8034568B2 (en) 2008-02-12 2011-10-11 Nugen Technologies, Inc. Isothermal nucleic acid amplification methods and compositions
US11142759B2 (en) 2008-03-10 2021-10-12 Illumina, Inc. Method for selecting and amplifying polynucleotides
US12060554B2 (en) 2008-03-10 2024-08-13 Illumina, Inc. Method for selecting and amplifying polynucleotides
US8999642B2 (en) 2008-03-10 2015-04-07 Illumina, Inc. Methods for selecting and amplifying polynucleotides
US9624489B2 (en) 2008-03-10 2017-04-18 Illumina, Inc. Methods for selecting and amplifying polynucleotides
US10597653B2 (en) 2008-03-10 2020-03-24 Illumina, Inc. Methods for selecting and amplifying polynucleotides
US12227798B2 (en) 2008-03-19 2025-02-18 IsoPlexis Corporation Methods and compositions for incorporating nucleotides
US7846666B2 (en) 2008-03-21 2010-12-07 Nugen Technologies, Inc. Methods of RNA amplification in the presence of DNA
US8143599B2 (en) 2008-05-05 2012-03-27 Illumina, Inc. Compensator for multiple surface imaging
US8586947B1 (en) 2008-05-05 2013-11-19 Illumina, Inc. Compensator for multiple surface imaging
USRE48219E1 (en) 2008-05-05 2020-09-22 Illumina, Inc. Compensator for multiple surface imaging
US8278630B1 (en) 2008-05-05 2012-10-02 Illumina, Inc. Compensator for multiple surface imaging
US8242463B2 (en) 2008-05-05 2012-08-14 Illumina, Inc. Compensator for multiple surface imaging
US8546772B2 (en) 2008-05-05 2013-10-01 Illumina, Inc. Compensator for multiple surface imaging
USRE48561E1 (en) 2008-05-05 2021-05-18 Illumina, Inc. Compensator for multiple surface imaging
USRE49884E1 (en) 2008-05-05 2024-03-26 Illumina, Inc. Compensator for multiple surface imaging
US9365898B2 (en) 2008-05-05 2016-06-14 Illumina, Inc. Compensator for multiple surface imaging
US9068220B2 (en) 2008-05-05 2015-06-30 Illumina, Inc. Compensator for multiple surface imaging
US8071962B1 (en) 2008-05-05 2011-12-06 Illumina, Inc. Compensator for multiple surface imaging
US8039817B2 (en) 2008-05-05 2011-10-18 Illumina, Inc. Compensator for multiple surface imaging
US8698102B2 (en) 2008-05-05 2014-04-15 Illumina, Inc. Compensator for multiple surface imaging
US10577601B2 (en) 2008-09-12 2020-03-03 University Of Washington Error detection in sequence tag directed subassemblies of short sequencing reads
US12152236B2 (en) 2008-09-12 2024-11-26 University Of Washington Sequence tag directed subassembly of short sequencing reads into long sequencing reads
US11505795B2 (en) 2008-09-12 2022-11-22 University Of Washington Error detection in sequence tag directed sequencing reads
US12168231B2 (en) 2008-09-23 2024-12-17 Bio-Rad Laboratories, Inc. Method of analysis
US10258988B2 (en) 2008-09-23 2019-04-16 Bio-Rad Laboratories, Inc. Device for generating droplets
US11612892B2 (en) 2008-09-23 2023-03-28 Bio-Rad Laboratories, Inc. Method of performing droplet-based assays
US9156010B2 (en) 2008-09-23 2015-10-13 Bio-Rad Laboratories, Inc. Droplet-based assay system
US9126160B2 (en) 2008-09-23 2015-09-08 Bio-Rad Laboratories, Inc. System for forming an array of emulsions
US9132394B2 (en) 2008-09-23 2015-09-15 Bio-Rad Laboratories, Inc. System for detection of spaced droplets
US11633739B2 (en) 2008-09-23 2023-04-25 Bio-Rad Laboratories, Inc. Droplet-based assay system
US9248417B2 (en) 2008-09-23 2016-02-02 Bio-Rad Laboratories, Inc. System for droplet-based assays using an array of emulsions
US12090480B2 (en) 2008-09-23 2024-09-17 Bio-Rad Laboratories, Inc. Partition-based method of analysis
US10512910B2 (en) 2008-09-23 2019-12-24 Bio-Rad Laboratories, Inc. Droplet-based analysis method
US9764322B2 (en) 2008-09-23 2017-09-19 Bio-Rad Laboratories, Inc. System for generating droplets with pressure monitoring
US9417190B2 (en) 2008-09-23 2016-08-16 Bio-Rad Laboratories, Inc. Calibrations and controls for droplet-based assays
US9216392B2 (en) 2008-09-23 2015-12-22 Bio-Rad Laboratories, Inc. System for forming an array of emulsions
US12162008B2 (en) 2008-09-23 2024-12-10 Bio-Rad Laboratories, Inc. Partition-based method of analysis
US9623384B2 (en) 2008-09-23 2017-04-18 Bio-Rad Laboratories, Inc. System for transporting emulsions from an array to a detector
US9492797B2 (en) 2008-09-23 2016-11-15 Bio-Rad Laboratories, Inc. System for detection of spaced droplets
US9636682B2 (en) 2008-09-23 2017-05-02 Bio-Rad Laboratories, Inc. System for generating droplets—instruments and cassette
US11130128B2 (en) 2008-09-23 2021-09-28 Bio-Rad Laboratories, Inc. Detection method for a target nucleic acid
US10258989B2 (en) 2008-09-23 2019-04-16 Bio-Rad Laboratories, Inc. Method of making a device for generating droplets
US9649635B2 (en) 2008-09-23 2017-05-16 Bio-Rad Laboratories, Inc. System for generating droplets with push-back to remove oil
US11130134B2 (en) 2008-09-23 2021-09-28 Bio-Rad Laboratories, Inc. Method of performing droplet-based assays
US9243288B2 (en) 2008-09-23 2016-01-26 Bio-Rad Laboratories, Inc. Cartridge with lysis chamber and droplet generator
US10279350B2 (en) 2008-09-23 2019-05-07 Bio-Rad Laboratories, Inc. Method of generating droplets
FR2936246A1 (en) * 2008-09-24 2010-03-26 Haploys New compound comprising a duplicable nucleic acid (amplified fragment), where compound comprises a means of locking of polymerization (loop linkage), useful e.g. in complex for diagnosing the amplification of the nucleic acids
US11866780B2 (en) 2008-10-02 2024-01-09 Illumina Cambridge Limited Nucleic acid sample enrichment for sequencing applications
US8728764B2 (en) 2008-10-02 2014-05-20 Illumina Cambridge Limited Nucleic acid sample enrichment for sequencing applications
US9702002B2 (en) 2008-10-02 2017-07-11 Illumina, Inc. Nucleic acid sample enrichment for sequencing applications
US9284547B2 (en) 2008-11-03 2016-03-15 The Regents Of The University Of California Methods for detecting modification resistant nucleic acids
WO2010062775A2 (en) 2008-11-03 2010-06-03 The Regents Of The University Of California Methods for detecting modification resistant nucleic acids
US9677068B2 (en) 2008-11-03 2017-06-13 The Regents Of The University Of California Methods for detecting modification resistant nucleic acids
US8486865B2 (en) 2008-11-03 2013-07-16 The Regents Of The University Of California Methods for detecting modification resistant nucleic acids
US9365901B2 (en) 2008-11-07 2016-06-14 Adaptive Biotechnologies Corp. Monitoring immunoglobulin heavy chain evolution in B-cell acute lymphoblastic leukemia
US10519511B2 (en) 2008-11-07 2019-12-31 Adaptive Biotechnologies Corporation Monitoring health and disease status using clonotype profiles
US9512487B2 (en) 2008-11-07 2016-12-06 Adaptive Biotechnologies Corp. Monitoring health and disease status using clonotype profiles
US10865453B2 (en) 2008-11-07 2020-12-15 Adaptive Biotechnologies Corporation Monitoring health and disease status using clonotype profiles
US10246752B2 (en) 2008-11-07 2019-04-02 Adaptive Biotechnologies Corp. Methods of monitoring conditions by sequence analysis
US12606870B2 (en) 2008-11-07 2026-04-21 Adaptive Biotechnologies Corporation Methods of monitoring conditions by sequence analysis
US9523129B2 (en) 2008-11-07 2016-12-20 Adaptive Biotechnologies Corp. Sequence analysis of complex amplicons
US10760133B2 (en) 2008-11-07 2020-09-01 Adaptive Biotechnologies Corporation Monitoring health and disease status using clonotype profiles
US11001895B2 (en) 2008-11-07 2021-05-11 Adaptive Biotechnologies Corporation Methods of monitoring conditions by sequence analysis
US10266901B2 (en) 2008-11-07 2019-04-23 Adaptive Biotechnologies Corp. Methods of monitoring conditions by sequence analysis
US12209282B2 (en) 2008-11-07 2025-01-28 Adaptive Biotechnologies Corporation Monitoring health and disease status using clonotype profiles
US10155992B2 (en) 2008-11-07 2018-12-18 Adaptive Biotechnologies Corp. Monitoring health and disease status using clonotype profiles
US11021757B2 (en) 2008-11-07 2021-06-01 Adaptive Biotechnologies Corporation Monitoring health and disease status using clonotype profiles
US9416420B2 (en) 2008-11-07 2016-08-16 Adaptive Biotechnologies Corp. Monitoring health and disease status using clonotype profiles
US9506119B2 (en) 2008-11-07 2016-11-29 Adaptive Biotechnologies Corp. Method of sequence determination using sequence tags
US9347099B2 (en) 2008-11-07 2016-05-24 Adaptive Biotechnologies Corp. Single cell analysis by polymerase cycling assembly
US9528160B2 (en) 2008-11-07 2016-12-27 Adaptive Biotechnolgies Corp. Rare clonotypes and uses thereof
US10323276B2 (en) 2009-01-15 2019-06-18 Adaptive Biotechnologies Corporation Adaptive immunity profiling and methods for generation of monoclonal antibodies
US8986958B2 (en) 2009-03-30 2015-03-24 Life Technologies Corporation Methods for generating target specific probes for solution based capture
US10266883B2 (en) 2009-04-30 2019-04-23 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US12129514B2 (en) 2009-04-30 2024-10-29 Molecular Loop Biosolutions, Llc Methods and compositions for evaluating genetic markers
US11352665B2 (en) 2009-04-30 2022-06-07 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US11499187B2 (en) 2009-04-30 2022-11-15 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US11499188B2 (en) 2009-04-30 2022-11-15 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US10119165B2 (en) 2009-04-30 2018-11-06 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US9783847B2 (en) 2009-04-30 2017-10-10 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US10266884B2 (en) 2009-04-30 2019-04-23 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US11447822B2 (en) 2009-04-30 2022-09-20 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US11840730B1 (en) 2009-04-30 2023-12-12 Molecular Loop Biosciences, Inc. Methods and compositions for evaluating genetic markers
US10501793B2 (en) 2009-04-30 2019-12-10 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US10000800B2 (en) 2009-04-30 2018-06-19 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US11339432B2 (en) 2009-04-30 2022-05-24 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
EP2248914A1 (en) 2009-05-05 2010-11-10 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. The use of class IIB restriction endonucleases in 2nd generation sequencing applications
US10329544B2 (en) 2009-05-13 2019-06-25 Life Technologies Corporation Nucleic acid amplification
US11214793B2 (en) 2009-06-25 2022-01-04 Fred Hutchinson Cancer Research Center Method of measuring adaptive immunity
US11905511B2 (en) 2009-06-25 2024-02-20 Fred Hutchinson Cancer Center Method of measuring adaptive immunity
US9809813B2 (en) 2009-06-25 2017-11-07 Fred Hutchinson Cancer Research Center Method of measuring adaptive immunity
US10036063B2 (en) 2009-07-24 2018-07-31 Illumina, Inc. Method for sequencing a polynucleotide template
EP2669387A1 (en) 2009-08-25 2013-12-04 Illumina, Inc. Methods for selecting and amplifying polynucleotides
EP3133169A1 (en) 2009-08-25 2017-02-22 Illumina, Inc. Methods for selecting and amplifying polynucleotides
EP2470669A4 (en) * 2009-08-25 2013-01-30 Illumina Inc METHODS FOR SELECTING AND AMPLIFYING POLYNUCLEOTIDES
US10166522B2 (en) 2009-09-02 2019-01-01 Bio-Rad Laboratories, Inc. System for mixing fluids by coalescence of multiple emulsions
US10677693B2 (en) 2009-09-02 2020-06-09 Bio-Rad Laboratories, Inc. System for mixing fluids by coalescence of multiple emulsions
US9194861B2 (en) 2009-09-02 2015-11-24 Bio-Rad Laboratories, Inc. Method of mixing fluids by coalescence of multiple emulsions
US8795971B2 (en) 2009-09-15 2014-08-05 Illumina Cambridge Limited Centroid markers for image analysis of high density clusters in complex polynucleotide sequencing
US9758825B2 (en) 2009-09-15 2017-09-12 Illumina Cambridge Limited Centroid markers for image analysis of high density clusters in complex polynucleotide sequencing
WO2011034690A3 (en) * 2009-09-15 2011-06-16 Illumina Cambridge, Ltd. Centroid markers for image analysis of high density clusters in complex polynucleotide sequencing
US8182994B2 (en) 2009-09-15 2012-05-22 Illumina Cambridge Limited Centroid markers for image analysis of high denisty clusters in complex polynucleotide sequencing
US8541172B2 (en) 2009-09-15 2013-09-24 Illumina Cambridge Limited Method for sequencing a polynucelotide template
WO2011071923A2 (en) 2009-12-07 2011-06-16 Illumina, Inc. Multi-sample indexing for multiplex genotyping
US9115401B2 (en) 2010-01-19 2015-08-25 Verinata Health, Inc. Partition defined detection methods
EP3492601A1 (en) 2010-01-19 2019-06-05 Verinata Health, Inc Novel protocol for preparing sequencing libraries
US10586610B2 (en) 2010-01-19 2020-03-10 Verinata Health, Inc. Detecting and classifying copy number variation
US9260745B2 (en) 2010-01-19 2016-02-16 Verinata Health, Inc. Detecting and classifying copy number variation
US11130995B2 (en) 2010-01-19 2021-09-28 Verinata Health, Inc. Simultaneous determination of aneuploidy and fetal fraction
US11875899B2 (en) 2010-01-19 2024-01-16 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
US11884975B2 (en) 2010-01-19 2024-01-30 Verinata Health, Inc. Sequencing methods and compositions for prenatal diagnoses
US10482993B2 (en) 2010-01-19 2019-11-19 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
US9323888B2 (en) 2010-01-19 2016-04-26 Verinata Health, Inc. Detecting and classifying copy number variation
US10662474B2 (en) 2010-01-19 2020-05-26 Verinata Health, Inc. Identification of polymorphic sequences in mixtures of genomic DNA by whole genome sequencing
US10415089B2 (en) 2010-01-19 2019-09-17 Verinata Health, Inc. Detecting and classifying copy number variation
EP3260555A1 (en) 2010-01-19 2017-12-27 Verinata Health, Inc Novel protocol for preparing sequencing libraries
US11286520B2 (en) 2010-01-19 2022-03-29 Verinata Health, Inc. Method for determining copy number variations
US9657342B2 (en) 2010-01-19 2017-05-23 Verinata Health, Inc. Sequencing methods for prenatal diagnoses
US12522869B2 (en) 2010-01-19 2026-01-13 Verinata Health, Inc. Sequencing methods and compositions for prenatal diagnoses
US12139760B2 (en) 2010-01-19 2024-11-12 Verinata Health, Inc. Methods for determining fraction of fetal nucleic acids in maternal samples
US10612096B2 (en) 2010-01-19 2020-04-07 Verinata Health, Inc. Methods for determining fraction of fetal nucleic acids in maternal samples
US10388403B2 (en) 2010-01-19 2019-08-20 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
WO2011090559A1 (en) 2010-01-19 2011-07-28 Verinata Health, Inc. Sequencing methods and compositions for prenatal diagnoses
US11697846B2 (en) 2010-01-19 2023-07-11 Verinata Health, Inc. Detecting and classifying copy number variation
US10941442B2 (en) 2010-01-19 2021-03-09 Verinata Health, Inc. Sequencing methods and compositions for prenatal diagnoses
US12435373B2 (en) 2010-01-19 2025-10-07 Verinata Health, Inc. Identification of polymorphic sequences in mixtures of genomic DNA
WO2011091046A1 (en) 2010-01-19 2011-07-28 Verinata Health, Inc. Identification of polymorphic sequences in mixtures of genomic dna by whole genome sequencing
US9493828B2 (en) 2010-01-19 2016-11-15 Verinata Health, Inc. Methods for determining fraction of fetal nucleic acids in maternal samples
US12553084B2 (en) 2010-01-19 2026-02-17 Verinata Health, Inc. Method for determining copy number variations
EP4074838A1 (en) 2010-01-19 2022-10-19 Verinata Health, Inc. Novel protocol for preparing sequencing libraries
US11952623B2 (en) 2010-01-19 2024-04-09 Verinata Health, Inc. Simultaneous determination of aneuploidy and fetal fraction
US8318430B2 (en) 2010-01-23 2012-11-27 Verinata Health, Inc. Methods of fetal abnormality detection
US10718020B2 (en) 2010-01-23 2020-07-21 Verinata Health, Inc. Methods of fetal abnormality detection
US9493831B2 (en) 2010-01-23 2016-11-15 Verinata Health, Inc. Methods of fetal abnormality detection
US9598725B2 (en) 2010-03-02 2017-03-21 Bio-Rad Laboratories, Inc. Emulsion chemistry for encapsulated droplets
US11866771B2 (en) 2010-03-02 2024-01-09 Bio-Rad Laboratories, Inc. Emulsion chemistry for encapsulated droplets
US11060136B2 (en) 2010-03-02 2021-07-13 Bio-Rad Laboratories, Inc. Emulsion chemistry for encapsulated droplets
US10378048B2 (en) 2010-03-02 2019-08-13 Bio-Rad Laboratories, Inc. Emulsion chemistry for encapsulated droplets
US12103005B2 (en) 2010-03-25 2024-10-01 Bio-Rad Laboratories, Inc. Method of emulsion formation and modification
US9500664B2 (en) 2010-03-25 2016-11-22 Bio-Rad Laboratories, Inc. Droplet generation for droplet-based assays
US9393560B2 (en) 2010-03-25 2016-07-19 Bio-Rad Laboratories, Inc. Droplet transport system for detection
US10099219B2 (en) 2010-03-25 2018-10-16 Bio-Rad Laboratories, Inc. Device for generating droplets
US10744506B2 (en) 2010-03-25 2020-08-18 Bio-Rad Laboratories, Inc. Device for generating droplets
US10272432B2 (en) 2010-03-25 2019-04-30 Bio-Rad Laboratories, Inc. Device for generating droplets
US11479810B1 (en) 2010-04-05 2022-10-25 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10472669B2 (en) 2010-04-05 2019-11-12 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11384386B2 (en) 2010-04-05 2022-07-12 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10996219B2 (en) 2010-04-05 2021-05-04 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11732292B2 (en) 2010-04-05 2023-08-22 Prognosys Biosciences, Inc. Spatially encoded biological assays correlating target nucleic acid to tissue section location
US11733238B2 (en) 2010-04-05 2023-08-22 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10662467B2 (en) 2010-04-05 2020-05-26 Prognosys Biosciences, Inc. Spatially encoded biological assays
US12297487B2 (en) 2010-04-05 2025-05-13 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10662468B2 (en) 2010-04-05 2020-05-26 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11001878B1 (en) 2010-04-05 2021-05-11 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10962532B2 (en) 2010-04-05 2021-03-30 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11001879B1 (en) 2010-04-05 2021-05-11 Prognosys Biosciences, Inc. Spatially encoded biological assays
US12297488B2 (en) 2010-04-05 2025-05-13 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10494667B2 (en) 2010-04-05 2019-12-03 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11365442B2 (en) 2010-04-05 2022-06-21 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11067567B2 (en) 2010-04-05 2021-07-20 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11313856B2 (en) 2010-04-05 2022-04-26 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11542543B2 (en) 2010-04-05 2023-01-03 Prognosys Biosciences, Inc. System for analyzing targets of a tissue section
US10961566B2 (en) 2010-04-05 2021-03-30 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11371086B2 (en) 2010-04-05 2022-06-28 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11866770B2 (en) 2010-04-05 2024-01-09 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10308982B2 (en) 2010-04-05 2019-06-04 Prognosys Biosciences, Inc. Spatially encoded biological assays
US12234505B2 (en) 2010-04-05 2025-02-25 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10480022B2 (en) 2010-04-05 2019-11-19 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11293917B2 (en) 2010-04-05 2022-04-05 Prognosys Biosciences, Inc. Systems for analyzing target biological molecules via sample imaging and delivery of probes to substrate wells
US12391979B2 (en) 2010-04-05 2025-08-19 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11008607B2 (en) 2010-04-05 2021-05-18 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11156603B2 (en) 2010-04-05 2021-10-26 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10619196B1 (en) 2010-04-05 2020-04-14 Prognosys Biosciences, Inc. Spatially encoded biological assays
US12391980B2 (en) 2010-04-05 2025-08-19 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11519022B2 (en) 2010-04-05 2022-12-06 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10612079B2 (en) 2010-04-05 2020-04-07 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11549138B2 (en) 2010-04-05 2023-01-10 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11767550B2 (en) 2010-04-05 2023-09-26 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11761030B2 (en) 2010-04-05 2023-09-19 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10983113B2 (en) 2010-04-05 2021-04-20 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10914730B2 (en) 2010-04-05 2021-02-09 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10982268B2 (en) 2010-04-05 2021-04-20 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11208684B2 (en) 2010-04-05 2021-12-28 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11634756B2 (en) 2010-04-05 2023-04-25 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11401545B2 (en) 2010-04-05 2022-08-02 Prognosys Biosciences, Inc. Spatially encoded biological assays
US10787701B2 (en) 2010-04-05 2020-09-29 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11560587B2 (en) 2010-04-05 2023-01-24 Prognosys Biosciences, Inc. Spatially encoded biological assays
US11326208B2 (en) 2010-05-18 2022-05-10 Natera, Inc. Methods for nested PCR amplification of cell-free DNA
US11306357B2 (en) 2010-05-18 2022-04-19 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11939634B2 (en) 2010-05-18 2024-03-26 Natera, Inc. Methods for simultaneous amplification of target loci
US11332785B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11339429B2 (en) 2010-05-18 2022-05-24 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11482300B2 (en) 2010-05-18 2022-10-25 Natera, Inc. Methods for preparing a DNA fraction from a biological sample for analyzing genotypes of cell-free DNA
US12553086B2 (en) 2010-05-18 2026-02-17 Natera, Inc. Methods for simultaneous amplification of target loci
US12221653B2 (en) 2010-05-18 2025-02-11 Natera, Inc. Methods for simultaneous amplification of target loci
US12110552B2 (en) 2010-05-18 2024-10-08 Natera, Inc. Methods for simultaneous amplification of target loci
US11332793B2 (en) 2010-05-18 2022-05-17 Natera, Inc. Methods for simultaneous amplification of target loci
US11286530B2 (en) 2010-05-18 2022-03-29 Natera, Inc. Methods for simultaneous amplification of target loci
US11525162B2 (en) 2010-05-18 2022-12-13 Natera, Inc. Methods for simultaneous amplification of target loci
US11408031B2 (en) 2010-05-18 2022-08-09 Natera, Inc. Methods for non-invasive prenatal paternity testing
US12553083B2 (en) 2010-05-18 2026-02-17 Natera, Inc. Methods for enriching and sequencing nucleic acids for non-invasive cancer testing
US12152275B2 (en) 2010-05-18 2024-11-26 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11111545B2 (en) 2010-05-18 2021-09-07 Natera, Inc. Methods for simultaneous amplification of target loci
US12020778B2 (en) 2010-05-18 2024-06-25 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11322224B2 (en) 2010-05-18 2022-05-03 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11312996B2 (en) 2010-05-18 2022-04-26 Natera, Inc. Methods for simultaneous amplification of target loci
US12410476B2 (en) 2010-05-18 2025-09-09 Natera, Inc. Methods for simultaneous amplification of target loci
US11746376B2 (en) 2010-05-18 2023-09-05 Natera, Inc. Methods for amplification of cell-free DNA using ligated adaptors and universal and inner target-specific primers for multiplexed nested PCR
US11519035B2 (en) 2010-05-18 2022-12-06 Natera, Inc. Methods for simultaneous amplification of target loci
US12270073B2 (en) 2010-05-18 2025-04-08 Natera, Inc. Methods for preparing a biological sample obtained from an individual for use in a genetic testing assay
EP3205730A1 (en) 2010-08-27 2017-08-16 Illumina Cambridge Limited Methods for paired-end sequencing of polynucleotides
US11279975B2 (en) 2010-08-27 2022-03-22 Illumina Cambridge Limited Methods for sequencing polynucleotides
WO2012025250A1 (en) 2010-08-27 2012-03-01 Illumina Cambridge Ltd. Methods for paired - end sequencing of polynucleotides
US9029103B2 (en) 2010-08-27 2015-05-12 Illumina Cambridge Limited Methods for sequencing polynucleotides
US10329613B2 (en) 2010-08-27 2019-06-25 Illumina Cambridge Limited Methods for sequencing polynucleotides
US12319962B2 (en) 2010-08-27 2025-06-03 Illumina Cambridge Limited Methods for sequencing polynucleotides
WO2012050920A1 (en) 2010-09-29 2012-04-19 Illumina, Inc. Compositions and methods for sequencing nucleic acids
US9902950B2 (en) 2010-10-08 2018-02-27 President And Fellows Of Harvard College High-throughput single cell barcoding
GB2512213B (en) * 2010-10-08 2015-02-11 Harvard College High-throughput single cell barcoding
GB2497912B (en) * 2010-10-08 2014-06-04 Harvard College High-throughput single cell barcoding
US11396651B2 (en) 2010-10-08 2022-07-26 President And Fellows Of Harvard College High-throughput single cell barcoding
GB2512213A (en) * 2010-10-08 2014-09-24 Harvard College High-throughput single cell barcoding
US10246703B2 (en) 2010-10-08 2019-04-02 President And Fellows Of Harvard College High-throughput single cell barcoding
US10752895B2 (en) 2010-10-08 2020-08-25 President And Fellows Of Harvard College High-throughput single cell barcoding
WO2012055929A1 (en) 2010-10-26 2012-05-03 Illumina, Inc. Sequencing methods
US11332774B2 (en) 2010-10-26 2022-05-17 Verinata Health, Inc. Method for determining copy number variations
US9089844B2 (en) 2010-11-01 2015-07-28 Bio-Rad Laboratories, Inc. System for forming emulsions
US10233443B2 (en) 2010-11-03 2019-03-19 Illumina, Inc. Reducing adapter dimer formation
WO2012061036A1 (en) 2010-11-03 2012-05-10 Illumina, Inc. Reducing adapter dimer formation
US9506055B2 (en) 2010-11-03 2016-11-29 Illumina, Inc. Reducing adapter dimer formation
US8575071B2 (en) 2010-11-03 2013-11-05 Illumina, Inc. Reducing adapter dimer formation
US9284604B2 (en) 2010-11-22 2016-03-15 The Regents Of The University Of California Methods of identifying a cellular nascent RNA transcript
US10233488B2 (en) 2010-12-17 2019-03-19 Life Technologies Corporation Clonal amplification of nucleic acid on solid surface with template walking
EP3564392A1 (en) * 2010-12-17 2019-11-06 Life Technologies Corporation Methods for nucleic acid amplification
US9371557B2 (en) 2010-12-17 2016-06-21 Life Technologies Corporation Nucleic acid amplification
US11578360B2 (en) 2010-12-17 2023-02-14 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US9476080B2 (en) 2010-12-17 2016-10-25 Life Technologies Corporation Clonal amplification of nucleic acid on solid surface with template walking
US10113195B2 (en) 2010-12-17 2018-10-30 Life Technologies Corporation Nucleic acid amplification
US10858695B2 (en) 2010-12-17 2020-12-08 Life Technologies Corporation Nucleic acid amplification
US10913976B2 (en) 2010-12-17 2021-02-09 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US11001815B2 (en) 2010-12-17 2021-05-11 Life Technologies Corporation Nucleic acid amplification
US9309557B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Nucleic acid amplification
US9334531B2 (en) 2010-12-17 2016-05-10 Life Technologies Corporation Nucleic acid amplification
US12351865B2 (en) 2010-12-17 2025-07-08 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US9309566B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US11725195B2 (en) 2010-12-17 2023-08-15 Life Technologies Corporation Nucleic acid amplification
US9309558B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Nucleic acid amplification
US11041852B2 (en) 2010-12-23 2021-06-22 Molecular Loop Biosciences, Inc. Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction
US11768200B2 (en) 2010-12-23 2023-09-26 Molecular Loop Biosciences, Inc. Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction
US11041851B2 (en) 2010-12-23 2021-06-22 Molecular Loop Biosciences, Inc. Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction
WO2012096703A1 (en) 2011-01-10 2012-07-19 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
US12151241B2 (en) 2011-01-10 2024-11-26 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
US11117130B2 (en) 2011-01-10 2021-09-14 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
EP4691642A2 (en) 2011-01-10 2026-02-11 Illumina Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
US12558687B2 (en) 2011-01-10 2026-02-24 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
US8951781B2 (en) 2011-01-10 2015-02-10 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
US12502669B2 (en) 2011-01-10 2025-12-23 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
EP3714978A1 (en) 2011-01-10 2020-09-30 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
US10220386B2 (en) 2011-01-10 2019-03-05 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
US11697116B2 (en) 2011-01-10 2023-07-11 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
US11559805B2 (en) 2011-01-10 2023-01-24 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
US11938479B2 (en) 2011-01-10 2024-03-26 Illumina, Inc. Systems, methods, and apparatuses to image a sample for biological or chemical analysis
EP3378564A1 (en) 2011-01-10 2018-09-26 Illumina Inc. Fluidic device holder
US11999951B2 (en) 2011-02-02 2024-06-04 University Of Washington Through Its Center For Commercialization Massively parallel contiguity mapping
US10457936B2 (en) 2011-02-02 2019-10-29 University Of Washington Through Its Center For Commercialization Massively parallel contiguity mapping
US11299730B2 (en) 2011-02-02 2022-04-12 University Of Washington Through Its Center For Commercialization Massively parallel contiguity mapping
US20130344540A1 (en) * 2011-02-03 2013-12-26 Mark T. Reed Methods for minimizing sequence specific bias
US11993772B2 (en) 2011-02-10 2024-05-28 Illumina, Inc. Linking sequence reads using paired code tags
US10246705B2 (en) 2011-02-10 2019-04-02 Ilumina, Inc. Linking sequence reads using paired code tags
US12097495B2 (en) 2011-02-18 2024-09-24 Bio-Rad Laboratories, Inc. Methods and compositions for detecting genetic material
US9222128B2 (en) 2011-03-18 2015-12-29 Bio-Rad Laboratories, Inc. Multiplexed digital assays with combinatorial use of signals
US9447453B2 (en) 2011-04-12 2016-09-20 Verinata Health, Inc. Resolving genome fractions using polymorphism counts
US10658070B2 (en) 2011-04-12 2020-05-19 Verinata Health, Inc. Resolving genome fractions using polymorphism counts
US11479809B2 (en) 2011-04-13 2022-10-25 Spatial Transcriptomics Ab Methods of detecting analytes
US11352659B2 (en) 2011-04-13 2022-06-07 Spatial Transcriptomics Ab Methods of detecting analytes
US11795498B2 (en) 2011-04-13 2023-10-24 10X Genomics Sweden Ab Methods of detecting analytes
US11788122B2 (en) 2011-04-13 2023-10-17 10X Genomics Sweden Ab Methods of detecting analytes
US8532936B2 (en) 2011-04-14 2013-09-10 Verinata Health, Inc. Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies
US12367947B2 (en) 2011-04-14 2025-07-22 Verinata Health, Inc. Normalizing chromosomes for the determination and verification of common and rare chromosomal aneuploidies
US9411937B2 (en) 2011-04-15 2016-08-09 Verinata Health, Inc. Detecting and classifying copy number variation
US9885034B2 (en) 2011-04-25 2018-02-06 Bio-Rad Laboratories, Inc. Methods and compositions for nucleic acid analysis
US10190115B2 (en) 2011-04-25 2019-01-29 Bio-Rad Laboratories, Inc. Methods and compositions for nucleic acid analysis
US10760073B2 (en) 2011-04-25 2020-09-01 Bio-Rad Laboratories, Inc. Methods and compositions for nucleic acid analysis
US9347059B2 (en) 2011-04-25 2016-05-24 Bio-Rad Laboratories, Inc. Methods and compositions for nucleic acid analysis
US11939573B2 (en) 2011-04-25 2024-03-26 Bio-Rad Laboratories, Inc. Methods and compositions for nucleic acid analysis
US8951939B2 (en) 2011-07-12 2015-02-10 Bio-Rad Laboratories, Inc. Digital assays with multiplexed detection of two or more targets in the same optical channel
US9670540B2 (en) * 2011-07-21 2017-06-06 Cornell University Methods and devices for DNA sequencing and molecular diagnostics
US20150099642A1 (en) * 2011-07-21 2015-04-09 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Methods and devices for dna sequencing and molecular diagnostics
US10385475B2 (en) 2011-09-12 2019-08-20 Adaptive Biotechnologies Corp. Random array sequencing of low-complexity libraries
EP3290528A1 (en) 2011-09-23 2018-03-07 Illumina, Inc. Methods and compositions for nucleic acid sequencing
EP3623481A1 (en) 2011-09-23 2020-03-18 Illumina, Inc. Methods and compositions for nucleic acid sequencing
EP3981886A1 (en) 2011-09-23 2022-04-13 Illumina, Inc. Compositions for nucleic acid sequencing
WO2013044018A1 (en) 2011-09-23 2013-03-28 Illumina, Inc. Methods and compositions for nucleic acid sequencing
WO2013049135A1 (en) 2011-09-26 2013-04-04 Gen-Probe Incorporated Algorithms for sequence determinations
US9228233B2 (en) 2011-10-17 2016-01-05 Good Start Genetics, Inc. Analysis methods
US9822409B2 (en) 2011-10-17 2017-11-21 Good Start Genetics, Inc. Analysis methods
US10370710B2 (en) 2011-10-17 2019-08-06 Good Start Genetics, Inc. Analysis methods
US9206418B2 (en) 2011-10-19 2015-12-08 Nugen Technologies, Inc. Compositions and methods for directional nucleic acid amplification and sequencing
US9279159B2 (en) 2011-10-21 2016-03-08 Adaptive Biotechnologies Corporation Quantification of adaptive immune cell genomes in a complex mixture of cells
US9181590B2 (en) 2011-10-21 2015-11-10 Adaptive Biotechnologies Corporation Quantification of adaptive immune cell genomes in a complex mixture of cells
US11286522B2 (en) 2011-12-01 2022-03-29 Genapsys, Inc. Systems and methods for high efficiency electronic sequencing and detection
US9824179B2 (en) 2011-12-09 2017-11-21 Adaptive Biotechnologies Corp. Diagnosis of lymphoid malignancies and minimal residual disease detection
US9499865B2 (en) 2011-12-13 2016-11-22 Adaptive Biotechnologies Corp. Detection and measurement of tissue-infiltrating lymphocytes
US9951384B2 (en) 2012-01-13 2018-04-24 Data2Bio Genotyping by next-generation sequencing
US10704091B2 (en) 2012-01-13 2020-07-07 Data2Bio Genotyping by next-generation sequencing
US10876108B2 (en) 2012-01-26 2020-12-29 Nugen Technologies, Inc. Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation
US9650628B2 (en) 2012-01-26 2017-05-16 Nugen Technologies, Inc. Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library regeneration
US10036012B2 (en) 2012-01-26 2018-07-31 Nugen Technologies, Inc. Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation
WO2013117595A2 (en) 2012-02-07 2013-08-15 Illumina Cambridge Limited Targeted enrichment and amplification of nucleic acids on a support
EP3363901B1 (en) 2012-02-17 2020-12-30 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
EP3854873A1 (en) 2012-02-17 2021-07-28 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
EP2814959B1 (en) 2012-02-17 2018-01-17 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
US10450606B2 (en) 2012-02-17 2019-10-22 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
US11441180B2 (en) 2012-02-17 2022-09-13 Fred Hutchinson Cancer Center Compositions and methods for accurately identifying mutations
US10011871B2 (en) 2012-02-17 2018-07-03 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
WO2013123442A1 (en) 2012-02-17 2013-08-22 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
EP3363901A1 (en) 2012-02-17 2018-08-22 Fred Hutchinson Cancer Research Center Compositions and methods for accurately identifying mutations
US10077478B2 (en) 2012-03-05 2018-09-18 Adaptive Biotechnologies Corp. Determining paired immune receptor chains from frequency matched subunits
WO2013131962A1 (en) 2012-03-06 2013-09-12 Illumina Cambridge Limited Improved methods of nucleic acid sequencing
EP3037552A1 (en) 2012-03-06 2016-06-29 Illumina Cambridge Limited Improved methods of nucleic acid sequencing
WO2013148970A1 (en) 2012-03-30 2013-10-03 Illumina, Inc. Methods and systems for determining fetal chromosomal abnormalities
US11667965B2 (en) 2012-04-04 2023-06-06 Invitae Corporation Sequence assembly
US10604799B2 (en) 2012-04-04 2020-03-31 Molecular Loop Biosolutions, Llc Sequence assembly
US11155863B2 (en) 2012-04-04 2021-10-26 Invitae Corporation Sequence assembly
US11149308B2 (en) 2012-04-04 2021-10-19 Invitae Corporation Sequence assembly
US9298804B2 (en) 2012-04-09 2016-03-29 Good Start Genetics, Inc. Variant database
US8812422B2 (en) 2012-04-09 2014-08-19 Good Start Genetics, Inc. Variant database
US9399215B2 (en) 2012-04-13 2016-07-26 Bio-Rad Laboratories, Inc. Sample holder with a well having a wicking promoter
US12110537B2 (en) 2012-04-16 2024-10-08 Molecular Loop Biosciences, Inc. Capture reactions
US10227635B2 (en) 2012-04-16 2019-03-12 Molecular Loop Biosolutions, Llc Capture reactions
US9371558B2 (en) 2012-05-08 2016-06-21 Adaptive Biotechnologies Corp. Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions
US9150905B2 (en) 2012-05-08 2015-10-06 Adaptive Biotechnologies Corporation Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions
US10214770B2 (en) 2012-05-08 2019-02-26 Adaptive Biotechnologies Corp. Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions
US10894977B2 (en) 2012-05-08 2021-01-19 Adaptive Biotechnologies Corporation Compositions and methods for measuring and calibrating amplification bias in multiplexed PCR reactions
US9012022B2 (en) 2012-06-08 2015-04-21 Illumina, Inc. Polymer coatings
US9752186B2 (en) 2012-06-08 2017-09-05 Illumina, Inc. Polymer coatings
US10266891B2 (en) 2012-06-08 2019-04-23 Illumina, Inc. Polymer coatings
US12060609B2 (en) 2012-06-08 2024-08-13 Illumina, Inc. Polymer coatings
US11702694B2 (en) 2012-06-08 2023-07-18 Illumina, Inc. Polymer coatings
US10954561B2 (en) 2012-06-08 2021-03-23 Illumina, Inc. Polymer coatings
US9957549B2 (en) 2012-06-18 2018-05-01 Nugen Technologies, Inc. Compositions and methods for negative selection of non-desired nucleic acid sequences
WO2013191775A2 (en) 2012-06-18 2013-12-27 Nugen Technologies, Inc. Compositions and methods for negative selection of non-desired nucleic acid sequences
WO2014008448A1 (en) 2012-07-03 2014-01-09 Sloan Kettering Institute For Cancer Research Quantitative assessment of human t-cell repertoire recovery after allogeneic hematopoietic stem cell transplantation
US11697843B2 (en) 2012-07-09 2023-07-11 Tecan Genomics, Inc. Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
US11028430B2 (en) 2012-07-09 2021-06-08 Nugen Technologies, Inc. Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
EP3243937A1 (en) 2012-07-17 2017-11-15 Counsyl, Inc. System and methods for detecting genetic variation
WO2014013218A1 (en) 2012-07-18 2014-01-23 Illumina Cambridge Limited Methods and systems for determining haplotypes and phasing of haplotypes
US12100478B2 (en) 2012-08-17 2024-09-24 Natera, Inc. Method for non-invasive prenatal testing using parental mosaicism data
US10221461B2 (en) 2012-10-01 2019-03-05 Adaptive Biotechnologies Corp. Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization
US12104211B2 (en) 2012-10-01 2024-10-01 Adaptive Biotechnologies Corporation Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization
US11180813B2 (en) 2012-10-01 2021-11-23 Adaptive Biotechnologies Corporation Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization
USRE50065E1 (en) 2012-10-17 2024-07-30 10X Genomics Sweden Ab Methods and product for optimising localised or spatial detection of gene expression in a tissue sample
US10150996B2 (en) 2012-10-19 2018-12-11 Adaptive Biotechnologies Corp. Quantification of adaptive immune cell genomes in a complex mixture of cells
US9092401B2 (en) 2012-10-31 2015-07-28 Counsyl, Inc. System and methods for detecting genetic variation
KR20220093268A (en) * 2013-01-09 2022-07-05 일루미나 케임브리지 리미티드 Sample preparation on a solid support
US10988760B2 (en) 2013-01-09 2021-04-27 Illumina Cambridge Limited Sample preparation on a solid support
US10041066B2 (en) 2013-01-09 2018-08-07 Illumina Cambridge Limited Sample preparation on a solid support
CN104968805A (en) * 2013-01-09 2015-10-07 伊鲁米纳剑桥有限公司 Sample preparation on solid supports
WO2014108850A2 (en) 2013-01-09 2014-07-17 Yeda Research And Development Co. Ltd. High throughput transcriptome analysis
WO2014108810A3 (en) * 2013-01-09 2014-12-04 Illumina Cambridge Limited Sample preparation on a solid support
US11970695B2 (en) 2013-01-09 2024-04-30 Illumina Cambridge Limited Sample preparation on a solid support
CN104968805B (en) * 2013-01-09 2017-03-15 伊鲁米纳剑桥有限公司 Sample preparation on solid support
US9683230B2 (en) 2013-01-09 2017-06-20 Illumina Cambridge Limited Sample preparation on a solid support
KR102602143B1 (en) 2013-01-09 2023-11-13 일루미나 케임브리지 리미티드 Sample preparation on a solid support
EP3486331A1 (en) * 2013-01-09 2019-05-22 Illumina Cambridge Limited Sample preparation on a solid support
WO2014135223A1 (en) 2013-03-08 2014-09-12 Illumina Cambridge Ltd Rhodamine compounds and their use as fluorescent labels
WO2014135221A1 (en) 2013-03-08 2014-09-12 Illumina Cambridge Ltd Polymethine compounds and their use as fluorescent labels
US12606818B2 (en) 2013-03-13 2026-04-21 Illumina, Inc. Methods and compositions for nucleic acid sequencing
US11319534B2 (en) 2013-03-13 2022-05-03 Illumina, Inc. Methods and compositions for nucleic acid sequencing
US10557133B2 (en) 2013-03-13 2020-02-11 Illumina, Inc. Methods and compositions for nucleic acid sequencing
US9677124B2 (en) 2013-03-14 2017-06-13 Good Start Genetics, Inc. Methods for analyzing nucleic acids
US10202637B2 (en) 2013-03-14 2019-02-12 Molecular Loop Biosolutions, Llc Methods for analyzing nucleic acid
US9115387B2 (en) 2013-03-14 2015-08-25 Good Start Genetics, Inc. Methods for analyzing nucleic acids
US9255265B2 (en) 2013-03-15 2016-02-09 Illumina, Inc. Methods for producing stranded cDNA libraries
US10619206B2 (en) 2013-03-15 2020-04-14 Tecan Genomics Sequential sequencing
US10392614B2 (en) 2013-03-15 2019-08-27 Abvitro Llc Methods of single-cell barcoding and sequencing
US9816088B2 (en) 2013-03-15 2017-11-14 Abvitro Llc Single cell bar-coding for antibody discovery
US10876107B2 (en) 2013-03-15 2020-12-29 Abvitro Llc Single cell bar-coding for antibody discovery
US12129462B2 (en) 2013-03-15 2024-10-29 Abvitro Llc Single cell bar-coding for antibody discovery
US10119134B2 (en) 2013-03-15 2018-11-06 Abvitro Llc Single cell bar-coding for antibody discovery
WO2014150435A1 (en) 2013-03-15 2014-09-25 Illumina, Inc. METHODS FOR PRODUCING STRANDED cDNA LIBRARIES
US10760123B2 (en) 2013-03-15 2020-09-01 Nugen Technologies, Inc. Sequential sequencing
US11118176B2 (en) 2013-03-15 2021-09-14 Abvitro Llc Single cell bar-coding for antibody discovery
US10047359B2 (en) 2013-03-15 2018-08-14 Illumina, Inc. Methods for producing stranded cDNA libraries
US9822408B2 (en) 2013-03-15 2017-11-21 Nugen Technologies, Inc. Sequential sequencing
US9535920B2 (en) 2013-06-03 2017-01-03 Good Start Genetics, Inc. Methods and systems for storing sequence read data
US10706017B2 (en) 2013-06-03 2020-07-07 Good Start Genetics, Inc. Methods and systems for storing sequence read data
US11286515B2 (en) 2013-06-25 2022-03-29 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US11618918B2 (en) 2013-06-25 2023-04-04 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US11753674B2 (en) 2013-06-25 2023-09-12 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US10774372B2 (en) 2013-06-25 2020-09-15 Prognosy s Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US10927403B2 (en) 2013-06-25 2021-02-23 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US11046996B1 (en) 2013-06-25 2021-06-29 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US11821024B2 (en) 2013-06-25 2023-11-21 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US11359228B2 (en) 2013-06-25 2022-06-14 Prognosys Biosciences, Inc. Methods and systems for determining spatial patterns of biological targets in a sample
US9708657B2 (en) 2013-07-01 2017-07-18 Adaptive Biotechnologies Corp. Method for generating clonotype profiles using sequence tags
US10526650B2 (en) 2013-07-01 2020-01-07 Adaptive Biotechnologies Corporation Method for genotyping clonotype profiles using sequence tags
US10077473B2 (en) 2013-07-01 2018-09-18 Adaptive Biotechnologies Corp. Method for genotyping clonotype profiles using sequence tags
US10392670B2 (en) 2013-07-25 2019-08-27 Dch Molecular Diagnostics, Inc. Methods and compositions for detecting bacterial contamination
WO2015013465A2 (en) 2013-07-25 2015-01-29 Dch Molecular Diagnostics, Inc. Methods and compositions for detecting bacterial contamination
US11274351B2 (en) 2013-07-25 2022-03-15 Dch Molecular Diagnostics, Inc. Methods and compositions for detecting bacterial contamination
US12303888B2 (en) 2013-09-27 2025-05-20 Illumina, Inc. Method to produce chemical pattern in micro-fluidic structure
US11298697B2 (en) 2013-09-27 2022-04-12 Illumina, Inc. Method to produce chemical pattern in micro-fluidic structure
US10486153B2 (en) 2013-09-27 2019-11-26 Illumina, Inc. Method to produce chemical pattern in micro-fluidic structure
US12077822B2 (en) 2013-10-18 2024-09-03 Molecular Loop Biosciences, Inc. Methods for determining carrier status
US11041203B2 (en) 2013-10-18 2021-06-22 Molecular Loop Biosolutions, Inc. Methods for assessing a genomic region of a subject
US10851414B2 (en) 2013-10-18 2020-12-01 Good Start Genetics, Inc. Methods for determining carrier status
US10570448B2 (en) 2013-11-13 2020-02-25 Tecan Genomics Compositions and methods for identification of a duplicate sequencing read
US11725241B2 (en) 2013-11-13 2023-08-15 Tecan Genomics, Inc. Compositions and methods for identification of a duplicate sequencing read
US11098357B2 (en) 2013-11-13 2021-08-24 Tecan Genomics, Inc. Compositions and methods for identification of a duplicate sequencing read
US10597715B2 (en) 2013-12-05 2020-03-24 Centrillion Technology Holdings Methods for sequencing nucleic acids
US10391467B2 (en) 2013-12-05 2019-08-27 Centrillion Technology Holdings Corporation Fabrication of patterned arrays
US10385335B2 (en) * 2013-12-05 2019-08-20 Centrillion Technology Holdings Corporation Modified surfaces
US12234512B2 (en) 2013-12-11 2025-02-25 Accuragen Holdings Limited Compositions and methods for detecting rare sequence variants
US11286519B2 (en) 2013-12-11 2022-03-29 Accuragen Holdings Limited Methods and compositions for enrichment of amplification products
US11859246B2 (en) 2013-12-11 2024-01-02 Accuragen Holdings Limited Methods and compositions for enrichment of amplification products
US10767222B2 (en) 2013-12-11 2020-09-08 Accuragen Holdings Limited Compositions and methods for detecting rare sequence variants
EP3495506A1 (en) 2013-12-11 2019-06-12 AccuraGen Holdings Limited Methods for detecting rare sequence variants
US11597973B2 (en) 2013-12-11 2023-03-07 Accuragen Holdings Limited Compositions and methods for detecting rare sequence variants
US11149310B2 (en) 2013-12-20 2021-10-19 Illumina, Inc. Preserving genomic connectivity information in fragmented genomic DNA samples
US12584171B2 (en) 2013-12-20 2026-03-24 Illumina, Inc. Preserving genomic connectivity information in fragmented genomic DNA samples
US10246746B2 (en) 2013-12-20 2019-04-02 Illumina, Inc. Preserving genomic connectivity information in fragmented genomic DNA samples
WO2015103225A1 (en) 2013-12-31 2015-07-09 Illumina, Inc. Addressable flow cell using patterned electrodes
US10537889B2 (en) 2013-12-31 2020-01-21 Illumina, Inc. Addressable flow cell using patterned electrodes
AU2014377537B2 (en) * 2014-01-16 2021-02-25 Illumina, Inc. Amplicon preparation and sequencing on solid supports
US10865444B2 (en) 2014-01-16 2020-12-15 Illumina, Inc. Amplicon preparation and sequencing on solid supports
US9926598B2 (en) 2014-01-16 2018-03-27 Illumina, Inc. Amplicon preparation and sequencing on solid supports
WO2015108663A1 (en) 2014-01-16 2015-07-23 Illumina, Inc. Amplicon preparation and sequencing on solid supports
US9745614B2 (en) 2014-02-28 2017-08-29 Nugen Technologies, Inc. Reduced representation bisulfite sequencing with diversity adaptors
US11248253B2 (en) 2014-03-05 2022-02-15 Adaptive Biotechnologies Corporation Methods using randomer-containing synthetic molecules
EP2921556A1 (en) 2014-03-21 2015-09-23 Lexogen GmbH Copy number preserving RNA analysis method
US11060139B2 (en) 2014-03-28 2021-07-13 Centrillion Technology Holdings Corporation Methods for sequencing nucleic acids
US11261490B2 (en) 2014-04-01 2022-03-01 Adaptive Biotechnologies Corporation Determining antigen-specific T-cells
US10066265B2 (en) 2014-04-01 2018-09-04 Adaptive Biotechnologies Corp. Determining antigen-specific t-cells
US12351872B2 (en) 2014-04-01 2025-07-08 Adaptive Biotechnologies Corporation Determining antigen-specific T-cells
US10435745B2 (en) 2014-04-01 2019-10-08 Adaptive Biotechnologies Corp. Determining antigen-specific T-cells
US12305229B2 (en) 2014-04-21 2025-05-20 Natera, Inc. Methods for simultaneous amplification of target loci
US11414709B2 (en) 2014-04-21 2022-08-16 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11530454B2 (en) 2014-04-21 2022-12-20 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11371100B2 (en) 2014-04-21 2022-06-28 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11486008B2 (en) 2014-04-21 2022-11-01 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11319596B2 (en) 2014-04-21 2022-05-03 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11319595B2 (en) 2014-04-21 2022-05-03 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11408037B2 (en) 2014-04-21 2022-08-09 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US11390916B2 (en) 2014-04-21 2022-07-19 Natera, Inc. Methods for simultaneous amplification of target loci
EP3828167A1 (en) 2014-05-07 2021-06-02 Illumina Cambridge Limited Polymethine compounds and their use as fluorescent labels
US11053548B2 (en) 2014-05-12 2021-07-06 Good Start Genetics, Inc. Methods for detecting aneuploidy
EP3143161B1 (en) * 2014-05-16 2021-04-21 Illumina, Inc. Nucleic acid synthesis techniques
US10858696B2 (en) 2014-06-02 2020-12-08 Illumina Cambridge Limited Methods of reducing density-dependent GC bias in amplification
US12260934B2 (en) 2014-06-05 2025-03-25 Natera, Inc. Systems and methods for detection of aneuploidy
WO2015189637A1 (en) * 2014-06-14 2015-12-17 Illumina Cambridge Limited Methods of increasing sequencing accuracy
CN106795552B (en) * 2014-06-14 2021-01-15 伊卢米纳剑桥有限公司 Method for improving sequencing accuracy
US10604800B2 (en) 2014-06-14 2020-03-31 Illumina Cambridge Limited Methods of increasing sequencing accuracy
CN106795552A (en) * 2014-06-14 2017-05-31 伊卢米纳剑桥有限公司 The method for improving sequencing accuracy
US12371690B2 (en) 2014-06-30 2025-07-29 Illumina, Inc. Methods and compositions using one-sided transposition
US10102337B2 (en) 2014-08-06 2018-10-16 Nugen Technologies, Inc. Digital measurements from targeted sequencing
US12386895B2 (en) 2014-08-15 2025-08-12 Laboratory Corporation Of America Holdings Systems and methods for genetic analysis
US11408024B2 (en) 2014-09-10 2022-08-09 Molecular Loop Biosciences, Inc. Methods for selectively suppressing non-target sequences
US10590483B2 (en) 2014-09-15 2020-03-17 Abvitro Llc High-throughput nucleotide library sequencing
US10429399B2 (en) 2014-09-24 2019-10-01 Good Start Genetics, Inc. Process control for increased robustness of genetic assays
US12570971B2 (en) 2014-10-17 2026-03-10 Illumina Cambridge Limited Contiguity preserving transposition
US11873480B2 (en) 2014-10-17 2024-01-16 Illumina Cambridge Limited Contiguity preserving transposition
US10392663B2 (en) 2014-10-29 2019-08-27 Adaptive Biotechnologies Corp. Highly-multiplexed simultaneous detection of nucleic acids encoding paired adaptive immune receptor heterodimers from a large number of samples
US10246701B2 (en) 2014-11-14 2019-04-02 Adaptive Biotechnologies Corp. Multiplexed digital quantitation of rearranged lymphoid receptors in a complex mixture
US11066705B2 (en) 2014-11-25 2021-07-20 Adaptive Biotechnologies Corporation Characterization of adaptive immune response to vaccination or infection using immune repertoire sequencing
US10066259B2 (en) 2015-01-06 2018-09-04 Good Start Genetics, Inc. Screening for structural variants
US11680284B2 (en) 2015-01-06 2023-06-20 Moledular Loop Biosciences, Inc. Screening for structural variants
US11319588B2 (en) 2015-02-17 2022-05-03 Mgi Tech Co., Ltd. DNA sequencing using controlled strand displacement
US10227647B2 (en) 2015-02-17 2019-03-12 Complete Genomics, Inc. DNA sequencing using controlled strand displacement
US12428682B2 (en) 2015-02-24 2025-09-30 Adaptive Biotechnologies Corporation Methods for diagnosing infectious disease and determining HLA status using immune repertoire sequencing
US11047008B2 (en) 2015-02-24 2021-06-29 Adaptive Biotechnologies Corporation Methods for diagnosing infectious disease and determining HLA status using immune repertoire sequencing
EP3783109A1 (en) * 2015-03-31 2021-02-24 Illumina Cambridge Limited Surface concatamerization of templates
WO2016156845A1 (en) * 2015-03-31 2016-10-06 Illumina Cambridge Limited Surface concatamerization of templates
US12123056B2 (en) 2015-03-31 2024-10-22 Illumina Cambridge Limited Surface concatemerization of templates
CN107532205A (en) * 2015-03-31 2018-01-02 伊卢米纳剑桥有限公司 The surface concatemerization of template
CN107532205B (en) * 2015-03-31 2021-06-08 伊卢米纳剑桥有限公司 Surface concatenation of templates
US11041202B2 (en) 2015-04-01 2021-06-22 Adaptive Biotechnologies Corporation Method of identifying human compatible T cell receptors specific for an antigenic target
US10774374B2 (en) 2015-04-10 2020-09-15 Spatial Transcriptomics AB and Illumina, Inc. Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US11299774B2 (en) 2015-04-10 2022-04-12 Spatial Transcriptomics Ab Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US11162132B2 (en) 2015-04-10 2021-11-02 Spatial Transcriptomics Ab Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US11739372B2 (en) 2015-04-10 2023-08-29 Spatial Transcriptomics Ab Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US11390912B2 (en) 2015-04-10 2022-07-19 Spatial Transcriptomics Ab Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US11613773B2 (en) 2015-04-10 2023-03-28 Spatial Transcriptomics Ab Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US12577617B2 (en) 2015-04-28 2026-03-17 Illumina, Inc. Error suppression in sequenced DNA fragments using redundant reads with unique molecular indices (UMIS)
US11866777B2 (en) 2015-04-28 2024-01-09 Illumina, Inc. Error suppression in sequenced DNA fragments using redundant reads with unique molecular indices (UMIS)
US10844428B2 (en) 2015-04-28 2020-11-24 Illumina, Inc. Error suppression in sequenced DNA fragments using redundant reads with unique molecular indices (UMIS)
US11479812B2 (en) 2015-05-11 2022-10-25 Natera, Inc. Methods and compositions for determining ploidy
US11946101B2 (en) 2015-05-11 2024-04-02 Natera, Inc. Methods and compositions for determining ploidy
US10239909B2 (en) 2015-05-22 2019-03-26 Illumina Cambridge Limited Polymethine compounds with long stokes shifts and their use as fluorescent labels
US11274333B2 (en) 2015-05-29 2022-03-15 Molecular Cloning Laboratories (MCLAB) LLC Compositions and methods for preparing sequencing libraries
EP3098324A1 (en) 2015-05-29 2016-11-30 Molecular Cloning Laboratories (MCLAB) LLC Compositions and methods for preparing sequencing libraries
DE102015011970A1 (en) 2015-09-09 2017-03-09 Scienion Ag Dispenser and dispensing method
EP4006150A1 (en) 2015-09-09 2022-06-01 QIAGEN GmbH Polymerase enzyme
DE102015011970B4 (en) * 2015-09-09 2017-04-06 Scienion Ag Dispenser and dispensing method
US10982261B2 (en) 2015-09-25 2021-04-20 Illumina Cambridge Limited Polymethine compounds and their use as fluorescent labels
US11981955B2 (en) 2015-09-25 2024-05-14 Illumina Cambridge Limited Polymethine compounds and their use as fluorescent labels
EP3831825A1 (en) 2015-09-25 2021-06-09 Illumina Cambridge Limited Polymethine compounds and their use as fluorescent labels
US11530439B2 (en) 2015-09-25 2022-12-20 Illumina Cambridge Limited Polymethine compounds and their use as fluorescent labels
EP3663290A1 (en) 2015-09-25 2020-06-10 Illumina Cambridge Limited Polymethine compounds and their use as fluorescent labels
US10752942B2 (en) 2015-10-09 2020-08-25 Accuragen Holdings Limited Methods and compositions for enrichment of amplification products
US11578359B2 (en) 2015-10-09 2023-02-14 Accuragen Holdings Limited Methods and compositions for enrichment of amplification products
WO2017096322A1 (en) 2015-12-03 2017-06-08 Accuragen Holdings Limited Methods and compositions for forming ligation products
US12163184B2 (en) 2015-12-03 2024-12-10 Accuragen Holdings Limited Methods and compositions for forming ligation products
US12146195B2 (en) 2016-04-15 2024-11-19 Natera, Inc. Methods for lung cancer detection
US11015192B2 (en) 2016-04-20 2021-05-25 Qiagen Gmbh Method for generating a stranded RNA library
WO2017182578A1 (en) 2016-04-20 2017-10-26 Qiagen Gmbh Method for generating a stranded rna library
US11427866B2 (en) 2016-05-16 2022-08-30 Accuragen Holdings Limited Method of improved sequencing by strand identification
US12247252B2 (en) 2016-05-16 2025-03-11 Accuragen Holdings Limited Method of improved sequencing by strand identification
CN109790575A (en) * 2016-07-20 2019-05-21 吉纳普赛斯股份有限公司 Systems and methods for nucleic acid sequencing
EP3904514A1 (en) 2016-07-22 2021-11-03 Oregon Health & Science University Single cell whole genome libraries and combinatorial indexing methods of making thereof
WO2018018008A1 (en) 2016-07-22 2018-01-25 Oregon Health & Science University Single cell whole genome libraries and combinatorial indexing methods of making thereof
US11535883B2 (en) 2016-07-22 2022-12-27 Illumina, Inc. Single cell whole genome libraries and combinatorial indexing methods of making thereof
US10724088B2 (en) 2016-08-15 2020-07-28 Accuragen Holdings Limited Compositions and methods for detecting rare sequence variants
US11643683B2 (en) 2016-08-15 2023-05-09 Accuragen Holdings Limited Compositions and methods for detecting rare sequence variants
US10155980B2 (en) 2016-08-15 2018-12-18 Accuragen Holdings Limited Compositions and methods for detecting rare sequence variants
US10428325B1 (en) 2016-09-21 2019-10-01 Adaptive Biotechnologies Corporation Identification of antigen-specific B cell receptors
US10844225B2 (en) 2016-09-30 2020-11-24 Illumina Cambridge Limited Fluorescent dyes and their uses as biomarkers
EP3974425A1 (en) 2016-09-30 2022-03-30 Illumina Cambridge Limited New fluorescent dyes and their uses as biomarkers
WO2018060482A1 (en) 2016-09-30 2018-04-05 Illumina Cambridge Limited New fluorescent dyes and their uses as biomarkers
US11370920B2 (en) 2016-09-30 2022-06-28 Illumina Cambridge Limited Fluorescent dyes and their uses as biomarkers
US10385214B2 (en) 2016-09-30 2019-08-20 Illumina Cambridge Limited Fluorescent dyes and their uses as biomarkers
US11485996B2 (en) 2016-10-04 2022-11-01 Natera, Inc. Methods for characterizing copy number variation using proximity-litigation sequencing
EP3733292A1 (en) 2016-10-21 2020-11-04 GNA Biosolutions GmbH Method for carrying out a polymerase chain reaction and device for carrying out the method
DE102016120124B4 (en) 2016-10-21 2018-07-19 Gna Biosolutions Gmbh A method of conducting a polymerase chain reaction and apparatus for carrying out the method
WO2018073435A1 (en) 2016-10-21 2018-04-26 Gna Biosolutions Gmbh Method for carrying out a polymerase chain reaction and device for carrying out the method
DE102016120124A1 (en) 2016-10-21 2018-04-26 Gna Biosolutions Gmbh A method of conducting a polymerase chain reaction and apparatus for carrying out the method
US12460264B2 (en) 2016-11-02 2025-11-04 Natera, Inc. Method of detecting tumour recurrence
US11530442B2 (en) 2016-12-07 2022-12-20 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US11519028B2 (en) 2016-12-07 2022-12-06 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US12571034B2 (en) 2016-12-07 2026-03-10 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
US10907196B2 (en) 2016-12-22 2021-02-02 Illumina Cambridge Limited Coumarin compounds and their uses as fluorescent labels
US11371078B2 (en) 2016-12-22 2022-06-28 Illumina Cambridge Limited Coumarin compounds and their uses as fluorescent labels
US10214768B2 (en) 2016-12-22 2019-02-26 Illumina Cambridge Limited Coumarin compounds and their uses as fluorescent labels
EP4257596A2 (en) 2016-12-22 2023-10-11 Illumina Cambridge Limited Coumarin compounds and their uses as fluorescent labels
US10533211B2 (en) 2016-12-22 2020-01-14 Illumina Cambridge Limited Coumarin compounds and their uses as fluorescent labels
WO2018114710A1 (en) 2016-12-22 2018-06-28 Illumina Cambridge Limited Coumarin compounds and their uses as fluorescent labels
US10844429B2 (en) 2017-01-18 2020-11-24 Illumina, Inc. Methods and systems for generation and error-correction of unique molecular index sets with heterogeneous molecular lengths
US11761035B2 (en) 2017-01-18 2023-09-19 Illumina, Inc. Methods and systems for generation and error-correction of unique molecular index sets with heterogeneous molecular lengths
US11866741B2 (en) 2017-02-13 2024-01-09 IsoPlexis Corporation Polymerase enzyme from 9°N
WO2018148723A1 (en) 2017-02-13 2018-08-16 Qiagen Waltham Inc. Polymerase enzyme from pyrococcus abyssi
WO2018148726A1 (en) 2017-02-13 2018-08-16 Qiagen Waltham Inc. Polymerase enzyme from phage t4
WO2018148724A1 (en) 2017-02-13 2018-08-16 Qiagen Waltham Inc. Polymerase enzyme from pyrococcus furiosus
WO2018148727A1 (en) 2017-02-13 2018-08-16 Qiagen Waltham Inc. Polymerase enzyme from 9°n
US11584958B2 (en) 2017-03-31 2023-02-21 Grail, Llc Library preparation and use thereof for sequencing based error correction and/or variant identification
US12492430B2 (en) 2017-04-11 2025-12-09 Tecan Genomics, Inc. Library quantitation and qualification
EP3872187A1 (en) 2017-04-23 2021-09-01 Illumina Cambridge Limited Compositions and methods for improving sample identification in indexed nucleic acid libraries
EP3842545A1 (en) 2017-04-23 2021-06-30 Illumina, Inc. Compositions and methods for improving sample identification in indexed nucleic acid libraries
WO2018197950A1 (en) 2017-04-23 2018-11-01 Illumina Cambridge Limited Compositions and methods for improving sample identification in indexed nucleic acid libraries
WO2018200380A1 (en) 2017-04-23 2018-11-01 Illumina, Inc. Compositions and methods for improving sample identification in indexed nucleic acid libraries
WO2018197945A1 (en) 2017-04-23 2018-11-01 Illumina Cambridge Limited Compositions and methods for improving sample identification in indexed nucleic acid libraries
EP3913053A1 (en) 2017-04-23 2021-11-24 Illumina Cambridge Limited Compositions and methods for improving sample identification in indexed nucleic acid libraries
WO2018200386A1 (en) 2017-04-23 2018-11-01 Illumina, Inc. Compositions and methods for improving sample identification in indexed nucleic acid libraries
US11028435B2 (en) 2017-05-01 2021-06-08 Illumina, Inc. Optimal index sequences for multiplex massively parallel sequencing
US11788139B2 (en) 2017-05-01 2023-10-17 Illumina, Inc. Optimal index sequences for multiplex massively parallel sequencing
WO2018204423A1 (en) 2017-05-01 2018-11-08 Illumina, Inc. Optimal index sequences for multiplex massively parallel sequencing
WO2018208699A1 (en) 2017-05-08 2018-11-15 Illumina, Inc. Universal short adapters for indexing of polynucleotide samples
US11028436B2 (en) 2017-05-08 2021-06-08 Illumina, Inc. Universal short adapters for indexing of polynucleotide samples
EP4443436A2 (en) 2017-05-08 2024-10-09 Illumina, Inc. Universal short adapters for indexing of polynucleotide
US11814678B2 (en) 2017-05-08 2023-11-14 Illumina, Inc. Universal short adapters for indexing of polynucleotide samples
WO2018213803A1 (en) 2017-05-19 2018-11-22 Neon Therapeutics, Inc. Immunogenic neoantigen identification
EP4293122A2 (en) 2017-06-07 2023-12-20 Oregon Health & Science University Single cell whole genome libraries for methylation sequencing
WO2018226708A1 (en) 2017-06-07 2018-12-13 Oregon Health & Science University Single cell whole genome libraries for methylation sequencing
EP3981884A1 (en) 2017-06-07 2022-04-13 Oregon Health & Science University Single cell whole genome libraries for methylation sequencing
US11655502B2 (en) 2017-07-12 2023-05-23 Illumina Cambridge Limited Short pendant arm linkers for nucleotides in sequencing applications
US10526648B2 (en) 2017-07-12 2020-01-07 Illumina Cambridge Limited Short pendant arm linkers for nucleotides in sequencing applications
US12071662B2 (en) 2017-07-12 2024-08-27 Illumina Cambridge Limited Short pendant arm linkers for nucleotides in sequencing applications
US11001888B2 (en) 2017-07-12 2021-05-11 Illumina Cambridge Limited Short pendant arm linkers for nucleotides in sequencing applications
WO2019027767A1 (en) 2017-07-31 2019-02-07 Illumina Inc. Sequencing system with multiplexed biological sample aggregation
EP4289967A2 (en) 2017-08-01 2023-12-13 Illumina, Inc. Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells
US11352668B2 (en) 2017-08-01 2022-06-07 Illumina, Inc. Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells
US12428680B2 (en) 2017-08-01 2025-09-30 Illumina, Inc. Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells
US11649498B2 (en) 2017-08-01 2023-05-16 Illumina, Inc. Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells
EP4446437A2 (en) 2017-08-01 2024-10-16 Illumina, Inc. Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells
WO2019028047A1 (en) 2017-08-01 2019-02-07 Illumina, Inc Spatial indexing of genetic material and library preparation using hydrogel beads and flow cells
EP3447153A1 (en) 2017-08-24 2019-02-27 Marian Grendár Method for determining the qualification of a sample for fetal aneuploidy status determination in non-invasive prenatal testing
US11898198B2 (en) 2017-09-15 2024-02-13 Illumina, Inc. Universal short adapters with variable length non-random unique molecular identifiers
WO2019055715A1 (en) 2017-09-15 2019-03-21 Illumina, Inc. Universal short adapters with variable length non-random unique molecular identifiers
US11447818B2 (en) 2017-09-15 2022-09-20 Illumina, Inc. Universal short adapters with variable length non-random unique molecular identifiers
US11858923B2 (en) 2017-10-16 2024-01-02 Illumina Cambridge Limited Secondary amine-substituted coumarin compounds and their uses as fluorescent labels
US11390619B2 (en) 2017-10-16 2022-07-19 Illumina Cambridge Limited Secondary amine-substituted coumarin compounds and their uses as fluorescent labels
US11099202B2 (en) 2017-10-20 2021-08-24 Tecan Genomics, Inc. Reagent delivery system
EP3707723B1 (en) 2017-11-06 2023-10-25 Illumina, Inc. Nucleic acid indexing techniques
US11254980B1 (en) 2017-11-29 2022-02-22 Adaptive Biotechnologies Corporation Methods of profiling targeted polynucleotides while mitigating sequencing depth requirements
US12084720B2 (en) 2017-12-14 2024-09-10 Natera, Inc. Assessing graft suitability for transplantation
US11203782B2 (en) 2018-03-29 2021-12-21 Accuragen Holdings Limited Compositions and methods comprising asymmetric barcoding
US12043867B2 (en) 2018-03-29 2024-07-23 Accuragen Holdings Limited Compositions and methods comprising asymmetric barcoding
WO2019195225A1 (en) 2018-04-02 2019-10-10 Illumina, Inc. Compositions and methods for making controls for sequence-based genetic testing
US11230731B2 (en) 2018-04-02 2022-01-25 Progenity, Inc. Methods, systems, and compositions for counting nucleic acid molecules
US11788121B2 (en) 2018-04-02 2023-10-17 Enumera Molecular, Inc. Methods, systems, and compositions for counting nucleic acid molecules
US12385096B2 (en) 2018-04-14 2025-08-12 Natera, Inc. Methods for cancer detection and monitoring
US12024738B2 (en) 2018-04-14 2024-07-02 Natera, Inc. Methods for cancer detection and monitoring
WO2019222264A1 (en) 2018-05-15 2019-11-21 Illumina, Inc. Compositions and methods for chemical cleavage and deprotection of surface-bound oligonucleotides
EP4306532A2 (en) 2018-05-15 2024-01-17 Illumina, Inc. Chemical cleavage and deprotection
US12084474B2 (en) 2018-05-15 2024-09-10 Illumina, Inc. Compositions and methods for chemical cleavage and deprotection of surface-bound oligonucleotides
WO2019222688A1 (en) 2018-05-17 2019-11-21 Illumina, Inc. High-throughput single-cell sequencing with reduced amplification bias
US11981891B2 (en) 2018-05-17 2024-05-14 Illumina, Inc. High-throughput single-cell sequencing with reduced amplification bias
EP4269618A2 (en) 2018-06-04 2023-11-01 Illumina, Inc. Methods of making high-throughput single-cell transcriptome libraries
US12049665B2 (en) 2018-06-12 2024-07-30 Accuragen Holdings Limited Methods and compositions for forming ligation products
US12083514B2 (en) 2018-07-03 2024-09-10 Illumina, Inc. Interposer with first and second adhesive layers
US12234509B2 (en) 2018-07-03 2025-02-25 Natera, Inc. Methods for detection of donor-derived cell-free DNA
US20210198733A1 (en) 2018-07-03 2021-07-01 Natera, Inc. Methods for detection of donor-derived cell-free dna
WO2020036991A1 (en) 2018-08-15 2020-02-20 Illumina, Inc. Compositions and methods for improving library enrichment
US12435362B2 (en) 2018-08-15 2025-10-07 Illumina, Inc. Compositions and methods for improving library enrichment
US12344892B2 (en) 2018-08-28 2025-07-01 10X Genomics, Inc. Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample
US12378607B2 (en) 2018-08-28 2025-08-05 10X Genomics, Inc. Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample
WO2020114918A1 (en) 2018-12-05 2020-06-11 Illumina Cambridge Limited Methods and compositions for cluster generation by bridge amplification
WO2020120179A1 (en) 2018-12-14 2020-06-18 Illumina Cambridge Limited Decreasing phasing with unlabeled nucleotides during sequencing
WO2020126593A1 (en) 2018-12-17 2020-06-25 Illumina Cambridge Limited Compositions for use in polyunucleotide sequencing
WO2020126595A1 (en) 2018-12-17 2020-06-25 Illumina Cambridge Limited Primer oligonucleotide for sequencing
WO2020126602A1 (en) 2018-12-18 2020-06-25 Illumina Cambridge Limited Methods and compositions for paired end sequencing using a single surface primer
WO2020132103A1 (en) 2018-12-19 2020-06-25 Illumina, Inc. Methods for improving polynucleotide cluster clonality priority
US11827931B2 (en) 2018-12-26 2023-11-28 Illumina Cambridge Limited Methods of preparing growing polynucleotides using nucleotides with 3′ AOM blocking group
US12227802B2 (en) 2018-12-26 2025-02-18 Illumina Cambridge Limited Nucleotides with a 3′ AOM blocking group
WO2020136170A2 (en) 2018-12-26 2020-07-02 Illumina Cambridge Limited Nucleosides and nucleotides with 3'-hydroxy blocking groups
US11293061B2 (en) 2018-12-26 2022-04-05 Illumina Cambridge Limited Sequencing methods using nucleotides with 3′ AOM blocking group
WO2020169635A1 (en) 2019-02-20 2020-08-27 Grendar Marian Method for determining the uncertainty of the degree of placental mosaicism of a sample in non-invasive prenatal screening
WO2020178231A1 (en) 2019-03-01 2020-09-10 Illumina, Inc. Multiplexed fluorescent detection of analytes
NL2023327B1 (en) 2019-03-01 2020-09-17 Illumina Inc Multiplexed fluorescent detection of analytes
WO2020178162A1 (en) 2019-03-01 2020-09-10 Illumina Cambridge Limited Exocyclic amine-substituted coumarin compounds and their uses as fluorescent labels
WO2020178165A1 (en) 2019-03-01 2020-09-10 Illumina Cambridge Limited Tertiary amine substituted coumarin compounds and their uses as fluorescent labels
WO2020180778A1 (en) 2019-03-01 2020-09-10 Illumina, Inc. High-throughput single-nuclei and single-cell libraries and methods of making and of using
US12110546B2 (en) 2019-03-01 2024-10-08 Illumina Cambridge Limited Tertiary amine substituted coumarin compounds and uses as fluorescent labels
US11390753B2 (en) 2019-03-01 2022-07-19 Illumina Cambridge Limited Exocyclic amine substituted coumarin compounds and uses as fluorescent labels
US11884825B2 (en) 2019-03-01 2024-01-30 Illumina Cambridge Limited Exocyclic amine substituted coumarin compounds and uses as fluorescent labels
EP4276769A2 (en) 2019-03-21 2023-11-15 Illumina, Inc. Training data generation for artificial intelligence-based sequencing
NL2023311B1 (en) 2019-03-21 2020-09-28 Illumina Inc Artificial intelligence-based generation of sequencing metadata
WO2020205296A1 (en) 2019-03-21 2020-10-08 Illumina, Inc. Artificial intelligence-based generation of sequencing metadata
NL2023316B1 (en) 2019-03-21 2020-09-28 Illumina Inc Artificial intelligence-based sequencing
NL2023310B1 (en) 2019-03-21 2020-09-28 Illumina Inc Training data generation for artificial intelligence-based sequencing
WO2020191389A1 (en) 2019-03-21 2020-09-24 Illumina, Inc. Training data generation for artificial intelligence-based sequencing
WO2020191391A2 (en) 2019-03-21 2020-09-24 Illumina, Inc. Artificial intelligence-based sequencing
WO2020193765A1 (en) 2019-03-28 2020-10-01 Illumina Cambridge Limited Methods and compositions for nucleic acid sequencing using photoswitchable labels
US11959138B2 (en) 2019-03-28 2024-04-16 Illumina Cambridge Limited Methods and compositions for nucleic acid sequencing using photoswitchable labels
US11421271B2 (en) 2019-03-28 2022-08-23 Illumina Cambridge Limited Methods and compositions for nucleic acid sequencing using photoswitchable labels
US11959129B2 (en) 2019-04-02 2024-04-16 Enumera Molecular, Inc. Methods, systems, and compositions for counting nucleic acid molecules
US11186863B2 (en) 2019-04-02 2021-11-30 Progenity, Inc. Methods, systems, and compositions for counting nucleic acid molecules
US12209278B2 (en) 2019-05-03 2025-01-28 Ultima Genomics, Inc. Accelerated sequencing methods
EP3963104A4 (en) * 2019-05-03 2023-11-08 Ultima Genomics, Inc. FAST-FORWARDING SEQUENCING THROUGH SYNTHESIS METHODS
US12305235B2 (en) 2019-06-06 2025-05-20 Natera, Inc. Methods for detecting immune cell DNA and monitoring immune system
US12031178B2 (en) 2019-11-27 2024-07-09 Illumina Cambridge Limited Cyclooctatetraene containing dyes and compositions
WO2021104845A1 (en) 2019-11-27 2021-06-03 Illumina Cambridge Limited Cyclooctatetraene containing dyes and compositions
US11597969B2 (en) 2019-11-27 2023-03-07 Illumina Cambridge Limited Cyclooctatetraene containing dyes and compositions
US12195796B2 (en) 2019-11-27 2025-01-14 Illumina Cambridge Limited Cyclooctatetraene containing dyes and compositions
WO2021127436A2 (en) 2019-12-19 2021-06-24 Illumina, Inc. High-throughput single-cell libraries and methods of making and of using
WO2021128441A1 (en) 2019-12-23 2021-07-01 Mgi Tech Co.,Ltd. Controlled strand-displacement for paired-end sequencing
US12241890B2 (en) 2019-12-23 2025-03-04 10X Genomics, Inc. Methods for generating barcoded nucleic acid molecules using fixed cells
US12566113B2 (en) 2019-12-23 2026-03-03 10X Genomics, Inc. Reversible fixing reagents and methods of use thereof
EP4524259A2 (en) 2019-12-23 2025-03-19 MGI Tech Co., Ltd. Controlled strand-displacement for paired-end sequencing
US12117439B2 (en) 2019-12-23 2024-10-15 10X Genomics, Inc. Compositions and methods for using fixed biological samples
EP4711471A1 (en) 2019-12-23 2026-03-18 MGI Tech Co., Ltd. Controlled strand-displacement for paired-end sequencing
US12600963B2 (en) 2020-01-20 2026-04-14 Tecan Genomics, Inc. Depletion of abundant uninformative sequences
US12076701B2 (en) 2020-01-31 2024-09-03 10X Genomics, Inc. Capturing oligonucleotides in spatial transcriptomics
US12059674B2 (en) 2020-02-03 2024-08-13 Tecan Genomics, Inc. Reagent storage system
US12129516B2 (en) 2020-02-07 2024-10-29 10X Genomics, Inc. Quantitative and automated permeabilization performance evaluation for spatial transcriptomics
WO2021180724A1 (en) 2020-03-09 2021-09-16 Illumina, Inc. Improvements in nucleic acid sequencing
WO2021180733A1 (en) 2020-03-09 2021-09-16 Illumina, Inc. Methods for sequencing polynucleotides
WO2021231477A2 (en) 2020-05-12 2021-11-18 Illumina, Inc. Generating nucleic acids with modified bases using recombinant terminal deoxynucleotidyl transferase
WO2021252375A1 (en) 2020-06-08 2021-12-16 The Broad Institute, Inc. Single cell combinatorial indexing from amplified nucleic acids
WO2021252617A1 (en) 2020-06-09 2021-12-16 Illumina, Inc. Methods for increasing yield of sequencing libraries
US11787831B2 (en) 2020-06-22 2023-10-17 Illumina Cambridge Limited Nucleosides and nucleotides with 3′ acetal blocking group
WO2021259881A1 (en) 2020-06-22 2021-12-30 Illumina Cambridge Limited Nucleosides and nucleotides with 3' acetal blocking group
US12286453B2 (en) 2020-06-22 2025-04-29 Illumina Cambridge Limited Methods of sequencing using nucleotides with 3′ acetal blocking group
WO2022006081A1 (en) 2020-06-30 2022-01-06 Illumina, Inc. Catalytically controlled sequencing by synthesis to produce scarless dna
WO2022006495A1 (en) 2020-07-02 2022-01-06 Illumina, Inc. A method to calibrate nucleic acid library seeding efficiency in flowcells
US11981960B1 (en) 2020-07-06 2024-05-14 10X Genomics, Inc. Spatial analysis utilizing degradable hydrogels
US11952627B2 (en) 2020-07-06 2024-04-09 10X Genomics, Inc. Methods for identifying a location of an RNA in a biological sample
US12209280B1 (en) 2020-07-06 2025-01-28 10X Genomics, Inc. Methods of identifying abundance and location of an analyte in a biological sample using second strand synthesis
US11761038B1 (en) 2020-07-06 2023-09-19 10X Genomics, Inc. Methods for identifying a location of an RNA in a biological sample
WO2022010965A1 (en) 2020-07-08 2022-01-13 Illumina, Inc. Beads as transposome carriers
WO2022023353A1 (en) 2020-07-28 2022-02-03 Illumina Cambridge Limited Substituted coumarin dyes and uses as fluorescent labels
US12351871B2 (en) 2020-07-28 2025-07-08 Illumina Cambridge Limited Substituted coumarin dyes and uses as fluorescent labels
US11981964B2 (en) 2020-07-28 2024-05-14 Illumina Cambridge Limited Substituted coumarin dyes and uses as fluorescent labels
US11981958B1 (en) 2020-08-20 2024-05-14 10X Genomics, Inc. Methods for spatial analysis using DNA capture
US11926822B1 (en) 2020-09-23 2024-03-12 10X Genomics, Inc. Three-dimensional spatial analysis
US11827935B1 (en) 2020-11-19 2023-11-28 10X Genomics, Inc. Methods for spatial analysis using rolling circle amplification and detection probes
WO2022129930A1 (en) 2020-12-17 2022-06-23 Illumina Cambridge Limited Alkylpyridinium coumarin dyes and uses in sequencing applications
WO2022129437A1 (en) 2020-12-17 2022-06-23 Illumina Cambridge Limited Long stokes shift chromenoquinoline dyes and uses in sequencing applications
WO2022129439A1 (en) 2020-12-17 2022-06-23 Illumina Cambridge Limited Methods, systems and compositions for nucleic acid sequencing
US12241060B2 (en) 2020-12-21 2025-03-04 10X Genomics, Inc. Methods, compositions, and systems for capturing probes and/or barcodes
US12371688B2 (en) 2020-12-21 2025-07-29 10X Genomics, Inc. Methods, compositions, and systems for spatial analysis of analytes in a biological sample
US11873482B2 (en) 2020-12-21 2024-01-16 10X Genomics, Inc. Methods, compositions, and systems for spatial analysis of analytes in a biological sample
US11680260B2 (en) 2020-12-21 2023-06-20 10X Genomics, Inc. Methods, compositions, and systems for spatial analysis of analytes in a biological sample
US11959076B2 (en) 2020-12-21 2024-04-16 10X Genomics, Inc. Methods, compositions, and systems for capturing probes and/or barcodes
US11618897B2 (en) 2020-12-21 2023-04-04 10X Genomics, Inc. Methods, compositions, and systems for capturing probes and/or barcodes
WO2022136402A1 (en) 2020-12-22 2022-06-30 Illumina Cambridge Limited Methods and compositions for nucleic acid sequencing
US12569847B2 (en) 2021-01-08 2026-03-10 Cellanome, Inc. Methods for detecting intercellular interactions of cells in a compartment of a fluidic device
US12576399B2 (en) 2021-01-08 2026-03-17 Cellanome, Inc. Methods for imaging and analyzing a cell in a compartment of a fluidic device
US12576400B2 (en) 2021-01-08 2026-03-17 Cellanome, Inc. Methods for incubating and analyzing a cell in a compartment of a fluidic device
WO2022165188A1 (en) 2021-01-29 2022-08-04 Illumina, Inc. Methods, compositions and kits to improve seeding efficiency of flow cells with polynucleotides
US12630860B2 (en) 2021-03-09 2026-05-19 Illumina, Inc. Nucleic acid sequencing
WO2022204032A1 (en) 2021-03-22 2022-09-29 Illumina Cambridge Limited Methods for improving nucleic acid cluster clonality
US12203134B2 (en) 2021-04-14 2025-01-21 10X Genomics, Inc. Methods of measuring mislocalization of an analyte
US12043637B2 (en) 2021-05-05 2024-07-23 Illumina Cambridge Limited Fluorescent dyes containing bis-boron fused heterocycles and uses in sequencing
WO2022233795A1 (en) 2021-05-05 2022-11-10 Illumina Cambridge Limited Fluorescent dyes containing bis-boron fused heterocycles and uses in sequencing
US12365935B2 (en) 2021-05-06 2025-07-22 10X Genomics, Inc. Methods for increasing resolution of spatial analysis
WO2022243480A1 (en) 2021-05-20 2022-11-24 Illumina, Inc. Compositions and methods for sequencing by synthesis
US12071655B2 (en) 2021-06-03 2024-08-27 10X Genomics, Inc. Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis
US11220707B1 (en) 2021-06-17 2022-01-11 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
US11859241B2 (en) 2021-06-17 2024-01-02 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
US11891651B2 (en) 2021-06-17 2024-02-06 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
US11236388B1 (en) 2021-06-17 2022-02-01 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
US11535892B1 (en) 2021-06-17 2022-12-27 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
US11427855B1 (en) 2021-06-17 2022-08-30 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
WO2022272260A1 (en) 2021-06-23 2022-12-29 Illumina, Inc. Compositions, methods, kits, cartridges, and systems for sequencing reagents
WO2022271954A1 (en) 2021-06-24 2022-12-29 Illumina, Inc. Methods and compositions for combinatorial indexing of bead-based nucleic acids
WO2023278608A1 (en) 2021-06-29 2023-01-05 Illumina, Inc. Self-learned base caller, trained using oligo sequences
WO2023278609A1 (en) 2021-06-29 2023-01-05 Illumina, Inc. Self-learned base caller, trained using organism sequences
WO2023003757A1 (en) 2021-07-19 2023-01-26 Illumina Software, Inc. Intensity extraction with interpolation and adaptation for base calling
EP4679300A2 (en) 2021-07-19 2026-01-14 Illumina, Inc. Intensity extraction with interpolation and adaptation for base calling
WO2023009758A1 (en) 2021-07-28 2023-02-02 Illumina, Inc. Quality score calibration of basecalling systems
WO2023014741A1 (en) 2021-08-03 2023-02-09 Illumina Software, Inc. Base calling using multiple base caller models
US11753673B2 (en) 2021-09-01 2023-09-12 10X Genomics, Inc. Methods, compositions, and kits for blocking a capture probe on a spatial array
US11840724B2 (en) 2021-09-01 2023-12-12 10X Genomics, Inc. Methods, compositions, and kits for blocking a capture probe on a spatial array
WO2023052427A1 (en) 2021-09-30 2023-04-06 Illumina Cambridge Limited Polynucleotide sequencing
US12275988B2 (en) 2021-11-10 2025-04-15 10X Genomics, Inc. Methods, compositions, and kits for determining the location of an analyte in a biological sample
US12195790B2 (en) 2021-12-01 2025-01-14 10X Genomics, Inc. Methods for improved in situ detection of nucleic acids and spatial analysis
WO2023114397A1 (en) 2021-12-16 2023-06-22 Illumina, Inc. Hybrid clustering
WO2023114896A1 (en) 2021-12-16 2023-06-22 Illumina Cambridge Limited Methods for metal directed cleavage of surface-bound polynucleotides
WO2023114394A1 (en) 2021-12-17 2023-06-22 Illumina, Inc. Orthogonal hybridization
WO2023122491A1 (en) 2021-12-20 2023-06-29 Illumina Cambridge Limited Periodate compositions and methods for chemical cleavage of surface-bound polynucleotides
WO2023122499A1 (en) 2021-12-20 2023-06-29 Illumina Cambridge Limited Periodate compositions and methods for chemical cleavage of surface-bound polynucleotides
WO2023126457A1 (en) 2021-12-29 2023-07-06 Illumina Cambridge Ltd. Methods of nucleic acid sequencing using surface-bound primers
WO2023175024A1 (en) * 2022-03-15 2023-09-21 Illumina, Inc. Paired-end sequencing
WO2023175037A2 (en) 2022-03-15 2023-09-21 Illumina, Inc. Concurrent sequencing of forward and reverse complement strands on separate polynucleotides for methylation detection
WO2023175041A1 (en) 2022-03-15 2023-09-21 Illumina, Inc. Concurrent sequencing of forward and reverse complement strands on concatenated polynucleotides
WO2023175040A2 (en) 2022-03-15 2023-09-21 Illumina, Inc. Concurrent sequencing of forward and reverse complement strands on concatenated polynucleotides for methylation detection
WO2023175013A1 (en) 2022-03-15 2023-09-21 Illumina, Inc. Methods for preparing signals for concurrent sequencing
WO2023175043A1 (en) 2022-03-15 2023-09-21 Illumina, Inc. Methods of base calling nucleobases
WO2023175018A1 (en) 2022-03-15 2023-09-21 Illumina, Inc. Concurrent sequencing of forward and reverse complement strands on separate polynucleotides
WO2023175029A1 (en) 2022-03-15 2023-09-21 Illumina, Inc. Concurrent sequencing of hetero n-mer polynucleotides
WO2023175021A1 (en) 2022-03-15 2023-09-21 Illumina, Inc. Methods of preparing loop fork libraries
WO2023175026A1 (en) 2022-03-15 2023-09-21 Illumina, Inc. Methods of determining sequence information
WO2023186815A1 (en) 2022-03-28 2023-10-05 Illumina Cambridge Limited Labeled avidin and methods for sequencing
WO2023186819A1 (en) 2022-03-29 2023-10-05 Illumina Cambridge Limited Chromenoquinoline dyes and uses in sequencing
WO2023192163A1 (en) 2022-03-29 2023-10-05 Illumina Cambridge Limited Systems and methods of sequencing polynucleotides
WO2023186872A1 (en) 2022-03-30 2023-10-05 Illumina Cambridge Limited Methods for chemical cleavage of surface-bound polynucleotides
WO2023192900A1 (en) 2022-03-31 2023-10-05 Illumina Singapore Pte. Ltd. Nucleosides and nucleotides with 3' vinyl blocking group useful in sequencing by synthesis
WO2023187061A1 (en) 2022-03-31 2023-10-05 Illumina Cambridge Limited Paired-end re-synthesis using blocked p5 primers
WO2023186982A1 (en) 2022-03-31 2023-10-05 Illumina, Inc. Compositions and methods for improving sequencing signals
WO2023196572A1 (en) 2022-04-07 2023-10-12 Illumina Singapore Pte. Ltd. Altered cytidine deaminases and methods of use
WO2023209606A1 (en) 2022-04-29 2023-11-02 Illumina Cambridge Limited Methods and systems for encapsulating lyophilised microspheres
WO2023232829A1 (en) 2022-05-31 2023-12-07 Illumina, Inc Compositions and methods for nucleic acid sequencing
WO2024003087A1 (en) 2022-06-28 2024-01-04 Illumina, Inc. Fluorescent dyes containing fused tetracyclic bis-boron heterocycle and uses in sequencing
US12552814B2 (en) 2022-06-28 2026-02-17 Illumina, Inc. Fluorescent dyes containing fused tetracyclic bis-boron heterocycle and uses in sequencing
US12540350B2 (en) 2022-08-15 2026-02-03 Element Biosciences, Inc. Spatially resolved surface capture of nucleic acids
WO2024039516A1 (en) 2022-08-19 2024-02-22 Illumina, Inc. Third dna base pair site-specific dna detection
US12624475B1 (en) 2022-08-22 2026-05-12 10X Genomics, Inc. Capturing genetic targets using a hybridization approach
WO2024059852A1 (en) 2022-09-16 2024-03-21 Illumina, Inc. Cluster segmentation and conditional base calling
WO2024061799A1 (en) 2022-09-19 2024-03-28 Illumina, Inc. Deformable polymers comprising immobilised primers
WO2024068641A1 (en) 2022-09-26 2024-04-04 Illumina, Inc. Resynthesis kits and methods
WO2024073043A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Methods of using cpg binding proteins in mapping modified cytosine nucleotides
WO2024073714A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Methods of modulating clustering kinetics
WO2024073663A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Amplification compositions and methods
WO2024073047A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Cytidine deaminases and methods of use in mapping modified cytosine nucleotides
WO2024073712A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Thermophilic compositions for nucleic acid amplification
WO2024073713A1 (en) 2022-09-30 2024-04-04 Illumina, Inc. Mesophilic compositions for nucleic acid amplification
WO2024069581A1 (en) 2022-09-30 2024-04-04 Illumina Singapore Pte. Ltd. Helicase-cytidine deaminase complexes and methods of use
WO2024068889A2 (en) 2022-09-30 2024-04-04 Illumina, Inc. Compositions and methods for reducing photo damage during sequencing
US12571029B1 (en) 2022-11-09 2026-03-10 10X Genomics, Inc. Methods, compositions, and kits for determining the location of multiple analytes in a biological sample
WO2024118903A1 (en) 2022-11-30 2024-06-06 Illumina, Inc. Chemoenzymatic correction of false positive uracil transformations
WO2024123917A1 (en) 2022-12-07 2024-06-13 Illumina, Inc. Monoclonal clustering using double stranded dna size exclusion with patterned seeding
WO2024123866A1 (en) 2022-12-09 2024-06-13 Illumina, Inc. Nucleosides and nucleotides with 3´ blocking groups and cleavable linkers
WO2024137886A1 (en) 2022-12-21 2024-06-27 Illumina, Inc. Context-dependent base calling
WO2024137765A1 (en) 2022-12-22 2024-06-27 Illumina, Inc. Transition-metal catalyst compositions and methods for sequencing by synthesis
WO2024137774A1 (en) 2022-12-22 2024-06-27 Illumina, Inc. Palladium catalyst compositions and methods for sequencing by synthesis
WO2024145154A1 (en) 2022-12-27 2024-07-04 Illumina, Inc. Methods of sequencing using 3´ allyl blocked nucleotides
WO2024147904A1 (en) 2023-01-06 2024-07-11 Illumina, Inc. Reducing uracils by polymerase
US12631560B2 (en) 2023-03-27 2026-05-19 Illumina, Inc. Chromenoquinoline dyes and uses in sequencing
WO2024206407A2 (en) 2023-03-29 2024-10-03 Illumina, Inc. Naphthalimide dyes and uses in nucleic acid sequencing
WO2024206394A1 (en) 2023-03-30 2024-10-03 Illumina, Inc. Compositions and methods for nucleic acid sequencing
WO2024249200A1 (en) 2023-05-26 2024-12-05 Illumina, Inc. Methods for preserving methylation status during clustering
WO2024249591A1 (en) 2023-05-31 2024-12-05 Illumina, Inc. Methods for double-stranded sequencing by synthesis
WO2024249466A1 (en) 2023-05-31 2024-12-05 Illumina, Inc. False positive reduction by translesion polymerase repair
WO2024256580A1 (en) 2023-06-14 2024-12-19 Illumina, Inc. Concurrent sequencing with spatially separated rings
WO2024256581A1 (en) 2023-06-14 2024-12-19 Illumina, Inc. Determination of modified cytosines
WO2025049700A1 (en) 2023-08-31 2025-03-06 Illumina, Inc. Compositions and methods for nucleic acid sequencing
WO2025062002A1 (en) 2023-09-20 2025-03-27 Illumina, Inc. Concurrent sequencing using nick translation
WO2025062001A1 (en) 2023-09-20 2025-03-27 Illumina, Inc. Optimised nucleic acid sequencing
WO2025072800A2 (en) 2023-09-28 2025-04-03 Illumina, Inc. Altered cytidine deaminases and methods of use
WO2025072783A1 (en) 2023-09-28 2025-04-03 Illumina, Inc. Altered cytidine deaminases and methods of use
WO2025072793A1 (en) 2023-09-28 2025-04-03 Illumina, Inc. Altered cytidine deaminases and methods of use
WO2025072683A1 (en) 2023-09-29 2025-04-03 Illumina, Inc. Solid supports and methods for strand invasion-based amplification
WO2025081064A2 (en) 2023-10-11 2025-04-17 Illumina, Inc. Thermophilic deaminase and methods for identifying modified cytosine
WO2025090596A1 (en) 2023-10-26 2025-05-01 Illumina, Inc. 4,5-substituted naphthalimide dyes and uses in nucleic acid sequencing
WO2025106715A1 (en) 2023-11-17 2025-05-22 Illumina, Inc. Conjugated polymers or polymer dots as fluorescent labels
WO2025117738A1 (en) 2023-11-28 2025-06-05 Illumina, Inc. Methods of improving unique molecular index ligation efficiency
US12630819B2 (en) 2023-12-15 2026-05-19 Illumina, Inc. Nucleic acid indexing techniques
WO2025136890A1 (en) 2023-12-18 2025-06-26 Illumina, Inc. Hydrogel nanoparticles as labeling scaffold in sequencing
WO2025137222A1 (en) 2023-12-19 2025-06-26 Illumina, Inc. Methylation detection assay
WO2025137479A1 (en) 2023-12-22 2025-06-26 Illumina, Inc. Reusable flow cells and methods of using them for nucleic acid sequencing
WO2025144626A1 (en) 2023-12-28 2025-07-03 Illumina, Inc. Sequencing with single-stranded binding proteins
WO2025144716A1 (en) 2023-12-28 2025-07-03 Illumina, Inc. Nucleotides with enzymatically cleavable 3'-o-glycoside blocking groups for sequencing
WO2025144711A1 (en) 2023-12-29 2025-07-03 Illumina, Inc. Tricyclic polymethine dyes for nucleic acid sequencing
WO2025153496A1 (en) 2024-01-15 2025-07-24 Benson Erik Mesh chip
WO2025184226A1 (en) 2024-02-28 2025-09-04 Illumina, Inc. Nucleotides with terminal phosphate capping
WO2025188906A1 (en) 2024-03-08 2025-09-12 Illumina, Inc. Modified adenosine nucleotides
WO2025207535A1 (en) 2024-03-26 2025-10-02 Illumina, Inc. Photo-switchable surfaces
WO2025221895A1 (en) 2024-04-19 2025-10-23 Illumina, Inc. Water soluble polymer scaffolds for dye labeling
WO2025230914A1 (en) 2024-04-29 2025-11-06 Illumina, Inc. Nucleotides with enzyme-triggered self-immolative linkers for sequencing by synthesis
WO2025264831A1 (en) 2024-06-18 2025-12-26 Illumina, Inc. Methods for increasing sequencing quality of gc-rich regions
WO2025264836A1 (en) 2024-06-18 2025-12-26 Illumina, Inc. Methods for increasing sequencing quality of gc-rich regions
WO2026006774A1 (en) 2024-06-28 2026-01-02 Illumina, Inc. Altered cytidine deaminases and methods of use
WO2026006746A2 (en) 2024-06-28 2026-01-02 Illumina, Inc. Nucleic acid preparation and analysis techniques
WO2026006314A1 (en) 2024-06-28 2026-01-02 Illumina, Inc. Tagging target regions prior to nucleotide sequencing
WO2026033007A1 (en) * 2024-08-07 2026-02-12 F. Hoffmann-La Roche Ag Automated solid-state amplification of library constructs for duplex sequencing
WO2026035914A1 (en) 2024-08-09 2026-02-12 Illumina, Inc. Nucleotides having 3'-hydroxy blocking groups
WO2026097017A2 (en) 2024-11-01 2026-05-07 Illumina, Inc. Methods of improving sequencing accuracy

Also Published As

Publication number Publication date
DE69837913T2 (en) 2008-02-07
EP2327797A1 (en) 2011-06-01
US8143008B2 (en) 2012-03-27
EP3034626A1 (en) 2016-06-22
JP2002503954A (en) 2002-02-05
ES2563643T3 (en) 2016-03-15
US20130231254A1 (en) 2013-09-05
US8993271B2 (en) 2015-03-31
EP0972081B1 (en) 2007-06-13
US20080286795A1 (en) 2008-11-20
EP1591541B1 (en) 2012-02-15
US20050100900A1 (en) 2005-05-12
US20150087531A1 (en) 2015-03-26
AU6846698A (en) 1998-10-22
HK1155784A1 (en) 2012-05-25
US7985565B2 (en) 2011-07-26
ATE364718T1 (en) 2007-07-15
US20110045541A1 (en) 2011-02-24
EP2327797B1 (en) 2015-11-25
US8476044B2 (en) 2013-07-02
US20150133320A1 (en) 2015-05-14
EP1591541A2 (en) 2005-11-02
US20140371100A1 (en) 2014-12-18
US9593328B2 (en) 2017-03-14
DE69837913D1 (en) 2007-07-26
EP0972081A1 (en) 2000-01-19
US9902951B2 (en) 2018-02-27
ATE545710T1 (en) 2012-03-15
EP1591541A3 (en) 2006-07-05
US20130217586A1 (en) 2013-08-22

Similar Documents

Publication Publication Date Title
EP2327797B1 (en) Method of nucleic acid sequencing
EP1634963B1 (en) Method of nucleic acid amplification using immobilised colony primers
US6297006B1 (en) Methods for sequencing repetitive sequences and for determining the order of sequence subfragments
US20030022207A1 (en) Arrayed polynucleotides and their use in genome analysis
EP1597397B1 (en) Dna sequence analysis
US20040175716A1 (en) Dna sequence analysis
EP1356120A2 (en) Arrayed polynucleotides and their use in genome analysis
JP2001517948A (en) Nucleic acid sequencing
AU2002219161A1 (en) Isothermal amplification of nucleic acids on a solid support
EP1689881A2 (en) Nucleic acid sequencing methods
WO2004050915A1 (en) Determination of methylation of nucleic acid sequences
EP1716251A1 (en) Arrayed polynucleotides
US20080108515A1 (en) Arrayed polynucleotides
HK1155784B (en) Method of nucleic acid sequencing
US20100130368A1 (en) Method and system for sequencing polynucleotides
WO2004050916A1 (en) Recovery of original template

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1998913952

Country of ref document: EP

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1998 541308

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 09402277

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1998913952

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: CA

WWG Wipo information: grant in national office

Ref document number: 1998913952

Country of ref document: EP

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)