MXPA01003266A

MXPA01003266A - Methods of nucleic acid amplification and sequencing

Info

Publication number: MXPA01003266A
Application number: MXPA/A/2001/003266A
Authority: MX
Inventors: Celine Adessi; Eric Kawashima; Pascal Mayer; Jeanjacques Mermod; Gerardo Turcatti
Original assignee: Applied Research Systems Ars Holding Nv
Priority date: 1998-09-30
Filing date: 2001-03-29
Publication date: 2002-02-26

Abstract

Methods for amplification and sequencing of at least one nucleic acid comprising the following steps:(1) forming at least one nucleic acid template comprising the nucleic acid(s) to be amplified or sequenced, wherein said nucleic acid(s) contains at the 5'end an oligonucleotide sequence Y and at the 3'end an oligonucleotide sequence Z and, in addition, the nucleic acid(s) carry at the 5'end a means for attaching the nucleic acid(s) to a solid support;(2) mixing said nucleic acid template(s) with one or more colony primers X, which can hybridize to the oligonucleotide sequence Z and carries at the 5'end a means for attaching the colony primers to a solid support, in the presence of a solid support so that the 5'ends of both the nucleic acid template and the colony primers bind to the solid support;(3) performing one or more nucleic acid amplification reactions on the bound template(s), so that nucleic acid colonies are generated and optionally, performing at least one step of sequence determination of one or more of the nucleic acid colonies generated. Solid supports, kits and apparatus for use in these methods.

Description

METHODS OF AMPLIFICATION AND SEQUENCING OF NUCLEIC ACIDS DESCRIPTION OF THE INVENTION This invention relates to the field of nucleic acid amplification and sequencing. More specifically, this invention relates to nucleic acid amplification and sequencing methods, and to the apparatus and equipment useful for the large-scale, high-throughput amplification and sequencing of nucleic acids. Nucleic acid sequence analysis has become a cornerstone in many activities in biology, biotechnology and medicine. The ability to determine nucleic acid sequences has become increasingly important as efforts have begun to determine the sequences of the large genomes of humans and other higher organisms and also, for example, in the detection and selection of nucleotide polymorphisms simple and in the periodic verification of the expression of genes. The genetic information provided by nucleic acid sequencing has many applications in areas such as for example drug discovery and validation, disease diagnosis and risk scoring and identification and characterization of organisms. The first step in such applications is the determination of the effective chemical composition of the nucleic acids of interest, more precisely the determination of the sequence of appearance of the four bases adenine (A), cytosine (C), guanine (G) and tintina (T) or uracil (U) comprising the nucleic acids. However, such applications require the sequencing of nucleic acids on a large scale, making high throughput nucleic acid sequencing methods extremely desirable. Nucleic acid sequencing methods are documented in the art. The two most commonly used are the chemical cleavage technique by Maxam and Gilbert that relies on base-specific chemistry and on the now more popular Sanger sequencing technique that relies on an enzymatic chain termination principle and is now used as a Routine basis for nucleic acid sequencing. In Sanger sequencing, each nucleic acid to be sequenced is replicated in a reaction involving DNA polymerase, deoxynucleotide triphosphates (dNTPs) and dideoxynucleotide triphosphates (ddNTPs). DNA polymerase can incorporate dNTPs and ddNTPs into the strand of growing DNA. However, once a ddNTP is incorporated, the 3 'end of the growing DNA strand lacks a hydroxyl group and is no longer a substrate for chain elongation, thereby terminating the nucleic acid strand. Therefore, in a particular reaction that includes a type of ddNTP a mixture of nucleic acids of different lengths is produced, ending all with the same ddNTP. Usually, separate reactions are established for each of the four types of ddNTP and the distribution of the lengths of the produced nucleic acid fragments is analyzed by denaturing gel electrophoresis (which resolves the nucleic acid fragments according to their size) , or more recently, by mass spectroscopy. Usually, one or more of the deoxynucleotide triphosphates in the reaction mixture is labeled to make it possible to detect fragments of different lengths. The methods described above are disadvantageous because each nucleic acid to be sequenced has to be processed individually during the biochemical reaction. Gel electrophoresis is problematic, labor intensive and intrinsically slow, even when capillary electrophoresis is used and is not well suited for high-throughput large-scale sequencing. In addition, the subsequent determination of the sequence is problematic. Mass spectroscopy is still at the prototype level, it requires very expensive devices and each sample has to be analyzed individually. One way to increase performance is to process many samples in parallel. Methods that use DNA hybridization of nucleic acid probes are in use and allow some multiplexing of the process during electrophoretic and biochemical processes, but at the cost of prolonged additional manipulations. More recently methods based on pieces of DNA and DNA hybridization are becoming available (Thomas and Bur e Exp. Opin. Ther.Patents 8: 503-508 (1998)). These methods are disadvantageous because for each application, a piece of DNA has to be designed and manufactured first: this is a prolonged operation and the price of an individual piece decreases only when very large numbers of the piece are required. Also, the pieces are not reusable and for each piece only a sample of nucleic acids, for example of a patient to be diagnosed, can be processed at the same time. Finally, the extent of the sequence that can be analyzed by such a piece is limited to less than 100,000 bases, and is limited to some applications such as DNA genotyping and profiling of gene expression. In most known techniques for nucleic acid sequence analysis, the nucleic acid amplification of interest is a prerequisite step in order to obtain the nucleic acid in an amount sufficient for analysis. Various methods of nucleic acid amplification are well known and documented in the art. For example, nucleic acids can be amplified by inserting the nucleic acid of interest into a construction of the expression vector. Such vectors can then be introduced into the appropriate biological host cells and the vector DNA, including the nucleic acid of interest, is amplified by culturing the biological host using well-established protocols. Nucleic acids amplified by such methods can be isolated from host cells by methods well known and documented in the art. However, such methods have the disadvantage of being generally time consuming, labor intensive and difficult to automate. The technique of DNA amplification by the polymerase chain reaction (PCR) was described in 1985 (Saiki et al., Science 230, 1350-1354) and is now a method well known and documented in the art. A target nucleic acid fragment of interest can be amplified using two short oligonucleotide sequences (usually referred to as primers) that are specific for known sequences that flank the DNA sequence to be amplified. The primers hybridize to the opposite strains of the double-stranded DNA fragment after it has been denatured, and are oriented so that the DNA synthesis by the DNA polymerase proceeds through the region between the two primers, with the primer sequences that are extended by the sequential incorporation of the nucleotides by the polymerase. The extension reactions create two double-stranded target regions, each of which can again be denatured for a second cycle of hybridization and extension. The third cycle produces two double-stranded molecules that comprise precisely the target region in double-stranded form. By repeated cycles of thermal denaturation, primer hybridization, and extension, a rapid exponential accumulation of the specific target fragment of DNA follows. Traditionally, this method is performed in solution and the amplified target nucleic acid fragment purified from the solution by methods well known in the art, for example, by gel electrophoresis. More recently, however, methods using a primer grafted to a surface in conjunction with free primers in solution have been described. These methods allow the simultaneous amplification and coupling of a PCR product on the surface (Oroskar, TO. . et al., Clini cal Chemi s try 42: 1547 (1996)). WO96 / 04404 and O98 / 36094 (Mosaic Technologies, Inc. et al.) Describe a method for the detection of a target nucleic acid in a sample, which potentially contains the target nucleic acid. The method involves the induction of a PCR-based amplification of the target nucleic acid only when the target nucleic acid is present in the sample tested. For the amplification of the target sequence, both primers are coupled to a solid support, which results in amplified target nucleic acid sequences, which are also coupled to the solid support. The amplification technique described in this document is sometimes referred to as the "bridging amplification technique." In this technique, the two primers are, as for conventional PCR, specifically designed so that they flank the particular target DNA sequence. This will allow the target nucleic acid to be hybridized to the primers and amplified by PCR.The first step in this PCR amplification process is hybridization. of the target nucleic acid to the first specific primer coupled to the support ("primer 1") A first amplification product, which is complementary to the target nucleic acid, is then formed by extension of the sequence of the primer 1. When subjecting the support to the denaturing conditions, the target nucleic acid is released and can then participate in subsequent hybridization reactions c on other sequences of the primer 1 that can be coupled to the support. The first amplification product that is coupled to the support can then hybridize with the second specific primer ("primer 2") coupled to the support, and a second amplification product comprising a nucleic acid sequence complementary to the first amplification product, can be formed by extending the sequence of the primer 2 and is also coupled to the support. In this way, the target nucleic acid and the first and second amplification products are able to participate in a plurality of hybridization and extension processes, limited only by the initial presence of the target nucleic acid and by the number of the primer sequences. 1 and primer 2 initially present, and the result is a copy number of the target sequence coupled to the surface. Since in carrying out this process, the amplification products are only formed if the target nucleic acid is present, the periodic verification of the support for the presence or absence of one or more amplification products, is an indicator of the presence or absence of a specific objective sequence. The Mosaic technique can be used to achieve a multiplexing amount since several different target nucleic acid sequences can be amplified simultaneously by arranging different groups of first and second primers, specific for each different target nucleic acid sequence, on different regions of the solid support. The disadvantage of the Mosaic process is that, since the first and second primer sequences have to be specific for each target nucleic acid to be amplified, it can only be used to amplify known sequences. In addition, the performance is limited by the number of different groups of specific primers and the target nucleic acid molecules, subsequently amplified, which may be accommodated in different regions of a given solid support and the time taken to accommodate nucleic acids in different regions. Also, the Mosaic process requires that 2 different primers be homogeneously coupled at the 5 'end to the support within the distinct region where the amplification product is formed. This can not be achieved with the technology available to make piece of DNA and has to be achieved by some means of sample assortment. In this way, the density that can be achieved by this procedure has the same limitation as other conventional arrangement or accommodation technologies. An additional limitation is the rate of periodic verification of the individual regions other than the support, for the presence or absence of the amplified target nucleic acids. The arrangement or arrangement of the DNA samples is conventionally performed on membranes (for example, nylon or nitrocellulose membranes). The use of suitable robotic means (for example, Q-botMR, Genetix Ltd, Dorset BH23 3TG, United Kingdom) means that it is possible to obtain a density of up to 10 samples / mm2. In such methods, the DNA is covalently bound to a membrane by physicochemical means (eg, UV irradiation) and the array of large DNA molecules (eg, molecules larger than 100 nucleotides in length) as well as smaller DNA molecules such as the oligonucleotide primers, it is possible. Other techniques are known by which higher-density arrangements of the oligonucleotides can be obtained. For example, procedures based on pre-arranged glass slides where reactive area arrays are obtained by inkjet technology (Blanchard, AP and L. Hood, Mi crobi al and Compare ti ve Genomi cs, 1: 225 (1996)) or arrays of reactive polyacrylamide gels (Yershov, G. et al., Proceedings of the Na tional Academy Sci ence, USA, 93: 4913-4918 (1996)) allow in theory the arrangement of up to 100 samples / mm2. The highest sample densities are still achievable by the use of pieces of DNA (Fodor, S.P.A. et al., Sci en 251: 767 (1991)). Currently, pieces with 625 oligonucleotide probes / mm2 are used in molecular biology techniques (Lockhart, D.J. et al., Na ture Biotechnology ogy 14: 1675 (1996)). Probe densities up to 250,000 samples / cm2 (2500 / mm2) are claimed as achievable (Chee, M. et al., Sci en 274: 610 (1996)). However, to date up to 132,000 different oligonucleotides can be accommodated on a single piece of approximately 2.5 cm 2. Importantly, these pieces are manufactured in such a way that the 3 '-OH end of the oligonucleotide is coupled to the solid surface. This means that the oligonucleotides coupled to the pieces in such a manner can not be used as primers in a PCR amplification reaction. Importantly, when the PCR products are linked to the vessel in which PCR amplification takes place, the density of the resulting array of PCR products is limited by the available vessel. The currently available containers are only in a 96-well microtiter plate format. These allow only about 0.02 samples of PCR products / mm2 of surface to be obtained. For example, using the commercially available Nucleolink ™ system (Nunc A / S, Roskilde, Denmark), it is possible to achieve simultaneous amplification and arrangement of samples at a density of 0.02 samples / mm2 in wells on the surface of which they have been grafted the oligonucleotide primers. However, the technical problems mean that it is unlikely that a significant increase in this sample density will be achieved with this procedure. Thus, it can be seen that in order to increase the yield there is a need in the art for new nucleic acid amplification methods, which allow the simultaneous amplification and arrangement of the nucleic acid samples at a higher density, and in addition, allowing periodic verification of the samples at a faster rate, preferably in parallel. Furthermore, it is apparent that there is a need in the art for new sequencing methods that allow large numbers of samples to be processed and sequenced in parallel, for example there is a need for sequencing methods that allow for significant multiplexing of the process. Significant multiplexing of the sequencing process could in turn lead to a higher throughput than that achievable with the sequencing methods known in the art. Such new methods could even be more desirable if they could achieve such high-throughput sequencing at a reasonable cost and with less labor intensity than conventional sequencing techniques. The present invention describes the new solid phase nucleic acid amplification methods that make it possible for a large number of different nucleic acid sequences to be accommodated or arranged, and that they be amplified simultaneously and at a high density. The invention also describes the methods by which a large number of different amplified nucleic acid sequences can be checked periodically at a rapid rate and, if desired, in parallel. The invention also describes the methods by which the sequences of a large number of different nucleic acids can be determined simultaneously and within a short period of time. The methods are particularly useful in, but are not limited to, the sequencing of a complete genome, or situations where many genes (for example 500) from many individuals (for example 500) have to be sequenced simultaneously, or the simultaneous qualification of large numbers (for example millions) of polymorphisms, or the Periodic verification of the expression of a large number of genes (for example 100,000) simultaneously. The present invention therefore provides a method for the amplification of at least one nucleic acid comprising the following steps: (1) the formation of at least one nucleic acid template comprising the nucleic acid (s) to be amplified, wherein the nucleic acid (s) contain at the 5 'end an oligonucleotide sequence Y, and at the 3' end an oligonucleotide sequence Z and, in addition, the nucleic acid (s) carry at the 5 'end a means for coupling the or from nucleic acids to a solid support; (2) the mixing of the nucleic acid template (s) with one or more colonial primers X, which can hybridize to the oligonucleotide sequence Z and possess at the 5 'end a means for coupling the colonial primers to a support solid, in the presence of a solid support, so that the 5 'ends of the nucleic acid template and the colonial primers are linked to the solid support; (3) carrying out one or more nucleic acid amplification reactions on the linked template (s), so that nucleic acid colonies are generated. In a further embodiment of the invention, two different colonial primers X are mixed with the nucleic acid template (s) in step (2) of the method. Preferably, the sequences of colonial primers X are such that the oligonucleotide sequences Z can hybridize to one of the primers X and the oligonucleotide sequence Y is the same as one of the colonial primers X. In an alternative embodiment of the invention, the oligonucleotide sequence Z is complementary to the oligonucleotide sequence Y, designated as Y 'and the colonial primer X of the same sequence as the oligonucleotide sequence Y. In a further embodiment of the invention, the colonial primer X may comprise a degenerate primer sequence, and the nucleic acid templates comprise the nucleic acid (s) to be amplified and do not contain Y or Z oligonucleotide sequences at the 5 'and 3' ends, respectively. In a further aspect of the invention, the method comprises the additional step of performing at least one step of determining the sequence of one or more of the nucleic acid colonies generated in step (3). Thus, the invention also provides a method for sequencing at least one nucleic acid comprising the following steps: (1) the formation of at least one nucleic acid template comprising the nucleic acid (s) to be sequenced, in wherein the nucleic acid (s) contains at the 5 'end an oligonucleotide sequence Y, and at the 3' end an oligonucleotide sequence Z and, in addition, the nucleic acid (s) possess at the 5 'end a means for coupling the or the nucleic acids to a solid support; (2) the mixing of the nucleic acid template (s) with one or more colonial primers X, which can hybridize to the oligonucleotide sequence Z, and has at the 5 'end a means for coupling the colonial primers to a support solid, in the presence of a solid support, so that the 5 'ends of the nucleic acid template and the colonial primers are linked to the solid support; (3) carrying out one or more nucleic acid amplification reactions on the linked template (s), so that the nucleic acid colonies are generated; and (4) carrying out at least one step of determining the sequence of at least one of the nucleic acid generated colonies. In a further embodiment of the invention, the 5 'ends of the nucleic acid template (s) and the colonial primers possess a means for coupling the nucleic acid sequences covalently to the solid support. Preferably, this means that the covalent coupling is a chemically modifiable functional group, such as for example, a phosphate group, a carboxyl or aldehyde moiety, a thiol, a hydroxyl, a dimethoxytrityl (DMT), or an amino group, preferably a group Not me. Nucleic acids that can be amplified according to the methods of the invention include DNA, for example, genomic DNA, cDNA, recombinant DNA, or any form of DNA, RNA, synthetic or modified mRNA, or any form of synthetic or modified RNA . Said nucleic acids can vary in length and can be fragments or smaller parts of the larger nucleic acid molecules. Preferably, the nucleic acid to be amplified is at least 50 base pairs in length and more preferably 150 to 4000 base pairs in length. The nucleic acid to be amplified may have a known or unknown sequence and may be in a single-stranded or double-stranded form. The nucleic acid to be amplified can be derived from any source. "Nucleic acid template" as used herein, refers to an entity comprising the nucleic acid to be amplified or sequenced in a single-stranded form. As described below, the nucleic acid to be amplified or sequenced can also be provided in a double-stranded form. Thus, the "nucleic acid templates" of the invention can be single-stranded or double-stranded nucleic acids. The nucleic acid templates that are to be used in the method of the invention can be of varying lengths. Preferably, these are at least 50 base pairs in length and more preferably 150 to 4000 base pairs in length. The nucleotides that make up the nucleic acid templates can be nucleotides of natural origin or of non-natural origin. The nucleic acid templates of the invention not only comprise the nucleic acid to be amplified, but may also contain the short oligonucleotide sequences of 5 'and 3' ends. The oligonucleotide sequence contained at the 5 'end is referred to herein as Y. The oligonucleotide sequence Y is of a known sequence and may be of variable length. The oligonucleotide sequence Y for use in the methods of the present invention is preferably at least five nucleotides in length, preferably between 5 and 100 nucleotides in length, and more preferably approximately 20 nucleotides in length. Nucleotides of natural origin or of non-natural origin may be present in the oligonucleotide sequence Y. As indicated above, preferably the sequence of the oligonucleotide Y is the same as the sequence of the colonial primer X. The oligonucleotide sequence contained at the 3 'end of the nucleic acid templates of the invention is referred to herein as Z. The oligonucleotide sequence Z is of a known sequence and may be of variable length. The oligonucleotide sequence Z for use in the methods of the present invention is preferably at least five nucleotides in length, preferably between 5 and 100 nucleotides in length and more preferably approximately 20 nucleotides in length. The nucleotides of natural origin or of non-natural origin can be present in the oligonucleotide sequence Z. The oligonucleotide sequence Z is designed so that it hybridizes with one of the colonial primers X, and is preferably designed so that it is complementary to the Y oligonucleotide sequence, referred to herein as Y '. The Y and Z oligonucleotide sequences contained at the 5 'and 3' ends respectively of a nucleic acid template do not need to be located at the ends of the template. For example, although the Y and Z oligonucleotide sequences are preferably located at or near the 5 'and 3' ends (or the terms) respectively of the nucleic acid templates (e.g. within 0 to 100 nucleotides of the 5 'ends) and 3 '), these can be located further away (for example more than 100 nucleotides) from the 5' or 3 'ends of the nucleic acid template. The Y and Z oligonucleotide sequences can therefore be located at any position within the nucleic acid template with the proviso that the Y and Z sequences are on either side, for example the flank, of the nucleic acid sequence that goes to be amplified. "Nucleic acid template" as used herein also includes an entity that comprises the nucleic acid to be amplified or sequenced in a double-stranded form. When the nucleic acid template is in a double-stranded form, the oligonucleotide sequences Y and Z are contained at the 5 'and 3' ends respectively of one of the strands. The other strand, due to the base pairing rules of the DNA, is complementary to the Y and Z oligonucleotide sequences containing the strand, and thus contains an oligonucleotide sequence Z 'at the 5' end and an oligonucleotide sequence Y ' at the 3 'end. "Colonial primer" as used herein refers to an entity comprising an oligonucleotide sequence that is capable of hybridizing to a complementary sequence and initiating a specific polymerase reaction. The sequence comprising the colonial primer is chosen such that it has maximal hybridization activity with its complementary sequence and very low unspecific hybridization activity to any other sequence. The sequence to be used as a colonial primer may include any sequence, but preferably includes 5'-AGAAGGAGAAGGAAAGGGAAAGGG or 5'-CACCAACCCAAACCAACCCAAACC. The colonial primer may be from 5 to 100 bases in length, but preferably from 15 to 25 bases in length. Nucleotides of natural origin or of non-natural origin may be present in the primer. One or two different colonial primers can be used to generate nucleic acid colonies in the methods of the present invention. Colonial primers for use in the present invention may also include degenerate primer sequences. "Degenerate primer sequences" as used herein refer to a short oligonucleotide sequence which is capable of hybridizing to any nucleic acid fragment, independent of the sequence of the nucleic acid fragment. Such primers degenerated in this way do not require the presence of Y or Z oligonucleotide sequences in the nucleic acid template (s) for hybridization to the template to occur, although the use of degenerate primers to hybridize to a template containing the oligonucleotide sequence X or Y, it is not excluded. Clearly, however, for use in the amplification methods of the present invention, the degenerate primers must hybridize to the nucleic acid sequences in the template at the sites on either side, or flanking, the nucleic acid sequence that will be amplified "Solid support" as used herein refers to any solid surface to which nucleic acids may be covalently linked, such as, for example, latex spheres, dextran spheres, polystyrene, polypropylene surface, polyacrylamide gel, gold, glass surfaces and silicon wafers. Preferably, the solid support is a glass surface. "Means for the coupling of nucleic acids to a solid support" as used herein, refers to any chemical or non-chemical coupling method that includes chemically modifiable functional groups. "Coupling" refers to the immobilization of nucleic acid on solid supports either by covalent bonding or via irreversible passive adsorption or via affinity between molecules (for example, immobilization on a surface coated with avidin by biotinylated molecules). The coupling must be of sufficient strength so that it can not be removed by washing with water or aqueous buffer under conditions of DNA denaturation. "Chemically modifiable functional group" as used herein refers to a group such as, for example, a phosphate group, a carboxyl or aldehyde portion, or a thiol group, or an amino group. "Nucleic acid colony" as used herein refers to a discrete area comprising multiple copies of a strand of nucleic acid. Multiple copies of the strand complementary to the nucleic acid strand may also be present in the same colony. Multiple copies of the nucleic acid strands constituting the colonies are generally immobilized on a solid support and may be in a single-stranded or double-stranded form. The nucleic acid colonies of the invention can be generated in different sizes and densities, depending on the conditions used. The size of the colonies is preferably 0.2 μm to 6 μm, more preferably 0.3 μm to 4 μm. The density of the nucleic acid colonies for use in the method of the invention is typically from 10,000 / mm2 to 100,000 / mm2. It is believed that the highest densities, for example, 100,000 / mm2 to 1'000,000 / mm2 and 1'000, 000 / mm2 to 10'000, 000 / mm2 can be achieved.

The methods of the invention can be used to generate nucleic acid colonies. Thus, a further aspect of the present invention provides one or more nucleic acid colonies. A nucleic acid colony of the invention can be generated from a simple, immobilized nucleic acid template of the invention. The method of the invention allows the simultaneous production of a number of such nucleic acid colonies, each of which can contain different immobilized nucleic acid strands. Thus, a further aspect of the invention provides a plurality of nucleic acid templates comprising the nucleic acids to be amplified, wherein the nucleic acids contain at their 5 'ends an oligonucleotide sequence Y, and at the end 3"an oligonucleotide sequence Z and, in addition, the nucleic acid (s) possess at the 5 'end a means for coupling the nucleic acid (s) to a solid support. Preferably, this plurality of nucleic acid templates are mixed with a plurality of colonial X primers that can hybridize to the oligonucleotide sequence Z and carry at the 5 'end a means for coupling the colonial primers to a solid support. Preferably, the plurality of nucleic acid templates and the colonial primers are covalently linked to a solid support. In a further embodiment of the invention, the pluralities of two different colonial primers X are mixed with the plurality of nucleic acid templates. Preferably, the sequences of the colonial primers X are such that the oligonucleotide sequence Z can hybridize to one of the colonial primers X and the oligonucleotide sequence Y is the same as the sequence of one of the colonial primers X. In an alternative embodiment, the oligonucleotide sequence Z is complementary to the oligonucleotide sequence Y, (Y ') and the plurality of colonial primers X are of the same sequence as the oligonucleotide sequence Y. In a further embodiment, the plurality of colonial primers X may comprise a primer sequence Degenerate and the plurality of nucleic acid templates comprise the nucleic acids to be amplified and do not contain Y or Z oligonucleotide sequences at the 5 'and 3' ends, respectively.

The nucleic acid templates of the invention can be prepared using techniques that are standard or conventional in the art. In general, these will be based on genetic engineering techniques. The nucleic acids that are to be amplified can be obtained using methods well known and documented in the art. For example, by obtaining nucleic acid such as, total DNA, genomic DNA, cDNA, total RNA, mRNA, etc. by methods well known and documented in the art and which generate fragments from them for example by limited digestion with restriction enzyme or by mechanical means. Typically, the nucleic acid to be amplified is first obtained in the double-stranded form. When the nucleic acid is provided in the form of a single strand, for example, the mRNA, it is first elaborated in a double-stranded form by means well known and documented in the art, for example, using oligo-dT primers and reverse transcriptase and DNA polymerase. Once the nucleic acid to be amplified is obtained in the form of a double strand of appropriate length, the oligonucleotide sequences corresponding to the oligonucleotide sequences Y and Z are linked to each end, for example to the 5 'and 3' ends of the nucleic acid. the nucleic acid sequence to form a nucleic acid template. This can be done using methods that are well known and documented in the art, for example by ligation, or by insertion of the nucleic acid to be amplified, within a biological vector at a site that is flanked by the appropriate oligonucleotide sequences. Alternatively, if at least part of the nucleic acid sequence to be amplified is known, the nucleic acid template containing the Y and Z oligonucleotide sequences at the 5 'and 3' ends respectively, can be generated by PCR using primers of appropriate PCRs which include specific sequences for the nucleic acid to be amplified. Prior to coupling the nucleic acid template to the solid support, it can be processed in a single-stranded form using methods that are well known and documented in the art, for example by heating to about 94 ° C and rapidly cooling to 0 ° C on ice. The oligonucleotide sequence contained at the 5 'end of the nucleic acid can be any sequence and any length, and is denoted herein as the Y sequence. Suitable lengths and sequences of the oligonucleotide can be selected using well known methods and. documented in the technique. For example, the oligonucleotide sequences coupled to each end of the nucleic acid to be amplified are usually relatively short nucleotide sequences between 5 and 100 nucleotides in length. The oligonucleotide sequence contained at the 3 'end of the nucleic acid can be of any sequence and any length, and is denoted herein as Z-sequence. Suitable lengths and sequences of the oligonucleotide can be selected using methods well known and documented in the art. . For example, the oligonucleotide sequences contained at each end of the nucleic acid to be amplified are usually relatively short nucleotide sequences between 5 and 100 nucleotides in length. The sequence of the oligonucleotide sequence Z is such that it can hybridize to one of the colonial primers X. Preferably, the sequence of the oligonucleotide sequence Y is such that this is the same as one of the colonial primers X. More preferably, the oligonucleotide sequence Z is complementary to the Oligonucleotide sequence Y (Y ') and the colonial primers X are of the same sequence as the oligonucleotide sequence Y. The oligonucleotide sequences Y and Z of the invention can be prepared using techniques that are standard or conventional in the art, or can be acquired from commercial sources. When the nucleic acid templates of the invention are produced, additional, desirable sequences can be introduced by methods well known and documented in the art. Such additional sequences include, for example, restriction enzyme sites or certain nucleic acid markers to enable the identification of amplification products of a given nucleic acid template sequence. Other desirable sequences include backfolding DNA sequences (which form hairpin curls or other secondary structures when made from a single strand), "control" DNA sequences which direct protein / DNA interactions, such as for example a promoter DNA sequence which is recognized by a nucleic acid polymerase or a DNA operator sequence that is recognized by a DNA binding protein.

If there is a plurality of nucleic acid sequences to be amplified, then the coupling of the Y and Z oligonucleotides can be carried out in the same or in a different reaction. Once a nucleic acid template has been prepared, it can be amplified before it is used in the methods of the present invention. Such amplification can be carried out using methods well known and documented in the art, for example by inserting the template nucleic acid into an expression vector and amplifying it in a suitable biological host, or amplifying it by PCR. This step of amplification is not essential, however, since the method of the invention allows multiple copies of the nucleic acid template to be produced in a nucleic acid colony generated from a single copy of the nucleic acid template. Preferably, the 5 'end of the nucleic acid template prepared as described above is modified to carry a means for coupling the nucleic acid templates covalently to a solid support. Such a medium can be, for example, a chemically modifiable functional group, such as, for example, a phosphate group, a carboxyl or aldehyde portion, a thiol, or an amino group. More preferably, the thiol, phosphate or amino group is used for the 5 'modification of the nucleic acid. The colonial primers of the invention can be prepared using techniques that are standard or conventional in the art. In general, the colonial primers of the present invention will be synthetic oligonucleotides generated by methods well known and documented in the art or can be purchased from commercial sources. According to the method of the invention, one or two different colonial X primers can be used to amplify any nucleic acid sequence. This contrasts with and has an advantage over many of the amplification methods known in the art such as, for example, that described in WO 96/04404, where different specific primers must be designed for each particular nucleic acid sequence that goes to be amplified. Preferably the 5 'ends of the colonial primers X of the invention are modified to carry a means for coupling the colonial primers covalently to the solid support. Preferably, this means for coupling or covalent bonding is a chemically modifiable functional group as described above. If desired, the colonial primers can be designed to include the additional desired sequences such as, for example, restriction endonuclease sites or other types of cleavage sites each as ribozyme cleavage sites. Other desirable sequences include backfolding DNA sequences (which form hairpin curls or other secondary structures when made from a single strand), "control" DNA sequences directing a protein / DNA interaction, such as for example a DNA promoter sequence which is recognized by a nucleic acid polymerase or a DNA operator sequence that is recognized by a DNA binding protein. Immobilization of a colonial primer X to a support at the 5 'end leaves its 3' end remote from the support such that the colonial primer is available for extension of the chain by a polymerase once hybridization with a complementary sequence of oligonucleotide contained in the 3 'end of the nucleic acid template has taken place. Once the nucleic acid templates and the colonial primers of the invention have been synthesized, they are mixed together in appropriate portions, so that when they are coupled to the solid support an appropriate density of the coupled templates is obtained. nucleic acid and the colonial primers. Preferably, the ratio of the colonial primers in the mixture is higher than the proportion of the nucleic acid templates. Preferably, the ratio of colonial primers to nucleic acid templates is such that when the colonial primers and nucleic acid templates are immobilized to the solid support, a "layer or turf" of colonial primers comprising a plurality of colonial primers is formed. which are located at an approximately uniform density over all or a defined area of the solid support, with one or more nucleic acid templates that are individually immobilized at intervals within the layer or turf of the colonial primers. The nucleic acid templates can be provided in the form of a single strand. However, these may also be provided totally or partially in double-stranded form, either with a 5 'end or with both ends 5' modified to allow coupling to the support. In that case, after completion of the coupling process, it may be desired to separate the strands by means known in the art, for example by heating to 94 ° C, before washing the strands released. It will be appreciated that in the case where both strands of the double-stranded molecules have reacted with the surface and are both coupled, the result will be the same as in the case when only one strand is coupled and an amplification step has been performed. In other words, in the case where both strands of a double-stranded template nucleic acid have been coupled, both strands are necessarily coupled to one another and are indistinguishable from the result of coupling only one strand and performing one amplification step. Thus, the single-stranded and double-stranded template nucleic acids can be used to provide template nucleic acids coupled to the surface, and suitable for the generation of colonies. The distance between the individual colonial primers and the individual nucleic acid templates (and therefore the density of the colonial primers and the nucleic acid templates) can be controlled by altering the concentration of the colonial primers and the template templates. nucleic acid that are immobilized to the support. A preferred density of the colonial primers is at least 1 fmol / mm2, preferably at least 10 fmol / mm2, more preferably between 30 to 60 fmol / mm2. The density of the nucleic acid templates for use in the method of the invention is typically 10., 000 / mm2 to 100,000 / mm2. It is believed that higher densities, for example from 100,000 / mm2 to 1,000,000 / mm2 and 1,000,000 / mm2 to 10,000,000 / mm2 can be achieved. The control of the density of the coupled nucleic acid templates and the colonial primers in turn allows the final density of the nucleic acid colonies on the surface of the support to be controlled to be controlled. This is due to the fact that according to the method of the invention, a nucleic acid colony can result from the coupling of a nucleic acid template, with the proviso that the colonial primers of the invention are present at a suitable site on the solid support (see in more detail later). The density of the nucleic acid molecules within a single colony can also be controlled by controlling the density of the coupled colonial primers. Once the colonial primers and nucleic acid templates of the invention have been immobilized on the solid support at the appropriate density, the nucleic acid colonies of the invention can then be generated by carrying out an appropriate number of amplification cycles. on the template nucleic acid, covalently linked, such that each colony comprises multiple copies of the original immobilized nucleic acid template and its complementary sequence. An amplification cycle consists of the steps of hybridization, extension and denaturation and these steps are generally performed using reagents and conditions well known in the art for PCR. A typical amplification reaction comprises attaching the solid support and the coupled nucleic acid template and the colonial primers to conditions that induce hybridization of the primer, for example by subjecting them to a temperature of about 65 ° C. Under these conditions the oligonucleotide sequence Z at the 3 'end of the nucleic acid template will hybridize to the immobilized colonial X primer and in the presence of conditions and reagents to support the extension of the primer, for example a temperature of about 72 ° C, the presence of a nucleic acid polymerase, for example, a DNA-dependent DNA polymerase or a reverse transcriptase molecule (eg, an RNA-dependent DNA polymerase, or an RNA polymerase, plus a supply of triphosphate molecules) of nucleoside or any other nucleotide precursors, for example modified nucleoside triphosphate molecules, the colonial primer will be extended by the addition of nucleotides complementary to the template nucleic acid sequence, examples of nucleic acid polymerases that can be used in the present invention are DNA polymerase (Kleno fragment, T4 DNA polymerase), stable DNA polymerases to heat from a variety of thermostable bacteria (such as Taq DNA polymerases, VENT, Pfu, Tfl) as well as their genetically modified derivatives (TaqGold, VENTexo, Pfu exo). A combination of RNA polymerase and reverse transcriptase can also be used to generate the amplification of a DNA colony. Preferably, the nucleic acid polymerase used for the extension of the colonial primer is stable under PCR reaction conditions, for example repeated cycles of heating and cooling, and is stable at the denaturation temperature used, usually about 94 ° C. preferably, the DNA polymerase used is Taq DNA polymerase.

Preferably, the nucleoside triphosphate molecules used are deoxyribonucleotide triphosphates, for example dATP, dTTP, dCTP, dGTP, or are ribonucleoside triphosphates, for example dATP, dUTP, dCTP, dGTP. The nucleoside triphosphate molecules may be of natural or non-natural origin. After the steps of hybridization and extension, when fastening the support and the nucleic acids coupled to the denaturing conditions, two immobilized nucleic acids will be present, the former being the initial immobilized nucleic acid template, and the latter being a nucleic acid. complementary to it, which extends from one of the immobilized X colonial primers. The immobilized, original nucleic acid template and the immobilized, extended, colonial primer formed are then capable of initiating additional rounds of amplification by clamping the support to additional cycles of hybridization, extension and denaturation. Such additional rounds of amplification will result in a nucleic acid colony comprising multiple immobilized copies of the template nucleic acid and its complementary sequence. The initial immobilization of the template nucleic acid means that the template nucleic acid can only hybridize with the colonial primers located at a distance within the total length of the template nucleic acid. In this way the boundary of the formed nucleic acid colony is limited to a relatively local area to the area in which the initial template nucleic acid was immobilized. Clearly, once more copies of the template molecule and its complement have been synthesized, by carrying out additional rounds of amplification, for example additional rounds of hybridization, extension and denaturation, then the limit of the nucleic acid colony that is generated it will be able to be further extended, although the boundary of the formed colony is still limited to a relatively local area to the area in which the initial nucleic acid template was immobilized. A schematic representation of a method of generating nucleic acid colonies according to an embodiment of the present invention is shown in Figure 1. Figure 1 (a) shows a colonial primer X of the invention (shown here as the one having the ATT sequence), and a nucleic acid template of the invention containing at the 5 'end an oligonucleotide sequence Y, shown here as ATT and at the 3' end an oligonucleotide sequence Z, shown here as AAT, which can hybridize to the sequence of the colonial primer X. In the schematic representation the colonial primer X and the oligonucleotide sequences Y and Z are shown as only three nucleotides in length. In practice, however, it will be appreciated that longer sequences could normally be used. The 5 'ends of the colonial primer and the nucleic acid template carry a means for coupling the nucleic acid to a solid support. This medium is denoted in Figure 1 as a black box. This coupling means can result in a covalent or a non-covalent bond. Only a colonial primer X and a template nucleic acid are shown in Figure 1 (a) for simplicity. However, in practice a plurality of colonial primers X with a plurality of nucleic acid templates will be present. The plurality of colonial primers X may comprise two different colonial primers X. However, for simplicity the schematic representation shown in Figure 1 shows only one type of colonial primer X, with the sequence ATT. The plurality of nucleic acid templates may comprise different nucleic acid sequences in the central portion between the Y and Z oligonucleotides, but may contain the same Y and Z oligonucleotide sequences at the 5 'and 3' ends respectively. Only one species of the nucleic acid template is shown for simplicity in Figure 1, in which a portion of the sequence in the central portion is shown as CGG. In the presence of a solid support, the 5 'ends of the nucleic acid template and the colonial primer are bound to the support. This is described in Figure 1 (b). The support and the coupled nucleic acid template and the colonial primers are then subjected to conditions that induce hybridization of a primer. Figure 1 (c) shows a nucleic acid template that has hybridized to a colonial primer. Such hybridization is made possible by virtue of the fact that the oligonucleotide sequence Z at the 3 'end of the nucleic acid template can hybridize to the colonial primer. In the schematic representation, the oligonucleotide sequence Z is shown to be complementary to the colonial primer, although in practice an exact complementary sequence is not essential, with the proviso that hybridization can occur under the conditions to which the templates are subjected. nucleic acid and the colonial primers.

Figure 1 (d) shows the extension step of the primer. Here, under appropriate temperature conditions and in the presence of a DNA polymerase and a supply of nucleotide precursors, for example dATP, dTTP, dCTP and dGTP, LA DNA polymerase extends the colonial primer from its 3 'end using the acid template nucleic as a template. When the extension of the primer is complete, see Figure 1 (e), it can be seen that a second strand of immobilized nucleic acid has been generated which is complementary to the initial nucleic acid template. In the separation of the two strands of nucleic acid for example by heating, two immobilized nucleic acids will be present, the first being the initial immobilized nucleic acid template and the second being a nucleic acid complementary to it, extending from one of the primers. colonial X immobilized, see Figure 1 (f). The immobilized, original nucleic acid template and the immobilized, extended, colonial primer formed are then capable of hybridizing to other colonial primers present (described as colonial primers 2 and 3 in Figure 1 (g)) and after an additional round of primer extension (Figure 1 (h)) and separation of the strand (Figure 1 (i)), four immobilized strands of a single strand are provided. Two of these contain sequences corresponding to the original nucleic acid template and two contain sequences complementary thereto. Additional rounds of amplification beyond those shown in Figure 1 can be carried out to result in a nucleic acid colony comprising multiple immobilized copies of the template nucleic acid and its complementary sequence. It can be observed in this way that the method of the present invention allows the generation of a nucleic acid colony from a simple immobilized nucleic acid template, and that the size of these colonies can be controlled by altering the number of rounds of amplification to which the nucleic acid template is attached. In this way, the number of nucleic acid colonies formed on the surface of the solid support is dependent on the number of nucleic acid templates that are initially immobilized to the support, provided that there is a sufficient number of immobilized colonial primers within the location of each immobilized nucleic acid template. It is for this reason that preferably the solid support to which the colonial primers and nucleic acid templates have been immobilized, comprises a layer or turf of immobilized colonial primers at an appropriate density with the nucleic acid templates immobilized at intervals within the layer or lawn of primers. The so-called "self-forming pattern" of the nucleic acid colonies has an advantage over many methods of the prior art, since a higher density of nucleic acid colonies can be obtained due to the fact that the density can be controlled by the regulation of the density at which the nucleic acid templates are originally immobilized. Thus, such a method is not limited, for example, by having to specifically accommodate or arrange specific primers on particular local areas of the support, and then initiate colonial formation by placing a point of a particular sample containing the template of nucleic acid on the same local area of the primer. The numbers and colonies that can be accommodated using the methods of the prior art, for example those described in WO96 / 04404 (Mosaic Technologies, Inc.) are thus limited by the density / spacing at which the areas of interest can be accommodated. the specific primers in the initial step. By making possible the control of the initial density of the nucleic acid templates and therefore the density of the resulting nucleic acid colonies of the nucleic acid templates, together with the ability to control the size of the nucleic acid colonies formed, and in addition to the density of the nucleic acid templates within the individual colonies, an optimum situation can be reached where the high density of the acid colonies Individual nucleic acids can be produced on a solid support of a sufficiently large size, and they contain a sufficiently large number of amplified sequences to enable subsequent analysis or periodic verification on the nucleic acid colonies. Once the nucleic acid colonies have been generated, it may be desirable to carry out an additional step such as for example visualization of the colony or determination of the sequence (see below). The visualization of the colony may for example be required if it were necessary to select the colonies for the presence or absence for example of all or part of a particular fragment of nucleic acid. In this case, the colony or colonies containing the particular nucleic acid fragment, could be detected by the design of a nucleic acid probe which hybridizes specifically to the nucleic acid fragment of interest. Such a nucleic acid probe is preferably labeled with a detectable entity such as a fluorescent group, a biotin-containing entity (which can be detected for example by an incubation with streptavidin labeled with a fluorescent group), a radiolabel (which can be incorporated into a nucleic acid probe by methods well known and documented in the art, and detected by detection with radioactivity, for example by incubation with scintillation fluid), or a dye or other staining agent. Alternatively, such a nucleic acid probe may be unlabelled and designed to act as a primer for the incorporation of a number of nucleotides labeled with a nucleic acid polymerase. The detection of the incorporated marker and thus the nucleic acid colonies can then be carried out. The nucleic acid colonies of the invention are then prepared for hybridization. Such preparation involves the treatment of the colonies so that all or part of the nucleic acid templates constituting the colonies are present in a single-stranded form. This can be achieved for example by heat denaturing any double-stranded DNA in the colonies. Alternatively, the colonies can be treated with a restriction endonuclease specific for a double-stranded form of a sequence in the template nucleic acid. Thus, the endonuclease can be specific to either a sequence contained in the Y or Z oligonucleotide sequences or another sequence present in the template nucleic acid. After digestion the colonies are heated, so that the double-stranded DNA molecules are separated and the colonies are washed to remove the non-immobilized strands, thus leaving the single-stranded DNA, coupled, in the colonies. After preparation of the colonies for hybridization, the labeled or non-labeled probe is then added to the colonies under conditions suitable for hybridization of the probe with its specific DNA sequence. Such conditions can be determined by a person of ordinary skill in the art using known methods, and will depend for example on the sequence of the probe. The probe can then be removed by thermal denaturation and, if desired, a probe specific for a second nucleic acid can be hybridized and detected. These steps can be repeated as many times as desired. The labeled probes that are hybridized to the nucleic acid colonies can then be detected, using apparatuses including an appropriate detection device. A preferred detection system for fluorescent markers is a charge coupled device (CCD) camera, which can optionally be coupled to an amplification device, for example a microscope. Using such technology it is possible to periodically verify many colonies in parallel simultaneously. For example, using a microscope with a CCD camera and an Lx or 20x objective, it is possible to observe colonies on a surface between 1 mm2 and 4 mm2, which corresponds to the periodic verification between 10,000 and 200,000 colonies in parallel. In addition, it is anticipated that this number will increase with the larger, improved optical microcircuits.

An alternative method of periodic verification of the colonies generated is to select the area covered with the colonies. For example, systems in which up to 100,000,000 colonies could be accommodated simultaneously and verified by taking photographs by the CCD camera over the entire surface can be used. In this way, it can be observed that up to 100 000 000 colonies could be checked periodically in a short time. Any other devices that allow the detection and preferably the quantification of fluorescence on a surface can be used to periodically verify the nucleic acid colonies of the invention. For example, fluorescent imagers or confocal microscopes could also be used. If the markers are radioactive, then a radioactivity detection system would be required. In the methods of the present invention, wherein the additional step of performing at least one step of determining the sequence of at least one of the generated nucleic acid colonies is performed, the determination of the sequence can be carried out using any appropriate solid phase sequencing technique. For example, a sequence determination technique that can be used in the present invention involves the hybridization of an appropriate primer, sometimes referred to herein as "sequencing primer," to the nucleic acid template to be sequenced. , which extends the primer and detects the nucleotides used to extend the primer. Preferably, the nucleic acid used to extend the primer is detected before an additional nucleotide is added to the growing nucleic acid strand, thereby allowing for the sequencing of the nucleic acid in si t u, base by base. The detection of the incorporated nucleotides is facilitated by the inclusion of one or more labeled nucleotides in the primer extension reaction. Any detectable, appropriate marker, for example a fluorophore, radiolabel, etc. may be used. Preferably, a fluorescent label is used. The same or different markers can be used for each different type of nucleotide. Where the marker is a fluorophore and the same labels are used for each different type of nucleotide, each nucleotide incorporation can provide a cumulative increase in the detected signal at a particular wavelength. If different markers are used, then these signals can be detected at different appropriate wavelengths. If desired, a mixture of labeled and unlabeled nucleotides is provided. In order to allow hybridization of an appropriate sequencing primer to the nucleic acid template to be sequenced, the nucleic acid template should normally be a single-stranded form. If the nucleic acid templates constituting the nucleic acid colonies are present in a double-stranded form, these can be processed to provide the single-stranded nucleic acid templates, using methods well known in the art, for example by denaturing , excision, etc. Sequencing primers that are hybridized to the nucleic acid template and used for extension of the primer are preferably short oligonucleotides, for example 15 to 25 nucleotides in length. The sequence of the primers is designed so that they hybridize to part of the nucleic acid template to be sequenced, preferably under stringent conditions. The sequence of the primers used for the sequencing may have the same or similar sequences to that of the colonial primers used to generate the nucleic acid colonies of the present invention. Sequencing primers may be provided in solution or in an immobilized form. Once the sequencing primer has been annealed to the nucleic acid template to be sequenced, by subjecting the nucleic acid template and the sequencing primer to appropriate conditions, determined by methods well known in the art, primer extension is carried out, for example using a nucleic acid polymerase and a nucleotide supply, at least some of which are provided in a labeled form, and suitable conditions are provided for the extension of the primer if a suitable nucleotide is provided. Examples of nucleic acid polymerase and nucleotides that can be used are described above. Preferably, after each step of extension of the primer, a washing step is included in order to remove unincorporated nucleotides which can interfere with the subsequent steps. Once the primer extension step has been carried out, the nucleic acid colony is checked periodically in order to determine whether a labeled nucleotide has been incorporated into an extended primer. The primer extension step can then be repeated in order to determine the subsequent and subsequent nucleotides incorporated into an extended primer. Any device that allows the detection, and preferably the quantification of the appropriate marker, for example fluorescence or radioactivity, can be used for the determination of the sequence. If the marker is fluorescent, a CCD camera optionally coupled to an amplification device (as described above) can be used. In fact, the devices used for the sequence determination aspects of the present invention may be the same as those described above for periodically verifying the amplified nucleic acid colonies. The detection system is preferably used in combination with an analysis system in order to determine the number and nature of the nucleotides incorporated in each colony after each step of extension of the primer. This analysis, which can be carried out immediately after each step of extension of the primer, or after using recorded data, allows the sequence of the nucleic acid template to be determined within a given colony. If the sequence that is determined is unknown, the nucleotides applied to a given colony are usually applied in a chosen order that is then repeated throughout the analysis, for example dATP, dTTP, dCTP, dGTP. However, if the sequence that is determined is known and is being resected, for example to analyze whether or not small differences in the sequence are present from the known sequence, the process of determining the sequence can be performed faster by the addition of the nucleotides in each step in the appropriate order, chosen according to the known sequence. The differences from the given sequence are thus detected by the lack of incorporation of certain nucleotides in particular steps of the extension of the primer. Thus, it can be seen that complete or partial sequences of amplified nucleic acid templates that constitute particular nucleic acid colonies can be determined using the methods of the present invention.

In a further embodiment of the present invention, the complete or partial sequence of more than one nucleic acid can be determined by determining the complete or partial sequence of the amplified nucleic acid templates present in more than one nucleic acid colony. Preferably a plurality of sequences is determined simultaneously. In carrying out the sequential determination of nucleic acids using the method of the present invention, it has the advantage that it is likely to be very reliable due to the fact that large numbers of each nucleic acid to be sequenced are provided within of each nucleic acid colony of the invention. If desired, further improvements in reliability can be obtained by providing a plurality of nucleic acid colonies comprising the same nucleic acid template to be sequenced, then determining the sequence for each of the plurality of colonies, and comparing the sequences determined in this way. Preferably, the coupling of the colonial primer and the nucleic acid template to the solid support is thermostable at the temperature at which the support can be subjected during the nucleic acid amplification reaction, for example, temperatures of up to about 100 ° C. , for example about 94 ° C. Preferably, the coupling or linkage is covalent in nature. In a further embodiment of the invention, the covalent linkage of the colonial primers and the nucleic acid template (s) to the solid support is induced by a cross-linking agent such as, for example, l-ethyl-3- (3- dimethylaminopropyl) -carbodiimide (EDC), succinic anhydride, phenyldiisothiocyanate or maleic anhydride, or a hetero-bifunctional crosslinker such as for example m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), N-succinimidyl [4-iodoacetyl] aminobenzoate] ( SIAB), 4- [N-maleimidomethyl] -cyclohexane-1-succinimidyl carboxylate (SMCC), Ny-maleimidobutyryloxy-succinimide ester (GMBS), succinimidyl-4- [p-maleimidophenyl] butyrate (SMPB) and the compounds corresponding sulfo (soluble in water). Preferred crosslinking reagents for use in the present invention are s-SIAB, s-MBS and EDC. In a further embodiment of the invention, the solid support has a derivatized surface. In a further embodiment, the derivatized surface of the solid support is subsequently modified with bifunctional crosslinking groups to provide a functionalized surface, preferably with reactive crosslinking groups. "Derivatized surface" as used herein refers to a surface that has been modified with chemically reactive groups, for example amino, thiol or acrylate groups. "Functionalized surface" as used herein refers to a derivatized surface that has been modified with specific functional groups, for example the maleic or succinic functional portions. In the method of the present invention, to be useful for certain applications, the binding or coupling of colonial primers and nucleic acid templates to a solid support has to meet various requirements. The ideal link or coupling should not be affected either by exposure to high temperatures and the repeated heating / cooling cycles employed during the nucleic acid amplification procedure. In addition, the support should allow obtaining a density of bound colonial primers of at least 1 fmol / mm 2, preferably of at least 10 fmol / mm 2, more preferably between 30 to 60 fmol / mm 2. The ideal support should have a uniformly flat surface with low fluorescence background and should also be thermally stable (non-deformable). Solid supports, which allow the passive adsorption of DNA, as in certain types of plastic and synthetic nitrocellulose membranesThey are not adequate. Finally, the solid support must be disposable, so it should not be a high cost. For these reasons, although the solid support can be any solid surface to which nucleic acids can be linked or coupled, such as for example latex spheres, dextran spheres, polystyrene, polypropylene surface, polyacrylamide gel, gold surfaces , glass surfaces and silicon wafers, preferably the solid support is a glass surface and the coupling or binding of the nucleic acids to it is a covalent bond. The covalent linkage of the colonial primers and the nucleic acid templates to the solid support can be carried out using techniques that are known and documented in the art. For example, the epoxysilane-amino covalent bond of the oligonucleotides on solid supports such as porous glass spheres has been widely used for synthesis in the solid phase of the oligonucleotides (via a link or coupling of the 3 'end) and has been also adapted for the oligonucleotide coupling at the 5 'end. Oligonucleotides modified at the 5 'end with carboxyl or aldehyde moieties have been covalently linked onto latex beads derivatized with hydrazine (Kremsky et al., 1987). Other methods for linking oligonucleotides to the solid surfaces use crosslinkers, such as succinic anhydride, phenyldiisothiocyanate (Guo et al., 1994), or maleic anhydride (Yang et al., 1998). Another widely used crosslinker is l-ethyl-3- (3-dimethylaminopropyl) -carbodiimide hydrochloride (EDC). The chemistry of the EDC was first described by Gilham et al. (1968) who docked DNA templates to paper (cellulose) via a terminal phosphate group at the 5 'end. Using the chemistry of the EDC, other supports such as latex spheres (Wolf et al., 1987, Lund et al., 1988), polystyrene microwells (Rasmussen et al., 1991), controlled pore glass (Ghosh et al. 1987) and dextran molecules (Gingeras et al., 1987). The condensation of the 5'-amino modified oligonucleotides with the carbodiimide-mediated reagent has been described by Chu et al. (1983), and Egan et al. (1982) for the phosphate modification group at the 5 'end. The coupling performance of the oligonucleotide via the 5 'ends using carbodiimides can reach 60%, but the non-specific binding via the internal nucleotides of the oligonucleotide is a major drawback. Rasmussen et al. (1991) have increased the specific binding via the 5 'end to 85% by derivatization of the surface using secondary amino groups. More recent documents have reported the advantages of hetero-bifunctional crosslinkers. Hetero- or mono-bifunctional crosslinkers have been widely used to prepare molecules conjugated to a peptide carrier (peptide-protein) in order to increase immunogenicity in animals (Peeters et al., 1989). Most of these grafting reagents have been described to form stable covalent bonds in aqueous solution. These crosslinking reagents have been used to bind DNA on a solid surface only at one point in the molecule.

Chrisey et al. (1996) studied the efficiency and stability of solid-phase DNA binding using 6 different hetero-bifunctional crosslinkers. In this example, the linkage occurs only at the 5 'end of the DNA oligomers modified by a thiol group. This type of link has also been described by 0 'Donnell-Maloney et al. (1996) for the linking of DNA targets in a MALDI-TOF sequence analysis and by Hamamatsu Photonics F.K. company (EP-A-665293) for the determination of the nucleic acid base sequence on a solid surface. Very few studies concerning the thermal stability of the bond of the oligonucleotides to the solid support have been carried out. Chrisey et al. (1996) reported that with succinimidyl-4- [p-maleimidophenyl] butyrate (SMPB) as a crosslinker, almost 60% of the molecules are released from the glass surface during heat treatment. But the thermal stability of the other reagents has not been described. In order to generate nucleic acid colonies via the solid phase amplification reaction as described in the present application, the colonial primers and nucleic acid templates need to be specifically linked at their 5 'ends to the solid surface, preferably of glass. In summary, the glass surface can be derivatized with reactive amino groups by silanization using amino-alkoxysilanes. Suitable silane reagents include aminopropyltrimethoxysilane, aminopropyltriethoxysilane and 4-aminobutyltriethoxysilane. The glass surfaces can also be derivatized with other reactive groups, such as acrylate or epoxy using epoxysilane, acrylates and acrylamidesilane. After the derivatization step, the nucleic acid molecules (colonial primers or nucleic acid templates) having a chemically modifiable functional group at their 5 'end, for example phosphate, thiol or amino groups are covalently linked to the derivatized surface by a crosslinking reagent such as those described above. Alternatively, the derivatization step can be followed by the linking of a bifunctional crosslinking reagent to the surface amino groups, with which a modified, functionalized surface is provided. Nucleic acid molecules (colonial primers or nucleic acid templates) having 5'-phosphate, thiol or amino groups are then reacted with the functionalized surface by forming a covalent bond between the nucleic acid and the glass. Potential crosslinking and grafting reagents that can be used for the covalent insertion of DNA / oligonucleotide onto the solid support include succinic anhydride, (l-ethyl-3 [3-dimethylaminopropyl] carbodiimide hydrochloride (EDC), m-maleimidobenzoyl ester -N-hydroxysuccinimide (MBS), N-succinimidyl- [4-iodoacetyl] aminobenzoate (SIAB), 4- [N-maleimidomethyl] cyclohexan-1-succinimidyl carboxylate (SMCC), Ny-maleimidobutyryloxy-succinimide ester (GMBS) ), succinimidyl-4- [p-maleimidophenyl] butyrate (SMPB) and the corresponding sulfo compounds (water soluble) The preferred crosslinking reagents, according to the present invention, are s-SIAB, s-MBS and EDC s-MBS is a hetero-bifunctional maleimide-succinimide cross-linker and s-SIAB is a hetero-bifunctional cross-linker of iodoacetylsuccinimide, both capable of forming a covalent bond respectively with SH groups and primary amino groups. reagent c arbodiimide which is mediator of the covalent bond of the phosphate and amino groups.

Colonial primers and nucleic acid templates are generally modified at the extreme 'by a phosphate group or by a primary amino group (for EDC grafting reagent) or a thiol group (for s-SIAB or s-MBS crosslinkers). Thus, a further aspect of the invention provides a solid support, to which is attached a plurality of colonial primers X as described above and at least one nucleic acid template as described above, wherein said nucleic acid templates contain at their 5 'ends an oligonucleotide sequence Y as described above, and at its 3 'ends an oligonucleotide sequence Z as described above. Preferably, a plurality of nucleic acid templates are linked to the solid support, which is preferably glass. Preferably, the binding or coupling of the nucleic acid templates and the colonial primers to the solid support is covalent. By performing one or more rounds of nucleic acid amplification on the immobilized nucleic acid template (s) using methods as described above, the nucleic acid colonies of the invention can be formed. A further aspect of the invention is, therefore, a support comprising one or more nucleic acid colonies of the invention. A further aspect of the present invention provides the use of the solid supports of the invention in nucleic acid amplification or sequencing methods. Such nucleic acid amplification or sequencing methods include the methods of the present invention. A further aspect of the invention provides the use of a derivatized or functionalized support, prepared as described above, in nucleic acid amplification or sequencing methods. Such nucleic acid amplification or sequencing methods include the methods of the present invention. A further aspect of the invention provides an apparatus for carrying out the methods of the invention or an apparatus for producing a solid support comprising the nucleic acid colonies of the invention. Such an apparatus may, for example, comprise a plurality of nucleic acid templates and colonial primers of the invention linked, preferably covalently, to a solid support as described above, together with a nucleic acid polymerase, a plurality of nucleotide precursors such as those described above, a proportion of which may be marked, and a means to control the temperature. Alternatively, the apparatus may comprise for example a support comprising one or more nucleic acid colonies of the invention. Preferably, the apparatus also comprises a detection means for detecting and distinguishing signals from individual colonies of nucleic acid accommodated on the solid support according to the methods of the present invention. For example, such detection means may comprise a device coupled to the load, operably connected to an amplification device such as a microscope as described above. Preferably, any apparatuses of the invention are provided in an automatic manner. The present application provides a solution to current and emerging needs that scientists and the biotechnology industry are trying to overcome in the genomic, pharmacogenomics, drug discovery, food characterization and genotyping fields. Thus, the method of the present invention has potential application for example in: sequencing and re-sequencing of nucleic acid, diagnosis and selection, periodic verification of gene expression, profiling of genetic diversity, discovery and classification of genomic polymorphism , the creation of genome slides (the complete genome of a patient on a microscope slide) and the sequencing of the entire genome. In this way, the present invention can be used to carry out the sequencing and re-sequencing of nucleic acid, where for example a selected number of genes are specifically amplified in colonies for the complete DNA sequencing. The re-sequencing of the gene allows the identification of all known or novel genetic polymorphisms, of the genes investigated. The applications are in the medical diagnosis and in the genetic identification of living organisms. For the use of the present invention in diagnosis and selection, whole genomes or fractions of genomes can be amplified in colonies for DNA sequencing of known single nucleotide polymorphisms (SNPs). The identification . of SNP has application in medical genetic research to identify genetic risk factors associated with diseases. SNP genotyping will also have pharmacogenomic diagnostic applications for the identification and treatment of patients with specific medications. For the use of the present invention in the profiling of genetic diversity, populations for example of organisms or cells or tissues, can be identified by amplifying the sample DNA within the colonies, followed by the sequencing of the DNA of the "markers". "specific for each individual genetic entity. In this way, the genetic diversity of the sample can be defined by counting the number of markers from each individual entity. For the use of the present invention in the periodic verification of gene expression, mRNA molecules expressed from a tissue or organism under investigation, are converted to cDNA molecules which are amplified in groups of colonies for DNA sequencing. The frequency of colonies encoding a given mRNA is proportional to the frequency of the mRNA molecules present in the initial tissue. The applications of the periodic verification of gene expression are in biomedical research.

A complete genome slide, where the complete genome of a living organism is represented in a number of DNA colonies numerous enough to comprise all the sequences of that genome, can be prepared using the methods of the invention. The genome slide is the genomic card of any living organism. Genetic cards have applications in medical research and in the genetic identification of living organisms of industrial value. The present invention can also be used to carry out the sequencing of the complete genome, where the complete genome of a living organism is amplified as groups of colonies for the sequencing of extensive DNA. The sequencing of the complete genome allows, for example, 1) an accurate identification of the genetic strain of any living organism; 2) discover the new genes encoded within the genome and 3) discover the new genetic polymorphisms. The applications of the present invention are not limited to an analysis of nucleic acid samples from the organism / patient. For example, nucleic acid markers can be incorporated into nucleic acid templates and amplified, and different nucleic acid markers can be used for each organism / patient. Thus, when the amplified nucleic acid sequence is determined, the marker sequence can also be determined and the origin of the sample identified. Thus, a further aspect of the invention provides the use of the methods of the invention, or the nucleic acid colonies of the invention, or the plurality of nucleic acid templates of the invention, or the solid supports of the invention, to provide nucleic acid molecules for sequencing and re-sequencing, periodic verification of gene expression, profiling of genetic diversity, diagnosis, selection, complete genome sequencing, discovery of the complete genome polymorphism and classification and preparation of genomic slides complete (for example, the complete genome of an individual on a support), or any other applications involving nucleic acid amplification or sequencing thereof. A further aspect of the invention provides equipment for use in the sequencing, re-sequencing, periodic verification of gene expression, profiling of genetic diversity, diagnosis, selection, complete genome sequencing, discovery and classification of genome polymorphism complete, or any other applications that involve the amplification of nucleic acids or the sequencing thereof. This equipment comprises a plurality of nucleic acid templates and colonial primers of the invention linked to a solid support, as described above. The invention will now be described in greater detail in the following non-limiting Examples, with reference to the following drawings in which: Figure 1: shows a schematic representation of a method of generating nucleic acid colonies according to an embodiment of the invention . Figure 2: a schematic representation of the preparation of the template and the subsequent link to the solid surface. In Figure 2a the preparation of Templates A, B and B 'containing the sequences of the colonial primer, is shown. The 3.2 kb template is generated from the genomic DNA using the PCR, TP1 and TP2 primers. Templates A (854 base pairs) and B (927 base pairs) are generated using the PCR primers TPA1 / TPA2 or TPB1 / TPB2, respectively. The oligonucleotides TPA1 and TPB1 are modified at their 5 'ends with either a phosphate or thiol group for the subsequent chemical bond (*). Note that the templates obtained contain sequences corresponding to the colonial primers CP1 and / or CP2. The 11 exons of the gene are reported as "El a Eli". In Figure 2b the chemical bond of the colonial primers and templates to the glass surface, it is shown. Derivatization by ATS (aminopropyltriethoxysilane) is exemplified. Figure 3: DNA colonies generated from a colonial primer. This shows the number of colonies observed per 20X field, as a function of the concentration of the template bound to the well. The lowest concentration of the detectable template corresponds to 10"13 M. Figure 4: representation of the discrimination between colonies originated from two different templates Figure 4a shows the images of colonies elaborated from templates and negative controls. Figure 4b shows the colonies from both templates in the same position and in the same well visualized with two different colors and negative controls Figure 4c shows the coordinates of the colonial types in a subsection of a microscope field Figure 4c shows that the colonies from different templates do not coincide Figure 5: Reaction diagrams of the template or oligonucleotide bond on glass Step A is the derivatization of the surface: the glass slides are treated with acid solution to increase the free hydroxyl group On the surface, the pre-treated slides are immersed in an aminosil solution ATS: aminopropyltriethoxysilane. Step B: Bl or B2 is the functionalization of the glass surface with the crosslinkers, followed by the bonding of the oligonucleotide. The amino group reacts with a crosslinking agent via an amide bond: Step Bl; s-MBS (sulfo-m-maleimidobenzoyl-N-hydroxy-succinimide ester) step B2; s-SIAB (sulfo-N-succinimidyl [4-iodoacetyl] aminobenzoate.) Oligonucleotides (thiol-modified oligonucleotide at the 5 'end) are bound to the surface by the formation of a covalent bond between the thiol and the double Maleimide bond Phosphate buffered saline: (PBS, 0.1 M NaH2P04, pH: 6.5, 0.15 M NaCl) B3: linkage of the oligonucleotides using EDC and imidazole Phosphate from the 5 'end of the modified oligonucleotides reacts with the imidazole in the presence of EDC to give the 5'-phosphorimidazolide derivatives (not shown) Derivatives form a phosphoramidate linkage with amino groups on the derivatized glass surface EDC: l-ethyl-3- (3-dimethyl) hydrochloride aminopropyl) -carbodimide Figure 6: this shows the number of colonies observed per 20X field as a function of the concentration of the template bound to the well.The DNA template was bound at a different concentration either by means of the reagent mediated coupling (EDC) on the glass surface derivatized with amino (A) or on the glass surface functionalized with s-MBS (B). The double-stranded DNA colonies were subjected to restriction enzyme and the recovered single strands were hybridized with a complementary oligonucleotide, fluorescently labeled with cy5. Figure 7: shows an example of the sequencing in si tu from the DNA colonies generated on glass. Figure 7A shows the result after incubation with Cy5MR-dCTP on a sample that has not been incubated with the pl? L primer. Only 5 fuzzy spots will be seen, indicating that the dramatic spurious effect is not taking place (such as the precipitation of the Cy5MR-dCTP aggregate, adsorption or simply the non-specific incorporation to the DNA in the colonies or on the surface). Figure 7B shows the result after incubation with CytMR-dUTP on a sample that has been incubated with the pl81 primer. It will be appreciated that the fluorescent spot can not be observed, indicating that the incorporation of a fluorescent base can not take place in detectable amounts when the nucleotide proposed for incorporation does not correspond to the sequence of the template after the hybridized primer. Figure 7C shows the result after incubation with CytMR-dCTP on a sample that has been incubated with the pl81 primer. It will be appreciated that many fluorescent spots can be observed, indicating that the incorporation of a fluorescent base can of course take place in detectable amounts when the proposed nucleotide for incorporation does correspond to the sequence of the template after the hybridized primer. Figure 8: shows the hybridization of the probes to the oligonucleotides coupled to Nucleolink, before and after the PCR cycles. The figure shows the hybridization of R58 to CP2 (5 '- (phosphate) -TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) closed circles, CP8 (5' - (amino-hexamethylene) - TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) closed triangles, CP9 (5 '- (hydroxyl) -TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) diamonds , CP10 (5 '- (dimethoxytrityl) - TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) open circles and CPU (5'- (biotin) -TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) open triangles.

EXAMPLES EXAMPLE 1: Preparation of DNA templates suitable for the generation of DNA colonies DNA colonies have been generated from DNA templates and colonial primers. The term "colonial primer sequence" as used herein, refers to a sequence corresponding to the sequence of a colonial primer and is hereafter sometimes referred to as "oligonucleotide sequence Y" or "oligonucleotide sequence Z". The properties of the colonial primers have been chosen based on a selection of the oligonucleotide primers that show little non-specific nucleotide incorporation in the presence of the heat-stable DNA polymerases. The colonial primers, CPa- (5'-p-CACCAACCCAAACCAACCCAAACC) and CPß- (5'-p-AGAAGGAGAAGGAAAGGGAAAGGG) have been selected due to their low incorporation of radiolabelled [a32p-dCTP] in the presence of a stable DNA polymerase (AmpliTaq , Perkin Elmer, Foster City, CA) in the standard buffer and under thermocycling conditions (94 ° C for 30 seconds, 65 ° C for 1 minute, 72 ° C for 2 minutes, 50 cycles). A 3.2 Kb DNA fragment was taken as a model system to demonstrate the feasibility of generating colonies using colonial primers and DNA templates. The template chosen comprises the human gene for the receptor for the advanced glycation end products (HUMOXRAGE, GenBank Acc. No. D28769). The specific RAGE primers are described in Table 1. The 3.2 Kb template was generated by PCR amplification from 0.1 μg of human genomic DNA with 1 μM of primers TP1 and TP2 with 1 unit of DNA polymerase ( AmpliTaq, Perkin Elmer, Foster City, CA) in the standard buffer and under thermocycling conditions (94 ° C for 30 seconds, 65 ° C for 1 minute, 72 ° C for 5 minutes, 40 cycles). This 3.2 Kb DNA fragment was used as a template for the secondary PCR to generate two shorter templates for the generation of the colony (Templates A and B). The primers used to generate the shorter templates contain both template-specific sequences and the sequences of the colonial primers CP1 and CP2 to amplify the DNA on the solid surface. In general, the PCR primer used to generate a DNA template is modified at the 5 'end with either a phosphate or thiol moiety. Thus, after PCR amplification, DNA fragments containing the colonial primer sequences at one or both ends are generated, joining the RAGE DNA fragment of interest (see Figure 2a). Template A (double-stranded template containing the colonial primer sequence, CPß at both ends) was generated with 0.1 ng of the 3.2 Kb template with 1 μM of the TPA1 primers and 1 μM of TPA2 with 1 unit of DNA- polymerase (AmpliTaq, Perkin Elmer, Foster City, CA) in the standard buffer and under thermocycling conditions (94 ° C for 30 seconds, 65 ° C for 1 minute, 72 ° C for 1 minute, 30 cycles). The products were then purified on Qiagen Qiagen columns (Qiagen GmbH, Hilden, Germany). Template B (double-stranded template containing the colonial primer sequences corresponding to CPß) was generated with 0.1 ng of the 3.2 Kb template with 1 μM of the TPBl primers and 1 μM of TPB2 with 1 DNA-polymerase unit ( AmpliTaq, Perkin Elmer, Foster City, CA) in the standard buffer and under thermocycling conditions (94 ° C for 30 seconds, 65 ° C for 1 minute, 72 ° C for 1 minute, 30 cycles). The products were then purified on Qiagen Qiagen columns (Qiagen GmbH, Hilden, Germany). Template B '(double-stranded template containing the colonial primer sequences corresponding to CPa and CPß at either end) was generated with 0.1 ng of the 3.2 Kb template with 1 μM of the TPB3 primers and 1 μM of TPB4 with 1 unit of (AmpliTaq, Perkin Elmer, Foster City, CA) in the standard buffer and under thermocycling conditions (94 ° C for 30 seconds, 65 ° C for 1 minute, 72 ° C for 1 minute, 30 cycles). The products were then purified on Qia-quick Qiagen columns (Qiagen GmbH, Hilden, Germany). All the specific oligonucleotides used for the preparation of the DNA templates and for the generation of the DNA colonies have been reported in Table 1 together with any chemical modification. A general scheme showing the chemical linkage of the colonial primers and of the templates to the glass surface is reported in Figure 2b, where the derivatization by ATS (aminopropyltriethoxysilane) is reported as a non-limiting example. TABLE 1 List of oligonucleotides used for the preparation of the templates and the generation of colonies: The coordinates from the HUMOXRAGE gene, with access number D28769 (R) means "inverse" and (F) means "forward" EXAMPLE la: Preparation of a random DNA template flanked by a degenerate primer A DNA fragment of 3.2 Kb was taken as a model system to demonstrate the feasibility of generating colonies from PCR amplification of the random primer. This strategy can be applied to the sequencing of DNA fragments of approximately 100 Kb in length and, by combining fragments to the complete genomes. A 3.2 Kb DNA fragment was generated by PCR from human genomic DNA using the PCR primers; TP1 5 '-pGAGGCCAGAACAGTTCAAGG and TP2 5'-pCCTGTGACAAGACGACTGAA as described in Example 1. The 3.2 Kb fragment was cut into smaller fragments by a combination of the restriction enzymes (EcoRI and Hhal yielding 4 fragments of approximately 800 pairs of bases) . The DNA fragments cut or not cut were then mixed with the degenerate primer, p252 (5'-P TTTTTTTTTTISISISISISIS, where I means inosine (which pairs with A, T and C) and S means G or C) and covalently coupled to the Nucleolink wells (Nunc, Denmark). The tubes were then subjected to random amplification by solid phase PCR and visualized by hybridization with the labeled DNA probes, as will be described in Example 2a.

EXAMPLE 2: Covalent linkage of DNA templates and colonial primers on the solid support (plastic) and colony formation with a colonial primer Covalent bond of the template and the colonial primer to the solid support (plastic) A colonial primer (CP2, 5'TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG), phosphorylated at its 5 'end (Microsynth GmBH, Switzerland), was coupled onto Nucleolink plastic microtiter wells (Nunc, Denmark) in the presence of varying doses of Template A (prepared as it is described in Example 1). Eight wells were established in duplicate with seven 1/10 dilutions of the template with CP2, beginning with the highest concentration of 1 nM. The microtiter wells to which the CP2 colonial primer and the template were covalently linked were prepared as follows. In each Nucleolink well, 30 μl of a 1 μM solution of the colonial primer was added with varying concentrations of the diluted dilution template from 1 nM in 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals). To each well, 10 μl of 40 mM l-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-imidazole was added to the solution of the colonial primer and Of the template. The wells were then sealed and incubated at 50 ° C overnight. After incubation, the wells were rinsed twice with 200 μl of RS (0.4 N sodium hydroxide, 0.25% Tween 20), incubated 15 minutes with 200 μl of RS, washed twice with 200 μl of RS and twice with 200 μl of TNT (100 mM TrisHCl, pH 7.5, 150 mM sodium chloride, 0.1% Tween 20). The tubes were dried at 50 ° C and stored in a sealed plastic bag at 4 ° C.

Generation of colonies The growth of the colonies was initiated in each well with 20 μl of the PCR mixture; the four dNTPs (0.2 mM), 0.1% BSA (bovine serum albumin), 0.1% Tween 20, 8% DMSO (dimethyl sulfoxide, Fluka, Switzerland), PCR buffer IX and 0.025 units / μl of DNA- AmpliTaq polymerase (Perkin Elmer, Foster City, CA). The wells were then placed in a thermal cycler and the development was performed by incubation of the wells sealed for 5 minutes at 94 ° C and the cycle for 50 repetitions of the following conditions: 94 ° C for 30 seconds, 65 ° C for 2 minutes, 72 ° C for 2 minutes. After completion of this program, the wells were maintained at 8 ° C until later use. Prior to hybridization the wells are filled with 50 μl of TE (10 mM Tris, 1 mM EDTA, pH 7.4) heated at 94 ° C for 5 minutes and cooled on ice before the addition of the probe at 45 ° C.Visualization of the colonies Probe: The probe was a DNA fragment of 1405 base pairs comprising the sequence of the template at its 3 'end (positions of nucleotides 8405 to 9259). The DNA probe was synthesized by PCR using two primers: p47 (5 '-GGCTAGGAGCTGAGGAGGAA), which amplifies from base 8405, and PT2, biotinylated at the 5' end which amplifies from base 9876 of the antisense strand.

Hybridization and detection: The probe was diluted to 1 nM "easyhyb" (Boehringer-Mannheim, Germany) and 20 μl were added to each well. The probe and colonies were denatured at 94 ° C for 5 minutes and then incubated 6 hours at 50 ° C. The excess probes were washed at 50 ° C in 2xSSC with 0.1% Tween. The DNA probes were ligated to green fluorescence fluorospheres coated with avidin, with a diameter of 0.04 μ (Molecular Probes) in TNT for 1 hour at room temperature. The excess spheres were washed with TNT. The colonies were visualized by microscopy and image analysis as described in Example 2a. Figure 3 shows the number of colonies observed per 20X field as a function of the concentration of the template bound to the well. The lowest concentration of the detectable template corresponds to 10 ~ 13 M.

EXAMPLE 2a: Covalent linkage of DNA templates and colonial primers on solid support (plastic) and colony formation with a degenerate primer Covalent attachment of the template and the colonial primer to the solid support (plastic) The microtiter wells with p252 and the template DNA fragments were prepared as follows: In each Nucleolink well, 30 μl of a 1 μM solution of the colonial primer p252 was added. with varying concentrations of the diluted diluted template from 0.5 nM in 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals). To each well, 10 μl of 40 mM l-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-imidazole was added to the colonial primer solution and template . The wells were then sealed and incubated at 50 ° C overnight. After incubation, the wells were rinsed twice with 200 μl of RS (0.4 N sodium hydroxide, 0.25% Tween 20), incubated 15 minutes with 200 μl of RS, washed twice with 200 μl of RS and twice with 200 μl of TNT (100 mM TrisHCl, pH 7.5, 150 mM sodium chloride, 0.1% Tween 20). The tubes were dried at 50 ° C and then stored in a sealed plastic bag at 4 ° C.

Generation of colonies Generation of DNA colonies was performed with a modified protocol to allow random priming in each well with 20 μl of PCR mixture, all four dNTPs (0.2 mM each), 0.1% BSA, 0.1% Tween 20, 8% DMSO (dimethyl sulfoxide, Fluka, Switzerland), IX PCR buffer and 0.025 units / μl of AmpliTaq DNA polymerase (Perkin Elmer, Foster City, CA). The wells were then placed in the thermal cycler and the amplification was performed by incubation of the wells sealed for 5 minutes at 94 ° C and the cycle for 50 repetitions of the following conditions: 94 ° C for 30 seconds, 65 ° C for 2 minutes, 72 ° C for 2 minutes. After completion of this program, the wells were maintained at 8 ° C until later use. Prior to hybridization the wells were filled with 50 μl of TE (10 mM Tris-1 mM EDTA, pH 7.4) heated at 94 ° C for 5 minutes and cooled on ice before the addition of the probe at 45 ° C.

Visualization of Colonies Probes: Two DNA fragments of 546 and 1405 base pairs comprising the sequences of either end of the original template were amplified by PCR. The anti-sense strand of the probe was labeled with biotin, through the use of a 5'-biotinylated .PCR primer. The coordinates of the base pairs of the probes were 6550 to 7113 and 6734 to 9805.

Hybridization and detection: The probes were diluted to 1 nM in "easyhyb" (Boehringer-Mannheim, Germany) and 20 μl were added to each well. The probe and colonies were denatured at 94 ° C for 5 minutes and then incubated 6 hours at 50 ° C. The excess probes were washed at 50 ° C in 2xSSC with 0.1% Tween. The DNA probes were ligated to green fluorescence fluorospheres coated with avidin with a diameter of 40 nanometers (Molecular Probes, Portland, OR) in TNT for 1 hour at room temperature. The excess spheres were washed with TNT. Fluorescence was detected using an inverted microscope (using the 20x / 0.400 LD Achroplan lens, on the Axiovert SIOOTV, with a mercury arc lamp HBO 100 W / 2, Cari Zeiss, Oberkochen, Germany) coupled to a camera 768 (H) x512 (V) pixel-CCD (Princeton Instruments Inc. Trenton, NJ, USA). The exposure was 20 seconds through the XF22 filter equipment (Example: 485DF22, Dichroic: 505DRLPO2 Em: 530DF30) and XF47 (Example: 640DF20, Dichroic: 670DRLPO2 Em: 682DF22) from Omega Optical (Brattleboro VT) for FITC and Cy5 respectively. The data was analyzed using the inview program (Princeton Instruments Inc., Trenton UN., USA). The numbers of colonies per field were counted in wells in duplicate with the image analysis program developed domestically.

EXAMPLE 3: Discrimination in sequence in different colonies originating from variable proportions of 2 different covalently linked templates and a colonial primer Covalent bonding of the templates and the colonial primer to the solid support (plastic) A colonial primer (CP2: 5'pTTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG), phosphorylated at its 5 'end (Microsynth GmbH, Switzerland), was grafted onto the plastic microtiter wells Nucleolink (Nunc, Denmark) in the presence of varying doses of the two templates A and B (prepared as described in Example 1). Series of 8 wells were established in triplicate with seven 1/10 dilutions of both templates, beginning with the highest concentration of 1 nM. Dilutions of the templates are set in opposite directions, such that the highest concentration of one template coincides with the lowest of the other.

The microtiter wells, to which the CP2 primer is covalently linked and both templates were prepared as follows. In each Nucleolink well, 30 μl of a 1 μM solution of the CP2 primer was added with varying concentrations of both templates diluted from 1 nM in 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals). To each well, 10 μl of 40 mM l-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-i-imidazole (pH 7.0), was added to the solution of the colonial primer and the templates. The wells were then sealed and incubated at 50 ° C for 4 hours. After incubation, the wells were rinsed three times with 50 μl of RS (0.4 N sodium hydroxide, 0.25% Tween 20), incubated 15 minutes with 50 μl of RS, washed three times with 50 μl of RS and three times with 50 μl of TNT (100 mM TrisHCl, pH 7.5, 150 mM sodium chloride, 0.1% Tween 20). The tubes were stored in TNT at 4 ° c. Generation of colonies The development of the colonies was initiated in each well with 20 μl of the PCR mixture; the four dNTPs (0.2 mM), 0.1% BSA, 0.1% Tween 20, 8% DMSO (dimethyl sulfoxide, Fluka, Switzerland), IX PCR buffer and 0.025 units / μl of AmpliTaq DNA polymerase (Perkin Elmer, Foster City, CA).

The wells were then placed in the thermocycler and the growth was performed by incubation of the wells sealed for 5 minutes at 94 ° C and the cycle for 50 repetitions of the following conditions: 94 ° C for 30 seconds, 65 ° C for 5 minutes, 72 ° C for 5 minutes. After completion of this program, the wells were maintained at 8 ° C until later use. Prior to hybridization the wells were filled with 50 μl of TE (10 mM Tris, 1 mM EDTA, pH 7.4) were heated at 94 ° C for 5 minutes and chilled on ice before the addition of the probe at 50 ° C .

Visualization of colonies Probe: Two DNA fragments of 546 and 1405 base pairs corresponding to the sequences of the 3.2 Kb DNA fragment at the 5 'and 3' ends, were amplified by PCR using a biotinylated primer (see Example 2) . The two probes were denatured by heating at 94 ° C for 5 minutes, rapidly cooled in 1 M sodium chloride, 10 mM Tris, pH 7.4 and allowed to bind to fluorospheres coated with streptavidin with a diameter of 0.04 μm, marked with different colors for 2 hours at 4 ° C. The probes linked to the spheres were diluted to a dilution of 20 in "easyhyb" solution preheated to 50 ° C. 20 μl of the probes were added to each well containing the denatured colonies. Hybridization and detection: Hybridization was carried out at 50 ° C for 5 hours. The excess probes were washed at 50 ° C in 2xSSC with 0.1% SDS. The colonies were visualized by microscope with a 20X objective, 20 second exposure and image analysis as described in Example 2a. Figure 4a shows the images of the colonies elaborated from the templates and the negative controls. Figure 4b shows the colonies from both templates in the same position in the same well visualized, with two different colors and negative controls. Figure 4C shows the coordinates of both colonial types in a sub-section of a microscope field. Figure 4c shows that the colonies of different templates do not coincide.

EXAMPLE 4: Covalent linking of DNA templates and oligonucleotides on solid glass supports Glass slides derivatized with aminosilane have been used as a solid support for covalently linking the thiol-modified oligonucleotide probes, using hetero-bifunctional crosslinkers. The selected reagents have groups reactive with thiol (maleimide) and reactive groups with amino (succinimidyl ester). The yields of the coupling or linkage of the oligonucleotide and the stability of the immobilized molecules will be strongly dependent on the stability of the crosslinker towards the conditions of the different treatments carried out. The Reaction Schemes of the DNA templates or the linkage of the oligonucleotides on the glass are described in Figure 5. The storage stability of the glass slides prepared with the s-MBS and s-SIAB crosslinkers and their thermal stability, have been evaluated. An important factor that affects the degree of hybridization of the immobilized oligonucleotide probes is the density of the linked probes (Beattie et al., 1995; Joss et al., 1997). This effect has been studied by varying the concentration of the oligonucleotides during the immobilization and the assay of the density of the linked oligos, by hybridization.

Materials and methods The acid pre-treatment of the microscope glass slides - microscope glass slides (Knittel, Merck ABS) were soaked in basic Helmanex solution for 1 hour (0.25% HelmanexIIR, 1 N sodium hydroxide). The slides were rinsed with water, immersed overnight in 1 N hydrochloric acid, rinsed again in water and treated for 1 hour in sulfuric acid solution.

(H2SO4 / H2O, 1/1, v / v, with a small amount of fresh ammonium persulfate added). The slides were rinsed in water, in ethanol and finally with pure acetone. The glass slides are dried and stored under vacuum for later use. Silanization of the surface.- The pre-treated slides were immersed in a 5% solution of ATS (aminopropyltriethoxysilane, Aldrich) in acetone. The silanization was carried out at room temperature for 2 hours. After three washes in acetone (5 minutes / wash) the slides were rinsed once with ethanol, dried and stored under vacuum. Cross-linking crosslinkers, s-MBS and s-SIAB (respectively the sulfo-m-maleimidobenzoyl-N-hydroxysuccinimide ester, sulfo-N-succinimidyl [4-iodoacetyl] aminobenzoate, Pierce, Rockford IL), are prepared as 20 mM solutions in PBS (phosphate buffered saline, 0.1 M sodium diacid phosphate, pH 7.2, 0.15 M sodium chloride). The silanized glass slides, on which 80 μl of the cross-linking solution was applied, were covered by a micro-cover or clean glass coverslip, and reacted for 5 hours at 20 ° C. The glass slides were rinsed in PBS, briefly immersed in water and rinsed in ethanol. The slides were then dried and stored under vacuum in the dark for later use. Oligonucleotide linkage - The oligonucleotides were synthesized with 5 'modifications of a thiol (CP3 and CP4, Eurogentec, Brussels) or a phosphate moiety (CP1 and CP2, Eurogentec, Brussels) using the standard chemistry of the phosphoramidite. - The 5'-thiol oligonucleotide primers (CP3 and CP4) were prepared as 100 μM solutions in a phosphate buffer saline (NaPi: 0.1 M sodium diacid phosphate, pH: 6.6, 0.15 M sodium chloride) and 1 μl drops were applied on the functionalized glass slide (functionalized with the crosslinker) for 5 hours at room temperature. The glass slides were kept under a humid saturated atmosphere to avoid evaporation. The glass slides were washed on a shaker in NaPi buffer. For the thermal stability study the glass slides were submerged twice in Tris buffer (10 mM, pH 8) for 5 minutes at 100 ° C and directly immersed in 5xSSC (0.75 M sodium chloride, 0.075 M sodium citrate, pH 7) at 4 ° C for 5 minutes. The slides were stored in 5xSSc at 4 ° C for later use. The oligonucleotide 5'-phosphate primers (CP1 and CP2) were applied (1 μl drops) for 5 hours at room temperature to the slide derivatized with amino as a 1 μM solution in 10 mM 1-methyl-imidazole (pH 7.0) ( Sigma Chemicals) containing 40 mM of l-ethyl-3- (3-dimethylamino-propyl) carbodiimide (EDC, Pierce, Rockford IL). The slides were washed 2 times at 100 ° C in Tris buffer (10 mM, pH 8) and directly immersed in 5xSSC at 4 ° C for 5 minutes. The slides were stored in 5xSSC at 4 ° C for later use.

Oligonucleotide and DNA template binding Oligonucleotide primers with 5'-thiol (CP3 and CP4), and the 5'-thiol template B ', were mixed in a phosphate-buffered saline (NaPi: 0.1 M NaH2P0, pH: 6.6, 0.15 M sodium chloride). The concentration of the DNA template varies from 0.001 to 1 μM and from 0.1 to 100 μM for the primers but they were optimized at 1 μM and 100 μM respectively for the template and the primers. The procedure described above for the binding of CP3 and CP4 on the functionalized glass surface was then followed. The 5'-phosphate oligonucleotide primers (CP1 and CP2), and the 5'-phosphate template B were mixed in a solution of 10 mM 1-methyl-imidazole (pH 7.0) (Sigma Chemicals) containing 40 mM of ethyl-3- (3-dimethylamino-propyl) carbodiimide (EDC, Pierce, Rockford IL). The concentration of the DNA template varied from 0.001 to 10 nM and from 0.1 to 1 μM for the primers, but were eventually optimized at 10 nM and 1 μM respectively for the template and the primers. The procedure described above for the binding of CPl and CP2 on the glass surface derivatized with amino was also followed. Hybridization with fluorescent probes. - Oligonucleotide sequences, fluorescently labeled with Cy5 or FITC at their 5 'end, were synthesized by Eurogentec (Brussels). To prevent non-specific hybridization, glass slides were incubated with a blocking solution (5xSSC, 0.1% Tween, 0.1% BSA) for 1 hour and washed on a shaker in 5xSSC (2 times, 5 minutes). The oligonucleotide probes were diluted to 0.5 μM in 5xSSC, 0.1% Tween and applied to the glass surface for 2 hours at room temperature. The glass slides were rinsed on a shaker at 37 ° C, once at 5xSSC for 5 minutes, and twice at 2xSSC containing 0.1% SDS for 5 minutes. Hybridization with radiolabeled probes. - The radiolabelled oligonucleotides complementary to the covalently linked oligonucleotides were used as hybridization probes in order to quantify the hybridization yields. The oligonucleotides were enzymatically labeled at their 5 'ends with [? -32P] dATP (Amersham, UK) using the polynucleotide kinase of bacteriophage T4 (New England Biolabs, Beverly, MA). Excess [? -32P] dATP was removed with a TE-10 Chroma Spin column (Clontech, Palo Alto, CA). Radiolabeled oligonucleotides (0.5 μM in 5xSSC, 0.1% Tween) were then applied to the derivatized slides for 2 hours at room temperature. The glass slides were rinsed on a shaker once at 5xSSC for 5 minutes and twice at 2xSSC, 0.1% SDS for 5 minutes at 37 ° C. After hybridization, the specific activity was determined by scintillation counting. Observation under a microscope.- The glass slides were coated with a 5xSSC solution and a micro glass coverslip. The fluorescence was detected using an inverted microscope model Axiovert SIOOTV, with a mercury arc lamp HBO 100W / 2 (Cari Zeiss, Oberkochen, Germany) coupled to a CCD camera equipped with a Kodak CCD array with a 768 (H) x512 format (V) pixels; 6.91x4.6 mm in total, pixel size 9x9 μm2 (Princeton Instruments Inc. Trenton, NJ, USA). The exposure times were between 1 and 50 seconds using the Achroplan 20x / 0.400 LD lens (Cari Zeiss, Oberkochen, Germany) and XF22 filter equipment (Example: 485DF22, Dichroic: 505DRLPO2 Em: 530DF30) and XF47 (Example: 640DF20 , Dichroic: 670DRLPO2 Em: 682DF22) from Omega Optical (Brattleboro VT) for FITC and Cy5 fluorophores respectively. The data were analyzed using the Winwiew program (Princeton Instruments Inc., Trenton NJ, USA).

Results Evaluation of storage stability, bonding and thermal stability The storage stability of glass plates prepared with s-MBS and s-SIAB was evaluated. Since these reagents are sensitive to hydrolysis, the binding yields of the oligonucleotide will be dependent on its stability. The amino-derivatized glass plates were functionalized with freshly prepared cross-linking reagents, s-MBS and s-SIAB. The functionalized slides were stored after the crosslinking bond for 10 days in a vacuum desiccator in the dark at room temperature. After this time, the stored slides (t = 10 days) and the newly reacted slides with the cross-linking reagents (t = 0) were evaluated. The results obtained after the reaction of a thiol-oligonucleotide and the hybridization of a complementary fluorescent probe were compared for both chemistries at t = 0 and time = 10 days. Once immobilized, slides functionalized with s-SIAB are completely stable after 10 days of storage as evidenced by the same hybridization yields obtained at t = 0 and t = 10 days. In contrast, s-MBS coupled to the glass was found to be less stable with a loss of 30% in the yield of oligonucleotide binding and hybridization after 10 days of storage. In conclusion, slides functionalized with s-SIAB are preferred since they can be prepared in advance and stored dry in a vacuum in the dark for at least 10 days without any reduction in the binding performance of the probe. To evaluate the thermal stability of the oligonucleotides bound to the glass, the slides were subjected to two treatments of 5 minutes at 100 ° C in 10 mM Tris-HCl, pH 8. The oligonucleotide remaining immobilized still after the washings was evaluated by hybridization with a fluorescently labeled complementary oligonucleotide. Approximately 14% of the bound molecules are released for the glass slides with s-SIAB, and 17% for the glass slides with s-MBS after the first 5 minutes of washing, but no further release was detected in the second washing for both chemistries (TABLE 1A). These results are surprising compared to those obtained by Chrisey et al. 1996, where a release of more than 62% bound oligonucleotides on fused silica slides, via the SMPB crosslinker (succinimidyl 4- [p-maleimidophenyl] butyrate) was measured after a 10 minute treatment in 80 ° PBS C.

TABLE 1A Table 1A: Thermal stability study The oligonucleotides were linked to glass slides functionalized with either s-MBS or s-SIAB. The bound oligonucleotides were evaluated by hybridization with a fluorescently labeled complementary oligonucleotide. The fluorescence signal is normalized to 100 for the highest signal obtained. The averaged values of the triplicate analyzes are reported.

Hybridization as a function of probe binding The degree of hybridization of the covalently linked oligonucleotide probes has been studied as a function of the surface coverage of bound oligonucleotides, using the s-MBS, s-SIAB crosslinkers and the mediated reactions. EDC. The concentration of the oligonucleotides applied for the immobilization was 1 μM for EDC and has been varied between 1 and 800 μM for the crosslinkers, the surface density was evaluated by hybridization with the probes labeled with 32P. The optimal concentration for the primer binding using hetero-bifunctional crosslinkers was 500 μM, which is the same with a surface density of the hybridized molecules of 60 fmol / mm2 for s-MBS, and 270 fmol / mm2 for s-SIAB . A coverage density similar to s-MBS was obtained using the EDC / imidazole mediated linkage of the 5'-phosphate oligonucleotides to the aminosilanized glass. However, only 1 μM solutions of the oligonucleotide were necessary to achieve the same binding performance, this represents a 500-fold excess of the oligonucleotide to be linked to the chemistry of s-MBS compared to the coupling strategy with EDC / imidazole (Table IB).

TABLE IB Table IB: Hybridization as a function of the probe link.

The oligonucleotides were linked to glass spheres functionalized with either s-MBS or s-SIAB or by means of the EDC activation reagent. The bound oligonucleotides were evaluated by hybridization with a radiolabelled complementary oligonucleotide. The specific activity and therefore the density of the hybridized molecules were determined by liquid scintillation. NT: not tested. The surface density of 60 fmol / cm2 corresponds to an average molecular spacing between the linked oligonucleotides, 8 nm. According to the present results, a coverage density of 30 fmol / mm2 (spacing of 20 nm) is sufficient to obtain DNA colonies. This performance can be obtained by immobilizing primers at 100 μM using the hetero-bifunctional s-SIAB cross-linker, or 1 μM probes using the EDC mediated procedure. Hybridization densities that have been obtained are in the range of the highest densities obtained on the glass slides of other previously reported grafting protocols.

(Guo et al., 1994, Joss et al., 1997, Beattie et al., 1995).

Generation of DNA-on-glass colonies: colony formation is dependent on length, template concentration and concentration of primers Theoretically, the formation of the DNA colony requires an appropriate density of linked primers on the surface, corresponding to an appropriate length of the DNA template. For optimum generation of DNA colonies, it is important to define the density range of the linked primers and templates, as well as the stoichiometric ratio between template and primer.

Materials and Methods Preparation of glass slides The glass slides were derivatized and functionalized as described above (Materials and methods) . The colonial DNA primers were CP1 and CP2. The colonial templates were prepared as described in Example 1 for template B ', but using primers TPB3 and TPB2. Modified colonial primers and templates were applied to the glass surface at varying concentrations of colonial primer and colonial template.

Generation of colonies Glass slides stored in 5xSSC were washed in microfiltered water to remove the salts. The colonial development was initiated on the glass surface with a mixture of PCR; all four dNTP (0.2 mM), 0.1% BSA, 0.1% Tween 20, IX PCR buffer and 0.05 U / μl AmpliTaq DNA polymerase (Perkin Elmer, Foster City, CA). The PCR mixture is placed in a structural sealing chamber (MJ Research, Watertown, MA). The slides were placed in the thermal cycler (The DNA Engine, JM Research Watertown, MA) and the thermocycling was carried out as follows: step 1 at 94 ° C for 1 minute, step 2 at 65 ° C for 3 minutes, step 3 at 74 ° C for 6 minutes and this program is repeated 50 times. After completion of this program, the slides are maintained at 6 ° C until after use.

Digestion of the double-stranded DNA colonies The glass surface containing the DNA was cut with a restriction nuclease by coating with the restriction enzyme in a IX digestion buffer. The reaction was run twice for 1 hour 30 minutes at 37 ° C. The double-stranded DNA colonies were denatured by immersing the slides 2 times in Tris buffer (10 mM, pH 8) at 100 ° C for 5 minutes, followed by a 5xSSC rinse at 4 ° C. The slides were stored in 5xSSC for later use.

Hybridization of single-stranded DNA colonies To prevent non-specific hybridization, the glass slides were incubated with a blocking solution (5XSSC, 0.1% Tween, 0.1% BSA) for 1 hour and the slides rinsed in 5xSSC ( 2 times, 5 minutes). The fluorescently labeled oligonucleotide at the 5 'end with Cy5 (Eurogentec, Brussels) was diluted to 0.5 μM in 5X SSC, 0.1% Tween and applied to the glass surface for at least 2 hours. The glass slides are rinsed on a shaker once in 5X SSC for 5 minutes and twice in 5X SSC, 0.1% SDS for 5 minutes at 37 ° C. The glass slides were visualized as previously described. It has been previously observed that the degree of hybridization is a function of the bond density of the oligonucleotide. A similar study with linked DNA templates has shown that the formation of the colonies is also a function of the concentration of the template bound on the glass slide. Depending on the chemistry used for the linkage of the oligonucleotide and the template, the optimal template concentration is 1 μM for the bifunctional crosslinkers, s-MBS (Figure 6B) and 1 nM for the EDC-carbodiimide (Figure 6A). Interestingly, a higher concentration of the template does not increase the number of colonies for EDC chemistry and a maximum corresponding to a maximum number of colonies seems to be reached. The formation of the colonies (number) has been studied as a function of the concentration of the primers, concentration of the DNA template applied on the surface and the length of the DNA template. The number of copies of the template in each colony has also been evaluated. The quantification was based on the detection of fluorescence with fluorophores marked with Cy5, Cy3 or with fluorescein, supplemented with an anti-bleaching reagent (Prolong, Molecular Probes, Portland OR). The calibration has been carried out by hybridization experiments on primers linked to the surface, since the corresponding exact density has been determined by radioactivity.

EXAMPLE 5: Colonial DNA sequencing in si t u Glass slides (5 mm in diameter, Verrerie de Carouge, Switzerland), were first placed in a 0.2% Helmanex bath (in water), 1 N sodium hydroxide for 1 hour at room temperature, rinsed with distilled water, rinsed in pure hexane, rinsed again twice with distilled water and treated with 1 M HCl overnight at room temperature. Then, these were rinsed twice in distilled water, and treated with sulfuric acid (50%) + K2S2Os for 1 hour at room temperature. These were rinsed in distilled water, then twice in ethanol. The glass slides were derivatized with ATS (as described in Example 4). The colonial primers CPl (5'-pTTTTTTTTTTCACCAACCCAAACCAACCCAAACC) and CP2 (5'-pTTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) which are 5'-phosphorylated (Microsynth GmbH, Switzerland) and the DNA template B (prepared as described in Example 1) were covalently linked at the 5 'end on glass slides or 5 mm in diameter (Verrerie de Carouge, Switzerland) to a final concentration of 1 μM and 10 nM respectively, as follows: 2 nmoles of each primer were added to 0.2 nmol of the template in 1 ml of solution A (41 μl of methylimidazole (Sigma, # M-8878) in 50 ml of water, pH adjusted to 7 with hydrochloric acid) and then mixed 1: 1 with solution D (0.2 nM EDC in 10 ml of solution A). On both sides of the glass slides, 3.5 μl of the mixture was loaded, and they were incubated overnight at room temperature. The glass slides were then briefly rinsed with 5xSSC buffer and placed at 100 ° C in 10 mM Tris buffer, pH 8.0 for 2x5 '.

The non-specific sites on the glass were blocked with bovine serum albumin (BSA, Boehringer Mannheim GmbH, Germany, # 238040) at 1 mg / ml in 5xSSC buffer for 1 hour at room temperature and then rinsed with distilled water. The glass slides were then individually placed on a Microamp ™ reaction tube (Perkin Elmer) containing 170 μl of PCR mixture, and the DNA colonies were then generated using Taq polymerase (AmpliTaq, PE-Applied Biosystems Inc., Foster City, CA) with 50 cycles (94 ° C / 60 seconds, 60 ° C / 3 minutes, 72 ° C / 6 minutes) in a MTC 200 thermocycler (MJ Research, Watertown, MA). Each slide was digested twice using 1.3 units of Pvu II (Stratagene) in the NEB 2 buffer (New England Biolabs) for 45 minutes at 37 ° C. After digestion, the tubes were placed at 100 ° C in 10 mM Tris buffer, pH 8.0 by 2x5 ', then blocked with 1 mg / ml filtered BSA (Millex GV4, Millipore) in 2xSSC buffer for 30 minutes at room temperature and rinsed first in the 0.1% SDS 2xSSC buffer then in 5xSSC buffer. Each slide was incubated overnight at room temperature with a 5xSSC / 0.1% Tween 20 buffer containing 1 μM of the pl81 sequencing primer (CGACAGCCGGAAGGAAGAGGGAGC) overnight at room temperature. Controls without the primer were maintained in the 5xSSC / 0.1% Tween 20 buffer. The glass slides were washed 2 times in 5xSSC / 0.1% SDS at 37 ° C for 5 minutes and rinsed in 5xSSC. The pl81 primer can hybridize to the template B 'and the following pldl sequence is CAGCT ... etc. In order to facilitate focusing, green fluorescent spheres were adsorbed to the bottom of the well by incubating each well with 20 μl of a 1/2000 dilution of streptavidin-coated FluoSpheres®, with yellow / green fluorescence, 200 nm (Molecular Probes , Eugene, Oregon) in 5X SSC for 20 seconds at room temperature. After hybridization with the primer, 2 μl of a solution containing 0.1% BSA, 6 mM dithiothreitol (Sigma Chemicals), 5 μM Cy5MR-dCTP or 5 μM Cy5MR-dUTP (Amersham, UK) and IX Sequenase reaction buffer is added to each slide. The addition of the Cy5MR-nucleotide is initiated with the addition of 1.3 units of the T7 DNA polymerase Sequenase ™ (Amersham, United Kingdom) for two minutes at room temperature. Wells are washed twice in a 5X SSC / 0.1% SDS bath for 15 minutes and rinsed with 5xSSC buffer. Samples are observed using a microscope (Axiovert SIOOTV, Cari Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512x768 CCD camera and the Winview program (Princeton Instruments, Trenton, NJ). For the approach, a 20X objective and an XF 22 filter equipment (Omega Optical, Brattleboro, VT) were used, and for the observation of the incorporation of Cy5MR on the samples, a 20X objective and an XF47 filter equipment (Omega Optical ) with a 50 second exposure using a 2x2 pixel deposit. The yellow / green FluoSpheres® (approximately 100 / field of view) does not give a detectable signal using the XF47 filter equipment and 50 second exposure (data not shown). Photographs are generated through the Winview program (Princeton, Instruments). Figure 7A shows the result after incubation with Cy5MR-dCTP on a sample that has not been incubated with the pl81 primer. Only 5 fuzzy spots will be seen, indicating that no dramatic spurious effect is occurring (such as the precipitation of the Cy5MR-dCTP aggregate, adsorption or simply the incorporation does not specify the DNA in the colonies or on the surface). Figure 7B shows the result after incubation with Cy5MR-dUTP on a sample that has been incubated with the pl81 primer. Someone will appreciate that no fluorescent spot can be observed, indicating that the incorporation of a fluorescent base can not take place in detectable amounts when the proposed nucleotide for incorporation does not correspond to the sequence of the template after the hybridized primer. Figure 7C shows the result after incubation with Cy5MR-dCTP on a sample that has been incubated with the pl81 primer. Someone will appreciate that many fluorescent spots can be observed, indicating that the incorporation of a fluorescent base can of course take place in detectable amounts when the nucleotide proposed for incorporation does correspond to the sequence of the template after the hybridized primer. In summary, it is shown that it is possible to incorporate fluorescent nucleotides in a specific manner, within the DNA contained in the colonies and periodically verify this incorporation with the apparatus and method described. However, this is only an example. Someone will appreciate that if you want, the incorporation of a fluorescent base could be repeated several times. Since this is done in a specific sequence manner, it is thus possible to deduce part of the DNA sequence contained in the colonies.

EXAMPLE 6: Marker analysis of mRNA sequence 5 ^ _ The most accurate way to verify gene expression in cells or tissues is to reduce the number of steps between sample collection and mRNA classification. New methods for rapidly isolating mRNA are commercially available. The most efficient methods involve the rapid isolation of the sample and the immediate disintegration of the cells in a solution of guanidine hydrochloride, which completely disintegrates the proteins and inactivates the RNAases. This is followed by purification of the mRNA from the supernatant of the disintegrated cells, by oligo-dT affinity chromatography. Finally, the mRNA encased at the 5 'end can be specifically directed and transformed into the cDNA using a simple strategy (synthesis of cDNA SMART, Clontech, Palo Alto). This method allows the synthesis of the cDNA copies only of the mRNA encased at the 5 'end, which is translationally active. By combining the above fast methods of mRNA isolation and cDNA preparation with the grafted template method of the generation of DNA colonies described in the present application, there is a method for the high-throughput identification of a large number of DNA markers. 5 'mRNA sequence. The advantage of the present invention is the possibility of sequencing a large number of cDNA by directly grafting the product of the cDNA synthesis reaction, amplifying the cDNA in thousands of copies, followed by sequencing simultaneously of the cDNAs.

Materials and methods Oligonucleotides and synthetic plasmids.- Oligonucleotides were synthesized with 5'-phosphates by Eurogentec or Microsynth. Plasmids containing the partial and 3'-non-translated sequences of the murine gene of the potassium channels, only, after the T3 RNA polymerase promoter, were generated by standard methods. MRNA synthesis.- The plasmids were only linearized at a restriction nuclease site SalI or simple Sacl after the poly A + sequence in the plasmid. After treatment of the plasmid cut with proteinase K, the linear plasmid DNA was extracted once with phenol / chloroform / isoamyl alcohol and precipitated with ethanol. The DNA precipitate was re-dissolved in water at a concentration of 10 μg / μl. The synthetic mRNA encased with the 5'-methylguanosine was synthesized by the mRNA synthesis team in vi tro, mMesage mMachine, following the manufacturer's instructions (Ambion, Austin TX). The synthetic mRNA was stored at 80 ° C. Enzymes.- Restriction enzymes were obtained from New England Biolabs (Beverly, MA). CDNA synthesis.- Synthetic mRNA was mixed with poly A + mRNA of mouse liver at different molar proportions (1: 1, 1:10, 1: 100) and the synthesis of the cDNA on the mixture of synthetic mRNA and liver mRNA. The mouse was performed using the "SMART PCR cDNA synthesis kit" (Clontech, Palo Alto, CA) with some minor modifications. In a cDNA reaction, about 1 μg of the mRNA mixture was mixed with the CP5 primer, which had at the 5 'end the CPß sequence, (5'p-AGAAGGAGAAGGAAAGGGAAAGGGTTTTTTTTTTTTTTTTNN). This primer has been used to perform the synthesis of the first strand of the cDNA. For the synthesis of the second strand, the "SMART" technique has been used. The basis of the SMART synthesis is the property of Moloney murine viral reverse transcriptase to add three to five deoxycytosine residues at the 3 'end of the first strand of cDNA, when the mRNA contains a 5' cap-methylguanosine (manual of the SMART user, Clontech, Palo Alto, CA). A CP6 primer, which contains the sequence of CPß plus AAAGGGGG at the 3 'end, (5' p-AGAAGGAGAAGGAAAGGGAAAGGGGG) has been used for the synthesis of the second strand of cDNA. The shock absorber and the reverse transcriptase H of the RNAse SUPERSCRIPTMR II of the murine leukemia virus of Moloney (Life Technologies, Ltd.) were used as described in the instructions and the reaction was carried out at 42 ° C for 1 hour. The cDNA was evaluated by PCR using the p251 primer, which contains a fragment of the CPß sequence, (5'-GAGAAGGAAAGGGAAAGG) with the Taq DNA polymerase (Platinum Taq, Life Technologies, Ltd.). Preparation of DNA colonies. The 5'p-cDNA was mixed with different concentrations of the CP2 solid phase colonial primer (5'p-TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) and chemically bound to Nucleolink PCR tubes (NUNC) following the manufacturer's instructions. DNA colonies were then generated using Taq polymerase (AmpliTaq Gold, PE-Applied Biosystems Inc., Foster City, CA) with 30 cycles (94 ° C / 30 seconds, 65 ° C / 1 minute, 72 ° C / 1.5 minute ) in an MTC 200 thermocycler (MJ Research, Watertown, MA). DNA probes and hybridization.- DNA probes Biotinylated and 32 P-radiolabeled DNA sequences were synthesized only with a 5'-biotinylated primer and a normal downstream (3 ') primer by PCR on the template (plasmid DNA mSlo). The probe incorporated [32P] -dCTP (Amersham, Amersham UK) at a ratio of 300: 1 (a [32P] -dCTP to dCTP) in the PCR reaction, with a final concentration of the four deoxynucleotide triphosphates of 50 μM. The resulting biotinylated and radiolabeled DNA probe was desalted on a Chromaspin-1000 column (Clontech, Palo Alto, CA). The DNA probes were hybridized to the samples in the "easyhyb" buffer (Boehringer-Mannheim, Germany), using the following temperature scheme (in the MTC200 thermal cycler): 94 ° C for 5 minutes, followed by 68 steps of decreasing 0.5 ° C in temperature every 30 seconds (in other words, the temperature is lowered to 60 ° C in 34 minutes), using sealed wells. The samples are then washed 3 times with 200 μl of TNT at room temperature. The wells are then incubated for 30 minutes with 50 μl of TNT containing 0.1 mg / ml BSA (New England Biolabs, Beverly, MA). The wells are then incubated for 15 minutes with 15 μl of 40 nm microsphere solution, streptavidin-coated, red fluorescent (Molecular Probes, Portland, OR). The microsphere solution is made of 2 μl of the microsphere reserve solution, which has been sonicated for 5 minutes in a 50 W ultrasound water bath (Elgasonic, Bienne, Switzerland), diluted in 1 ml of TNT solution containing 0.1 mg / ml of BSA and filtered with a pore size filter of 0.22 μm Millex GV4 (Millipore, Bedford, MA). Visualization of DNA colonies.- Stained samples are observed using an Axiovert 10 inverted microscope using a 20X objective (Cari Zeiss AG, Oberkochen, Germany) equipped with a Micromax 512x768 CCD camera (Princeton Instruments, Trenton, NJ), using a computer of filter PB546 / FT580 / LP590, and 10 seconds of light collection. The files are converted to TIFF formats and processed in the appropriate program (PhotoPaint, Corel Corp. Ltd, Dublin, Ireland). The processing consisted of the inversion and the increase of the linear contrast, in order to provide a suitable image for the black and white printing on a laser printer.

Results Synthesis of synthetic mRNA and cDNA.- After cDNA synthesis, the cDNA was verified in a PCR using primer p251 (generated at each end of the first strand of cDNA) for correct product lengths as evaluated by electrophoresis in agarose gel. The mRNA of mSlo synthetic was diluted in the liver mRNA, which was evidenced by the decrease in the intensity of the specific band of it and the increase of a nonspecific smear of liver cDNA.

Detection and quantification of DNA colonies. - DNA colonies were evaluated using the CCD fluorescence imaging microscope, or scintillation counting. The numbers of fluorescently detectable colonies were increased as a function of the amount of the grafted template, as shown in Figure 6. This increase was reflected by the amount of 32 P radiolabel detected. With radiolabeled probes it is possible to detect mRNA copies at approximately 1: 100. But with fluorescent microscopic CCD imaging technology, mRNA can be detected at a 1: 10000 dilution. EXAMPLE 7: Covalent link of the primer to the solid support (plastic) The oligonucleotide primers were ligated onto plastic microtiter wells Nucleolink (Nunc, Denmark) in order to determine optimal coupling times and optimal chemistries. Oligonucleotides; CP2 (5 '- (phosphate) -TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG), CP8 (5'- (amino-hexamethylene) -TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG), CP9 (5' - (hydroxyl) -TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG), CP10 (5'- (dimethoxytrityl) -TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG) and CPl 1 (5 '- (biotin) -TTTTTTTTTTAGAAGGAGAAGGAAAGGGAAAGGG), (Microsynth GmbH, Switzerland), were linked to the Nucleolink microtiter wells as follows (8 wells each); 20 μl of a solution containing 0.1 μM oligonucleotide, 10 mM 1-methyl-imidazole (pH 7.0) was added to each well.

(Sigma Chemicals) and 10 mM l-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (pH 7.0) (Sigma Chemicals) in 10 mM 1-methyl-i-imidazole. The wells were then sealed and incubated at 50 ° C for varying amounts of time. The coupling reaction was terminated at specific times by rinsing twice with 200 μl of RS (0.4 N sodium hydroxide, 0.25% Tween 20) and twice with 200 μl of TNT (100 mM TrisHCl, pH 7.5, chloride sodium 150 mM, 0.1% Tween 20). The tubes were dried at 50 ° C for 30 minutes and stored in a sealed plastic bag at 4 ° C.

Stability of bound oligonucleotides under colony generation conditions by PCR The stability was tested under colonial development conditions by the addition of a PCR mixture (20 μl of the four dNTPs (0.2 mM), 0. 1% BSA, 0.1% Tween 20, 8% DMSO (sulfoxide dimethyl, Fluka, Switzerland), IX PCR buffer). The wells were then placed in the thermal cycler and by 33 repetitions under the following conditions: 94 ° C for 45 seconds, 60 ° C for 4 minutes, 72 ° C for 4 minutes. After the completion of this program, the wells were rinsed with 5xSSC, 0.1% Tween 20 and kept at 8 ° C until after use. Prior to hybridization the wells were filled with 50 μl of 5xSSC, 0.1% of Tween 20 heated at 94 ° C for 5 minutes and stored at room temperature.

Probe: The oligonucleotide probes, R57 (5 '(phosphate) -GTTTGGGTTGGTTTGGGTTGGTG, control probe) and R58 (5' - (phosphate) -CCCTTTCCCTTTCCTTCTCCTTCT, which is complementary to CP2, CP8, CP9, CP10 and CP11) were enzymatically labeled in its 5 'ends with [? -32P] dATP (Amersham, UK) using the bacteriophage T4 polynucleotide kinase (New England Biolabs, Beverly, MA). Excess 32P-dATP was removed with a Chroma Spin TE-10 column (Clontech, Palo Alto, CA). The radiolabelled oligonucleotides (0.5 μM in 5xSSC, 0.1% Tween 20) were then hybridized to the Nucleolink wells derivatized with the oligonucleotide at 37 ° C for two hours. The wells were washed 4 times with 5xSSC, 0.1% Tween 20 at room temperature, followed by a wash with 0.5xSSC, 0.1% Tween 20 for 15 minutes at 37 ° C. The wells were then evaluated for the probe connected by scintillation counting.

Results There is a marked difference in the proportion and specificity of the oligonucleotide coupling, depending on the nature of the functional group at the 5 'end on the oligonucleotide. The oligonucleotides bearing the 5'-amino group were coupled approximately twice as fast as the oligonucleotides functionalized with a 5'-phosphate group (see Table 2 and Figure 8). In addition, the control oligonucleotides functionalized with 5'-hydroxyl, 5'-DMT or 5'-biotin were all coupled at speeds similar to those of 5'-phosphate, which questions the specific 5 'nature of the chemical bond using the group 5'-phosphate. Table 2 LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: (A) NAME: Applied REsearch Systems ARS Holding N.V. (B) STREET: 14 John B. Gorsiraweg (C) CITY: Curaçao (E) COUNTRY: Netherlands Antilles (F) POSTAL CODE: None (ii) TITLE OF THE INVENTION: METHODS OF AMPLIFICATION AND SEQUENCING OF NUCLEIC ACIDS (iii) SEQUENCE NUMBER: 19 (iv) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIUM: Diskette (B) COMPUTER: IBM compatible PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Relay # 1.0, Version # 1.30 (EPO) (2) INFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1: AGAAGGAGAA GGAAAGGGAA AGGG 24 (2) INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2: CACCAACCCA AACCAACCCA AACC 24 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer ' (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: GAGGCCAGAA CAGTTCAAGG 20 (2) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 4: CCTGTGACAA GACGACTGAA 20 (2) INFORMATION FOR SEQ ID NO: 5 : (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer ' (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: TTTTTTTTTTT CACCAACCCA AACCAACCCA AACC 34 (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "oligonucleotide primer ' (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: TTTTTTTTTTT AGAAGGAGAA GGAAAGGGAA AGGG 34 (2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 7: TTTTTTTTTTT CACCAACCCA AACCAACCCA AACC 34 (2) INFORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer ' (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8: TTTTTTTTTTT AGAAGGAGAA GGAAAGGGAA AGGG 34 (2) INFORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9: AGAAGGAGAA GGAAAGGGAA AGGGTTTTTT TTTTTTTTTT NN 42 (2) INFORMATION FOR SEQ ID NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 10: AGAAGGAGAA GGAAAGGGAA AGGGGG 26 (2) INFORMATION FOR SEQ ID NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 52 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 11: AGAAGGAGAA GGAAAGGGAA AGGGGCGGCC GCTCGCCTGG TTCTGGAAGA CA 52 (2) INFORMATION FOR SEQ ID NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 44 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer ' (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 12: AGAAGGAGAA GGAAAGGGAA AGGGCCTGTG ACAAGACGAC TGAA 44 (2) INFORMATION FOR SEQ ID NO: 13: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 62 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 13: TTTTTTTTTTT AGAAGGAGAA GGAAAGGGAA AGGGGCGGCC GCTGAGGCCA GTGGAAGTCA 60 GA 62 (2) INFORMATION FOR SEQ ID NO: 14: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 60 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 14: TTTTTTTTTTT CACCAACCCA AACCAACCCA AACCGAGCTC AGGCTGAGGC AGGAGAATTG 60 (2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 44 base pairs 10 (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 15: AGAAGGAGAA GGAAAGGGAA AGGGGAGCTG AGGAGGAAGA GAGG 44 (2) INFORMATION FOR SEQ ID NO: 16: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 52 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 16: AGAAGGAGAA GGAAAGGGAA AGGGGCGGCC GCTCGCCTGG TTCTGGAAGA CA 52 11 (2) INFORMATION FOR SEQ ID NO: 17: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer ' (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 11 (D) OTHER INFORMATION: / base mod = i (ix) FEATURES: (A) NAME / KEY: modified base (B) LOCATION: 13 (D) OTHER INFORMATION: / base mod = i (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 15 (D) OTHER INFORMATION: / base mod = i 12 (ix) FEATURE: (A) NAME / KEY: modified base (B) LOCATION: 17 (D) OTHER INFORMATION: / base mod = i (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 19 (D) OTHER INFORMATION: / base mod = i (ix) CHARACTERISTICS: (A) NAME / KEY: modified base (B) LOCATION: 21 (C) OTHER INFORMATION: / base mod = i (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 17: TTTTTTTTTT NSNSNSNSNS NS 22 (2) INFORMATION FOR SEQ ID NO: 18: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear 13 (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 18: CGACAGCCGG AAGGAAGAGG GAGC 24 (2) INFORMATION FOR SEQ ID NO: 19: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide primer" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 19: GAGAAGGAAA GGGAAAGG 18

Claims

130 CLAIMS

1. A method for the amplification of at least one nucleic acid, comprising the steps of: (1) the formation of at least one nucleic acid comprising the nucleic acid (s) to be amplified, wherein the nucleic acid (s) contain in the 5 'end an oligonucleotide sequence Y, and at the 3' end an oligonucleotide sequence Z and, in addition, the nucleic acid (s) carry at the 5 'end a means for the binding of the nucleic acid (s) to a solid support; (2) the mixture of the nucleic acid template (s) with one or more colonial primers X, which can hybridize to the oligonucleotide sequence Z and carry at the 5 'end a means for linking the colonial primers to a support solid, in the presence of a solid support, so that the 5 'ends of the nucleic acid template and the colonial primers are linked to the solid support; (3) carrying out one or more nucleic acid amplification reactions on the linked template (s), so that colonies of nucleic acid are generated. 131

2. A method according to claim 1, wherein the oligonucleotide sequence Z is complementary to the oligonucleotide sequence Y, and the colonial primer X is of the same sequence as the oligonucleotide sequence Y.

3. A method according to claim 1, wherein two different colonial primers X are mixed with the template (s) in step (2), and wherein the sequences of the colonial primers X are such that the oligonucleotide sequences Z can hybridize to one of the colonial primers X and the oligonucleotide sequence Y is the same as one of the colonial primers X.

4. A method for the amplification of at least one nucleic acid, comprising the following steps: (1) the formation of at least one nucleic acid template comprising the nucleic acid (s) to be amplified, wherein the nucleic acid (s) carry at the 5 'end a medium for the binding of the nucleic acid (s) to a solid support, (2) the mixture of the nucleic acid templates with one or more degenerate X colonial primers, which can hybridize to a sequence 132 oligonucleotide in the template (s) at a site flanking the nucleic acid sequence to be amplified, and carries at the 5 'end a means for linking the colonial primers to a solid support, in the presence of a solid support, so that the 5 'ends of the nucleic acid template and the colonial primers are linked to the solid support; (3) carrying out one or more nucleic acid amplification reactions on the linked template (s), so that nucleic acid colonies are generated.

5. A method according to any one of claims 1 to 4, comprising the additional step of performing at least one step of determining the sequence of one or more of the colonies generated from nucleic acid.

6. A method according to claim 5, wherein step (5) of the sequence determination involves the incorporation and detection of the labeled oligonucleotides.

7. A method according to claim 5 or 6, wherein the complete sequences 133 or partial nucleic acid amplified templates present in more than one nucleic acid colony, are determined simultaneously.

8. A method according to any of claims 1 to 7, comprising the additional step of visualizing the generated colonies.

9. A method according to claim 8, wherein the visualization step involves the use of a labeled or non-labeled nucleic acid probe.

10. A method according to any of claims 1 to 9, wherein the means for linking the nucleic acid template (s) and the colonial primers to the solid support comprises a means for linking the sequences of the nucleic acid template (s) to the solid support. nucleic acid covalently to said support.

11. A method according to claim 10, wherein the means for linking the nucleic acid sequences covalently to the solid support is a chemically modifiable functional group. 134

12. A method according to claim 11, wherein the chemically modifiable functional group is a phosphate group, a carboxyl or aldehyde portion, a thiol, hydroxyl, dimethoxytrityl (DMT) group, or an amino group.

13. A method according to claim 12, wherein the chemically modifiable functional group is an amino group.

14. A method according to any of claims 1 to 13, wherein the solid support is selected from the group comprising latex spheres, dextran spheres, polystyrene, polypropylene surface, polyacrylamide gel, gold surfaces, glass surfaces and silicon wafers.

15. A method according to claim 14, wherein the solid support is glass.

16. A method according to any of claims 1 to 15, wherein the density of the nucleic acid colonies generated is from 10,000 / mm2 to 100, 000 / mm2. 135

17. A method according to any of claims 1 to 16, wherein the density of the colonial primers X bonded to the solid support is at least 1 fmol / mm2.

18. A method according to any of claims 1 to 17, wherein the density of the nucleic acid templates is from 10,000 / mm2 to 100, 000 / mm2.

19. A plurality of different nucleic acid templates comprising the nucleic acids to be amplified, wherein each of the nucleic acids contain at their 5 'ends a known oligonucleotide sequence Y and at the 3' end a known oligonucleotide sequence Z and In addition, the nucleic acid (s) carry at the 5 'end a medium for the binding of the nucleic acid (s) to a solid support.

20. The plurality of nucleic acid templates according to claim 19, wherein the oligonucleotide sequence Z is complementary to the oligonucleotide sequence Y. 136

21. The plurality of nucleic acid templates according to claim 19, when mixed with a plurality of colonial primers X that can hybridize to the oligonucleotide sequence Z and carry at their 5 'ends a means for linking the colonial primers to a solid support.

22. The plurality of nucleic acid templates according to claim 21, wherein the oligonucleotide sequence Z is complementary to the oligonucleotide sequence Y, and the colonial primer X is of the same sequence as the oligonucleotide sequence Y.

23. A plurality of nucleic acid templates according to claim 19, when mixed with two different colonial primers X, and wherein the sequences of the colonial primers X are such that the oligonucleotide sequence Z can hybridize to one of the colonial primers X and the oligonucleotide sequence Y is the same as one of the colonial primers X.

24. A plurality of nucleic acid templates according to claim 21, in 137 where the colonial primers X comprise a degenerate primer sequence and the nucleic acid templates do not contain Y or Z oligonucleotide sequences.

25. A solid support, to which is adhered a plurality of colonial primers X as defined according to any of the previous claims, and a plurality of nucleic acid templates according to any of claims 19 to 24.

26. A solid support according to claim 25, wherein the solid support is as defined in accordance with claims 14 and 15.

27. A solid support according to any of claims 25 or 26, wherein the binding of the nucleic acid templates and colonial primers to the solid support is covalent.

28. A solid support comprising one or more nucleic acid colonies generated by a method according to any of claims 1 to 18. 138

29. The use of the solid support according to any of claims 25 to 28 in nucleic acid amplification or sequencing methods.

30. The use according to claim 29, wherein the method is a method according to any of claims 1 to 18.

31. The use of a method according to any of claims 1 to 18, for the amplification or sequencing of the nucleic acid.

32. The use of a method according to any one of claims 1 to 18, or the nucleic acid colonies generated by said methods, or the plurality of nucleic acid templates according to claims 19 to 24, or the solid supports of the claims 25 to 28, for the provision of nucleic acid molecules for sequencing and re-sequencing, periodic verification of gene expression, profiling of genetic diversity, diagnosis, selection, complete genome sequencing, discovery and classification of the polymorphism of the complete genome and the preparation of slides of the complete genome, or any other applications that involve the amplification of the nucleic acids or the sequencing thereof.

33. A kit for use in the amplification or sequencing of nucleic acid, comprising a plurality of nucleic acid templates as defined according to any of claims 19 to 24 and colonial primers as defined in accordance with any of the claims precedents, linked to a solid support.

34. An equipment according to claim 33, for use in sequencing, re-sequencing, periodic verification of gene expression, profiling of genetic diversity, diagnosis, selection, complete genome sequencing, discovery and classification of genome polymorphism complete, or any other applications that involve the amplification of nucleic acids or the sequencing thereof.