WO1998040403A1 - Psca: prostate stem cell antigen - Google Patents

Psca: prostate stem cell antigen Download PDF

Info

Publication number
WO1998040403A1
WO1998040403A1 PCT/US1998/004665 US9804665W WO9840403A1 WO 1998040403 A1 WO1998040403 A1 WO 1998040403A1 US 9804665 W US9804665 W US 9804665W WO 9840403 A1 WO9840403 A1 WO 9840403A1
Authority
WO
WIPO (PCT)
Prior art keywords
psca
sample
antibody
protein
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1998/004665
Other languages
English (en)
French (fr)
Inventor
Robert Reiter
Owen Witte
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Priority to JP53971398A priority Critical patent/JP4404381B2/ja
Priority to EP98911548A priority patent/EP0981541B1/en
Priority to AU65481/98A priority patent/AU739407C/en
Priority to CA002281877A priority patent/CA2281877C/en
Priority to DE69824287T priority patent/DE69824287T2/de
Priority to NZ337413A priority patent/NZ337413A/xx
Priority to AT98911548T priority patent/ATE268340T1/de
Publication of WO1998040403A1 publication Critical patent/WO1998040403A1/en
Anticipated expiration legal-status Critical
Priority to AU2004200093A priority patent/AU2004200093B8/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3069Reproductive system, e.g. ovaria, uterus, testes, prostate
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57555Immunoassay; Biospecific binding assay; Materials therefor for cancer of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • PSCA PROSTATE STEM CELL ANTIGEN
  • vanous publications are referenced within parentheses The disclosures of these publications are hereby incorporated by reference herein in their entireties
  • Prostate cancer is currently the most common type of cancer in Amencan men and the second leading cause of cancer related death in this population In its advanced stages, prostate cancer metastasizes preferentially to bone, where it forms osteoblastic lesions After initial treatment with androgen ablation therapy, most metastatic prostate cancers become hormone-refractory and lethal Current diagnostic and therapeutic modalities are limited by a lack of specificity and an inability to predict which patients are at nsk of developing metastaUc disease
  • DRE digital rectal examinations
  • PSA prostate specific antigen
  • TRUS transrectal ultrasonography
  • TRNB transrectal needle biopsy
  • PSA is the most widely used tumor marker for screemng, diagnosis, and monitoring prostate cancer today
  • several immunoassays for the detection of serum PSA are in widespread clinical use
  • RT-PCR reverse transcnptase-polymerase chain reaction
  • PSA is not a disease-specific marker, as elevated levels of PSA are detectable in a large percentage of patients with BPH and prostatitis (25- 86%)(Gao et al , 1997, Prostate 31 264-281), as well as in other nonmalignant disorders and in some normal men, a factor which significantly limits the diagnostic specificity of this marker
  • elevations m serum PSA of between 4 to 10 ng/ml are observed in BPH, and even higher values are observed in prostatitis, particularly acute prostatitis BPH is an extremely common condition in men Further confusing the situation is the fact that serum PSA elevations may be observed without any indication of disease from DRE. and visa-vers
  • PSMA Prostate -Specific Membrane Antigen
  • PSMA protein is highly expressed m most p ⁇ mary and metastatic prostate cancers, but is also expressed in most normal intraepithelial neoplasia specimens (Gao et al , supra)
  • Preliminary results using an Indium-Ill labeled, anti- PSMA monoclonal antibody to image recurrent prostate cancer show some promise (Sodee et al 1996.
  • PSMA is a hormone dependent antigen requiring the presence of functional androgen receptor Since not all prostate cancer cells express androgen receptor. PSMA's utility as a therapeutic target may be inherently limited.
  • Clinical staging of prostate cancer is another fundamental problem facing urologists toda ⁇
  • clinical staging relies on rectal examination to determine whether the tumor remains withm the borders of the prostatic capsule (locally confined) or extends beyond it (locally advanced), in combination with serum PSA determinations and transrectal ultrasound guided biopsies
  • clinical staging by DRE regularly underestimates or overestimates local extension of the tumor, frequently misjudges its location, and correlates poorly with volume and extent of the tumor (Lee.
  • the invention provides a novel prostate-specific cell-surface antigen, designated Prostate Stem Cell Antigen (PSCA), which is widely over-expressed across all stages of prostate cancer, including high grade prostatic intraepithelial neoplasia (PIN), androgen-dependent and androgen-independent prostate tumors
  • PSCA Prostate Stem Cell Antigen
  • PIN prostatic intraepithelial neoplasia
  • SCA-2 stem cell ant ⁇ gen-2
  • PSCA mRNA expression is prostate specific in normal male tissues and is highly upregulated m both androgen dependent and androgen independent prostate cancer xenografts
  • In situ mRNA analysis localizes PSCA expression to the basal cell epithelium, the putative stem cell compartment of the prostate Flow cytometnc analysis demonstrates that PSCA is expressed predominantly on the cell surface and is anchored by a GPI linkage
  • Fluorescent in situ hybridization analysis localizes the PSCA gene to chromosome 8q24 2, a region of allelic gain in more than 80% of prostate cancers
  • PSCA may be an optimal therapeutic target m view of its cell surface location, prostate specific expression, and greatly upregulated expression in prostate cancer cells
  • the invention provides antibodies capable of binding to PSCA which can be used therapeutically to destroy prostate cancer cells
  • PSCA proteins and PSCA-encodmg nucleic acid molecules mav be used in vanous lmmunotherapeutic methods to promote immune-mediated destruction of prostate tumors
  • PSCA also may represent an ideal prostate cancer marker which can be used to discnnunate between malignant prostate cancers, normal prostate glands and non-malignant neoplasias For exmaple.
  • PSCA is expressed at very high levels in prostate cancer in relation to benign prostatic hyperplasia (BPH)
  • BPH benign prostatic hyperplasia
  • PSA is expressed at high levels m both normal prostate and BPH, but at lower levels in prostate cancer, rende ⁇ ng PSA expression useless for distinguishing malignant prostate cancer from BPH or normal glands
  • PSCA expression is essentially the reverse of PSA expression, analysis of PSCA expression can be employed to distinguish prostate cancer from non-malignant conditions
  • the genes encoding both human and munne PSCA have been isolated and their coding sequences elucidated and provided herein Also provided are the amino acid sequences of both human and munne PSCA
  • the invention further provides vanous diagnostic assays for the detection, monitoring, and prognosis of prostate cancer, including nucleic acid-based and immunological assays PSCA-specific monoclonal and polyclonal antibodies and lmmunotherapeutic and other therapeutic methods of treating prostate cancer are also provided.
  • FIG 1 Nucleotide (A) and translated amino acid (B) sequences of a cDNA encoding human PSCA (ATCC Designation 209612)
  • FIG 2 Nucleotide sequence of a cDNA encoding munne PSCA homologue
  • FIG 3 Alignment of amino acid sequences of human PSCA munne PSCA and human stem cell ant ⁇ gen-2 (hSCA-2) Shaded regions highlight conserved amino acids conserveed cysteines are indicated by bold lettenng
  • Four predicted N-glycosylation sites in PSCA are indicated by astensks
  • the underlined amino acids at the beginning and end of the protein represent N terminal hydrophobic signal sequences and C terminal GPI-anchonng sequences, respectively
  • FIG 4 Hydrophobicity plot of human PSCA
  • FIG 5 Chou-Fassman analysis of human PSCA
  • FIG 6 RT-PCR analysis of PSCA expression in vanous prostate cancer cell hues and xenografts
  • FIG 7 Rest ⁇ cted Expression of PSCA mRNA m normal and cancerous tissues
  • FIG 8 Schematic representation of human PSCA, munne PSCA. and human Thy-l/Lv-6 gene structures
  • FIG 9 Northern blot analysis of PSCA expression A: Total RNA from normal prostate and LAPC-4 androgen dependent (AD) and independent (Al) prostate cancer xenografts were analyzed using PSCA or PSA specific probes Equivalent RNA loading and RNA integnty were demonstrated separately by ethidium staining for 18S and 28S RNA B: Human multiple tissue Northern blot analysis of PSCA The filter was obtained from Clontech (Palo Alto, CA) and contains 2ug of polyA RNA m each lane
  • FIG 10 Northern blot compa ⁇ son of PSCA, PSMA, and PSA expression in prostate cancer xenografts and tumor cell lines
  • PSCA and PSMA demonstrate high level prostate cancer specific gene expression 10 ⁇ g of total RNA from the indicated tissues were size fractionated on an agarose formaldehyde gel, transferred to nitrocellulose, and hybndized sequentially with 32 P- labelled probes representing PSCA.
  • PSMA, and PSA cDNA fragments Shown are 4 hour and 72 hour autoradiogrphic exposures of the membrane and the ethidium bromide gel demonstrating equivalent loading of samples BPH, benign prostatic hyperplasia.
  • AD androgen-dependent, Al. androgen-mdependent, IT, mtratibial xenograft, C L . cell line
  • FIG 11 In situ hybridization with antisense ⁇ boprobe for human PSCA on normal and malignant prostate specimens
  • PSCA-transfected 293T cells and LAPC-4 prostate cancer xenograft cells using an affinity purified polyclonal anti-PSCA antibody Cells were not permeabihzed in order to detect only surface expression
  • the y axis represents relative cell number and the x axis represents fluorescent staining intensity on a loganthmic scale
  • FIG 13 In situ hybridization of biotin-labeled PSCA probes to human metaphase cells from phytohemagglutimn-stimulated penpheral blood lymphocytes
  • the chromosome 8 homologues are identified with arrows, specific labeling was observed at 8q24 2
  • the inset shows partial karyotypes of two chromosome 8 homologues illustrating specific labeling at 8q24 2 (arrowheads) Images were obtained using a Zeiss Axiophot microscope coupled to a cooled charge coupled device (CCD) camera Separate images of DAPI stained chromosomes and the hybndization signal were merged using image analysis software (NU200 and Image 1 57)
  • image analysis software NU200 and Image 1 57
  • FIG 14 How Ctometnc analysis of cell surface PSCA expression on prostate cancer xenograft (LAPC-9), prostate cancer cell line (LAPC-4) and normal prostate epithelial cells (PREC) using anti-PSCA monoclonal antibodies 1G8 (green) and 3E6 (red), mouse anti-PSCA polyclonal serum (blue), or control secondary antibody (black) See Example 5 for details
  • FIG 15 Epitope mappmg of anti-PSC A monoclonal antibodies 1G8 and 3E6 See Example 5 for details
  • PSCA Prostate Stem Cell Antigen
  • GPI glycosylphosphatidylmositol
  • PSCA mRNA is also expressed by a subset of basal cells in normal prostate
  • the basal cell epithelium is believed to contain the progemtor cells for the terminally differentiated secretory cells (Bonkhoff et al.. 1994, Prostate 24: 114-118).
  • cytokeratin markers suggest that the basal cell epithelium contains at least two distinct cellular subpopulations, one expressing cytokeratins 5 and 14 and the other cytokeratins 5. 8 and 18 (Bonkhoff and Remberger, 1996, Prostate 28: 98-106).
  • PSCA is expressed by only a subset of basal cells suggests that PSCA may be a marker for one of these two basal cell lineages.
  • Ly-6 gene family is involved in diverse cellular functions, including signal transduction and cell-cell adhesion. Signaling through SCA-2 has been demonstrated to prevent apoptosis in immature thymocytes (Noda et al., 1996, J. Exp. Med. 183: 2355-2360). Thy-1 is involved in T cell activation and transmits signals through src-like tyrosine kinases (Thomas et al.. 1992. J. Biol. Chem. 267: 12317-12322). Ly-6 genes have been implicated both in tumorigenesis and in homotypic cell adhesion (Bamezai and Rock, 1995, Proc. Natl. Acad. Sci.
  • PSCA is highly conserved in mice and humans. The identification of a conserved gene which is predominantly restricted to prostate supports the hypothesis that PSCA may play an important role in normal prostate development.
  • the present invention provides PSCA proteins, antibodies, nucleic acid molecules, recombinant DNA molecules, transformed host cells, generation methods, assays, irnmunotherapeutic methods, transgenic animals, immunological and nucleic acid-based assays, and compositions.
  • PSCA refers to a protein that has the amino acid sequence of human PSCA as provided in FIGS. IB and 3. the amino acid sequence of the murine PSCA homologue as provided in FIG. 3, or the amino acid sequence of other mammalian PSCA homologues. as well as allelic variants and conservative substitution mutants of these proteins that have PSCA activity.
  • the PSCA proteins of the invention include the specifically identified and characterized variants herein described, as well as allelic variants, conservative substitution variants and homologs that can be isolated/generated and characterized without undue experimentation following the methods outlined below.
  • PSCA proteins will be collectively referred to as the PSCA proteins, the proteins of the invention, or PSCA
  • PSCA The term "PSCA" mcludes all naturally occurnng allelic variants, lsoforms. and precursors of human PSCA as provided m FIGS IB and 3 and munne PSCA as provided in FIG 3
  • naturally occurnng allehc variants of human PSCA will share significant homology (e g , 70 - 90%) to the PSCA am o a ⁇ d sequence provided m FIGS IB and 3 Allehc vanants, though possessing a slightly different ammo a ⁇ d sequence, may be expressed on the surface of prostate cells as a GPI linked protein or may be secreted.
  • allehc variants of the PSCA protein will contain conservative ammo a ⁇ d substitutions from the PSCA sequence herein descnbed or will contain a substitution of an ammo a ⁇ d from a correspondmg position m a PSCA homologue such as, for example, the munne PSCA homologue descnbed herein
  • PSCA allehc variants will be proteins that share a high degree of homology with at least a small region of the PSCA ammo a ⁇ d sequences presented in FIGS IB and 3, but will further contain a radical departure form the sequence, such as a non-conservative substitution, truncation, insertion or frame shift
  • Such alleles are termed mutant alleles of PSCA and represent proteins that typically do not perform the same biological functions
  • Conservative amino acid substitutions can frequently be made m a protein without alternativeng either the conformation or the function of the protein
  • Such changes include substituting any of isoleucine (I), valme (V). and leucme (L) for any other of these hydrophobic amino acids, aspartic acid (D) for glutamic acid (E) and vice versa, glutanune (Q) for asparagme (N) and vice versa, and senne (S) for threonine (T) and vice versa
  • substitutions can also be considered conservative, depending on the environment of the particular amino acid and its role in the three-dimensional structure of the protein
  • glycine (G) and alanine (A) can frequently be interchangeable, as can alamne (A) and valme (V) Methionine (M), which is relatively hydrophobic, can frequently be interchanged with leu ⁇ ne and isoleucine, and sometimes with valme Lysine (K) and arginine (R) are frequently interchangeable
  • the ammo a ⁇ d sequence of human PSCA protein is provided m FIGS IB and 3 Human PSCA is compnsed of a single subunit of 123 ammo a ⁇ ds and contains an anunc-ternrinal signal sequence, a cartioxy-terminal GPI-ancho ⁇ ng sequence, and multiple N-glycosylation sites PSCA shows 30% homology to stem cell antigen-2 (SCA-2), a member of the Thy- 1 /Ly-6 gene family, a group of cell surface proteins which mark the earhest phases of hematopoetic development
  • SCA-2 stem cell antigen-2
  • the ammo a ⁇ d sequence of a munne PSCA homologue is shown in FIG 3 Munne PSCA is a single subunit protein of 123 ammo a ⁇ ds having approximately 70% homology to human PSCA and similar structural organization PSCA proteins may be embodied in many forms, preferably m isolated form As used herein, a protein is said to be isolated when physical, mechanical or chemical methods are
  • the invention also provides peptides compnsing biologically active fragments of the human and munne PSCA ammo acid sequences shown m FIGS IB and 3
  • the peptides of the invention exhibit properties of PSCA, such as the ability to elicit the generation of antibodies which specifically bind an epitope associated with PSCA
  • Such peptide fragments of the PSCA proteins can be generated using standard peptide synthesis technology and the ammo a ⁇ d sequences of the human or munne PSCA proteins disclosed herein Alternatively, recombinant methods can be used to generate nucleic a ⁇ d molecules that encode a fragment of the PSCA protein
  • the PSCA-encoding nucleic a ⁇ d molecules descnbed herein provide means for generating defined fragments of PSCA.
  • peptide fragments of PSCA are particularly useful m generating domam specific antibodies, identifying agents that bmd to PSCA or a PSCA domam. identifying cellular factors that bmd to PSCA or a PSCA domam. and isolating homologs or other allehc forms of human PSCA PSCA peptides containing particularly interesting structures can be predicted and/or identified using vanous analytical techniques well known m the art. mcluding, for example, the methods of Chou-Fasman.
  • PSCA proteins of the invention may be useful for a vanety of purposes, mcluding but not limited to their use as diagnostic and/or prognostic markers of prostate cancer and as targets for vanous therapeutic modalities, as further descnbed below PSCA proteins may also be used to identify and isolate ligands and other agents that bmd to PSCA. In the normal prostate.
  • PSCA is expressed exclusively m a subset of basal cells, suggesting that PSCA may be used as a marker for a specific cell lineage within basal epithehum
  • this set of basal cells represent the target of neoplastic transformation
  • therapeutic strategies designed to eliminate or modulate the molecular factors responsible for transformation may be specifically directed to this population of cells via the PSCA cell surface protein PSCA ANTIBODIES
  • the invention further provides antibodies that bmd to PSCA.
  • the most preferred antibodies will selectively bmd to PSCA and will not bmd (or will bmd weakly) to non-PSCA proteins
  • Anti-PSCA antibodies that are particularly contemplated m clude monoclonal and polyclonal antibodies as well as fragments containing the antigen bmdmg domam and/or one or more complement deternunmg regions of these antibodies
  • the PSCA antibodies specifically bind to the extracellular domain of a PSCA protein
  • the PSCA antibodies specifically bind to other domains of a PSCA protein or precursor
  • the regions or epitopes of a PSCA protein to which an antibody is directed may vary with the intended application
  • antibodies intended for use in an immunoassay for the detection of membrane-bound PSCA on viable prostate cancer cells should be directed to an accessible epitope on membrane- bound PSCA Examples of such antibodies are descnbed the Examples which follow
  • Antibodies which recognize other epitopes may be useful for the identification of PSCA within damaged or dying cells, for the detection of secreted PSCA proteins or fragments thereof
  • the invention also encompasses antibody fragments which specifically recognize an PSCA protein
  • an antibody fragment is defined as at least a portion of the vanable region of the lmmunoglobulin molecule which binds to its target, l e . the antigen binding region
  • PSCA prostate-specificity of PSCA. its overexpression in both androgen-dependent and androgen- mdependent prostate cancer cells, and the cell surface location of PSCA represent charactenstics of an excellent marker for screemng, diagnosis, prognosis, and follow-up assays and imaging methods In addition, these charactenstics indicate that PSCA may be an excellent target for therapeutic methods such as targeted antibody therapy, immunotherapy, and gene therapy
  • PSCA antibodies of the invention may be particularly useful in diagnostic assays, imaging methodologies, and therapeutic methods in the management of prostate cancer
  • the invention provides vanous immunological assays useful for the detection of PSCA proteins and for the diagnosis of prostate cancer
  • Such assays generally compnse one or more PSCA antibodies capable of recognizing and bmdmg a PSCA protein, and mclude vanous immunological assay formats well known in the art.
  • mcludmg but not limited to vanous types of radioimmunoassays.
  • immunological imaging methods capable of detecting prostate cancer are also provided by the invention, including but limited to radioscintigraphic imaging methods using labeled PSCA antibodies Such assavs may be clinically useful m the detection, monitoring, and prognosis of prostate cancer
  • PSCA antibodies and fragments thereof are used for detecting the presence of a prostate cancer, PIN or basal epithelial cell expressing a PSCA protein
  • the presence of such PSCA + cells within vanous biological samples, including serum, prostate and other tissue biopsy specimens, other tissues such as bone, unne, etc may be detected with PSCA antibodies
  • PSCA antibodies may be used in vanous imaging methodologies, such as lmmunoscintigraphy with Indu ⁇ m-111 (or other isotope) conjugated antibody
  • an imaging protocol similar to the one recently descnbed using an In- 111 conjugated anti-PSMA antibody may be used to detect re ⁇ urent and metastatic prostate carcinomas (Sodee et al . 1997, Clin Nuc Med 21 759-766)
  • PSCA may be particularly useful for targeting androgen receptor-negative prostate cancer cells
  • PSCA antibodies may also be used therapeutically to inhibit PSCA function
  • PSCA antibodies may also be used in methods for purifying PSCA proteins and peptides and for isolating PSCA homologues and related molecules
  • the method of purifying a PSCA protein comprises incubating a PSCA antibody, which has been coupled to a solid matrix, with a lysate or other solution containing PSCA under conditions which permit the PSCA antibody to bmd to PSCA, washing the solid matrix to eliminate lrnpunties, and eluting the PSCA from the coupled antibody
  • PSCA antibodies may be used to isolate PSCA positive cells using cell sorting and purification techniques
  • the presence of PSCA on prostate tumor cells may be used to distinguish and isolate human prostate cancer cells from other cells
  • PSCA antibodies may be used to isolate prostate cancer cells from xenograft tumor tissue, from cells in culture, etc . using antibody-based cell sorting or affinity purification techniques
  • Other uses of the PSCA antibodies of the invention include generating anti-idiotypic antibodies that mimic the PSCA protein
  • an individual patient s prostate cancer cells may be expanded from a limited biopsy sample and then tested for the presence of diagnostic and prognostic genes, proteins, chromosomal abenations, gene expression profiles, or other relevant genotypic and phenotypic charactenstics. without the potentially confounding vanable of contaminating cells
  • diagnostic and prognostic genes, proteins, chromosomal abenations, gene expression profiles, or other relevant genotypic and phenotypic charactenstics without the potentially confounding vanable of contaminating cells
  • such cells may be evaluated for neoplastic aggressiveness and metastatic potential in ammal models
  • patient-specific prostate cancer vaccines and cellular lmmunotherapeutics may be created from such cell preparations
  • antibodies may be prepared by immunizing a suitable mammalian host using a PSCA protein, peptide, or fragment, m isolated or unmunoconjugated form (Harlow, Antibodies. Cold Spring Harbor Press, NY (1989))
  • PSCA protein, peptide, or fragment m isolated or unmunoconjugated form
  • fusion proteins of PSCA may also be used, such as a PSCA GST-fusion protein
  • Cells expressing or overexpressing PSCA may also be used for immunizations
  • any cell engineered to express PSCA may be used This strategy may result in the production of monoclonal antibodies with enhanced capa ⁇ ties for recognizing endogenous PSC
  • ammo acid sequence of PSCA presented herein may be used to select specific regions of the PSCA protem for generating antibodies
  • hydrophobi ⁇ ty and hydrophih ⁇ ty analyses of the PSCA ammo acid sequence may be used to identify hydrophihc regions m the PSCA structure
  • Regions of the PSCA protem that show lmmunogemc structure, as well as other regions and domains, can readily be identified using vanous other methods known m the art. such as Chou-Fasman, Garnier-Robso ⁇ Kyte- Doohttle.
  • Immortalized cell lines which secrete a desired monoclonal antibody mav be prepared using the standard method of Kohler and Milstein or modifications which effect immortalization of lymphocytes or spleen cells, as is generally known
  • the immortalized cell lines secreting the desired antibodies are screened by lmmunoassay m which the antigen is the PSCA protem or PSCA fragment
  • the cells can be cultured either m vitro or by production in as ⁇ tes fluid
  • the desired monoclonal antibodies are then recovered from the culture supernatant or from the as ⁇ tes supernatant Fragments of the monoclonals or the polvclonal antisera which contain the lmmunologically significant portion can be used as antagonists, as well as the intact antibodies
  • Fab', of F(ab') 2 fragments is often preferable, espe ⁇ alh m a therapeutic context, as these fragments are generally less lmmunogenic than the whole mrmunoglobulin
  • MAbs monoclonal antibodies capable of bmdmg to cell surface PSCA
  • Example 5 Epitope mappmg of these MAbs mdicates that they recognize different epitopes on the PSCA protem, one recognizing an epitope withm the carboxy-ternunal region and the other recognizing an epitope within the ammo-terminal region
  • PSCA antibodies may be particularly well suited to use in a sandwich-formatted ELISA, given their differing epitope bmdmg charactenstics
  • the antibodies or fragments may also be produced, using current technology, by recombinant means Regions that bmd specifically to the desired regions of the PSCA protem can also be produced m the context of chime ⁇ c or CDR grafted antibodies of multiple species ongm
  • the antibody or fragment thereof of the invention may be labeled with a detectable marker or conjugated to a second molecule, such as a cytotoxic agent, and used for targeting the second molecule to an PSCA positive cell (Vitetta, E S et al , 1993. Immunotoxin therapy, in DeVita. Jr V T et al . eds. Cancer Pnnciples and Practice of Oncology, 4th ed . J B Lippmcott Co Philadelphia, 2624-2636)
  • cytotoxic agents include, but are not limited to ncin doxorubicin. daunorubi ⁇ n. taxol. ethiduim bromide, mitomycin, etoposide. tenoposide.
  • Suitable detectable markers include, but are not limited to, a radioisotope. a fluorescent compound, a biolununescent compound, chemiluminescent compound, a metal chelator or an enzyme
  • PSCA antibodies may be used systemically to treat prostate cancer PSCA antibodies conjugated with toxic agents, such as ncin. as well as unconjugated antibodies may be useful therapeutic agents naturally targeted to PSCA-beanng prostate cancer cells Techmques for conjugating therapeutic agents to antibodies are well known (see, e g . Arnon et al , "Monoclonal Antibodies For Immunotargeting Of
  • vanous nucleic acid molecules encoding PSCA proteins and fragments thereof, preferably in isolated form, including DNA, RNA, DNA/RNA hybnd and related molecules, nucleic acid molecules complementary to the PSCA coding sequence or a part thereof, and those which hybndize to the PSCA gene or to PSCA-encoding nucleic acids
  • nucleic a ⁇ d molecules will have a nucleotide sequence substantially identical to or complementary to the human or munne DNA sequences herem disclosed Specifically contemplated are genomic DNA, cDNAs, ⁇ bozymes, and antisense molecules, as well as nucleic acids based on an alternative backbone or including alternative bases, whether denved from natural sources or synthesized
  • antisense molecules can be RNAs or other molecules, including peptide nucleic a ⁇ ds
  • PNAs or non-nucleic acid molecules such as phosphorothioate denvatives, that specifically bind
  • PSCA-encodmg nucleic acid molecules will be referred to herem as PSCA-encodmg nucleic a ⁇ d molecules.
  • FIG 1A The nucleotide sequence of a cDNA encoding one allehc form of human PSCA is provided in FIG 1A
  • FIG 2 The nucleotide sequence of a cDNA encoding a munne PSCA homologue ("munne PSCA") is provided in FIG 2
  • Genomic clones of human and munne PSCA have also been isolated as descnbed m
  • Example 4 Both the human and munne genomic clones contain three exons encoding the translated and 3' untranslated regions of the PSCA gene A fourth exon encoding a 5' untranslated region is presumed to exist based on PSCA's homology to other members of the Ly-6 and Thy-1 gene families (FIG 8)
  • the human PSCA gene maps to chromosome 8q24 2 Human stem cell antigen 2 (RIG-E), as well as one other recently identified human Ly-6 homologue (E48) are also localized to this region, suggesting that a large family of related genes may exist at this locus (Brakenhoff et al . 1995, supra, Mao et al , 1996, Proc Natl Acad Sci USA 93 5910-5914) Intnguingly.
  • chromosome 8q has been reported to be a region of allelic gam and amplification in a majonty of advanced and recurrent prostate cancers (Cher et al .
  • c-myc localizes proximal to PSCA at chromosome 8q24 and extra copies of c-myc (either through allehc gam or amplification) have been found m 68% of pnmary prostate tumors and 96% of metastases (Jenkins et al , 1997, Cancer Res 57 524-531)
  • Embodiments of the PSCA-encoding nucleic acid molecules of the invention include pnmers. which allow the specific amplification of nucleic acid molecules of the invention or of any specific parts thereof, and probes that selectively or specifically hybndize to nucleic acid molecules of the invention or to any part thereof
  • the nucleic acid probes can be labeled with a detectable marker Examples of a detectable marker include, but are not limited to, a radioisotope, a fluorescent compound a biolununescent compound a chemiluminescent compound a metal chelator or an enzyme
  • Such labeled probes can be used to diagnosis the presence of a PSCA protein as a means for diagnosing cell expressing a PSCA protem Technologies for generating DNA and RNA probes are well known
  • nucleic a ⁇ d molecule is said to be "isolated" when the nucleic a ⁇ d molecule is substantially separated from contaminant nucleic a ⁇ d molecules that encode polypeptides other than PSCA.
  • a skilled artisan can readily employ nucleic a ⁇ d isolation procedures to obtam an isolated PSCA- encodmg nucleic a ⁇ d molecule
  • the mvention further provides fragments of the PSCA-encodmg nucleic a ⁇ d molecules of the present mvention
  • a fragment of a PSCA-encodmg nucleic a ⁇ d molecule refers to a small portion of the entire PSCA-encodmg sequence
  • the size Of the fragment will be determined by its intended use For example, if the fragment is chosen so as to encode an active portion of the PSCA protein, such an active domain, effector bmdmg site or GPI bmdmg domam then the fragment will need to be large enough to encode the functional reg ⁇ on(s) of the PSCA protem If the fragment is to be used as a nucleic acid probe or PCR pnmer.
  • fragment length is chosen so as to obtam a relatively small number of false positives during probmg/p ⁇ mmg
  • Fragments of human PSCA that are particularly useful as selective hybndization probes or PCR primers can be readily identified from the entire PSCA sequence usmg art- known methods
  • One set of PCR primers that are useful for RT-PCR analysis compnse 5' - TGCTTGCCCTGTTGATGGCAG - and 3' - CCAGAGCAGCAGGCCGAGTGCA -
  • PSCA-encodmg nucleic a ⁇ d molecules are the expression control sequence found upstream and downstream from the PSCA-encodmg region found m genomic clones of the PSCA gene Specifically, prostate specific expression control elements can be identified as being 5' to the PSCA- encodmg region found m genomic clones of the PSCA gene Such expression control sequence are useful m generating expression vectors for expressing genes m a prostate specific fashion A skilled artisan can readily use the PSCA cDNA sequence herem descnbed to isolate and identify genomic PSCA sequences and the expression control elements found m the PSCA gene
  • PSCA-encodmg nucleic a ⁇ d molecules descnbed herem enable the isolation of PSCA homologues, alternatively shced isoforms, allehc vanants. and mutant forms of the PSCA protem as well as then- codmg and gene sequences
  • the most preferred source of PSCA homologs are mammalian organisms
  • a portion of the PSCA-encodmg sequence herem descnbed can be synthesized and used as a probe to retneve DNA encoding a member of the PSCA family of proteins from organisms other than human, allehc vanants of the human PSCA protem herem descnbed and genomic sequence containing the PSCA gene
  • Oligomers containing approximately 18-20 nucleotides (encoding about a 6-7 am o a ⁇ d stretch) are prepared and used to screen genomic DNA or cDNA hbranes to obtam hybndization under stringent conditions or conditions of sufficient stringency to eliminate an undue level of false positives
  • cDNA encoding human PSCA was used to isolate a full length cDNA encoding the munne PSCA homologue as descnbed m
  • Example 3 herem The munne clone encodes a protem with 70% am no acid identity to human PSCA.
  • ammo a ⁇ d sequence of the human PSCA protem may be used to generate antibody probes to screen expression hbranes prepared from cells
  • polyclonal antiserum from mammals such as rabbits immunized with the purified protem (as descnbed below) or monoclonal antibodies can be used to probe an expression library, prepared from a target organism, to obtam the appropriate codmg sequence for a PSCA homologue
  • the cloned cDNA sequence can be expressed as a fusion protein, expressed directly using its own control sequences, or expressed bv constructing an expression cassette usmg control sequences appropnate to the particular host used for expression of the enzyme
  • Genomic clones containing PSCA genes may be obtained usmg molecular cloning methods well known m the art
  • a human genomic clone of approximately 14kb containing exons 1-4 of the PSCA gene was obtained bv screening a lambda phage library with a human PSCA cDNA probe, as more completely descnbed m Example 4 herem
  • a genomic clone of approximately lOkb containing the munne PSCA gene was obtained by screemng a munne BAC (bactenal artifi ⁇ al chromosome) library with a munne PSCA cDNA (also descnbed m Example 4)
  • pairs of oligonucleotide primers can be prepared for use in a polymerase chain reaction (PCR) to selectively amplify/clone a PSCA-encodmg nucleic a ⁇ d molecule, or fragment thereof
  • PCR polymerase chain reaction
  • a PCR denature/anneal/extend cycle for usmg such PCR primers is well known m the art and can readily be adapted for use in isolating other PSCA-encodmg nucleic a ⁇ d molecules Regions of the human PSCA gene that are particularly well suited for use as a probe or as primers can be readily identified
  • Non-human homologues of PSCA naturally occurnng allehc vanants of PSCA and genomic PSCA sequences will share a high degree of homology to the human PSCA sequences herem descnbed
  • nucleic a ⁇ d molecules will hybndize to the human PSCA sequence under stnngent conditions
  • Such sequences will typically contain at least 70% homology, preferably at least 80%. most preferably at least 90% homology to the human PSCA sequence "Stnngent conditions" are those that (1) employ low lomc strength and high temperature for washing for example. 0015M NaCl/00015M sodium titrate/0 1% SDS at 50EC , or (2) employ during hybndization a denatunng agent such as formamide.
  • rDNAs recombinant DNA molecules
  • a rDNA molecule is a DNA molecule that has been subjected to molecular manipulation tn vitro Methods for generating rDNA molecules are well known in the art, for example, see Sambrook et al , Molecular Cloning (1989) In the prefened rDNA molecules of the present invention, a PSCA-encodmg DNA sequence that encodes a PSCA protem or a fragment of PSCA.
  • the rDNA molecule can encode either the entire PSCA protein, or can encode a fragment of the PSCA protein
  • the choice of vector and/or expression control sequences to which the PSCA-encodmg sequence is operably linked depends directly, as is well known m the art, on the functional properties desired e g protem expression, and the host cell to be transformed
  • a vector contemplated by the present mvention is at least capable of directing the replication or insertion mto the host chromosome, and preferably also expression, of the PSCA-encodmg sequence mcluded m the rDNA molecule
  • Expression control elements that are used for regulating the expression of an operably linked protem encoding sequence are known m the art and include, but are not limited to, indu ⁇ ble promoters, constitutive promoters, secretion signals, enhancers, trans ⁇ iption terminators and other regulaton elements
  • an mdu ⁇ ble promoter that is readily controlled such as being responsive to a nutnent in the host cell's medium, is used
  • the vector containmg a PSCA-encodmg nucleic a ⁇ d molecule will mclude a prokaryotic rephcon, I e .
  • a prokaryotic host cell such as a bactenal host cell, transformed therewith
  • rephcons are well known m the art
  • vectors that mclude a prokaryotic rephcon may also mclude a gene whose expression confers a detectable marker such as a drug resistance
  • Typical bactenal drug resistance genes are those that confer resistance to ampi ⁇ lhn or tetracychne
  • Vectors that mclude a prokaryotic rephcon can further mclude a prokaryotic or viral promoter capable of directing the expression (transc ⁇ ption and translation) of the PSCA-encodmg sequence m a bactenal host cell, such as E coli A promoter is an expression control element formed by a DNA sequence that permits bmdmg of RNA polymerase and transcnption to occur
  • promoter sequences compatible with bactenal hosts are typically provided m plasmid vectors containmg convement rest ⁇ ction sites for insertion of a DNA segment of the present mvention Vanous viral vectors well known to those skilled m the art ma ⁇ also be used such as. for example, a number of well known retroviral vectors
  • Expression vectors compatible with eukaryotic cells can also be used to vanant rDNA molecules that contam a PSCA-encodmg sequence
  • Eukaiyotic cell expression vectors are well known m the art and are available from several commer ⁇ al sources Typically, such vectors are provided containing convement restnction sites for insertion of the desired DNA. segment Typical of such vectors are PSVL and pKSV-10 (Pharmacia), pBPV-l/pML2d (International Biotechnologies. Inc ).
  • pTDTl ATCC, #31255) the ve ⁇ or pCDM8 descnbed herein, and the like eukarvotic expression vectors
  • Eukarvotic cell expression vectors used to construct the rDNA molecules of the present invention ma ⁇ further mclude a selectable marker that is effective m an eukaryotic ceil, preferably a drug resistance selection marker
  • a preferred drug resistance marker is the gene whose expression results in neomy ⁇ n resistance. 1 e . the neomy ⁇ n phosphotransferase (neo) gene Southern et al . J Mol Anal Genet (1982) 1 327-341
  • the selectable marker can be present on a separate plasmid and the two vectors are mtroduced b> cotransfection of the host cell, and selected by cultunng m the presence of the approp ⁇ ate drug for the selectable marker
  • the vector can be a plasmid cosmid or phage vector encoding the cDNA molecule discussed above
  • the invention provides a host- vector system compnsmg the plasmid cosmid or phage vector transfected into a suitable eucaryotic host cell
  • suitable eucaryotic host cells include a yeast cell, a plant cell, or an animal cell, such as a mammalian cell
  • suitable cells include the LnCaP. LAPC-4, and other prostate cancer cell lines
  • the host-vector system is useful for the production of an PSCA protein
  • the host cell can be prokaryotic. such as a bactenal cell
  • the mvention further provides host cells transformed with a nucleic a ⁇ d molecule that encodes a PSCA protein or a fragment thereof
  • the host cell can be either prokaryotic or eukaryotic Eukaryotic cells useful for expression of a PSCA protem are not limited so long as the cell line is compatible with cell culture methods and compatible with the propagation of the expression vector and expression of a PSCA gene
  • Preferred eukaryotic host cells mclude, but are not limited to, yeast, insect and mammalian cells, preferably vertebrate cells such as those from a mouse, rat, monkey or human fibroblastic cell line
  • Prostate cancer cell lines, such as the LnCaP and LAPC-4 cell lines may also be used Any prokaryotic host can be used to express a PSCA-encodmg rDNA molecule
  • the preferred prokaryotic host is E coli
  • Transformation of approp ⁇ ate cell hosts with an rDNA molecule of the present invention is accomplished by well known methods that typically depend on the type of vector used and host system employed
  • electroporation and salt treatment methods are typically employed see, for example, Cohen et al , Proc Acad Set USA (1972) 69 2110, and Mamatis et al Molecular Clonmg. A Laboratory Manual, Cold Sprmg Harbor Laboratory, Cold Sprmg Harbor. NY (1982)
  • electroporatioa cationic hpid or salt treatment methods are typically employed see. for example. Graham et al . I Irol (1973) 52 456. Wigler et al . Proc Natl Acad Sci USA (1979) 76 1373-76
  • Successfully transformed cells I e , cells that contam an rDNA molecule of the present mvention, can be identified bv well known techniques
  • cells resulting from the introduction of an rDNA of the present mvention can be cloned to produce single colonies Cells from those colonies can be harvested lysed and their DNA content examined for the presence of the rDNA usmg a method such as that descnbed by Southern. JMol Biol (1975) 98 503. or Berent et al . Biotech (1985) 3 208 or the proteins produced from the cell assaved via an immunological method
  • the mvention further provides methods for producmg a PSCA protem usmg one of the PSCA-encodmg nucleic a ⁇ d molecules herem descnbed
  • the production of a recombinant PSCA protem typically mvolves the following steps
  • nucleic acid molecule is obtamed that encodes a PSCA protem or a fragment thereof, such as the nucleic a ⁇ d molecule depicted m FIG 1A.
  • the PSCA-encodmg nucleic acid molecule is then preferably placed in an operable linkage with suitable control sequences, as descnbed above, to generate an expression unit containing the PSCA-encodmg sequence
  • the expression unit is used to transform a suitable host and the transformed host is cultured under conditions that allow the production of the PSCA protem
  • the PSCA protem is isolated from the medium or from the cells, recovery and punfication of the protem may not be necessary m some instances where some lmpunties may be tolerated
  • each of the foregoing steps may be done m a vanety of ways
  • the desired codmg sequences may be obtamed from genomic fragments and used directly m an appropnate host
  • the construction of expression ve ⁇ ors that are operable in a vanety of hosts is accomplished usmg an appropriate combination of rephcons and control sequences
  • the control sequences, expression vectors, and transformation methods are dependent on the type of host cell used to express the gene and were discussed m detail earlier Suitable resrnction sites can, if not normally available, be added to the ends of the codmg sequence so as to provide an ex ⁇ sable gene to insert mto these vectors
  • a skilled artisan can readily adapt any host/expression system known m the art for use with PSCA-encodmg sequences to produce a PSCA protem
  • PSCA hgands and other agents and cellular constituents that bmd to PSCA can be identified by the abihtv of the PSCA hgand or other agent or constituent to bmd to PSCA and/or the ability to inhibit/stimulate PSCA activm Assays for PSCA activity (e g .
  • bmdmg) usmg a PSCA protem are suitable for use m high through-put screemng methods
  • the assay compnses mixing PSCA with a test agent or cellular extract After mixing under conditions that allow asso ⁇ ation of PSCA with the agent or component of the extract the mixture is analyzed to determine if the agent/component is bound to PSCA Bmdmg agents/components are identified as being able to bmd to PSCA
  • PSCA activity' can be directly assessed as a means for identifying agonists and antagonists of PSCA activity
  • targets that bmd to a PSCA protem can be identified usmg a yeast two-h b ⁇ d system or usmg a binding-capture assay
  • yeast two hybnd system an expression unit encoding a fusion protem made up of one subunit of a two subunit tianscnption factor and the PSCA protem is mtroduced and expressed m a yeast cell
  • the cell is further modified to contam (1) an expression umt encodmg a detectable marker whose expression requires the two subunit tianscnption factor for expression and (2) an expression umt that encodes a fusion protem made up of the second subunit of the transcnption factor and a cloned segment of DNA.
  • the expression results m the interaction of the PSCA and the encoded protem This bnngs the two subunits of the transcnption factor mto bmdmg proximity, allowing reconstitution of the transcnption factor This results m the expression of the detectable marker
  • the yeast two hybnd system is particularly useful in s ⁇ eenmg a library of cDNA encodmg segments for cellular bmdmg partners of PSCA.
  • PSCA proteins which may be used m the above assays mclude, but are not limited to, an isolated PSCA protein, a fragment of a PSCA protem. a cell that has been altered to express a PSCA protem or a fraction of a cell that has been altered to express a PSCA protem Further, the PSCA protem can be the entire PSCA protem or a defined fragment of the PSCA protem It will be apparent to one of ordinary skill m the art that so long as the PSCA protem can be assayed for agent bmdmg, e g , by a shift in molecular weight or activity, the present assay can be used
  • the method used to identify whether an agent/cellular component bmds to a PSCA protein will be based p ⁇ manly on the nature of the PSCA protem used
  • a gel retardation assay can be used to determine whether an agent bmds to PSCA or a fragment thereof
  • immunodetection and biochip technologies can be adopted for use with the PSCA protem
  • a skilled artisan can readily employ numerous art-known techmques for determining whether a particular agent bmds to a PSCA protem
  • Agents and cellular components can be further tested for the ability to modulate the activity of a PSCA protem using a cell-free assay system or a cellular assay system As the activities of the PSCA protem become more defined functional assays based on the identified activity can be employed
  • an agent is said to antagonize PSCA activity when the agent reduces PSCA activity
  • the preferred antagonist will selectively antagonize PSCA not affecting any other cellular proteins Further. the preferred antagonist will reduce PSCA activity by more than 50%. more preferably by more than 90%. most preferably eliminating all PSCA activity
  • an agent is said to agonize PSCA activity when the agent increases PSCA activiti-
  • the prefened agonist will selectively agonize PSCA not affecting any other cellular proteins
  • the preferred antagonist will increase PSCA activity by more than 50%. more preferably by more than 90%, most preferably more than doubting PSCA activity
  • Agents that are assayed m the above method can be randomly selected or rationally selected or designed As used herem an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences of the PSCA protem
  • An example of randomly selected agents is the use of a chemical library or a peptide combinato ⁇ al library, or a growth broth of an organism or plant extract
  • an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis that takes mto account the sequence of the target site and/or its conformation in connection with the agent's action
  • Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up the PSCA protem
  • a rationally selected peptide agent can be a peptide whose ammo a ⁇ d sequence is identical to a fragment of a PSCA protem
  • agents tested m the methods of the present mvention can be. as examples, peptides. small molecules and vitamin denvatives. as well as carbohydrates
  • agents used m the present screemng method One class of agents of the present invention are peptide agents whose ammo a ⁇ d sequences are chosen based on the ammo a ⁇ d sequence of the PSCA protem Small peptide agents can serve as competitive inhibitors of PSCA protem assembly
  • Peptide agents can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known m the art
  • the DNA encodmg these peptides may be synthesized usmg commercially available ohgonucleotide synthesis instrumentation and produced recombmantiy usmg standard recombinant production systems The production usmg solid phase peptide synthesis is necessitated if non-gene-encoded ammo a ⁇ ds are to be mcluded
  • agents of the present mvention are antibodies lmmunoreactive with c ⁇ tical positions of the PSCA protem
  • antibodies are obtamed by immunization of suitable mammalian subjects with peptides. containmg as antigenic regions, those portions of the PSCA protem intended to be targeted by the antibodies Cntical regions may mclude the domains identified m Figures 4 and 5
  • Such agents can be used m competitive bmdmg studies to identify second generation inhibitory agents The cellular extracts tested m the methods of the present mvention can be.
  • bmd a PSCA protein such as a PSCA antibody
  • a PSCA antibody can be used to modulate the activity of PSCA to target anticancer agents to appropnate mammalian cells, or to identify agents that block the interaction with PSCA Cells expressing PSCA can be targeted or identified by usmg an agent that bmds to PSCA
  • a PSCA binding agent can be used to deliver conjugated toxins, such a diphthena toxin, cholera toxin, non or pseudomonas exotoxm, to a PSCA expressing cell, modulate PSCA activity, to directly kill PSCA expressing cells, or m screens to identify competitive bmdmg agents
  • conjugated toxins such as diphthena toxin, cholera toxin, non or pseudomonas exotoxm
  • a PSCA inhibitory agent can be used to directly inhibit the growth of PSCA expressing cells whereas a PSCA binding agent can be used as a diagnostic agent
  • the mvention provides vanous lmmunotherapeutic methods for treating prostate cancer, mcludmg antibody therapy, in vivo vaccines, and ex vivo lnimunotherapy approaches
  • the mvention provides PSCA antibodies which may be used systemically to treat prostate cancer
  • unconjugated PSCA antibody may be introduced mto a patient such that the antibody bmds to PSCA on prostate cancer cells an mediates the destruction of the cells, and the tumor, by mechanisms which may include complement-mediated cytolysis.
  • PSCA antibodies conjugated to toxic agents such as ⁇ cm may also be used therapeutically to deliver the toxic agent directly to PSCA-beanng prostate tumor cells and thereby destroy the tumor
  • Prostate cancer immunotherapy usmg PSCA antibodies may follow the teachmgs generated from vanous approaches which have been successfully employed with respect to other types of cancer, mcludmg but not limited to colon cancer (Arlen et al . 1998, C ⁇ t Rev Immunol 18 133-138). multiple myeloma (Ozaki et al . 1997. Blood 90 3179-3186. Tsunena ⁇ et al , 1997, Blood 90 2437-2444), gastnc cancer (Kasprzyk et al . 1992. Cancer Res 52 2771-2776). B-cell lymphoma (Funakoshi et al , 1996. J Immunther Emphasis Tumor Immunol 19 93-101).
  • the mvention further provides vaccines formulated to contam a PSCA protein or fragment thereof
  • the use of a tumor antigen in a vaccine for generating humoral and cell-mediated immunity for use m anticancer therapy is well known in the art and has been employed m prostate cancer usmg human PSMA and rodent PAP lmmunogens (Hodge et al . 1995.
  • viral gene delivery systems may be used to dehver a PSCA-encodmg nucleic acid molecule
  • Vanous viral gene dehveiy systems which can be used m the practice of this aspect of the mvention mclude. but are not limited to, vaccinia fowlpox, canarypox. adenovirus, influenza, pohovirus. adeno- associated virus, lentivirus. and Sindbus virus (Restifo, 1996.
  • Non-viral delivery systems may also be employed by usmg naked DNA encodmg a PSCA protem or fragment thereof introduced mto the patient (e g , mtramuscularly) to induce an anti-tumor response
  • the full-length human PSCA cDNA may be employed
  • PSCA nucleic a ⁇ d molecules encodmg specific cytotoxic T lymphocyte (CTL) epitopes may be employed CTL epitopes can be determined usmg specific algonthms (e g , Epimer, Brown University) to identify peptides within a PSCA protem which are capable of optimally binding to specified HLA alleles
  • Vanous ex vivo strategies may also be employed One approach mvolves the use of dendntic cells to present PSCA antigen to a patient's immune system Dendntic cells express MHC class I and ⁇ . B7 costimulator, and EL-12. and are thus highly spe ⁇ ahzed antigen presenting cells
  • PSMA prostate-specific membrane antigen
  • Dendntic cells can be used to present PSCA peptides to T cells in the context of MHC class I and II molecules
  • autologous dendntic cells are pulsed with PSCA peptides capable of bmdmg to MHC molecules
  • dendntic cells are pulsed with the complete PSCA protein
  • Yet another embodiment involves enginee ⁇ ng the overexpression of the PSCA gene in dendntic cells using vanous implementing vectors known in the art. such as adenovirus (Arthur et al , 1997, Cancer Gene Ther 4 17-25), retrovirus (Henderson et al , 1996, Cancer Res 56 3763-3770).
  • lentivirus adeno-associated virus. DNA transfection (Ribas et al . 1997. Cancer Res 57 2865- 2869). and tumor-denved RNA transfection (Ashley et al . 1997. J Exp Med 186 1177-1182)
  • Anti-idiotypic anti-PSCA antibodies can also be used m anti-cancer therapy as a vaccine for inducing an immune response to cells expressing a PSCA protein Specifically, the generation of anti-idiotypic antibodies is well known in the art and can readily be adapted to generate anti-idiotypic anti-PSCA antibodies that mimic an epitope on a PSCA protem (see, for example. Wagner et al , 1997, Hybndoma 16 33 ⁇ 0. Foon et al . 1995. J Chn Invest 96 334-342, Herlyn et al . 1996. Cancer Immunol Immunother 43 65-76) Such an anti-idiotypic antibody can be used m anti-idiotypic therapy as presently practiced with other anti-idiotypic antibodies directed against tumor antigens
  • Genetic immunization methods may be employed to generate prophylactic or therapeutic humoral and cellular immune responses directed against cancer cells expressing PSCA Using the PSCA-encodmg DNA molecules descnbed herein, constructs compnsing DNA encodmg a PSCA protein/imunogen and approp ⁇ ate regulatory sequences may be injected directly mto muscle or skin of an mdividual.
  • PSCA protein immunogen may be expressed as a cell surface protein or be secreted Expression of the PSCA protein/immunogen results m the generation of prophylactic or therapeutic humoral and cellular l ⁇ imunity against prostate cancer Vanous prophylactic and therapeutic genetic immunization techmques known m the art may be used (for review, see information and references published at internet address www genvveb com)
  • the mvention provides methods for identifying cells, tissues or organisms expressing a PSCA protem or a PSCA gene Such methods can be used to diagnose the presence of cells or an organism that expresses a PSCA protem in vivo or in vitro
  • the methods of the present mvention are particularly useful m the determi ng the presence of cells that mediate pathological conditions of the prostate Specifically, the presence of a PSCA protem can be identified by determmmg whether a PSCA protein, or nucleic a ⁇ d encodmg a PSCA protein, is expressed
  • the expression of a PSCA protem can be used as a means for diagnosing the presence of cells, tissues or an organism that expresses a PSCA protem or gene
  • a vanety of immunological and molecular genetic techmques can be used to determine if a PSCA protem is expressed/produced m a particular cell or sample
  • an extract containmg nucleic a ⁇ d molecules or an extract containmg proteins is prepared The extract is then assayed to determine whether a PSCA protein, or a PSCA-encodmg nucleic a ⁇ d molecule, is produced m the cell
  • Vanous polynucleotide-based detection methods well known in the art may be employed for the detection of PSCA-encodmg nucleic acid molecules and for the detection of PSCA expressing cells m a biological specimen
  • RT-PCR methods may be used to selectively amplify a PSCA mRNA or fragment thereof, and such methods may be employed to identify cells expressing PSCA as descnbed m Example 1 below
  • RT-PCR is used to detect micrometastauc prostate cancer cells or circulating prostate cancer cells Vanous other amplification type detection methods, such as.
  • branched DNA methods for example, branched DNA methods, and vanous well known hybndization assays usmg DNA or RNA probes mav also be used for the detection of PSCA-encodmg polynucleotides or PSCA expressing cells
  • Vanous methods for the detection of proteins are well known m the art and may be employed for the detection of PSCA proteins and PSCA expressing cells
  • a suitable protem sample is obtained and prepared usmg conventional techmques Protein samples can be prepared for example, simply by boiling a sample with SDS
  • the extracted protem can then be analyzed to determine the presence of a PSCA protem usmg known methods
  • the presence of specific sized or charged vanants of a protem can be identified usmg mobility m an elect ⁇ c filed Alternatively, antibodies can be used for detection purposes
  • a stalled artisan can readily adapt known protem analytical methods to determine if a sample contains a PSCA protem
  • PSCA expression can also be used m methods to identify' agents that decrease the level of expression of the PSCA gene
  • cells or tissues expressing a PSCA protem can be contacted with a test agent to determine the effects of the agent on PSCA expression
  • Agents that activate PSCA expression can be used as an agonist of PSCA activity whereas agents that decrease PSCA expression can be used as an antagonist of PSCA activity
  • the mvention further provides the expression control sequences found 5' of the of the newly identified PSCA gene in a form that can be used m generating expression vectors and transgenic animals
  • the PSCA expression control elements such as the PSCA promoter that can readily be identified as being 5' from the ATG start codon m the PSCA gene, can be used to direct the expression of an operably linked protem encodmg DNA sequence Since PSCA expression is confined to prostate cells.
  • the expression control elements are particularly useful m directing the expression of an mtroduced transgene m a tissue specific fashion A skilled artisan can readily use the PSCA gene promoter and other regulatory elements m expression vectors usmg methods known m the art
  • PSCA-deficient non-human animals can be generated usmg standard knock-out procedures to inactivate a PSCA homologue or. if such animals are non-viable.
  • mdu ⁇ ble PSCA homologue antisense molecules can be used to regulate PSCA homologue activity/expression Alternatively, an animal can be altered so as to contam a human PSCA-encodmg nucleic acid molecule or an antisense-PSCA expression umt that directs the expression of PSCA protem or the antisense molecule m a tissue specific fashion
  • a non-human mammal for example a mouse or a rat is generated m which the expression of the PSCA homologue gene is altered by lnachvation or activation and/or replaced by a human PSCA gene This can be accomplished using a vanety of art-known procedures such as targeted recombination
  • the animal that expresses PSCA (human or homologue) in a tissue specific manner, or an animal that expresses an antisense molecule can be used to (1) identify biological and pathological processes mediated bv the PSCA protein, (2) identify proteins and other genes that mtera ⁇ with the PSCA proteins
  • transgemc mice expressing the human minigene encodmg PSCA m a tissue specific-fashion and test the effect of over-expression of the protem in tissues and cells that normally do not contam the PSCA protem
  • This strategy has been successfully used for other genes, namely bcl-2 (Veis et al Cell 1993 75 229)
  • Such an approach can readily be applied to the PSCA protein gene and can be used to address the issue of a potential beneficial or detrimental effect of the PSCA proteins in a specific tissue
  • the invention provides a pharmaceutical composition compnsing an PSCA nucleic acid molecule of the invention or an expression vector encoding an PSCA protem or encoding a fragment thereof and optionally, a suitable earner
  • the invention additionally provides a pharmaceutical composition compnsing an antibody or fragment thereof which recognizes and binds an PSCA protein
  • the antibody or fragment thereof is conjugated or linked to a therapeutic drug or a cytotoxic agent
  • Suitable earners for pharmaceutical compositions include any matenal which when combined with the nucleic acid or other molecule of the invention retains the molecule's activity and is non-reactive with the subject's immune systems
  • Examples include, but are not limited to, any of the standard pharmaceutical earners such as a phosphate buffered saline solution, water, emulsions such as oil/water emulsion, and vanous types of wetting agents
  • Other earners may also include stenle solutions, tablets including coated tablets and capsules
  • Such earners contain excipients such as starch, milk, sugar, certain types of clay, gelatin, steanc acid or salts thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients
  • Such earners may also include flavor and color additives or other ingredients
  • Compositions compnsing such earners are formulated bv well known conventional methods
  • Such compositions may also be formulated within vanous lipid compositions,
  • the invention also provides a diagnostic composition compnsing a PSCA nucleic acid molecule, a probe that specifically hvbndizes to a nucleic acid molecule of the invention or to any part thereof, or an PSCA antibody or fragment thereof
  • the nucleic acid molecule, the probe or the antibody or fragment thereof can be labeled with a detectable marker
  • a detectable marker include, but are not limited to, a radioisotope, a fluorescent compound a bioluminescent compound a chemiluminescent compound a metal chelator or an enzyme
  • the invention provides a diagnostic composition compnsing a PSCA-specific pnmer pair capable of amplifying PSCA- encod g sequences using polymerase chain reaction methodologies, such as RT-PCR
  • EXAMPLE 1 IDENTIFICATION AND MOLECULAR CHARACTERIZATION OF A NOVEL PROSTATE-SPECIFIC CELL SURFACE ANTIGEN (PSCA)
  • LAPC-4 Xenografts LAPC-4 xenografts were generated as descnbed in Klein et al. 1997, Nature Med 3 402-408
  • RDA Human PSCA cDNA Representational Difference Analysis
  • clone #15 had no exact match m the databases, but shared 30% nucleotide homology with stem cell antigen 2, a member of the Thy-l/Ly-6 superfanulv of glycosylphosphatidylinositol (GPI)-anchored cell surface antigens
  • Clone #15 encodes a 123 amino acid protein which is 30% identical to SCA-2 (also called RIG-E) and contains a number of highly conserved cysteine residues charactenstic of the Ly-6/Thy-l gene family (FIG 3)
  • SCA-2 also called RIG-E
  • FOG 3 glycosylphosphatidylinositol gene family
  • clone #15 contains both an amino-terminal hydrophobic signal sequence and a carboxyl-terminal stretch of hydrophobic amino acids preceded by a group of small amino acids defining a cleavage/binding site for GPI linkage (Udenfnend and Kodukula.
  • RT-PCR Reverse transcnptase-polymerase chain reaction
  • PSCA expression is largely prostate-specific
  • PSCA is Expressed bv a Subset of Basal Cells m Normal Prostate Normal prostate contains two major epithelial cell populations-secretory luminal cells and subjacent basal cells In situ hybndizations were performed on multiple sertions of normal prostate using an antisense nboprobe specific for PSCA to localize its expression As shown in FIG 11. PSCA is expressed exclusively in a subset of normal basal cells Little to no staining is seen in stroma.
  • Hybndization with sense PSCA nboprobes showed no background staining
  • Hybndization with an antisense probe for GAPDH confirmed that the RNA m all cell types was intact Because basal cells represent the putative progemtor cells for the terminally differentiated secretory cells, these results suggest that PSCA may be a prostate-specific stem/progemtor cell marker (Bonkhoff et al . 1994.
  • Prostate 24 114-118) since basal cells are androgen- lndependent, the association of PSCA with basal cells raises the possibility that PSCA may play a role in androgen-mdependent prostate cancer progression PSCA is Overexpressed in Prostate Cancer Cells
  • PSA expression is clearly detectable in normal prostate, at levels 2-3 times those seen in the LAPC-4 tumors
  • PSA expression is clearly detectable in normal prostate, at levels 2-3 times those seen in the LAPC-4 tumors
  • PSCA is Expressed in Androgen Receptor Negative Prostate Cancer Cell Lines Although PSCA was imtially cloned using subtractive hybndization. Northern blot analysis demonstrated strong PSCA expression m both androgen-dependent and androgen-mdependent LAPC-4 xenograft tumors (FIG 9) Moreover. PSCA expression was detected in all prostate cancer xenografts and cell lines tested including the LAPC-4 cell line and xenograft. the LAPC-9 xenograft, and the LnCaP cell line (all androgen-dependent) as well as in the Al LAPC-4 xenograft subhne the LAPC-3 xenograft.
  • Rabbit polyclonal antiserum was generated against the synthetic peptide -TARIRAVGLLTVISK- and affinity purified using a PSCA- glutathione S transferase fusion protein 293T cells were transiently transfected with pCDNA II (Invitrogen, San Diego, CA) expression vectors containing PSCA CD59. E25 or vector alone by calcium phosphate precipitation Immunoprecipitation was performed as previously descnbed (Harlow and Lane, 1988. Antibodies A Laboratory Manual (Cold Spnng Harbor Press)) Bnefly.
  • PSCA is a GPI-Anchored Glvcoprotein Expressed on the Cell Surface
  • the deduced PSCA amino acid sequence predicts that PSCA is heavily glycosylated and anchored to the cell surface through a GPI mechanism
  • we produced an affinity purified polyclonal antibody raised against a unique PSCA peptide This peptide contains no glycosvlation sites and was predicted based on compa ⁇ son to the three dimensional structure of CD59 (another GPI-anchored PSCA homologue). to lie in an exposed portion of the mature protein (Kiefer et al . 1994.
  • FIG 12B indicates that some PSCA is secreted in the 293T-overexpress ⁇ ng system
  • the secreted form of PSCA migrates at a lower molecular weight than the cell surface-associated form, perhaps reflecting the absence of the covalent GPI-linkage This result may reflect the high level of expression in the 293T cell line and needs to be confirmed in prostate cancer cell lines and in vivo
  • FIG 12C shows cell surface expression of PSCA in PSCA-transfected 293T and LAPC-4 cells, but not in mock- transfected cells
  • PLC GPI-spe ⁇ fic phosphohpase C
  • the human PSCA cDNA was used to search munne EST databases in order to identify homologues for potential transgenic and knockout expenments
  • One EST obtained from fetal mouse and another from neonatal kidnev were 70% identical to the human cDNA at both the nucleotide and amino a ⁇ d levels
  • the homology between the mouse clones and human PSCA included regions of divergence between human PSCA and its GPI-anchored homologues. indicating that these clones likely represented the mouse homologue of PSCA Alignment of these ESTs and 5' extension using RACE-PCR provided the entire coding sequence (FIG 2)
  • Genomic Clomng Lambda phage clones contaimng the human PSCA gene were obtained by screemng a human genomic library (Stratagene) with a human PSCA cDNA probe (Sambrook et al . 1989. Molecular Clomng (Cold Spnng Harbor)) BAC (bactenal artificial chromosome) clones contaimng the munne PSCA gene were obtained by screemng a munne BAC library (Genome Systems. St Louis. MO) with a munne PSCA cDNA probe A 14kb human Not I fragment and a lOkb munne Eco RI fragment were subcloned into pBluescnpt (Stratagene). sequenced and restnction mapped
  • Fluorescence in situ chromosomal analysis was performed as previously descnbed using overlapping human lambda phage clones (Rowley et al.. 1990, Proc Natl Acad Sci USA 87 9358-9362)
  • a GST-PSCA fusion protem immunogen was used to raise antibodies in mice using standard monoclonal antibody generation methodology Bnefly, the PSCA coding sequence conespondmg to amino acids 18 through 98 of the human PSCA amino acid sequence shown in FIG IB was PCR- amplified using the pnmer pair
  • the amplified PSCA sequence was cloned into pGEX-2T (Pharmacia), used to transform E coli. and the fusion protem isolated
  • Epitope mapping of anti-PSCA monoclonal antibodies was conducted by Western blot analysis of GST-PSCA fusion proteins Bnefly. 1 ⁇ g GST-PSCA fusion protein (amino acids 18 - 98) or a GST-PSCA amino terminal region protein (N-terminal. ammo acids 2-50), a GST-PSCA middle region protein (GST-middle, amino acids 46-109). or a GST-carboxyl terminal region protein (GST- C-termmal.
  • PSCA MAbs 3E6 and 1G8 were epitope mapped by Western blot analysis of GST-PSCA fusion proteins The results are shown in FIG 15 and indicate that these MAbs recognize different epitopes on PSCA MAb 3E6 recognizes an epitope in the carboxy-terminal region of the protein, whereas MAb 1G8 recognizes an ammo-terminal epitope (FIG 15)
  • Monoclonal antibodies 1G8, 2H5, 3C5, and 4A10 recognize an epitope residing in the amino terminal region of the PSCA protein and monoclonal antibody 3E6 recognizes an epitope in the carboxyl-terminal region of the protein GST-PSCA fusion proteins encoding either the amino terminal region of the PSCA protein (N-terminal, amino acids 2-50), the middle region (middle, amino acids 46-109), or the carboxyl terminal region (C-terminal amino acids 85-123) were used in an ELISA to identify the epitope recognized by 5 anti-PSCA monoclonal antibodies 10 ng of the indicated fusion protein coated in wells of a nucrotiter plate was incubated with either a 1 250 dilution of concentrated tissue culture supernatants of hybndomas 1G8 or 3E6 or with 1 10 dilutions of supernatants from hybndomas 2H5.
  • Monoclonal antibodies 1G8. 2H5. 3C5. and 4A10 recognize an epitope residing in the amino terminal region of the PSCA protein and monoclonal antibody 3E6 recognizes an epitope in the carboxyl-terminal region of the protein GST-PSCA fusion proteins encoding either the amino terminal region of the PSCA protein (N-terminal. ammo acids 2-50).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Gynecology & Obstetrics (AREA)
  • Biotechnology (AREA)
  • Pregnancy & Childbirth (AREA)
  • Microbiology (AREA)
  • Reproductive Health (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US1998/004665 1997-03-10 1998-03-10 Psca: prostate stem cell antigen Ceased WO1998040403A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
JP53971398A JP4404381B2 (ja) 1997-03-10 1998-03-10 Psca:前立腺幹細胞抗原
EP98911548A EP0981541B1 (en) 1997-03-10 1998-03-10 Psca: prostate stem cell antigen
AU65481/98A AU739407C (en) 1997-03-10 1998-03-10 PSCA: prostate stem cell antigen
CA002281877A CA2281877C (en) 1997-03-10 1998-03-10 Psca: prostate stem cell antigen
DE69824287T DE69824287T2 (de) 1997-03-10 1998-03-10 Prostata stammzell-antigen (psca)
NZ337413A NZ337413A (en) 1997-03-10 1998-03-10 Antibodies that bind to Prostate Stem Cell Antigen (PSCA) to treat prostate cancer.
AT98911548T ATE268340T1 (de) 1997-03-10 1998-03-10 Prostata stammzell-antigen (psca)
AU2004200093A AU2004200093B8 (en) 1997-03-10 2004-01-09 "PSCA: Prostate Stem Cell Antigen and uses thereof"

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US81427997A 1997-03-10 1997-03-10
US08/814,279 1997-03-10
US7114198P 1998-01-12 1998-01-12
US60/071,141 1998-01-12
US7467598P 1998-02-13 1998-02-13
US60/074,675 1998-02-13

Publications (1)

Publication Number Publication Date
WO1998040403A1 true WO1998040403A1 (en) 1998-09-17

Family

ID=27371828

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/004665 Ceased WO1998040403A1 (en) 1997-03-10 1998-03-10 Psca: prostate stem cell antigen

Country Status (10)

Country Link
US (1) US6267960B1 (https=)
EP (3) EP1514876B1 (https=)
JP (3) JP4404381B2 (https=)
AT (1) ATE268340T1 (https=)
AU (1) AU739407C (https=)
CA (1) CA2281877C (https=)
DE (1) DE69824287T2 (https=)
ES (1) ES2221982T3 (https=)
NZ (1) NZ337413A (https=)
WO (1) WO1998040403A1 (https=)

Cited By (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000018925A1 (en) * 1998-09-30 2000-04-06 Urogenesys, Inc. Gene expressed in prostate cancer
WO2000032752A1 (en) * 1998-12-02 2000-06-08 The Regents Of The University Of California Psca: prostate stem cell antigen and uses thereof
WO2001005427A1 (en) * 1999-07-20 2001-01-25 The Regents Of The University Of California Psca: prostate stem cell antigen and uses thereof
WO2001040309A3 (en) * 1999-10-29 2001-11-29 Genentech Inc Anti-prostate stem cell antigen (psca) antibody compositions and methods of use
WO2001098358A3 (en) * 2000-06-22 2002-06-20 Rhode Island Hosp Lifespan Ptr Compositions for identification and isolation of stem cells
US6824780B1 (en) * 1999-10-29 2004-11-30 Genentech, Inc. Anti-tumor antibody compositions and methods of use
WO2007086932A3 (en) * 2006-01-13 2007-09-13 Univ Johns Hopkins Prostate stem cell antigen vaccines and uses thereof
EP1629088A4 (en) * 2003-05-30 2008-04-02 Agensys Inc VARIANTS OF PROSTATE STEM CELL ANTIGEN (PSCA) AND PART SEQUENCES THEREOF
US7541442B2 (en) 2003-05-30 2009-06-02 Agensys, Inc. Antibodies and related molecules that bind to PSCA proteins
US7595379B2 (en) 2003-05-30 2009-09-29 Agensys, Inc. Antibodies and related molecules that bind to PSCA proteins
RU2381234C2 (ru) * 2004-05-28 2010-02-10 Эдженсис, Инк. Антитела и родственные молекулы, связывающиеся с белками psca
US7834163B2 (en) 2003-06-26 2010-11-16 Exonhit Therapeutics S.A. Prostate specific genes and the use thereof as targets for prostate cancer therapy
EP2260858A2 (en) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Monomethylvaline compounds capable of conjugation to ligands
EP2286844A2 (en) 2004-06-01 2011-02-23 Genentech, Inc. Antibody-drug conjugates and methods
WO2011031870A1 (en) 2009-09-09 2011-03-17 Centrose, Llc Extracellular targeted drug conjugates
WO2011056983A1 (en) 2009-11-05 2011-05-12 Genentech, Inc. Zirconium-radiolabeled, cysteine engineered antibody conjugates
WO2011130598A1 (en) 2010-04-15 2011-10-20 Spirogen Limited Pyrrolobenzodiazepines and conjugates thereof
WO2011156328A1 (en) 2010-06-08 2011-12-15 Genentech, Inc. Cysteine engineered antibodies and conjugates
EP2402758A2 (en) 2005-09-19 2012-01-04 Veridex, LLC Methods and materials for identifying the origin of a carcinoma of unknown primary origin
WO2012074757A1 (en) 2010-11-17 2012-06-07 Genentech, Inc. Alaninyl maytansinol antibody conjugates
WO2012155019A1 (en) 2011-05-12 2012-11-15 Genentech, Inc. Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides
KR101215611B1 (ko) * 2004-05-28 2012-12-28 어젠시스 인코포레이티드 Psca 단백질에 결합하는 항체 및 관련 분자
WO2013130093A1 (en) 2012-03-02 2013-09-06 Genentech, Inc. Biomarkers for treatment with anti-tubulin chemotherapeutic compounds
WO2014057074A1 (en) 2012-10-12 2014-04-17 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
WO2014140174A1 (en) 2013-03-13 2014-09-18 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
WO2014140862A2 (en) 2013-03-13 2014-09-18 Spirogen Sarl Pyrrolobenzodiazepines and conjugates thereof
WO2014159981A2 (en) 2013-03-13 2014-10-02 Spirogen Sarl Pyrrolobenzodiazepines and conjugates thereof
WO2015023355A1 (en) 2013-08-12 2015-02-19 Genentech, Inc. 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment
WO2015095223A2 (en) 2013-12-16 2015-06-25 Genentech, Inc. Peptidomimetic compounds and antibody-drug conjugates thereof
WO2015095227A2 (en) 2013-12-16 2015-06-25 Genentech, Inc. Peptidomimetic compounds and antibody-drug conjugates thereof
WO2015095212A1 (en) 2013-12-16 2015-06-25 Genentech, Inc. 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment
WO2016037644A1 (en) 2014-09-10 2016-03-17 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2016040856A2 (en) 2014-09-12 2016-03-17 Genentech, Inc. Cysteine engineered antibodies and conjugates
WO2016040825A1 (en) 2014-09-12 2016-03-17 Genentech, Inc. Anthracycline disulfide intermediates, antibody-drug conjugates and methods
WO2016090050A1 (en) 2014-12-03 2016-06-09 Genentech, Inc. Quaternary amine compounds and antibody-drug conjugates thereof
EP3088004A1 (en) 2004-09-23 2016-11-02 Genentech, Inc. Cysteine engineered antibodies and conjugates
US9562049B2 (en) 2012-12-21 2017-02-07 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US9567340B2 (en) 2012-12-21 2017-02-14 Medimmune Limited Unsymmetrical pyrrolobenzodiazepines-dimers for use in the treatment of proliferative and autoimmune diseases
WO2017059289A1 (en) 2015-10-02 2017-04-06 Genentech, Inc. Pyrrolobenzodiazepine antibody drug conjugates and methods of use
WO2017064675A1 (en) 2015-10-16 2017-04-20 Genentech, Inc. Hindered disulfide drug conjugates
WO2017068511A1 (en) 2015-10-20 2017-04-27 Genentech, Inc. Calicheamicin-antibody-drug conjugates and methods of use
WO2017165734A1 (en) 2016-03-25 2017-09-28 Genentech, Inc. Multiplexed total antibody and antibody-conjugated drug quantification assay
EP3235820A1 (en) 2014-09-17 2017-10-25 Genentech, Inc. Pyrrolobenzodiazepines and antibody disulfide conjugates thereof
WO2017201449A1 (en) 2016-05-20 2017-11-23 Genentech, Inc. Protac antibody conjugates and methods of use
WO2017205741A1 (en) 2016-05-27 2017-11-30 Genentech, Inc. Bioanalytical method for the characterization of site-specific antibody-drug conjugates
WO2017214024A1 (en) 2016-06-06 2017-12-14 Genentech, Inc. Silvestrol antibody-drug conjugates and methods of use
WO2018031662A1 (en) 2016-08-11 2018-02-15 Genentech, Inc. Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof
US9919056B2 (en) 2012-10-12 2018-03-20 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US9931415B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9931414B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
WO2018065501A1 (en) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Methods for preparing antibody drug conjugates
US9950078B2 (en) 2013-10-11 2018-04-24 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9956299B2 (en) 2013-10-11 2018-05-01 Medimmune Limited Pyrrolobenzodiazepine—antibody conjugates
US10010624B2 (en) 2013-10-11 2018-07-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10029018B2 (en) 2013-10-11 2018-07-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2019060398A1 (en) 2017-09-20 2019-03-28 Ph Pharma Co., Ltd. ANALOGUES OF THAILANSTATINE
US10392393B2 (en) 2016-01-26 2019-08-27 Medimmune Limited Pyrrolobenzodiazepines
US10420777B2 (en) 2014-09-12 2019-09-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10544223B2 (en) 2017-04-20 2020-01-28 Adc Therapeutics Sa Combination therapy with an anti-axl antibody-drug conjugate
US10543279B2 (en) 2016-04-29 2020-01-28 Medimmune Limited Pyrrolobenzodiazepine conjugates and their use for the treatment of cancer
WO2020049286A1 (en) 2018-09-03 2020-03-12 Femtogenix Limited Polycyclic amides as cytotoxic agents
WO2020086858A1 (en) 2018-10-24 2020-04-30 Genentech, Inc. Conjugated chemical inducers of degradation and methods of use
WO2020123275A1 (en) 2018-12-10 2020-06-18 Genentech, Inc. Photocrosslinking peptides for site specific conjugation to fc-containing proteins
US10695433B2 (en) 2012-10-12 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10695439B2 (en) 2016-02-10 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine conjugates
WO2020157491A1 (en) 2019-01-29 2020-08-06 Femtogenix Limited G-a crosslinking cytotoxic agents
US10736903B2 (en) 2012-10-12 2020-08-11 Medimmune Limited Pyrrolobenzodiazepine-anti-PSMA antibody conjugates
US10751346B2 (en) 2012-10-12 2020-08-25 Medimmune Limited Pyrrolobenzodiazepine—anti-PSMA antibody conjugates
US10780096B2 (en) 2014-11-25 2020-09-22 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
US10799595B2 (en) 2016-10-14 2020-10-13 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11059893B2 (en) 2015-04-15 2021-07-13 Bergenbio Asa Humanized anti-AXL antibodies
US11135303B2 (en) 2011-10-14 2021-10-05 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US11160872B2 (en) 2017-02-08 2021-11-02 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
WO2022023735A1 (en) 2020-07-28 2022-02-03 Femtogenix Limited Cytotoxic agents
US11318211B2 (en) 2017-06-14 2022-05-03 Adc Therapeutics Sa Dosage regimes for the administration of an anti-CD19 ADC
US11352324B2 (en) 2018-03-01 2022-06-07 Medimmune Limited Methods
US11370801B2 (en) 2017-04-18 2022-06-28 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11517626B2 (en) 2016-02-10 2022-12-06 Medimmune Limited Pyrrolobenzodiazepine antibody conjugates
US11524969B2 (en) 2018-04-12 2022-12-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof as antitumour agents
US11612665B2 (en) 2017-02-08 2023-03-28 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
WO2023078273A1 (en) 2021-11-03 2023-05-11 Hangzhou Dac Biotech Co., Ltd. Specific conjugation for an antibody-drug conjugate
US11649250B2 (en) 2017-08-18 2023-05-16 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11702473B2 (en) 2015-04-15 2023-07-18 Medimmune Limited Site-specific antibody-drug conjugates
WO2024138128A2 (en) 2022-12-23 2024-06-27 Genentech, Inc. Cereblon degrader conjugates, and uses thereof
WO2024220546A2 (en) 2023-04-17 2024-10-24 Peak Bio, Inc. Antibodies and antibody-drug conjugates and methods of use and synthetic processes and intermediates
US12209099B2 (en) 2019-03-15 2025-01-28 Medimmune Limited Azetidobenzodiazepine dimers and conjugates comprising them for use in the treatment of cancer
WO2026006689A2 (en) 2024-06-28 2026-01-02 Firefly Bio, Inc. Bcl-xl degrader antibody conjugates and uses thereof
WO2026006688A2 (en) 2024-06-28 2026-01-02 Firefly Bio, Inc. Degrader antibody conjugates and uses thereof

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2004200093B8 (en) * 1997-03-10 2008-05-29 The Regents Of The University Of California "PSCA: Prostate Stem Cell Antigen and uses thereof"
US20080318254A9 (en) * 1997-03-10 2008-12-25 The Regents Of The University Of California PSCA antibodies and hybridomas producing them
AU771026B2 (en) * 1998-03-10 2004-03-11 Regents Of The University Of California, The PSCA: prostate stem cell antigen and uses thereof
WO1998051805A1 (en) * 1997-05-15 1998-11-19 Abbott Laboratories Reagents and methods useful for detecting diseases of the prostate
US9012141B2 (en) 2000-03-27 2015-04-21 Advaxis, Inc. Compositions and methods comprising KLK3 of FOLH1 antigen
US7713693B1 (en) 2004-09-01 2010-05-11 University Of Louisiana At Monroe Human cancer cell specific gene transcript
WO2006112933A1 (en) * 2005-04-14 2006-10-26 Agensys, Inc. Antibodies and related molecules that bind to psca proteins
CN101223191B (zh) * 2005-04-14 2012-09-05 阿根西斯公司 与psca蛋白结合的抗体和相关分子
US8088908B2 (en) * 2005-05-10 2012-01-03 City Of Hope Humanized anti-prostate stem cell antigen monoclonal antibody
WO2007109321A2 (en) 2006-03-20 2007-09-27 The Regents Of The University Of California Engineered anti-prostate stem cell antigen (psca) antibodies for cancer targeting
US8940298B2 (en) 2007-09-04 2015-01-27 The Regents Of The University Of California High affinity anti-prostate stem cell antigen (PSCA) antibodies for cancer targeting and detection
DE102011118022B4 (de) * 2011-06-30 2018-01-18 Gemoab Monoclonals Gmbh Antikörper gegen das Prostata-spezifische Stammzellenantigen und dessen Verwendung
USD1094985S1 (en) * 2024-09-17 2025-09-30 Skechers U.S.A., Inc. Ii Outsole bottom

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3684578D1 (de) * 1985-12-17 1992-04-30 Eastern Virginia Medical Autho Monoklonale antikoerper mit bindungsspezifitaet fuer menschliche prostatatumorantigene und methoden fuer ihre verwendung.
AU6267896A (en) * 1995-06-07 1996-12-30 Imclone Systems Incorporated Antibody and antibody fragments for inhibiting the growth oftumors
US5856136A (en) * 1996-07-03 1999-01-05 Incyte Pharmaceuticals, Inc. Human stem cell antigens
WO1998051824A1 (en) * 1997-05-15 1998-11-19 Abbott Laboratories Reagents and methods useful for detecting disease of the urinary tract
WO1998051805A1 (en) * 1997-05-15 1998-11-19 Abbott Laboratories Reagents and methods useful for detecting diseases of the prostate

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
CAMA C., ET AL.: "MOLECULAR STAGING OF PROSTATE CANCER. II. A COMPARISON OF THE APPLICATION OF AN ENHANCED REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION ASSAY FOR PROSTATE SPECIFIC ANTIGEN VERSUS PROSTATE SPECIFIC MEMBRANE ANTIGEN.", JOURNAL OF UROLOGY., LIPPINCOTT WILLIAMS & WILKINS, BALTIMORE, MD, US, vol. 153., 1 May 1995 (1995-05-01), BALTIMORE, MD, US, pages 1373 - 1378., XP002910141, ISSN: 0022-5347, DOI: 10.1016/S0022-5347(01)67407-X *
HOROSZEWICZ J. S., ET AL.: "MONOCLONAL ANTIBODIES TO A NEW ANTIGENIC MARKER IN EPITHELIAL PROSTATIC CELLS AND SERUM OF PROSTATIC CANCER PATIENTS.", ANTICANCER RESEARCH - INTERNATIONAL JOURNAL OF CANCER RESEARCH AND TREATMENT, INTERNATIONAL INSTITUTE OF ANTICANCER RESEARCH, GR, vol. 07., 1 January 1987 (1987-01-01), GR, pages 927 - 935., XP002910140, ISSN: 0250-7005 *
ISRAELI R. S., ET AL.: "EXPRESSION OF THE PROSTATE-SPECIFIC MEMBRANE ANTIGEN.", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 54., 1 April 1994 (1994-04-01), US, pages 1807 - 1811., XP002910138, ISSN: 0008-5472 *
ISRAELL R. S., ET AL.: "SENSITIVE NESTED REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION DETECTION OF CIRCULATING PROSTATIC TUMOR CELLS: COMPARISON OF PROSTATE-SPECIFIC MEMBRANE ANTIGEN AND PROSTATE-SPECIFIC ANTIGEN-BASED ASSAYS.", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 54., 15 December 1994 (1994-12-15), US, pages 6306 - 6310., XP002910143, ISSN: 0008-5472 *
SMITH M. R., ET AL.: "PROSTATE-SPECIFIC ANTIGEN MESSENGER RNA IS EXPRESSED IN NON-PROSTATE CELLS: IMPLICATIONS FOR DETECTION OF MICROMETASTASES.", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 55., 15 June 1995 (1995-06-15), US, pages 2640 - 2644., XP002910142, ISSN: 0008-5472 *
SODEE D. B., ET AL.: "PRELIMINARY IMAGING RESULTS USING IN-111 LABELED CYT-356 (PROSTASCINT) IN THE DETECTION OF RECURRENT PROSTATE CANCER.", CLINICAL NUCLEAR MEDICINE., LIPPINCOTT, PHILADELPHIA., US, vol. 21., no. 10., 1 October 1996 (1996-10-01), US, pages 759 - 767., XP002910137, ISSN: 0363-9762, DOI: 10.1097/00003072-199610000-00002 *
WU J. T.: "ASSAY FOR PROSTATE SPECIFIC ANTIGEN (PSA): PROBLEMS AND POSSIBLE SOLUTIONS.", JOURNAL OF CLINICAL LABORATORY ANALYSIS., NEW YORK, NY., US, vol. 08., 1 January 1994 (1994-01-01), US, pages 51 - 62., XP002910139, ISSN: 0887-8013 *

Cited By (136)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7407656B2 (en) 1997-03-10 2008-08-05 The Regents Of The University Of California PSCA: prostate stem cell antigen and uses thereof
US7527786B2 (en) 1997-03-10 2009-05-05 The Regents Of The University Of California Methods for inhibiting the growth of cancer cells expressing PSCA
US8759006B2 (en) 1997-03-10 2014-06-24 The Regents Of The University Of California PSCA: prostate stem cell antigen and distinguishing androgen receptor negative prostate cancer from benign prostatic hyperplasia
US8524460B2 (en) 1997-03-10 2013-09-03 The Regents Of The University PSCA: prostate stem cell antigen and uses thereof
US6825326B2 (en) * 1997-03-10 2004-11-30 The Regents Of The University Of California PSCA: prostate stem cell antigen and uses thereof
US6541212B2 (en) * 1997-03-10 2003-04-01 The Regents Of The University Of California Methods for detecting prostate stem cell antigen protein
WO2000018925A1 (en) * 1998-09-30 2000-04-06 Urogenesys, Inc. Gene expressed in prostate cancer
US7432346B2 (en) 1998-09-30 2008-10-07 Agensys, Inc. Gene expressed in prostate cancer
US7803916B2 (en) 1998-09-30 2010-09-28 Agensys Inc. Gene expressed in prostate cancer
US6509458B1 (en) 1998-09-30 2003-01-21 Agensys, Inc. Gene expressed in prostate cancer
US7968283B2 (en) 1998-09-30 2011-06-28 Agensys, Inc. Gene expressed in prostate cancer
WO2000032752A1 (en) * 1998-12-02 2000-06-08 The Regents Of The University Of California Psca: prostate stem cell antigen and uses thereof
JP2009159973A (ja) * 1998-12-02 2009-07-23 Regents Of The Univ Of California Psca:前立腺幹細胞抗原およびそれの使用
JP2002531082A (ja) * 1998-12-02 2002-09-24 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア Psca:前立腺幹細胞抗原およびそれの使用
EP1780268A3 (en) * 1998-12-02 2007-05-16 The Regents of the University of California PSCA: Prostate stem cell antigen and uses thereof
AU776716B2 (en) * 1999-07-20 2004-09-16 Agensys, Inc. PSCA: prostate stem cell antigen and uses thereof
WO2001005427A1 (en) * 1999-07-20 2001-01-25 The Regents Of The University Of California Psca: prostate stem cell antigen and uses thereof
JP2007001983A (ja) * 1999-07-20 2007-01-11 Univ California Psca:前立腺幹細胞抗原およびその使用
US7435416B2 (en) * 1999-10-29 2008-10-14 Genetech, Inc. Anti-tumor antibody compositions and methods of use
WO2001040309A3 (en) * 1999-10-29 2001-11-29 Genentech Inc Anti-prostate stem cell antigen (psca) antibody compositions and methods of use
US6824780B1 (en) * 1999-10-29 2004-11-30 Genentech, Inc. Anti-tumor antibody compositions and methods of use
AU778199B2 (en) * 1999-10-29 2004-11-25 Genentech Inc. Anti-prostate stem cell antigen (PSCA) antibody compositions and methods of use
US7223549B2 (en) 2000-06-22 2007-05-29 Andrew N. Marakovskiy Compositions for identification and isolation of stem cells
WO2001098358A3 (en) * 2000-06-22 2002-06-20 Rhode Island Hosp Lifespan Ptr Compositions for identification and isolation of stem cells
US6632620B1 (en) 2000-06-22 2003-10-14 Andrew N. Makarovskiy Compositions for identification and isolation of stem cells
US8853364B2 (en) 2003-05-30 2014-10-07 Agensys, Inc. Prostate stem cell antigen (PSCA) variants and subsequences thereof
US7622564B2 (en) 2003-05-30 2009-11-24 Agensys, Inc. Prostate stem cell antigen (PSCA) variants and subsequences thereof
US7595379B2 (en) 2003-05-30 2009-09-29 Agensys, Inc. Antibodies and related molecules that bind to PSCA proteins
US7541442B2 (en) 2003-05-30 2009-06-02 Agensys, Inc. Antibodies and related molecules that bind to PSCA proteins
EP1629088A4 (en) * 2003-05-30 2008-04-02 Agensys Inc VARIANTS OF PROSTATE STEM CELL ANTIGEN (PSCA) AND PART SEQUENCES THEREOF
KR101291787B1 (ko) * 2003-05-30 2013-08-07 어젠시스 인코포레이티드 전립선 줄기 세포 항원 (psca) 변이체 및 그의서브서열
US8278424B2 (en) 2003-05-30 2012-10-02 Agensys, Inc. Antibodies that bind to PSCA proteins for diagnosis of cancer
EP2319524A1 (en) * 2003-05-30 2011-05-11 Agensys, Inc. Prostate stem cell antigen (PSCA) variants and subsequences thereof
US8206932B2 (en) 2003-05-30 2012-06-26 Agensys, Inc. Antibodies and related molecules that bind to PSCA proteins
US8013128B2 (en) 2003-05-30 2011-09-06 Agensys, Inc. Antibodies and related molecules that bind to PSCA proteins
US7834163B2 (en) 2003-06-26 2010-11-16 Exonhit Therapeutics S.A. Prostate specific genes and the use thereof as targets for prostate cancer therapy
EP2486933A1 (en) 2003-11-06 2012-08-15 Seattle Genetics, Inc. Monomethylvaline compounds conjugated with antibodies
EP3434275A1 (en) 2003-11-06 2019-01-30 Seattle Genetics, Inc. Assay for cancer cells based on the use of auristatin conjugates with antibodies
EP3858387A1 (en) 2003-11-06 2021-08-04 Seagen Inc. Monomethylvaline compounds capable of conjugation to ligands
EP2260858A2 (en) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Monomethylvaline compounds capable of conjugation to ligands
EP2489364A1 (en) 2003-11-06 2012-08-22 Seattle Genetics, Inc. Monomethylvaline compounds onjugated to antibodies
EP2478912A1 (en) 2003-11-06 2012-07-25 Seattle Genetics, Inc. Auristatin conjugates with anti-HER2 or anti-CD22 antibodies and their use in therapy
KR101215611B1 (ko) * 2004-05-28 2012-12-28 어젠시스 인코포레이티드 Psca 단백질에 결합하는 항체 및 관련 분자
RU2381234C2 (ru) * 2004-05-28 2010-02-10 Эдженсис, Инк. Антитела и родственные молекулы, связывающиеся с белками psca
EP2286844A2 (en) 2004-06-01 2011-02-23 Genentech, Inc. Antibody-drug conjugates and methods
EP3088004A1 (en) 2004-09-23 2016-11-02 Genentech, Inc. Cysteine engineered antibodies and conjugates
EP2402758A2 (en) 2005-09-19 2012-01-04 Veridex, LLC Methods and materials for identifying the origin of a carcinoma of unknown primary origin
WO2007086932A3 (en) * 2006-01-13 2007-09-13 Univ Johns Hopkins Prostate stem cell antigen vaccines and uses thereof
WO2011031870A1 (en) 2009-09-09 2011-03-17 Centrose, Llc Extracellular targeted drug conjugates
WO2011056983A1 (en) 2009-11-05 2011-05-12 Genentech, Inc. Zirconium-radiolabeled, cysteine engineered antibody conjugates
WO2011130598A1 (en) 2010-04-15 2011-10-20 Spirogen Limited Pyrrolobenzodiazepines and conjugates thereof
WO2011156328A1 (en) 2010-06-08 2011-12-15 Genentech, Inc. Cysteine engineered antibodies and conjugates
WO2012074757A1 (en) 2010-11-17 2012-06-07 Genentech, Inc. Alaninyl maytansinol antibody conjugates
WO2012155019A1 (en) 2011-05-12 2012-11-15 Genentech, Inc. Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides
US11135303B2 (en) 2011-10-14 2021-10-05 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2013130093A1 (en) 2012-03-02 2013-09-06 Genentech, Inc. Biomarkers for treatment with anti-tubulin chemotherapeutic compounds
US10751346B2 (en) 2012-10-12 2020-08-25 Medimmune Limited Pyrrolobenzodiazepine—anti-PSMA antibody conjugates
US9889207B2 (en) 2012-10-12 2018-02-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10646584B2 (en) 2012-10-12 2020-05-12 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10799596B2 (en) 2012-10-12 2020-10-13 Adc Therapeutics S.A. Pyrrolobenzodiazepine-antibody conjugates
US12121590B2 (en) 2012-10-12 2024-10-22 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10994023B2 (en) 2012-10-12 2021-05-04 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10695433B2 (en) 2012-10-12 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10736903B2 (en) 2012-10-12 2020-08-11 Medimmune Limited Pyrrolobenzodiazepine-anti-PSMA antibody conjugates
US10335497B2 (en) 2012-10-12 2019-07-02 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2014057074A1 (en) 2012-10-12 2014-04-17 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
US9931414B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10780181B2 (en) 2012-10-12 2020-09-22 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9931415B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10722594B2 (en) 2012-10-12 2020-07-28 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US9919056B2 (en) 2012-10-12 2018-03-20 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US11690918B2 (en) 2012-10-12 2023-07-04 Medimmune Limited Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US11779650B2 (en) 2012-10-12 2023-10-10 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11701430B2 (en) 2012-10-12 2023-07-18 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US11771775B2 (en) 2012-10-12 2023-10-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
EP2839860A1 (en) 2012-10-12 2015-02-25 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
US9567340B2 (en) 2012-12-21 2017-02-14 Medimmune Limited Unsymmetrical pyrrolobenzodiazepines-dimers for use in the treatment of proliferative and autoimmune diseases
US9562049B2 (en) 2012-12-21 2017-02-07 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2014159981A2 (en) 2013-03-13 2014-10-02 Spirogen Sarl Pyrrolobenzodiazepines and conjugates thereof
WO2014140174A1 (en) 2013-03-13 2014-09-18 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
WO2014140862A2 (en) 2013-03-13 2014-09-18 Spirogen Sarl Pyrrolobenzodiazepines and conjugates thereof
WO2015023355A1 (en) 2013-08-12 2015-02-19 Genentech, Inc. 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment
US9950078B2 (en) 2013-10-11 2018-04-24 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9956299B2 (en) 2013-10-11 2018-05-01 Medimmune Limited Pyrrolobenzodiazepine—antibody conjugates
US10010624B2 (en) 2013-10-11 2018-07-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10029018B2 (en) 2013-10-11 2018-07-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2015095223A2 (en) 2013-12-16 2015-06-25 Genentech, Inc. Peptidomimetic compounds and antibody-drug conjugates thereof
WO2015095227A2 (en) 2013-12-16 2015-06-25 Genentech, Inc. Peptidomimetic compounds and antibody-drug conjugates thereof
WO2015095212A1 (en) 2013-12-16 2015-06-25 Genentech, Inc. 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment
US10188746B2 (en) 2014-09-10 2019-01-29 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2016037644A1 (en) 2014-09-10 2016-03-17 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2016040856A2 (en) 2014-09-12 2016-03-17 Genentech, Inc. Cysteine engineered antibodies and conjugates
US10420777B2 (en) 2014-09-12 2019-09-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2016040825A1 (en) 2014-09-12 2016-03-17 Genentech, Inc. Anthracycline disulfide intermediates, antibody-drug conjugates and methods
EP3235820A1 (en) 2014-09-17 2017-10-25 Genentech, Inc. Pyrrolobenzodiazepines and antibody disulfide conjugates thereof
US10780096B2 (en) 2014-11-25 2020-09-22 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
WO2016090050A1 (en) 2014-12-03 2016-06-09 Genentech, Inc. Quaternary amine compounds and antibody-drug conjugates thereof
US11702473B2 (en) 2015-04-15 2023-07-18 Medimmune Limited Site-specific antibody-drug conjugates
US11059893B2 (en) 2015-04-15 2021-07-13 Bergenbio Asa Humanized anti-AXL antibodies
WO2017059289A1 (en) 2015-10-02 2017-04-06 Genentech, Inc. Pyrrolobenzodiazepine antibody drug conjugates and methods of use
WO2017064675A1 (en) 2015-10-16 2017-04-20 Genentech, Inc. Hindered disulfide drug conjugates
WO2017068511A1 (en) 2015-10-20 2017-04-27 Genentech, Inc. Calicheamicin-antibody-drug conjugates and methods of use
US10392393B2 (en) 2016-01-26 2019-08-27 Medimmune Limited Pyrrolobenzodiazepines
US11517626B2 (en) 2016-02-10 2022-12-06 Medimmune Limited Pyrrolobenzodiazepine antibody conjugates
US10695439B2 (en) 2016-02-10 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine conjugates
WO2017165734A1 (en) 2016-03-25 2017-09-28 Genentech, Inc. Multiplexed total antibody and antibody-conjugated drug quantification assay
EP4273551A2 (en) 2016-03-25 2023-11-08 F. Hoffmann-La Roche AG Multiplexed total antibody and antibody-conjugated drug quantification assay
US10543279B2 (en) 2016-04-29 2020-01-28 Medimmune Limited Pyrrolobenzodiazepine conjugates and their use for the treatment of cancer
WO2017201449A1 (en) 2016-05-20 2017-11-23 Genentech, Inc. Protac antibody conjugates and methods of use
WO2017205741A1 (en) 2016-05-27 2017-11-30 Genentech, Inc. Bioanalytical method for the characterization of site-specific antibody-drug conjugates
WO2017214024A1 (en) 2016-06-06 2017-12-14 Genentech, Inc. Silvestrol antibody-drug conjugates and methods of use
WO2018031662A1 (en) 2016-08-11 2018-02-15 Genentech, Inc. Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof
WO2018065501A1 (en) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Methods for preparing antibody drug conjugates
US10799595B2 (en) 2016-10-14 2020-10-13 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11612665B2 (en) 2017-02-08 2023-03-28 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11160872B2 (en) 2017-02-08 2021-11-02 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
US11813335B2 (en) 2017-02-08 2023-11-14 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11370801B2 (en) 2017-04-18 2022-06-28 Medimmune Limited Pyrrolobenzodiazepine conjugates
US10544223B2 (en) 2017-04-20 2020-01-28 Adc Therapeutics Sa Combination therapy with an anti-axl antibody-drug conjugate
US11318211B2 (en) 2017-06-14 2022-05-03 Adc Therapeutics Sa Dosage regimes for the administration of an anti-CD19 ADC
US11938192B2 (en) 2017-06-14 2024-03-26 Medimmune Limited Dosage regimes for the administration of an anti-CD19 ADC
US11649250B2 (en) 2017-08-18 2023-05-16 Medimmune Limited Pyrrolobenzodiazepine conjugates
WO2019060398A1 (en) 2017-09-20 2019-03-28 Ph Pharma Co., Ltd. ANALOGUES OF THAILANSTATINE
US11352324B2 (en) 2018-03-01 2022-06-07 Medimmune Limited Methods
US11524969B2 (en) 2018-04-12 2022-12-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof as antitumour agents
WO2020049286A1 (en) 2018-09-03 2020-03-12 Femtogenix Limited Polycyclic amides as cytotoxic agents
WO2020086858A1 (en) 2018-10-24 2020-04-30 Genentech, Inc. Conjugated chemical inducers of degradation and methods of use
WO2020123275A1 (en) 2018-12-10 2020-06-18 Genentech, Inc. Photocrosslinking peptides for site specific conjugation to fc-containing proteins
WO2020157491A1 (en) 2019-01-29 2020-08-06 Femtogenix Limited G-a crosslinking cytotoxic agents
US12209099B2 (en) 2019-03-15 2025-01-28 Medimmune Limited Azetidobenzodiazepine dimers and conjugates comprising them for use in the treatment of cancer
WO2022023735A1 (en) 2020-07-28 2022-02-03 Femtogenix Limited Cytotoxic agents
WO2023078273A1 (en) 2021-11-03 2023-05-11 Hangzhou Dac Biotech Co., Ltd. Specific conjugation for an antibody-drug conjugate
WO2024138128A2 (en) 2022-12-23 2024-06-27 Genentech, Inc. Cereblon degrader conjugates, and uses thereof
WO2024220546A2 (en) 2023-04-17 2024-10-24 Peak Bio, Inc. Antibodies and antibody-drug conjugates and methods of use and synthetic processes and intermediates
WO2026006689A2 (en) 2024-06-28 2026-01-02 Firefly Bio, Inc. Bcl-xl degrader antibody conjugates and uses thereof
WO2026006688A2 (en) 2024-06-28 2026-01-02 Firefly Bio, Inc. Degrader antibody conjugates and uses thereof

Also Published As

Publication number Publication date
AU739407B2 (en) 2001-10-11
EP2343085A2 (en) 2011-07-13
EP0981541A4 (en) 2000-03-29
DE69824287D1 (de) 2004-07-08
US6267960B1 (en) 2001-07-31
JP4404381B2 (ja) 2010-01-27
JP2010029209A (ja) 2010-02-12
CA2281877C (en) 2010-01-05
AU6548198A (en) 1998-09-29
EP0981541B1 (en) 2004-06-02
EP1514876B1 (en) 2013-05-08
CA2281877A1 (en) 1998-09-17
JP2008133287A (ja) 2008-06-12
NZ337413A (en) 2003-02-28
AU739407C (en) 2002-08-08
EP0981541A1 (en) 2000-03-01
JP2002511740A (ja) 2002-04-16
EP1514876A3 (en) 2007-06-20
DE69824287T2 (de) 2005-06-16
EP2343085A3 (en) 2011-10-26
ES2221982T3 (es) 2005-01-16
EP2343085B1 (en) 2014-12-10
JP4615007B2 (ja) 2011-01-19
EP1514876A2 (en) 2005-03-16
ATE268340T1 (de) 2004-06-15

Similar Documents

Publication Publication Date Title
AU739407C (en) PSCA: prostate stem cell antigen
US6258939B1 (en) PSCA antibodies and hybridomas producing them
US20080318254A9 (en) PSCA antibodies and hybridomas producing them
CA2351887C (en) Psca: prostate stem cell antigen and uses thereof
US6790939B2 (en) Anti-PSCA antibodies
US6261789B1 (en) Methods for detecting the presence of a PSCA protein using PSCA antibodies
US6960443B2 (en) Methods of detecting prostate stem cell antigen in cancer
AU766669B2 (en) PSCA: prostate stem cell antigen
AU771026B2 (en) PSCA: prostate stem cell antigen and uses thereof
CA2566516C (en) Psca: prostate stem cell antigen and uses thereof
NZ516660A (en) PSCA: Prostate stem cell antigen for diagnosis and treatment of prostate cancer
AU2004200093B8 (en) "PSCA: Prostate Stem Cell Antigen and uses thereof"

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BR CA IL JP KR MX NZ SG

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 65481/98

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2281877

Country of ref document: CA

Ref country code: CA

Ref document number: 2281877

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 337413

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 1998911548

Country of ref document: EP

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1998 539713

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1998911548

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 65481/98

Country of ref document: AU

WWG Wipo information: grant in national office

Ref document number: 1998911548

Country of ref document: EP