FR2936246A1 - New compound comprising a duplicable nucleic acid (amplified fragment), where compound comprises a means of locking of polymerization (loop linkage), useful e.g. in complex for diagnosing the amplification of the nucleic acids - Google Patents

New compound comprising a duplicable nucleic acid (amplified fragment), where compound comprises a means of locking of polymerization (loop linkage), useful e.g. in complex for diagnosing the amplification of the nucleic acids Download PDF

Info

Publication number
FR2936246A1
FR2936246A1 FR0856430A FR0856430A FR2936246A1 FR 2936246 A1 FR2936246 A1 FR 2936246A1 FR 0856430 A FR0856430 A FR 0856430A FR 0856430 A FR0856430 A FR 0856430A FR 2936246 A1 FR2936246 A1 FR 2936246A1
Authority
FR
France
Prior art keywords
nucleic acid
compound
end
amplifiable
loop
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
FR0856430A
Other languages
French (fr)
Inventor
Pascal Mayer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
HAPLOYS
Original Assignee
Haploys
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Haploys filed Critical Haploys
Priority to FR0856430A priority Critical patent/FR2936246A1/en
Publication of FR2936246A1 publication Critical patent/FR2936246A1/en
Application status is Pending legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions

Abstract

Compound comprising at least one duplicable nucleic acid, named amplified fragment, where the amplified fragment is mainly composed of nucleotides allowing a polymerization of complementary single stranded nucleic acid, the compound comprises at least one means of locking of the polymerization, named loop linkage, mainly constituted substances not allowing polymerization, the amplified fragment comprises a 3' part, a central part, and a 5' part, the parts of 3' and 5' of the amplified fragment all are linked between each other by at least a locking means of polymerization, is new. Independent claims are included for: (1) a complex comprising the compound, and a nucleic acid forming trigger, where the trigger comprises at least one region paired on at least a part of the amplified fragment, the trigger further comprises one unpaired region in amplified fragment for allowing a nucleic acid at least partially complementary of the trigger to be paired at least in a part of the region for releasing the part of the amplified fragment paired with the trigger, preferably by competitive hybridization or duplication of the trigger; (2) a precursor, forming particularly precursor of the compound, where the precursor comprises at least one first and second nucleic acid, end 3' of the first nucleic acid is linked to end 5' of the second nucleic acid by a linkage of a loop linkage; (3) a composition comprising the compound, the complex and/or the precursor in a solvent, preferably aqueous solvent; (4) a diagnostic method comprising implementation of an amplification of nucleic acids comprising the compound, the complex and/or the precursor; (5) a method for detecting the presence of a substance or its mixture, comprising implementing an amplification of nucleic acids contained in the composition comprising the compound, the complex and the precursor; (6) a device carrying out the logical operations or calculation comprising implementing logical operations or calculation of the compound, the complex and/or the precursor; and (7) a logical operator comprising OR, AND, NON AND, comprising implementing the compound, the complex and/or the precursor.

Description

Field of the invention

The invention relates to the field of nucleic acid chemistry. More specifically, it relates to the use of nucleic acid molecules and enzymes to generate multiple copies of neV-ynLhetized nucleic acids to detect nucleic acids present in samples or to label affinity compounds and thereby enable the expression of nucleic acids. indirectly detect the interaction of labeled affinity compounds with their target or to allow for analog or digital molecular computation operations based on nucleic acid molecules. state of art

The state of the art today makes it possible to detect and enumerate individual nucleic acid molecules through complex manipulations and complex and highly sensitive instruments, for example as described in Nature Biotechnology, 26 (3) 2008. , p317-325. However, some detection applications require simple and fast preparations that can be visualized without instrumentation.

It is for example possible to detect without instrument nucleic acids previously labeled with a hapten such as biotin. These labeled nucleic acids can be hybridized to primers attached to a support and this hybridization is revealed by an efficient staining method, for example as described in Nucleic Acids Res. 200'7; 35 (10): e74. Other staining methods are also well known to those skilled in the art, for example the use of gold nanopatticules or captive, attached directly to the nucleic acids or via an interaction with a hapten, for example as described in Nucleic Acids Res, 2005 Jan 31; 33 (2): e17. Among the effective dyeing methods well known to those skilled in the art, it will be particularly noted the use of streptavidin-coupled alkaline phosphatase that recognizes the bioUnc attached to the labeled nucleic acid molecules. This enzyme catalyzes the formation and precipitation of a colored product from a suitable solution, for example 0BT'B [IP as described in Biosens Bioelectron. 2004 Feb: 15; 19 (7): 685-92.

These detection methods do not detect less than 10 9 to 101 6 molecules, whereas in many applications the number of nucleic acids present in the solution of interest does not exceed 10 6 molecules. For this, the use of nucleic acids and enzymes to generate multiple copies of neo-synthesized nucleic acids from the nucleic acids present in the solution remains widespread and useful. Methods for generating multiple copies are known to those skilled in the art as nucleic acid amplification. The most common amplification method is PCR, described in detail in U.S. Pat. Our. 4,683,195, 4,683,202 and 4,800,159. Since then, many other methods have been described and a review with the appropriate references is provided in WO2008013462 and in Nucleosides Nucleotides Nucleic Acids. Mar. 2008; 27 (3): 224-43. Among the amplification methods described to date, two broad groups can be distinguished: those in which it is necessary to repeatedly subject nucleic acids to a cycle of different conditions (e.g. changes in temperature or solutions) ,

those where the nucleic acid copies are continuously produced under reaction conditions to which no change is made by external action (in practice, the reaction conditions are never strictly constant because reagents are consumed; pH and ionic strength etc. may change due to consumption of reagents and heat may be released or absorbed during the reaction). The present invention is in the group where nucleic acid copies are continuously produced under reaction conditions which are not modified by external action. These methods are advantageous because they make it possible to avoid the use of instrumentation to subject the nucleic acids repeatedly to a cycle of different conditions. In this group, one can distinguish and isolate the group of methods based on the generation of copies of a circular nucleic acid. The generation of circular nucleic acid copies is based on observation of the replication of certain viruses, as popularized by Gilbert and Pressier's paper (Gilbert W, Dressler D., DNA replication: the rolling circle mDde !, Cold Spring Harb Symp Quant Biol 1968: 33: 473-484). In this mechanism, the genome of the virus forms a circular, single-stranded intermediate, as in the bacteriophage or double strand as the bacteriophage T4. A primer, sometimes in the form of a transfer RNA, allows a DNA oo rase to make a copy of the genome. When the first copy is complete, the end of the strand being synthesized is separated from the circular intermediate under the action of geometric constraints acting on a circular molecule and under the action of specialized enzymes. This spontaneous opening of the circular structure at the 5 'end of the strand being synthesized allows the synthesis to continue and form a large concatemer formed by the repetition of the genome sequence. The use of the rolling circle mechanism for the production of concatameric copies of circular nucleic acids by enzymatic enzymatic pathway in vitro is described by Fire 8tXu in Rolling Nep! Ication of short DNA cinc! Es. Nat Pnoc! Acad Sci U S A. 1995 May 9; 92/10: 4641-4645.) And "Method for constructing an oligonucleotide concatamer library by rolling circle replication", US5648245. This approach is known to those skilled in the art under the term "rolling circueancepication" or "RCA". In order to promote the opening of the 5 'end of the strand being synthesized without the input of specialized enzymes, the circular molecules are relatively short, typically from 50 to 500 nanometers. This amplification method makes it possible to obtain linear concatemers in single-stranded form. Additional enzymatic steps make it possible to convert the single-stranded concatemer into a double-stranded concatemer. The length of the concatemer increases linearly with the reaction time. In double-stranded form, restriction endonuclease digestion also provides linear fragments of a single copy of the original circular fragment. In this case, the number of fragments obtained also increases linearly with the duration of the reaction. This molecular approach forms the core of many derived techniques that are described in the references already cited (VVO2OO8O134G2, Nucleosides Nucleic Acids Nucleic Ac / ds, 2008 Mar; 27 (3): 22443). For example, NUC (eic acid amplification method: ramification extension amplification method (PAM) * US5942391 describes how to couple RCA-type linear amplification with strand amplification (SDA amplification amplification) by adding a suitable primer bulb. SDA-type amplification relies on the property of certain DNA polymerases to be able to displace a strand of DNA which opposes the elongation of the current strand, and this on linear molecules in the absence of any geometric constraint. such as, for example, the phage polymerase of the Klenow fragment exon form of the E-polymorphonated DNA. al. The RAM method makes it possible to obtain an exponential amplification of concatemers of different lengths of double-stranded form, it being understood that an imbalance in the quantity of each primer makes it possible to obtain at the end of the reaction a certain proportion of single-stranded molecules.

Nevertheless, this approach produces concatemeric type molecules of all sizes that are mainly double-stranded. This method is therefore not very efficient for generating primers that can be used in hybridization methods for detection without instrumentation. It is therefore advantageous to have a method which directly produces single-stranded molecules of homogeneous size. A simple way to obtain single-stranded molecules is to use a construct such as, for example, a pBR322-type circular plasmid or a linear fragment comprising one or more transcription promoters. The use of RNA polymerase then makes it possible to obtain single-stranded copies in an amount proportional to the reaction time. Nevertheless, the amplification is not exponential and the nucleic acids produced are RNA which are nucleic acids which require special precautions to preserve ribonucleases present on the skin of the manipulators. The use of RNA is therefore more delicate than that of DNA, particularly in the context of detection methods without automated instrumentation. It is therefore advantageous to have a method which directly produces single-stranded DNA molecules of homogeneous size. The SDA-type amplification on linear molecules without being coupled to R-type amplification has been described in US5455166, and in this case uses an unnatural alpha-iodine nucleotide triphosphate which prevents cleavage by a restriction enzyme whose recognition site must be present in the sequence of primers used for amplification. Nevertheless, this technique requires the use of two different enzymes in the memo reaction. It is therefore advantageous to have a method which directly produces single-stranded DNA molecules of homogeneous size by the use of a single enzyme. Other methods have been described which combine the use of several enzymes, sometimes the generation of RNA intermediates, as described in Nucleosides Nucleotides Nucleic Acids, 2OO8Mar / 27 (3): 224'4]. An object of the present invention is to describe a simple method, which allows homogeneous size single-stranded DNA molecules to be produced directly by the use of a single enzyme, especially amplified. Methods have been described which combine the use of nucleic acids and enzymes to perform molecular computing operations but do not provide the necessary components for the realization of powerful calculators / momme discussed in EM8Unepods VUL4 NO 1 (2003). Another object of the present invention is to describe a simple method for carrying out molecular calculation operations which makes it possible to produce components necessary for the production of powerful computers.

Brief description of the invention

According to a first aspect, the invention relates to a compound, called amnDUOæble compound, comprising at least one nucleic acid called amnoible fragment, said amplifiable fragment consisting essentially of nucleotides allowing polymerization of a complementary single-stranded nucleic acid said compound comprising at least one polymerization arresting means, termed a loop bond, essentially consisting of non-polymerizable substances, said polymerizer comprising a portion 3 ', a central portion, and a portion 5', parts 3 'and 5' of said amplifiable fragment being both interconnected by at least one means of stopping polymerization. Nucleic acid is understood to mean polymers whose base unit, or monomonomene, is the nucleotide. These nucleotides are linked to each other by phosphodiester or alpha thiophosphodiester bonds. Typically, the nucleic acids are selected from: DNA, DNA, mtDNA, chroophagous DNA, AONc, RNA, mRNA, non-coding RNA, mRNA, rRNA, RNA, shRNA, siRNA, pRNA, pRNA, pRNA, ARWsno, AR0tm, oligonucleotides, and derivatives thereof. The nucleic acid can be in single or double stranded form. The term "replicable nucleic acid" is understood to mean a nucleic acid allowing the polymerization of a complementary single-stranded nucleic acid, with the errors of a close copy. Typically a complementary nucleic acid is obtained by replication or transcription. Copy errors generally occur naturally during the polymerization of the complementary nucleic acid and do not alter the function of the nucleic acid under the conditions and object of the present invention. The term "compound consisting essentially of nucleotides allowing polymerization of a complementary single-stranded nucleic acid" is understood to mean a fragment comprising nucleotides and allowing the polymerization of a complementary single-stranded nucleic acid. Without limiting the scope of the invention, the amplifiable fragment consists of nucleotides allowing polymerization of a complementary single-stranded nucleic acid.

Advantageously, the compound comprises at least one means for imposing a geometric constraint on the amplifiable fragment so that the complementary strand of the amplifiable fragment can not match under the conditions of the amplifiable fragment polymerization over its entire length to allow a other nucleic acid to hybridize to the amplifiable fragment. Preferably, the loop link limits the end-to-end distance between the 3 'and 5' ends of the amplifiable fragment at a constraint length or Le, so as to impose said geometric constraint on the amplifiable fragment. By end-to-end distance between the ends 3 'and 5' is meant the length of a virtual line segment separating the ends 3 'and 5'.

Alternatively, the compound allows the polymerization of a complementary single-stranded nucleic acid by an enzyme having DNA or RNA polymerase activity, and preferably the loop bond stops the polymerization. Advantageously, the amplifiable fragment consists essentially of nucleotides present in nature and / or artificial.

By nucleotide is meant the ribonucleotides, such as for example: AN1P, TMP, UMP, GMP, CMP, ADP, TDP, UDP, GDP, CDP, ATP, 11P, UTP, GTP, CTP, CAMP, cGMP; deoxyribonucleotides, such as, for example: dAMP, dTMP, dUMP, dGMP, dCMP, dADP, dTDP, dUDP, dGDP, dCDP, dATP, dP, dUTP, dGTP, dCI P; and their alpha-thiophosphate derivatives; as well as all of their derivatives present in nature and / or artificial. The expression present in nature also covers synthetic nucleotides. Advantageously, the compounds of the invention are circular, thus forming one or more amplifiable loops, possibly complex when the loop bond 5 comprises at least one duplicable nucleic acid. By "amplifiable loop" is meant one or more amplifiable loops, possibly complex. During the duplication, the first complementary strand of the amplifiable fragment is detached due to the polymerization of a second complementary strand. According to a particular embodiment Lc is equal to 1U nm, pnehénenc8à 5 10 nm, pnefénenceà 3nm. Especially when Lc = Nn) xpu nxq), where x is the sign of multiplication, or the - is the sign of subtraction, where N is the number of nucleotides contained in the amplifiable fragment, p is approximately equal to 0.32nrn ( nanometers), q is approximately equal to 0.75 nm (nanometers), and n is preferably between 6 and 50, preferably between 8 and 30, preferably between 10 and 25. Advantageously, the loop bond blocks the synthesis of a complementary strand by a DNA or RNA polymerase. According to one embodiment, the loop link comprises one or more abaSic nucleotides; and / or one or more nucleotides comprising a chemical group on the sugars, or on the bases, or on the phosphate groups of the 3'-5 'bonds, or in place of the bases which compose them; and / or two nucleotides connected by a different linkage of a 3'-5 'phosphate or alpha-thiophosphate linkage constituting the duplicable nucleic acids. Advantageously, the loop bond comprises at least two nucleotides comprising a chemical group on the sugars, and / or on the phosphate groups of the 3'-5 'bonds, and / or on the bases, and / or instead of the bases. These compounds are connected by a different linkage from a 3'-5 'phosphate or a pho'lhiophosphotecompusa / {usual nucleic acid linkage. According to one variant, a loop link comprises several nodes whose bases are connected to each other by covalent bonds, which can be connected to one another by the action of UV rays, in particular when it is a question of One or more thymidine dimeres. Alternatively, the loop linkage also comprises one or more nucleic acids at least at one end thereof, said nucleic acid and the amplifiable fragment being at least partially compatible. According to one variant, the mentioned chemical groups form covalent bonds and / or a high affinity interaction with a particle that is essentially indeformable under the operating conditions of the invention and / or with a solid support. In particular the essentially indeformable particles are proteins, colloids, micelles, emulsion droplets and / or solid surfaces covered with such non-deformable particles or by molecular films. According to one variant, the loop bond comprises two nucleotides connected via a molecular structure and / or a polymer, or a surface or block of material. It should be noted that in all cases the loop connection can be deformable, but imposes a maximum end-to-end distance at the 3 'and 5' ends less than Lc under the operating conditions of the invention. According to one variant, the compound comprises a single nucleic acid and a single loop link, which is then called an amplifiable loop. According to one embodiment, the compound comprises at least two amnp! Iflab! Es fragments, thus named amplifiable multi-loop, said compound possibly comprising in at least one loop link at least one duplicable nucleic acid. According to a second aspect, the invention relates to a complex compound comprising an amplifiable compound, as defined above, and a wgâchetbe formed at least in part of a nucleic acid, said trigger comprising at least one paired region on at least a part fragment amplifia bye, said trigger also comprising at least one region unmatched to the aniplifiabte fragment to allow a nucleic acid at least partially complementary to the trigger to pair at least in part of this region in order to release the portion of the fragment amplifiable paired with said trigger, in particular by competitive hybridization or duplication of the trigger. It is meant to release the separation of the paired compounds and to leave the complex compound free in the previously paired region (part of the amplifiable fragment) in order to make possible a new pairing with a nucleic acid complementary to the reglon.

Advantageously, said trigger is matched in the part 3 'of said amplifiable fragment. A complex compound having no trigger can be designated by unlocked compound or amplifiable compound unlocked. Alternatively, the blocked amplifiable compounds may also include triggers, referred to as secondary triggers, formed at least in part of a nucleic acid, said secondary trigger comprising at least one paired region on at least a portion of another trigger, said trigger secondary cell also comprising at least one region not matched to said other trigger to allow a nucleic acid at least partially complementary to said secondary trigger to mate at least in a portion of that region to release the portion of said other trigger matched to said secondary trigger, in particular by competitive hybridization or duplication of the trigger. Advantageously, the portion of the trigger paired with the amplifiable fragment and / or the trigger, is duplicable.

Advantageously, the 3 'portion of the gate has enough nucleotides to allow at least one primer to pair on this part. Preferably, the 3 'end of the gate comprises a means preventing the start of the polymerization at this end, for example when the last nucleotide of the 3' end is a 2'3'-didesoxynucleotide.

Advantageously, in the primary and / or secondary triggers each part may consist of 8 or more nucleotides, preferably 12 nucleotides or more, preferably 18 nucleotides or more. According to a variant, at least one trigger is connected by at least one of its ends to the loop link.

According to a third aspect the invention relates to a precursor, forming in particular a precursor of a compound as defined above, said precursor comprising at least a first and a second nucleic acid, the 3 'end of the first nucleic acid being connected to the 5 'end of the second nucleic acid by a loop link type linkage. Thus, a compound as defined above can be easily formed by forming at least one covalent bond between the 5 'and 3' end of the amplifiable fragment. Advantageously, the loop bond limits the end-to-end distance between the 3 'end of the first nucleic acid and the 5' end of the second nucleic acid at a constraint length or <- <Lc not allowing the matching a complementary nucleic acid over its entire length, when the 5 'end of the first nucleic acid is connected to the 3' end of the second nucleic acid. In particular, the precursors of the compounds of the invention may be formed of a pair of nucleic acids called ligatable pair, whose 5 'end of the first 5 is phosphorilled and whose 3' end of the first is connected to the 5 'end of the second by a link of the loop link type. These precursors are named ligable precursors of type 1. Advantageously, this loop link is such that those constituting an amplifiable loop where the maximum end-to-end distance under the operating conditions of the invention of the link is lower, especially with N = (01+ N2), where N1 is the number of nucleotides contained in the first nucleic acid and N2 is the number of nucleotides included in the second nucleic acid. According to a fourth aspect, the invention relates to a precursor, in particular forming a precursor of a compound t8l as defined above, said precursor comprising at least a first, a second, and a third nucleic acid, where a first end (end) 'or The first nucleic acid is connected to the 5 'end of the second nucleic acid by a loop-type binding, and a second end (5' or 3 'end, respectively) of the first nucleic acid is connected to the 3 'end of the third nucleic acid by a loop-type binding said third nucleic acid having a phosphorated 5' end, said first nucleic acid having a defined length so as to limit the end-to-end distance between the end 3 'of the second nucleic acid and the 5' end of the third nucleic acid at the nain of constrainb or mLc * not allowing the pairing of a nucleic acid e complementary over its entire length, when the 5 'end of the third nucleic acid is connected to the 3' end of the second nucleic acid. In particular, when the precursors of the amplifiable compounds are formed of a first nucleic acid connected at its ends to the 3 'end of a second nucleic acid whose 5' end is phosphorilled and at the 5 'end of a third nucleic acid, by boude bonding bonds, wherein the second and third nucleic acids having a length such as the whole [o / me by the first loop bond, the second nucleic acid, the third nucleic acid and the second loop link, when the 3 'ends of the second nucleic acid and the 5' of the third nucleic acid are cnirculated, form a definite loop of the goat. previously. These precursors are named ligable precursors of type II. The second and third nuctic acids are also called pairs! Advantageously, the precursors can form the amplifiable compounds through an enzymatic reaction and / or a chemical reaction. The precursors of the amplifiable compounds may be formed of a nucleic acid whose ends each comprise at least one chemical group capable of forming covalent bonds with each other and / or with a bifunctional molecule and / or a high affinity interaction with a particle essentially. indeformable under the operating conditions of the invention and / or with a solid support. Advantageously, the chemical groups comprise biotins and / or haptens and / or amines and / or thiols. According to one variant, the precursors are composed of a product of the ligation between a digestion product of a fragment of natural or synthetic origin digested with one or more restriction enzymes, and one or preferably two adapters comprising the one at its end 3 'and the other at its end 5' at least one of the chemical groups described above. Typically, the digestion product forms part of the amplifiable fragment, in particular for the purpose of quantifying it, particularly in the context of soil characterization after DNA extraction, to recognize soils 20 of a similar or homologous nature. In this way, mixtures of organisms in general can be characterized. Advantageously, these ligation products are digested with an exonuclease which digests, by the 3 'end, the strands of DNA in duplex form, for example exonuclease III, and in particular the strand bearing the chemical group at its 3' end comprises Also nucleic acids linked by alpha-thio-phosphodiester bonds. In another of its aspects, the invention also consists in providing a composition comprising at least one amine compound and / or at least one complex compound, and / or at least one precursor as defined above, in a solvent, in particular aqueous. Advantageously, the composition comprises an enzyme having a plasmid DNA activity, nucleotides making it possible to form, by their polymerization, a nucleic acid, at least one buffer, preferably at least one salt, and at least one nucleic acid. It is a further object of the invention to provide a composition, called an amplifying primer, which advantageously comprises at least a portion of an amplification primer. of its sequence complementary to the total or partial sequences of the central portions 5 and / or 3 'of the amplifiable compounds Advantageously, the amplification primer in its part 3' joins the part 3 'of the amplifiable fragments. these amplification primers are attached by one of their 5 'end to the loop linkage The amplifiable fragments and amplification primers 3' No. 8 or more nucleotides, preferably 12 nucleotides or more, preferably 18 or more nucleotides, and preferably at least 2 nucleotides less than the number of nucleotides complementary parts amplifiable loops blocked. Advantageously, the conditions of the amplifier mix define the operating conditions of the invention. Especially when the enhancer mix is maintained at a temperature in which the DNA polymerase activity of the selected enzyme is at least 1% of the nominal activity. In particular, the amplification primers may comprise at least one biotin, a dye, a fluorophore, a hapten, a protein or a functional group capable of forming a covalent bond or of high affinity with a biotin, a dye or a fluorophore. , a protein or a hapten. The invention also relates to a reaction mixture containing the amplifying mix and one or more reagents for converting a precursor into an amplifiable compound. According to one embodiment, the amplifying mlx comprises annealing compounds and / or their precursors and / or their triggers which are attached to particles or solid supports separable from the amplifying mix. According to one embodiment, the reaction mixture contains at least one loop, the sequence of which is identical to that of the portion 5 'of the trigger. amplifiable fragment of at least one distinct amplifiable loop also contained in the ampliflable set. According to one embodiment, the amplifier mix also contains at least one locked loop whose sequence of the trigger portion is homologous, 13 ideally identical to that of the portion 5 'of the amplifiable fragment of this plug. blocked. By homologue is meant an amino acid match of at least 60%, preferably at least 80%, 85%, 90%, and more preferably at least 95%. The preferred homology percentages being at least 96, 97, 98 or 99%. It should be understood that non-identical sequences can lead to the same results. This is typically the case of a sequence having a high homology. In another of its aspects, the invention also consists in providing an amplifying mix containing blocked amplifiable compounds also comprising a nucleic acid whose sequence is partially or totally complementary in their 3 'part to that of the 3' part of the acids. nucleic components of the triggers. In another of its aspects, the invention also consists in providing an amplifying mix containing amplifiable blocked loops also comprising a nucleic acid whose sequence is partially or totally complementary to that of the nucleic acids making up the triggers. In another of its aspects, the invention consists in providing a preparation comprising ligatable precursors of type I and / or type II, and preferably also comprising a ligase, preferably at least one salt, at least one buffer, the cofactors and solvents necessary for the ligase activity of the ligase, and nucleic acids whose sequence is partially or totally complementary to that of the ligatable pairs put end to end in the 5'-3 'direction. The object of the invention is to amplify, that is to say to create a multitude of copies, advantageously the amplifiable compounds. Thus, the purpose of the 3 'portion of the hagment annulus is to hybridize with an amplification primer, typically in the 3' portion of the primer. Typically the 3 'portion comprises from 8 to 100 nucleotides, preferably from 8 to 40, and generally about 20 nucleotides. The function of the S 'portion of the ampullible fragment is to generate a nucleic acid hybridized either on the 3' part of the same loop or another loop. either gates or nucleic acids on supports, in particular of the chip type, making it possible to detect the nucleic acid generated by the 5 'part. The central portion of the ampUfiob! Ca fragment serves to generate a portion of a nucleic acid detectable by. a method of detection or forming a waste. For the amplification primer (amplification primer), the function of the part 3 'is to hybridize with the part 3' of an amplification loop. For the trigger, also called primary trigger, whose role is to block a loop must include a nucleotide sequence hybridizing with the 3 'portion of a loop, preferably with a greater specificity than the 3' portion of a loop. a primer. Typically, the portion of the gate hybridizable with the 3 'portion of a fragment of the invention is longer than the portion of the primer hybridizable with this fragment. Preferably, the trigger must comprise a nucleotide sequence sufficient to be hybridizable with a complementary nucleic acid upstream (end 31 of the blocking part of an amplifiable fragment or be more specifically hybridizable to a nucleic acid, for example complementary, than in part] 'of the blocked compound For a secondary trigger, the function (s) is (are) identical, but the hybridization is carried out with a primary trigger and not with the hagmentamp! ifiab / e A nucleic acid capable of simultaneously forming a primary trigger with at least one amplifiable loop and forming a secondary trigger with at least one other trigger is referred to as a mixed trigger In another of its aspects, the invention also relates to an amplification method. for identifying the presence of substances, said method comprising contacting, on the one hand, substances of biological, geological or synthetic origin, live antes or inert, or a mixture of these substances, with, on the other hand, amplifiable compounds, optionally complex, or their precursors having, by the sequence of part of the amplifiable fragment and / or part of the sequence of a trigger of the second nucleic acid of the complex amplifiable compounds and / or by the composition of the loop bonds, an affinity and / or an absence of affinity with at least one of said substances. In one embodiment, the nucleic acids are DNA molecules. Advantageously, the substances are in a form which makes it possible to separate them from amplifiable compounds, which may be complex, or from their precursors which do not have any substance with the substance. Advantageously, the ampliflable compounds, optionally complex, or their precursors which do not exhibit affinity with the substances, can by the nature of their loop bond be separated from the substances. The invention also relates to a diagnostic method comprising the implementation of a nucleic acid amplification step comprising at least one amplifiable compound and / or at least one complex compound, and / or at least one precursor as defined previously. The invention also relates to a method for detecting the presence of a substance or a mixture of substances, said method comprising the implementation of a nucleic acid amplification step contained in a composition comprising at least one amplifiable compound and / or at least one complex compound, and / or at least one precursor as defined above. Advantageously, the substance is bound to an insoluble or separable support of said composition.

According to one embodiment, the method or method comprises contacting an amplifying mix with substances of biological, geological or synthetic origin, living or inert, or a mixture of these substances, which have been brought into contact with amplifiable compounds, optionally complex, and / or their precursors and from which the amplifiable compounds, possibly complex, and / or their precursors having no affinity with the substance have been removed. Advantageously, the substances, after having been separated from the amplifiable compounds, optionally complex, and / or their precursors not having any affinity with them, have been brought into contact with at least one reagent making it possible to transform an amplifiable compound precursor. in amplifiable compound.

According to one embodiment, the method comprises contacting an amplifying mix with amplifiable compounds, possibly complex, and / or their precursors which have been separated from the substances with which they have been previously brought into contact. Advantageously, the amplifiable compounds, optionally complex, and / or their precursors, after having been separated from the substances with which they have no affinity, have been brought into contact with at least one reagent making it possible to transform an amplifiable compound precursor. in amplifiable compound. In another of its aspects, the method comprises contacting the mix with nucleic acids attached to a support and whose sequence is partially or completely identical to the central portion and / or the 5 'portion of the sequence of at least one of the amplifiable fragments present in the reaction mixture. Advantageously, the nucleic acids attached to the support are observed after having been separated from the reaction mixture with which they had been brought into contact for a certain time, preferably after 20 seconds or more, preferably after one minute or more, preferably after three, ten, thirty minutes or more; this time being determined by the skilled person according to the operating conditions. According to a variant, the presence of a detection means, such as nucleic acid and / or biotin and / or dye and / or UuDrDphor8 and / or hapten 5 retained by the nucleic acids attached to the support , is observed visually and / or by a method of revelation and / or by an appropriate instrument. Advantageously, at least a portion of the amplifiable compounds and nucleic acids are attached to the same support. According to one variant, the nucleic acids are observed on a microscopic scale in order to count the areas having a high density of nucleic acid and / or biotin and / or dye and / or fluorophore and / or hapten retained by the nucleic acids attached to the support. According to one variant, the support is a colloidal particle or a microbead. In another aspect, the method comprises contacting the reaction mixture with nucleic acids, referred to as a reporter or detection probe, whose sequence is partially or completely identical to the central portion and / or the 5 'portion of the sequence of at least one of the amplifiable fragments present in the reaction mixture, the observation of the reaction mixture, preferably after 20 seconds or more, preferably after one minute or more, preferably after three, ten or thirty minutes or more after the amplification reaction has started, either to make a real-time follow-up of the amplification, or to quantify the nucleic acids generated from the amplifiable fragments, this time being determined by those skilled in the art. Advantageously, the reaction mixture also contains a compound whose physicochemical properties change in the presence of nucleic acids in the form of ds / chdn. Advantageously, the reporter nucleic acids are of two different types, the first type being partially or totally identical to the central part of the amplifiable fragment sequence, the second type being partially or totally identical to the 5 'portion of the fragment sequence. amp) ihob / e, one comprising a first detectable compound, the other comprising a second compound which modulates the detectable signal of the first compound as a function of the distance separating the two compounds. Advantageously, the method comprises the visualization of DNA molecules to observe those present in the mixamp / iraLeur, preferably after 20 seconds or more, preferably after one minute or more, preferably after three, ten or thirty minutes or more after the reaction mixture is formed, this time being determined by those skilled in the art. According to one embodiment, the visualization method is gel electrophoresis or capillary electrophoresis of part or all of of the amplifier mix. Preferably, at least a portion of the nucleic acids present in the enhancer mix are enumerated as they move in solution. Advantageously, at least a portion of the nucleic acids present in the amplifying mix are immobilized on a surface and enumerated. In another of its aspects, the various aspects of the invention are combined to detect the presence of nucleic acids of interest in a solution by contacting this solution with an amplifier mix. Advantageously, these nucleic acids of interest have previously been subjected to a high temperature, preferably 90 ° C or more, preferably 95 ° C or more, before being cooled to the same temperature as the amplifier mix. Advantageously, the nucleic acids of interest have previously been subjected to a large shear, for example by repeated pipetting action, followed by digestion with an exonuclease which digests the duplex DNA strands with the 3 'end. For example, the exonuclease In particular, the nucleic acids have been previously: - digested with two restriction enzymes having different recognition sites, when the first of these restriction enzymes can produce protuberances 3 'of at least 4 nucleotides long and that the second does not produce such protuberances, digested by an exonuclease which digests by the 3 'end the DNA strands in duplex form, for example Exonuclease III. In another of its aspects, the various aspects of the invention are combined to detect the presence of a substance of interest. In particular, the substance of interest is present in a solution and the solution is contacted with expandable compounds having an affinity for the substance of interest, the complexes formed by the compounds containing the substance. of interest are separated from the solution, for example by filtration or by centrifugation, the separated complexes are brought into contact with a buffer (18) or, alternatively, the loop bonds of the amphoteric compounds contain antibodies having a In particular, the amnoseophilic compounds comprise amplifiable multi-loops whose arnphaftyl moiety and / or the second nucleic acid of the complex compounds and / or the loop linkage have a high affinity to the substance of interest. affinity with the substance of interest The invention also relates to a device performing logical or calculation operations comprising logic or calculation operations implementing the same ns an amplifiable compound and / or at least one complex compound, and / or at least one precursor as defined above. The invention also relates to a logical operator chosen from the OR, AND, AND operator, characterized in that it comprises the use of at least one amplifiable compound and / or at least one complex compound, and / or at least one precursor as defined above. In another of its aspects, the invention relates to a method for detecting the presence of a substance of interest on and / or on the surface of a fiber and / or a solid and / or porous material. and / or fibrous, said method comprising carrying out the amplification method, and any of its variants and combinations thereof. Typically this process can be used in police or customs investigations. In particular, the surface containing the substances of interest is brought into contact with amplifiable compounds having an affinity with the substance of interest, the amplifiable compounds which do not interact with the substances of interest are separated from the surface, and an amplifier mix is brought into contact with the surface. In another of its aspects, the invention relates to a method comprising molecular calculation operations by observing the evolution over time of the composition of the amplifying mix after contacting it with at least two different nucleic acids. and / or while sequentially adding at least one nucleic acid, said method comprising carrying out the amplification method, and any of its variants and combinations thereof. According to one variant, the amplifier mix is distributed inside a network of at least two compartments interconnected by at least one passage Advantageously, the compartments form a one-dimensional, two-dimensional or three-dimensional network. bi-or three-dimensional is a quasi-fractal or random array for example a gel, such as an agarose gel Preferably the two-dimensional array has a planar topology, or spherical, or toric, or Mobius ribbon. In general, the mono-, bi- or three-dimensional network may have a morphology homologous to that of a mathematical representation of a natural phenomenon or of an artificial system or a theoretical concept. Nucleic acids are added to a compartment partition Advantageously, at least a portion of the nucleic acids and / or enhancer loops are attached by construction to the surface of the compartments. preferably spatially ordered at the surface of a partition of the compartments. In particular, nucleic acids and / or amplifiable compounds are bound to nucleic acids or amplifiable compounds attached to the surface of the compartments. Advantageously, compartment partitions also comprise a source of enzyme and reagents, for example and without being restrictive, DNA polymerases, RNA polymerases, restriction endonucleases, exonucleases, endonucleases, oligases, terminal transferases, helicaces, ribosomes, methyltransferases, salts, solvents, buffers / adjuvants, etc. According to a variant, the displacement of the solutions through at least one part or partition of the compartments is imposed, for example by means such as pressurization or depression, or the passage of an electric current. In another of its aspects, the invention relates to a method for determining genetic variations, in particular for performing express / on gene level determinations, and / or for detecting the presence, and / or assaying of markers. and / or any other molecule or substance, and / or for detecting the presence and / or identification of living organisms and / or any particle or substance of biological origin, said method comprising / carrying out the method amplification, and any of its variants and combinations .In another of its aspects, the invention relates to molecular calculators, and / or artificial neural networks, and / or self-evolving systems, the process of amplification, and any of its variants and combinations Brief description of the figures Figure 1A schematically shows an amplifiable compound (1) in its minimum form. e loop (10), the amplifiable fragment (2) where one distinguishes the part 3 '(3), the central part (4), and the part 5' (5). The arrow directs the nucleic acids in the 5'-3 'direction. FIG. 1B diagrammatically shows an amplifiable compound (1 ') in its blocked form: The amplifiable compound according to FIG. 1A is further identified by a primary trigger (11), a secondary trigger (12) and nucleic acids (13) respectively. ) and (14) whose central parts are complementary respectively to the central parts and 5 'of the amplifiable fragment. The links (15) between the nucleic acids and the loop link are also identified.

Figure 2 shows the different steps of the amplification. The amplification primer 101 is identified, and an enzyme 102 with a DNA polymerase activity. Figure 3 is a reproduction of an agarose gel photograph, a result of the experiment of Example 1.

Figure 4 is a reproduction of a chemiluminescence-revealed nylon membrane image as a result of the experiment of Example 2.

Detailed description of the invention

This invention notably takes advantage of the following features: the impossibility for the polymerized DNAs to make a copy of a nucleic acid fragment comprising altered bases or abnormal bonds between nucleotides the propensity of the nucleic acids to maintain a slightly stretched conformation in order to minimize the contact area between the aromatic portion of the bases and the water in which they are in solution, the propensity of two complementary nucleic acids to be more stable in double-stranded form than in single-stranded form. the difference in stiffness between single-stranded DNA molecules and double-stranded DNA molecules. The amplifiable compounds described in the invention have been made in light of these characteristics to enable a large number of single-stranded DNA copies to be obtained when they are part of the amplifying mix. They are schematized in their generality in FIG. 1. As for any manipulation of nucleic acids in single-stranded form, it is possible to check with suitable software (for example, nnfb / d as described in NuckaicAcid Research 31 (13) 3406-15). (2003)), that the amplifiable fragments as well as all the nucleic acids interacting in the different aspects of the invention do not form too stable secondary structures that could harm the expected interactions.

Although not shown in FIG. 113, the amplifiable compound may also include at least one nucleic acid at least partially complementary to the 3 'portion of the immunoglobulin and linked by a link to the loop link. These nucleic acids make it possible to limit the pairing of the amplifiable fragment with nucleic acids forming a pairing that is less stable than the pairing formed with the amplification primer. Similarly, the amplifiable compound may also include at least one trigger connected by a link to the loop link. The amplification mechanism is shown diagrammatically in FIG. 2. The amplifying mix contains amplification primers (101) which are primers that will hybridize on the 3 'part of the amplifiable fragments (2). This set may be extended by the DNA polymerase (102) present in the mix. However, the loop link (10) has been defined to have a maximum end-to-end length, i.e., the length of the geometric segment in the space between the 5 'and 3' ends of the amp fragment. !) Dob! C, not allowing to connect the ends of a double-stranded DNA molecule having N pairs of nucleotides. This length or distance is preferably less than N`0.32nm. After a while, the complex being extended will be composed of a simple part consisting of only 5 nucleotides consisting of the 5 'part of the omplexic fragment, of a double-stranded part. having N -n nucleotides composed of the 3 'portion of the amplifiable fragment and the extended primer, and the end binding loop a -bout less than L [. The fact that both ends of the amplifiable fragment are connected together imposes a geometric constraint on the loop (1). For the reaction to continue, either the single-stranded portion should be stretched to its maximum, or the double-stranded portion should separate at the end opposite to that being expanded. A schematic representation is the subject of FIG. 2, steps II and III. Step II illustrates an extended double-stranded portion at its maximum, and Step III illustrates on the one hand an extended primer whose extension product has an unpaired portion (104), thus single-stranded, and a double-stranded portion. strand (105). FIG. 2 shows in step IV a loop (1) on which three primers are at different stages of duplication: a first primer (101) is matched to the part 3 '(3) of the amplifiable fragment (2) and is ready to be extended; a second primer / 101 \ is being extended and its extension product is still matched by its end 3 'on the central part (4) of the amplifiable fragment (2) where its extension continues while its part 5' is in single-stranded form (104); a third primer (101) has been extended and its extension product remains paired at its 3 'end with the G' / 5 'part of the Fragnnantarnp / Uiab / e (2) where its extension has been blocked by the loop link (10) while its part 5 'is in single-stranded form (104) and it ends to be detached from the amplifiable fragment (2) by the progression of the extension of the second primer (101) . The invention defines a constraint between the end-to-end length of the loop bond and the number of nucleotides of the bonding agent. This constraint is such that in the present situation the extension of the single-strand part is important. Stretching it to the maximum will further expose the nucleic acid component bases to the solvent in which they are located, i.e., water in general. These are essentially hydrophobic aromatic molecules and the exposure to water will have a high energy impact under the conditions usually used for DNA polymerase, especially with those whose activity is optimal at low temperature. . From a certain level of stretching (FIG. 2, step II), this energy impact will be greater than the energetic incidence of the opening of the double helix 30 at the end opposite to that in progress. extension effect, the newly created single-stranded part on the neo synthesized strand does not suffer the constraint imposed by the amplifiable fragment binding loop, and does not need to be eke and rec (scale Z, step III). At this stage the polymerization reaction therefore continues as the nucleotides of the 5 'portion of the primer, i.e. also the strand, detach from the amplifiable fragment by Brownian agitation. Indeed, it is well known to those skilled in the art that the end of a double-stranded fragment is a dynamic structure. The double helix opens and closes continuously at its extremities, and this over a distance of one to several nucleotides. This effect is known to those skilled in the art by the expression breathing of the extremities. While the 5 'portion of the neosynthesized strand is open, an additional nucleotide can be added to its 3' portion by DNA polymerase (Figure 2, Step III). However, the number of nucleotides that can remain in double-stranded form remains unchanged because of the geometric constraints imposed by the loop link. During the synthesis, the double-stranded part virtually slides along the amplifiable fragment, and a single-stranded protuberance corresponding to the 5 'part of the neo-synthesized strand appears. Simultaneously, the 3 'portion of the amplifiable fragment 15 is also found in single-stranded form, and becomes accessible to hybridization with a new primer. In this first phase of the amplification reaction it is critical that the synthesis of the strand stops well or at least is particularly slowed down at the level of the loop link (FIG. 2, step IV). If this were not the case, the synthesis would continue as in the rolling circle amplifications mentioned in the state of the art. If the synthesis of the complementary strand is slowed down at the loop, slowdown is sufficient for the synthesis of another primer to release the first primer of the loop. The answer provided by the invention to solve this technical problem is to link the two ends of the amplifiable fragment with a loop link which blocks or stops the synthesis of the amplifiable fragment by the DNA polymerase. Indeed, with the notable exception of the 3 "5 'alpha thio-phosphodiester bonds well known to those skilled in the art, the bonds between nucleotides that are different from natural phosphodiester bonds and which allow lean all to a 30-inch DNA The same is true of non-natural nucleotides such as nucleotides,> abasic or haptene, in particular Ta b / oLinc, which are known for all practical purposes. Thus, the amplifiable fragments do not contain a nucleotide, or nucleotide sequence, which blocks the polymerase, the nucleotides comprising the nucleic acids, including those of The invention other than those of the invention may include non-natural nucleic acids, in particular those carrying haptens, dyes and fluorophores. generally prevent a nucleic acid strand from hybridizing, and most often, such nucleic acids can serve as a primer in the synthesis of a complementary strand by a DNA polymerase. On the other hand, as indicated in the general description, the nucleic acids of the amplifiable fragments are only those which do not block the synthesis of a complementary strand by a DNA polymerase. Thus, in the conventional sense, circular nucleic acids having one or more nucleotides bearing a chemical group blocking the activity of a DNA polymerase, are considered in the context of the present invention as amplifiable loops whose loop bonds comprise nucleotides carrying the chemical groups blocking the DNA polymerase activity in sufficient number to block the replication of the circular nucleic acid strand, provided that the link length conditions (binding loop) are observed with respect to the longest non-blocking portion contiguous, which is the amplifiable fragment. As a result, a substance of a drastic nudetic acid can be formed under certain conditions (for example at high temperature) but which includes sequences known to those skilled in the art under the term inverted-repSat or inverted. repeated sufficiently stable under the operating conditions of the invention, for example if the repeated inverted sequences are formed by a succession of at least 5 Cytosines or Guanines, form an amplifiable loop whose duplication is sufficiently slowed down at the level of the loop link formed by pairing the portions having the inverted-repeated sequences. Accordingly, a cluplicable circular nucleic acid fragment having at least one sequence having a G-rich region, eg, a sequence of at least 5 Cytosines and Guanines, which is paired at this sequence. to a nucleic acid which may be doped but the end 3 'is not matched to the circular fragment or the 3' end of which does not allow a method to start with this excimer, forms an amplifiable loop whose duplication is sufficiently slowed down at the level of the loop binding [ormeo by the pairing between the circular fragment and the nucleic acid at the GC-rich regions. Therefore, a duplicable circular nucleic acid paired in at least one of its regions with a second nucleic acid forming a more stable pairing than those formed between duplicable nucleic acids, for example if the second nucleic acid is a PNA, forms an amplifiable loop. whose loop link is formed by the paired parts. As for the amplifications of the RCA type, amplifiable fragments comprising between 50, 150 or even 500 nucleotides are generally used, and the amplification efficiency generated by longer fragments is experimentally verified on a case-by-case basis. For an advantageous amplification can be done, it is necessary that a second primer can hybridize with the amplifiable fragment despite the presence of the neo-synthesized fragment. For this to be possible, it is necessary that the 3 'part of the amplifiable fragment contains enough nucleotides in single-stranded form. For this, it is necessary on the one hand to impose a geometric constraint, and on the other hand to ensure that it is dimensioned so that the number of nucleotides that are in single-stranded form is sufficient to allow a primer to bind to its part 3 '. A response provided by the invention to solve this technical problem is on the one hand to connect the two ends of the amplifiable fragment by a loop link which will induce a geometric constraint, and on the other hand to size the end-to-end length of this bond so that it is less than a constraint length Lc, and which is defined by Lc = ((Nn) xpûnxq)

where x is the sign of multiplication, where - is the sign of subtraction, where N is the number of nucleotides contained in the amplifiable fragment, p is approximately equal to 0.32nm (nanometers), q is approximately equal to 0.75 nm (nanometers) and n is preferably between 6 and 50, preferably between 8 and 30, preferably between 10 and 25.

The invention arbitrarily sets the value of q at 0.75 nm rather than 0.32 nm, which is the typical spacing between base plates in a double-stranded DNA molecule under the operating conditions of the invention. It is expected that the single-stranded portion of the copying slug will be greatly stretched, so far from being as compact as double-stranded nucleic acids. The invention therefore implicitly defines constraints on the size of the primer, which should comprise in its part 3 'preferably between 6 and 50, preferably between 8 and 30, preferably between 10 and 25 nucleotides whose sequence is complementary to the sequence of the part 3 'of the amplifiable fragment. In addition, the primer preferably comprises at least between 0 and 10, preferably between 0 and 3 nucleotides less than the value of n sizing the amplifiable loop. On the other hand, the primer may have a portion 5 'whose length is arbitrary, although the molecules that are too long, of which part of the sequence may be complementary to the part 3' and form internal structures with this part, are avoided. ci and limit its ability to hybridize with the amplifiable fragment. In fact, to design an amplifiable loop, two of the parameters N, n and Lc can be chosen and the constraint on the third determined.

For example, for a loop link consisting of a single modified nucleotide, Lc is approximately equal to 0.75 nm, and n is approximately equal to 0.4 x N. The amplification primer therefore preferably comprises a number of nucleotides comprised between 6 For example, by setting n to 20 which is a primer size long enough to allow good hybridization specificity, N may be defined to be at least about 50 nucleotides. For example, for a loop link consisting of biotins attached to the last nucleotide of each end of the amplifiable fragment, the biotins themselves being linked by affinity to streptavidin, we can estimate Le at about 3 nm, and determined as previously. , N equal to at least 60 nucleotides. The hybridization of a second primer on the amplifying fragment is an energetically favorable event, because at the level of the solution, the number of single-stranded molecules decreases. Once the second amplification primer hybridizes to the enhancer fragment, it is extended by the DNA polymerase. Thanks to the phenomenon of respiration, the neo-synthesized first strand transiently releases one or two nucleotides of the amplifiable fragment, which allows the polymerase to incorporate one or two nucleotides on the second amplification primer and to render the first strand deshybridization neo-synthesized irreversible. Thus, step by step, the nec synthesized first strand is entirely detached from the amplifiable fragment and replaced by the second fragment n. At this stage, the amplification cycle can resume with the arrival of a third amplification primer. etc. It is understood from this description that the amplification mechanism directly provides single-stranded nucleic acids whose sequence is complementary to that of the amplifiable fragment. It is also understood from the description of the invention that each amplifying loop will produce a single-stranded nucleic acid at a certain time interval. The number M of nucleic acids produced by B amplifiable loops will therefore be proportional to the time of nea [tiont:

M = Bxt / ~ m where tau is ~~ mpsmoyen this realization of an amplification cycle under the conditions of the experiment. This relation is obviously valid only after the first amplification cycle, because as long as no complete copy is made, M is equal to U. An accurate measurement of the number of molecules produced over time makes it possible to put highlight a latency that corresponds to the average time required to make the first copy on each loop, and may be different from tau.

The feasibility of this invention was verified by carrying out the following experiments. EXAMPLES EXAMPLE 1 Demonstration of the Formation of Amplification Products The first experiment makes it possible to demonstrate the nature of the amplification probes revealing their presence by gel electrophoresis and labeling. Amplifiers contained in 1.5mL Eppendorf-type tubes were formulated according to the following table: Amplifier Mix Na 1 2 3 4 8.351x1 ampicillable loop solution + + 0.35 pI DNA polymerase + - + 0.35 μ Amplification primer + + + 20 pI Mix Buffer + + + + +: signifying presence: meaning absence

The solution of amplifiable loops is composed of: 1 μl of a 188 μM solution of the oligonucleotide (DNA) sequence GAAGAGATATAGGATTAGCCAATTGACGACAATGTCCCGACACCAGAAGCAGCATCAG T (SEQ ID No. 1), comprising a biotin at each of its ends and manufactured in a manner by Eurogentec, Belgium (command syntax: GAAGAGATATAGGATTAGCCAATTGACGACAATGTCCCGACACCAGAAGCAGCATCAG T [3 '] Biotin [5] Biotin 200 OliGold) 2 μl of a 1 μl streptavidin solution (New England Biolabs, USA) 10 μl of 10x Nebl buffer (New England Biolabs, USA) 87 μl of PCR water (Sigma Aldrich, USA) It should be noted that in this example, the oligonucleotide constitutes an amplifiable loop precursor, and that the sequence of the amplifiable fragment corresponds here to that of this oligonucleotide. The solution of the amplification primer is composed of the oligonucleotide (DNA) with the sequence TAATGTCGTCACTGATGCTGC 1 t CTGGTGT (SEQ ID No. 2) comprising a biotin at its 5 'end, custom-made by Eurogentec, Belgium (syntax of control: TAATGTCGTCACTGATGCTGCTTCTGGTGT 200 genomic [5 '] biotin), in solution at 100 μM in water. DNA polymerase is a solution comprising 5 U / μl of DNA polymerase activity of a mutant having lost its 3 'exonuctase activity of the Klenow fragment of Escherichia coli DNA polymerase I (New England Biolabs, USA).

The buffer mix is a solution composed of 10 μl of 10x Nebl buffer (New England Biolabs, USA) 20 μl DMSO 29 - 3 μl of a 10mM solution 10mM d8dATP dCTP, 10mM dGTP and 10mM dTTP (Finnzymes, Finland ) 67 μl of PCR water (Sigma Aldrich, USA)

Amplifier mixes 1 to 4 are set at 370C. After 1 hour, 10 μl of the reaction product is taken, mixed with 2 μl of a solution containing loading blue (New England Biolabs, USA) containing SYBr green and loaded on agarose gel. An image of the gG1 placed on a computer is reproduced in FIG. 3. It is clearly seen that a band corresponding to the amplification product is produced only when the amplifier mix is totally formed, and absent when the amplifier mix is incomplete. . The apparent size of the band is intermediate between that of the amplification primer and that of the amplifiable loop.

EXAMPLE 2 Demonstration of the Hybridization Amplification Products on a Support A second experiment makes it possible to demonstrate the hybridization amplification products on a support comprising nucleic acids complementary to the amplification products which are marked by a biotin group present on the amplification primer. Hybridization is revealed by chemiluminescence after revelation by treatment with streptavidin and alkaline phophatase.

For this purpose, an amplification loop comprising: 1 μl of 1 × Neb buffer 1 - 2 μl DMSO-035 μ μDs 10 μM-0.35 μl of the amplification primer 0.35 μl of amplifiable loop DNA 0.35 μ ymease 6 pf of water. The origin and composition of the reagents is the same as in the previous experiment. After 1 hour of incubation at 440 ° C., the reaction is diluted by the addition of 400 μl of an aqueous solution, called Solution Abis composed of: - 3% SDS 25mM sodium phosphate buffer, pH 8.5, 5 - 75mMNacl (all reagents: Sigma Aldrich, USA).

This solution is used to coat a Nytran N (Schleicher & Schuell, USA) hybridization membrane of about 10 n × 2 CO 3 onto which was deposited and fixed by a 40 second exposure to ultraviolet rays generated by a trans-illuminator ( VUtærLourmad: - 0.35 μl of a 1 μM solution of the sequence oligonucleotide / * / C / u / C / G / * / C! C! O! G! C! / AC! 8! 8 [AA {! ΔACGA [A / 1] GTCCCG (SED ID No. 3) 15 - 0.35 μl of a 1 μM solution of the sequence oligonucleotide GTAGTCCCAGTACGGTAGTGTCTCGCATGACATCTCACAGGATAAGACC (SEOIDv4) - 0.35 μl of a 1 μM solution of the sequence oligonucleotide 11AACTATACAATTGACGACAATGTCCCG (SEO ID # 5)

It will be noted that the sequence of the 3 'portion of the first and third such oligonucleotides is identical to the sequence of the central portion of the amplifiable fragment, whereas the 5' portions of these oligonucleotides as well as the second oligonucleotide do not exhibit significant homology with the amplifiable fragment sequence. After 30 minutes of incubation, the membrane is removed and placed successively for 5 minutes each time and with gentle manual stirring in: - about Zm! Desolution Abis - 2 ml of Abis solution also containing Z pl of streptavidin at 1 g / ! - about Zml solution Abis 2rn Solution Abs also containing 2 p! a (ka! ine phoshphotase 30 '2 ml solution Abis' 1 ml aqueous solution with 40p1 x CDP'sto / Assay bu [iron (25x ) 1 Mn / of aqueous solution comprising 48 μl of DP [DPrstorAssay buffer (25x e 1 p / of [OPstar oeageni (2SmN) "31 The membrane is then placed between two glass plates placed on a heating plate PZ 28- 1 (Harry GesUgkeit, Germany) kept at 60 ° C and thus placed in a dark room (manufactured for example by Vilber-Lourmat, France) equipped with a Mu! Lib / ue digital camera (Perkin Elmer, USA itself) equipped with a 83mm lens 1: 13 (Pentax, Japan) An image of the membrane is taken with an exposure time of 300 seconds, a gain of O and an offset of 100 (arbitrary values specific to the camera) using a control logic (such as the software Mu! dB! ueGUI supplied with the camera). The resulting image is reproduced in Figure 4 and shows a signal at the location of the deposition of the first and third oligonucleotides only, as expected. The other aspects of the invention do not have a critical phase from a physico-chemical or enzymatic point of view. The enzymatic and physico-chemical steps that make up these other aspects are known to be achievable by the human being.

Example 3: Possible Protocol for the Preparation of Precursors:

Complex amplifiable loop precursors can be prepared by mixing a molar amount of the second biotin-containing nucleic acids at their 3 'end and the phosphorylated end of which is 5'phosphate with a molar amount W of streptavidin and a two-fold amount. W molars of biotin, by mixing a molar amount W of the third nucleic acids having a biotin at their 5 'end also with a molar amount W of streptavidin and two molar amounts W of biotin, and then mixing these two first mixtures by adding a molar amount W of the first nucleic acid having a biotin at each of its ends. In this procedure, care is taken to add in the first two mixtures the two molar quantities W of biotin in order to obtain mainly constructions comprising streptavidin, only one of the second or third nucleic acids and two biotins, thus leaving only a single streptavidin binding site available to attach to one end of the first nucleic acid. The resulting mixture contains a mixture of molecular species, usually comprising the expected construct comprising a second or a third nucleic acid, a skeptovidine, a first nucleic acid, a streptavidin and then a third or a second nucleic acid (2S1S2 two 2S! 53 + 3SlS3 although only 2S! S3 are active but 25153 will also be in the majority). The latter can be separated from undesirable constructions, for example by separating them by agarose gel electrophoresis and then releasing them from the gel by methods well known to those skilled in the art, or for example by magnetic bead techniques of which the practical implementation is well known to those skilled in the art: by capturing them a first time with magnetic beads covered with nucleic acids complementary to the second nucleic acid, separating them from the magnetic beads, for example by carrying the pH at 11.5 followed by neutralization of the supernatant comprising the nucleic acids, - capturing them a second time with magnetic beads covered with nucleic acids complementary to the third nucleic acid, separating them from the magnetic beads, for example by raising the pH at 11.5 followed by neutralization of the supernatant comprising the nucleic acids.

Certain aspects of the invention greatly enrich the basic amplification mechanism described above, as described hereinafter. In particular, the triggers are nucleic acids that are designed and sized so that they take the place of the amplification primers. To prevent them from being displaced by the primer by virtue of respiration, the primers are sized so that the primer has a few nucleotides less than the 5 'portion of the triggers which hybridizes to the amplifiable fragment. The 3 'portion of the triggers is not hybridized to the amplifiable fragment, and therefore a trigger does not behave like a primer. The trigger therefore blocks the amplification mechanism. Preferably, the 3 'end of the gate comprises a means preventing the start of the polymerization at this end, for example when the last nucleotide of the 3' end is a 2'3'-didesoxynucleotide. To unlock the trigger, several mechanisms have been designed and constitute different aspects of the invention.

The first is to provide a nucleic acid whose sequence of part 3` is complementary to that of the part 3 'of the trigger. In other words, it is to provide a primer that allows the synthesis of a complementary fragment of the trigger. During this process, the trigger is separated from the portion 3 'of the amplifiable fragment. This allows an amplification primer to attach to the amplifiable fragment and start the amplification described above. It is thus understood that the amplification mechanism can be started by nucleic acids whose sequence is independent of that of the amplification primer and the amplifiable fragment. These primers may be derived from double-stranded nucleic acids by enzymatic treatment. In one aspect of the invention, DNA fragments are digested with two restriction enzymes having different recognition sites, when the first of these restriction enzymes can produce 3 'protuberances of at least 4 nucleotides of DNA. long and the second does not produce such protuberances, followed by digestion with an exonuclease which digests by the end 3 '/ es strands of DNA in duplex form. Enzymes can be, for example, Sph I and exonudase III. A single strand of Sph Alu fragments has a 3 'protrusion of 4 nucleotides. This is not digested by exonuclease III while the other is, which provides single-stranded fragments that can serve as a primer. As the restriction enzymes cut at predictable positions, each nucleic acid, for example genomic, mitochondrial or viral DNA, is transformed into predictable nucleic acid sequences. Knowing the sequence of the nucleic acids of interest, it is of course possible to design the sequence of the triggers so that the amplification is triggered by the fragments from the preparation of the nucleic acid of interest. The sequence of a trigger then comprises in its 3 'part the sequence complementary to the 3' part of one of the fragments from the preparation, while the sequence of the 5 'part is complementary to that of the 3' part. of the amplifying fragment. Preferably, this 5 'portion comprises 2 to 4 more nucleotides than the amplifying primers, and is separated from the 3' portion by 2 to 4 essentially identical nucleotides, for example the TT1 sequence, although it is adapted at the cos per case to the rest of the trigger sequence to avoid the formation of secondary structures likely to interfere with the hybridization properties of the gaster.

We note the simplicity and efficiency of the process, because i! There is no need to re-examine specific amplifc loops for each nucleic acid of interest. It suffices to draw a single-strand fragment of 40 to 50 nucleotides in length which can be synthesized very easily by the synthetic techniques known to those skilled in the art. Another way to release amplifiable loops from the presence of the trigger is to design triggers whose sequence is completely complementary to at least a portion of the fragments from the nucleic acid preparation. In order to avoid having to use amplifiable loops specific to each fragment, it is advantageous to reserve this approach for secondary gates. A primary trigger is thus drawn whose sequence of the 3 'part is partially or totally identical to the sequence of the central part of one of the nucleic acids resulting from the preparation, and a secondary trigger whose sequence of the central part is complementary. in part 3 'of the primary trigger and whose sequences of parts 3' and 5 'are complementary to the sequences of parts æcUacenteSà the part of the fragment from the preparation which was used as a basis for the drawing of the primary trigger. In this way, the fragment from the preparation can fully hybridize with the secondary trigger, which will detach it from the primary trigger. In order to detach the primary trigger from the amplifiable loop, care has been taken to add a nucleic acid whose sequence is complementary to the sequence of the primary trigger, so that it can serve as a primer and detach the trigger. unblocked primary as previously described. This second mechanism for triggering amplification makes it possible to use simpler nucleic acid preparation methods. For example, messenger RNAs that are naturally occurring nucleic acids can be used directly in single-stranded form. For example, when dealing with complex nucleic acids such as microorganism or eukaryotic genomes, the nucleic acids can simply be rapidly heated and cooled, thereby freezing a large portion of the nucleic acids in single stranded form. The nucleic acids can also be treated with a denaturing agent which is rapidly neutralized, for example a solution with a pH greater than 12.5, for example sodium hydroxide neutralized with an acid solution, for example HCl.

The nucleic acids can also be digested with an exonuclease which digests DNA strands in duplex form by, for example, exonodase HI, which will lead to the formation of nucleic acids in single-stranded form. . To increase the efficiency of this treatment, it is useful to subject the DNA in solution to shear forces to cut the longer fragments. This can be done easily by pipetting the solution several times with the micropipettes commonly used in the art. An important aspect of the amplification mechanism of the invention is to provide nucleic acids in single-stranded form. These can of course behave like a leader in their turn. In particular, they can serve as primer on the triggers. In particular, when the reaction amplifier mix contains at least one locked loop, denoted B2 whose sequence of the portion 3 'of the trigger is the same as that of the part 5' of the amplifiable fragment of at least one distinct amplifiable loop 10, noted B1, also contained in the amplifiable mix. This amplifying mix composition is very advantageous when the B1 loops are initially blocked and released by nucleic acids prepared as described above. When the amplifying mix comprises m nucleic acid molecules capable of unblocking B1, at the beginning of the reaction, m B1 loops will be unblocked. Each unblocked loop B1 will produce nucleic acids, denoted S1, from the moment it has been unblocked. Each S1 nucleic acid can unblock a B2 loop, which will itself produce nucleic acids, denoted S2, from the moment it has been unlocked. By integrating this dynamic over time and neglecting in first approximation the time necessary to unblock loops B1, the total number of nucleic acids S2 produced over time, which from a certain reaction time is obtained. becomes approximately equal to: m / 2 x (t / tau) ^ 2 It is found that we obtain an amplification which is no longer linear with time, but which increases as the square of time, which in practice is much faster. It is understood that it is quite possible to chain several locked loops to obtain even faster kinetics of the polynomial amplification type. Exponential kinetics can be obtained when the amplifier mix 30 also contains at least one blocked BI loop whose sequence of the central part of the trigger is the same as that of the part 5 'of the amplifiable fragment of this locked loop. In addition, the sequence of the 3 'portion of the trigger may be identical to that of the 3' portion of a nucleic acid fragment of interest. In this way, the sequence of the amplifiable fragment is independent of that of the triggering fragments. This amplifying mix composition is very advantageous when the B1 loops, initially blocked, are released by nucleic acids prepared as described above. When the amplifying mix comprises m nucleic acid molecules capable of unblocking B1, at the beginning of the reaction, m BI loops will be unlocked. Each unlocked loop B1 will produce nucleic acids, denoted Si, from the moment it has been unblocked. Each nucleic acid Si will be able to unlock another locked loop B1, because the sequence of the portion 1 'of Si is complementary to the central part of the trigger and can therefore serve as a primer to unlock it. The number of unlocked loops will therefore increase approximately exponentially after a certain reaction time, and therefore also the number of S1 fragments. This exponential approach has the advantages and disadvantages of exponential amplification in general. If it makes it possible to obtain a lot of signal in a short time and therefore to be advantageous for purposes of detecting the presence or absence of the triggering nucleic acid, it is in practice difficult to deduce with certainty the quantity initiating nucleic acid initially present from the amount of nucleic acid produced during a given time interval. In addition, the reaction is so fast that it can exhaust the number of loops locked during the reaction, and thus operate in an all or nothing mode, which can be problematic for quantification purposes but which can be advantageous for detection purposes or molecular calculation purposes. On the other hand, it is possible to take advantage of the ability of the invention to allow both polynomial and exponential amplification in time to achieve combined dosing and detection applications. In practice, the methods of visualizing the number of molecules produced have a lack of linearity. Indeed, when the signal is too weak, it is masked by the noise of the measurement, when the signal is too strong, it saturates the instrument. This remains true for a simple visual observation of a coloration related to the presence of molecules produced. Therefore, if one carries out in parabola in separate containers or within the same mixture, exponential and polynomial amplifications of increasing order, one can take advantage of the effect of scuil to dispose at the test of the presence or absence of the targeted nucleic acids and an evaluation of the number of these nucleic acids. In the above description, the polynomial or exponential amplification was triggered by nucleic acids that unblock amplifiable loops b / oquecs. It is obvious that the amplification starts spontaneously if unblocked loops are provided This aspect is particularly interesting if amplifiable loops with affinity to a substance are used For example, amplifiable loops attached to an antibody can be used. A simple way of doing this is to use antibodies labeled with one or more biotins, and amplifiable loops formed, for example, of streptavidin and nucleic acids end-modified with biotins, are added in stoichiometric proportion. All of these compounds are commercially available, it is clear that amplifiable loops having an affinity for a substance, in fact the one recognized by the antibody, are thus obtained, so it is easy to carry out detection tests. the presence of substances, especially bacteria, viruses or other adsorbent substances or are deposited on a surface, for example directly on objects such as an operating table or door handles or on smears with a tongue 15 in plastic or other suitable material. {} n then contacts the surface with a first solution, containing a buffer (for example Tris-HCl 50 mmM pH 7, 50 mM NaCl, 10 mM EDTA), containing amplifiable loops having an affinity with bacteria, viruses or substances. to detect. After 1 to 5 minutes, this first solution is rinsed with a rinsing solution (for example 5mM Tris-Hel pH 7, 10 mM NaCl). The rinsing solution is removed by shaking the surface or blowing air, then placing a few microliters (eg 50) p! of a speaker. The amplifying mix may comprise a tab having nucleic acids identical to the central portion and / or 5 'loops having an affinity (or secondary amplifiable loops used to perform polynomial or exponential amplification) attached to its surface, and the primers amplification can be labeled with biotin or dye, for example as described in Nuc! eicAcids Res. After a few minutes of reaction, the tab is removed, rinsed with a buffer (for example 50 mM Tris-Hel pH 7, 10 mM Na 2 and observed directly if dye-labeled amplification primers were used. If bovine primer has been used, the latter may be exposed by contacting them, for example for 5 minutes, with a solution containing strcptavidio alkaline phosphatase complexes (SigmaAldrich) at a concentration of 100 μg //, followed by rinsing (eg, Tris-Hd 50mN1 pH 7, 10 mM NaCl), followed by contacting a solution containing NB [-B (IP / 'k] aldrich). After about 5 minutes, we can rinse (for example Tris-Hel SOnnM pH 7, 10 mM Na []) and observe the tongue.In both cases of revelation, if a color appears, we can deduce that the target substance was present on the surface, this procedure can easily be using several pluralities of aminifluorocular lozenges having a particular affinity, each plurality having in the central part or the 5 'portion of the amplifiable fragment a particular sequence, and using a tab comprising several distinct zones on each of which is a nucleic acid of identical sequence to that of each of the central and 5 'portions of each of the particular loop pluralities. {} n can also use / atenæl flow type systems as described in Nucleic Acids R8s.2OU7; 35 (1O): e74. An interesting aspect of this approach is that it is not necessary to remove the sunspots from the surface containing the affinity substances, unlike other techniques well known to those skilled in the art, for example ELISA tests. This makes it possible to carry out tests on novel media, for example directly on the skin, leather, fabrics, furs, etc. Of course, we have presented here only one example among a large number of possibilities. . As indicated in the brief description, the invention also consists in combining the various aspects of the invention as described to meet a large number of problems encountered in the art. One of the interesting applications of the invention is to perform allele determinations on SNPS using Type II precursors (a similar approach is possible with type I ligable precursors). Fragments whose ends are free and whose 5 'end is phosphorized are then selected so that their sequence corresponds to one of the sequences adjacent to the SNP and the last nucleotide of one of the two fragments is identical to one or the other of the expected alleles. These precursors are then brought into contact with DNA made single-stranded by one of the methods already described above, in a solution containing a DNA ligase and its appropriate buffer (for example 0.5 μl of T4 DNA oligos (NEB)). 5 μl / μgose buffer (Neb), 45 μM H 2 O). After a few minutes (for example 5 minutes), the ligase is inactivated by heating to 65 ° C. for 10 minutes or by stirring the solution on a Vortcx-type orbitol stirrer with a rotation speed of at least 2000. rpm for at least one minute. Then the amplification primer, a DNA polymerase and the nucleotides and DM6O (eg, 7 μl DMSO grade, Sigma Aldrich), 10 μL H20 (Sigma Aldrich), 0.5 μl of E coli DNA polymerase I ( NEB), 0.7 μl dNTP mix at 10 mM

In this process, only the precursors whose fragment sequence corresponds completely to the allele are ligated and form amplifiable loops. The observation, by one of the methods described in the invention, amplification products loops thus allows to deduce and / or quantify the presence of the alleles of interest The locked loops allow to define logical operations whose signals of The inputs are made by nucleic acids in single-stranded form and the output signals are made by the amplification products of the loops which have been unblocked, directly or indirectly, by the input signals. One of the ways of carrying out the logical operation {} U is to use an amplifier mix having locked loops of which only the parts 3 'of the gates are different. The input signals are formed of a mixture which may comprise nucleic acids complementary to one and / or the other of the 3 'parts of the triggers. It is also possible to use a single trigger whose sequence of part 3 'comprises the complementary sequences of the two nucleic acids producing the input signals. The output signal is produced by the nucleic acids produced by the unblocked loops. One of the ways to perform the AND logic operation is to use an amplifier mix having loops locked by primary gates themselves locked by secondary gates. These loops will be unlocked only by the simultaneous presence of the two nucleic acids producing the input signal, the first being complementary to the part 3 'of the primary trigger and which is blocked by the secondary trigger, the second being complementary to the part 3 'of the secondary trigger. The output signal is produced by the nucleic acids produced by the unblocked loops. One of the ways to perform the AND operation is to use an amplifier rnlx with three locked loops. The sequence of the first loop trigger portion 3 'is complementary to the sequence of the first nucleic acid (A) forming the input signals, and the sequence of the portion 5' of the first loop cst Identical to the sequence of the part 3 'of the trigger of the third loop. The sequence of the portion 3 'of the gate of the second loop is complementary to the sequence of the second nucleic acid (B) forming the input signals, and the sequence of the central part of the second loop is identical to the sequence of the part 3 'of the trigger of the third loop. Thus, the DNA fragments produced by the second loop, if unblocked by one of the input signals, form secondary triggers which will block the primary trigger of the third locked loop, which can no longer be unlocked. by the nucleic acids produced by the first loop. The output signal is produced by the amplification products of the third loop. This loop combination forms a logical flip-flop or memory. The writing or storage of the information is done by the second nucleic acid / 8 \, the reading by the first nucleic acid (A), and a 3rd nucleic acid identical to the 5 'part of the second loop can regenerate the memory. By analogy with computers based on electronic logic gates, these three operations make it possible to define all the logic functions necessary for the production of a computer by linking the operations inside the same amplifier mix or via a network of compartments interconnected by channels, particularly if the loops are immobilized on the surfaces of the compartments through their loop connection. According to one embodiment, at least a portion of the array of compartments 70 and channels is formed by the porous structure of a material, for example an agarose or po / yaoryamide gel, and at least a portion of Amplifiable loops and nucleic acids are immobilized on the porous material. One of the peculiarities of the present invention in the context of molecular computation is to be able to very simply realize a system generating pulses of molecules. One way to realize pulses is to use an amplifier mix with two loops. The sequence of the 3 'portion of the trigger of the first mouth is complementary to the sequence of the nucleic acid forming the triggering signal of the pulse, and the sequence of the 5' portion of the lead. loop es Same as the sequence of the 3 'part of the second loop The sequence of the central part of the second loop is identical to the sequence of the 3' part of the first loop and the sequence of the 5 'part of the second loop. loop is identical to the sequence of the 3 'partle of the nucleic acid 41 triggering the pulse.The amplifying mix may also comprise nucleic acids, the only of which the central sequence is complementary to the central sequence of the second loops, and of Preferably, these nucleic acids are attached to the loop bonds of the second loops by one of their ends, Thus, the amplification products of the first loop behave as amplification primers of the second The DNA fragments thus produced by the second loop form triggers that will re-block the first loop. This reblocking process is not instantaneous, and during a certain time interval, but only during this time interval, the first unblocked loops 10 will generate amplification products which will constitute the impulse. The duration of the pulse is also modulated by the amount of triggering nucleic acid. The pulse generation aspect of the invention makes it possible to design sequential information processing systems and not only parallel ones as in the molecular calculation embodiments known to those skilled in the art to date. Of course, the invention also makes it possible to parallelize the sequential processing of the information. One of the ways to perform a signal expansion operation is to use an amplifier mix having a plurality of different loops in their central part and 5 ', but which are blocked by the same trigger. Thus, nucleic acids whose sequence of the 3 'portion is identical can trigger the production of a plurality of different nucleic acids. One of the ways to realize an operational amplifier is to use an amplifier mix having two locked loops and two distinct amplification primers specific to each of the loops. The sequence of the central portion of the first loop is identical to the sequence of the 3 'portion of the second loop and the sequence of the 5' portion of the first loop is complementary to the sequence of the 3 'portion of the trigger. the second locked loop. The sequence of the central portion of the second loop is identical to the sequence of the 3 'portion of the first loop and the sequence of the 5' portion of the second loop is complementary to the sequence of the 3 'portion of the second loop. trigger of the first locked loop. Each loop may also comprise a nucleic acid of which only the central part is complementary to the central part of the amplifying fragment and which is attached to a loop link by one of its ends. These nudic acids make it possible to control the unwanted hybridizations of the amplification primers on the central portions of the amplifiable fragments. For this purpose, their central part whose sequence is complementary to the central part of the amplifiable fragments may comprise 2 to 4 nucleotides more than the amplification primers.

One of the ways to achieve such a loop is to use an amplifiable fragment comprising a biotin at each of its ends, and two nucleic acids each having a biotin at one of their ends. These 3 fragments are mixed with streptavidin, a protein that binds 4 biotins simultaneously. Thus, the nucleic acids produced by one of the loops constitute triggers of the other loop. The level of amplification of one of the loops is therefore modulated positively by the nucleic acid flow of its own triggers and negatively modulated by the flux of trigger nucleic acids of the second loop. The output signal is produced by the nucleic acids produced by one or the other of the amplifiable loops.

It is understood that the loops of the invention can be seen as bio-molecular transistors that can be combined in an infinite number of ways so as to produce circuits producing the desired functionalities, whether for analytical purposes or for calculation purposes.

Claims (15)

  1. REVENDICATIONS1. Compound comprising at least one nucleic acid CLAIMS1. A compound comprising at least one duplicable nucleic acid, called an amplifiable fragment, said amplifiable fragment consisting essentially of nucleotides allowing polymerization of a complementary single-stranded nucleic acid, said compound comprising at least one means for stopping the polymerization, called a bouchæ bond. * / consisting essentially of substances not permitting polymerization, said amplifiable fragment comprising a portion 3 ', a central portion, and a portion 5', the 3 'and 5' parts of said amplifiable fragment being both connected to each other by less a means of stopping polymerization.
  2. 2. Compound according to claim 1, characterized in that the loop connection limits the end-to-end distance between the ends 3 'and 5' of the longitudinal component at a length of strain C L *, so as to impose a geometric constraint to the fragmnentarnp! ifiab! e so that the complementary strand of the amplifiable fragment can not match under the conditions of the polymerization amplifiable fragment over its entire length to allow another nucleic acid to hybridize on the amplifiable fragment.
  3. 3. Compound according to claim 1 or 2, characterized in that it allows the polymerization of a complementary single-stranded nucleic acid by an enzyme having a DNA or RNA polymerase activity, and in that the loop bond stops the polymerization. .
  4. 4. Compound according to any one of the preceding claims, characterized in that the ampicillable fragment consists essentially of nucleotides present in nature and / or artificial.
  5. A compound according to any one of the preceding claims, characterized in that it is circular, thus forming an amphibizic loop, optionally complex when the loop bond comprises at least one duplicable nucleic acid.
  6. 6. Compound according to any one of the preceding claims, characterized in that it comprises at least two amplifiable fragments, thus forming an amplifiable loop 44, said compound optionally comprising in at least one loop bond at least one nucleic acid duplicable.
  7. A complex compound characterized in that it comprises a compound as defined in any one of the preceding claims and a trigger nucleic acid, said trigger comprising at least one paired region on at least a portion of the amplifiable fragment. said trigger also comprising at least one region unmatched to the amplifiable fragment to allow a nucleic acid at least partially complementary to the trigger to pair at least in a portion of that region to release the fragment of the fragment. e matched to the trigger, in particular by competitive hybridization or trigger duplication.
  8. 8. complex compound according to claim 7, characterized in that said trigger is matched in the portion 3 'of said amplifiable fragment.
  9. 9. Precursor, forming in particular precursor of a compound as defined in any one of claims 1 to 8, said precursor comprising at least a first and a second nucleic acid, the 3 'end of the first nucleic acid being connected to the 5 'end of the second nucleic acid by a loop link type linkage. 20
  10. 10. Precursor according to claim 9, characterized in that the loop bond limits the end-to-end distance between the 3 'end of the first nucleic acid and the 5' end of the second nucleic acid at a constraint length. or LC does not allow the pairing of a complementary nucleic acid over its entire length, when the 5 'end of the first nucleic acid is connected to the 3' end of the second nucleic acid.
  11. 11. Precursor, forming in particular precursor of a compound as defined in any one of claims 1 to H 'said precursor comprising at least a first, a second, and a third nucleic acid, where a first end (3' end) or 5 ') of the first nucleic acid is connected to the 5' end of the second nucleic acid by a loop-type binding / and where a second end (5 'or 3' end, respectively) of the first nucleic acid is connected at the 3-end of the third nucleic acid by a loop-bond-like linkage said third nucleic acid having a phosphorated 5 'end, said first nucleic acid having a defined length so as to limit the end-to-end distance between the 3 'end of the second nucleic acid and the 5' end of the third nucleic acid at the constraint length or Lc does not allow the pairing of a complementary nucleic acid re on its entire length, when the 5 'end of the third nucleic acid is connected to the 3' end of the second nucleic acid.
  12. 12. Composition comprising at least one compound as defined in any one of claims 1 to 6 and / or at least one complex compound as defined in claim 7 or 8, and / or at least one precursor as defined in any of claims 9 to 11, in a solvent, especially aqueous.
  13. 13. Composition according to claim 12, characterized in that it comprises an enzyme having a DNA or RNA polymerase activity, units making it possible to form, by their polymerization, a nucleic acid, at least one buffer, at least one salt, and at least one minus a nucleic acid complementary to the amplifiable fragment forming amplification primer.
  14. 14. Diagnostic method comprising the implementation of a nucleic acid amplification step comprising at least one compound as defined in any one of claims 1 to 6 and / or at least one complex compound as defined in claim 7 or 8, and / or at least one precursor as defined in any one of claims 9 to 11.
  15. 15. Method for detecting the presence of a substance or a mixture of substances, said method comprising the implementation of a nucleic acid amplification step contained in a composition comprising at least one compound as defined to any one of claims 1 to 6 and / or at least one complex compound as defined in claim 7 or 8, and / or at least one precursor as defined in any of claims 16 Method according to claim Characterized in that the substance is bound to an insoluble or separable support of said composition. Device carrying out logical or calculation operations comprising logical or calculation operations using at least one compound as defined in any one of Claims 1 to 6 and / or at least one complex compound as defined in claim 7 or 8, and / or at least one precursor as defined in any one of claims 9 to 11. 18. A logical operator selected from the OR, AND, AND operator, characterized in that it comprises the use of at least one compound as defined in any one of claims 1 to 6 and / or at least one complex compound as defined in claim 7 or 8, and / or at least one precursor as defined in any one of claims 9 to 11.
FR0856430A 2008-09-24 2008-09-24 New compound comprising a duplicable nucleic acid (amplified fragment), where compound comprises a means of locking of polymerization (loop linkage), useful e.g. in complex for diagnosing the amplification of the nucleic acids Pending FR2936246A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
FR0856430A FR2936246A1 (en) 2008-09-24 2008-09-24 New compound comprising a duplicable nucleic acid (amplified fragment), where compound comprises a means of locking of polymerization (loop linkage), useful e.g. in complex for diagnosing the amplification of the nucleic acids

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
FR0856430A FR2936246A1 (en) 2008-09-24 2008-09-24 New compound comprising a duplicable nucleic acid (amplified fragment), where compound comprises a means of locking of polymerization (loop linkage), useful e.g. in complex for diagnosing the amplification of the nucleic acids

Publications (1)

Publication Number Publication Date
FR2936246A1 true FR2936246A1 (en) 2010-03-26

Family

ID=40568524

Family Applications (1)

Application Number Title Priority Date Filing Date
FR0856430A Pending FR2936246A1 (en) 2008-09-24 2008-09-24 New compound comprising a duplicable nucleic acid (amplified fragment), where compound comprises a means of locking of polymerization (loop linkage), useful e.g. in complex for diagnosing the amplification of the nucleic acids

Country Status (1)

Country Link
FR (1) FR2936246A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998044151A1 (en) * 1997-04-01 1998-10-08 Glaxo Group Limited Method of nucleic acid amplification
WO1999055914A1 (en) * 1998-04-29 1999-11-04 Trustees Of Boston University Methods and compositions pertaining to pd-loops
EP1016731A1 (en) * 1998-01-08 2000-07-05 Laboratory of Molecular Biophotonics Probes for detecting target nucleic acid, method of detecting target nucleic acid, and solid phase for detecting target nucleic acid and process for producing the same

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998044151A1 (en) * 1997-04-01 1998-10-08 Glaxo Group Limited Method of nucleic acid amplification
EP1016731A1 (en) * 1998-01-08 2000-07-05 Laboratory of Molecular Biophotonics Probes for detecting target nucleic acid, method of detecting target nucleic acid, and solid phase for detecting target nucleic acid and process for producing the same
WO1999055914A1 (en) * 1998-04-29 1999-11-04 Trustees Of Boston University Methods and compositions pertaining to pd-loops

Similar Documents

Publication Publication Date Title
US9689031B2 (en) Nicking and extension amplification reaction for the exponential amplification of nucleic acids
US7910304B2 (en) Random array DNA analysis by hybridization
CN1961081B (en) Methods for quantification of microRNA and small interfering RNA
CN102212614B (en) Methods of amplifying and sequencing nucleic acids
Vogelstein et al. Digital pcr
ES2434915T3 (en) Multiplex detection of nucleic acids
EP1117827B1 (en) Methods of nucleic acid amplification and sequencing
JP5007440B2 (en) Nano -PCR: methods and apparatus for nucleic acid amplification and detection
Shen et al. Digital isothermal quantification of nucleic acids via simultaneous chemical initiation of recombinase polymerase amplification reactions on SlipChip
CN103370425B (en) For the method for nucleic acid amplification, composition, system, instrument and kit
US9683230B2 (en) Sample preparation on a solid support
US9458493B2 (en) Sequencing method using magnifying tags
US20050221341A1 (en) Sequence-based karyotyping
Ali et al. Rolling circle amplification: a versatile tool for chemical biology, materials science and medicine
US20020031764A1 (en) Cascade nucleic acid amplification reaction
US20070065823A1 (en) Method and compositions for detection and enumeration of genetic variations
Lizardi et al. Mutation detection and single-molecule counting using isothermal rolling-circle amplification
EP2291533B1 (en) Using populations of beads for the fabrication of arrays on surfaces
Kim et al. Isothermal DNA amplification in bioanalysis: strategies and applications
US9957549B2 (en) Compositions and methods for negative selection of non-desired nucleic acid sequences
CA2100159C (en) Rapid assays for amplification products
US9404155B2 (en) Alternative nucleic acid sequencing methods
AU2010245304B2 (en) Real-time sequencing methods and systems
US8206902B2 (en) Method of amplifying nucleic acid and method of detecting mutated nucleic acid using the same
CA2135607C (en) Chemical method for the analysis of dna sequences