WO1998002548A2 - Infectious papillomavirus pseudoviral particles - Google Patents
Infectious papillomavirus pseudoviral particles Download PDFInfo
- Publication number
- WO1998002548A2 WO1998002548A2 PCT/US1997/012115 US9712115W WO9802548A2 WO 1998002548 A2 WO1998002548 A2 WO 1998002548A2 US 9712115 W US9712115 W US 9712115W WO 9802548 A2 WO9802548 A2 WO 9802548A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- papiuomavirus
- cells
- infectious
- gene
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/081—DNA viruses
- C07K16/084—Papillomaviridae (F); Polyomaviridae (F), e.g. SV40, BK virus or JC virus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5258—Virus-like particles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20023—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
- C12N2810/60—Vectors comprising as targeting moiety peptide derived from defined protein from viruses
- C12N2810/6009—Vectors comprising as targeting moiety peptide derived from defined protein from viruses dsDNA viruses
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S977/00—Nanotechnology
- Y10S977/902—Specified use of nanostructure
- Y10S977/904—Specified use of nanostructure for medical, immunological, body treatment, or diagnosis
- Y10S977/915—Therapeutic or pharmaceutical composition
- Y10S977/916—Gene therapy
Definitions
- the field of the invention is related to infectious papiUomavirus pseudoviral particles useful in gene transfer.
- Gene transfer is a laboratory strategy in which the genetic repertoire of eukaryotic cells is modified. Essentially, gene transfer involves the delivery, to target cells, of an expression cassette made up of one or more genes and the sequences controlling their expression. The transfer process is accomplished by delivery of the cassette to the cell where it can function appropriately.
- the first type of delivery system for introducing cloned DNAs into eukaryotic cells involves transfection. Calcium phosphate- or DEAE-dextran- ediated transfection is the most widely used method.
- the polycation Polybrene allows the efficient and stable introduction of plasmid ONAs into cultured cells that are relatively resistant to transfection by other methods (Kawai, S., and Nishizawa, M., 1984, Mol. Cell. Biol. 4, 1 172; Chaney, W.G., et al., 1986, Somatic Cell Mol. Genet. 12, 237).
- Electroporatio ⁇ features the application of electric pulses to mammalian and plant cells so that DNA is taken directly into the cell cytoplasm (Neumann, E., et al., 1982, EMBO J.
- Artificial membrane vesicles such as liposomes and cationic lipids, are useful as delivery vehicles in vitro and in vivo (Mannino, R.J., and Gould-Fogerite, S., 1988, BioTechniques 6, 682; Feigner, P.L., and Holm, M. f 1989, Bethesda Res. Lab. Focus 11, 21; Maurer, R.A., 1989, Bethesda Res. Lab. Focus 11, 25).
- naked DNA can, by itself, be placed into cells by particle bombardment (Yang, N.S., et al., 1990, Proc. Natl. Acad. Sci. USA 87, 9568), or taken up by cells, particularly when injected into muscle (Wolff, J.A., et al., 1990, Science 247, 1465).
- the other type of delivery system is mediated by infection and involves the use of viral expression vectors derived from simian virus 40 (SV40) (Elder, J.T., et al., 1981, Annu. Rev.
- proteins from cloned genes in eukaryotic ceils has been used for a number of different purposes: to confirm the identity of a cloned gene by using immunological or functional assays to detect the encoded protein, to express genes encoding proteins that require posttransiational modifications such as glycosylation or proteolytic processing, to produce large amounts of proteins of biological interest that are normally available in only limited quantity from natural sources, to study the biosynthesis and intracellular transport of proteins following their expression in various cell types, to elucidate structure function relationships by analyzing the properties of normal and mutant proteins, to express intron containing ge ⁇ omic sequences that cannot be transcribed correctly into RNA in prokaryotes, and to identify DNA sequence elements involved in gene expression. Because expression of proteins can serve so many different purposes, there is a need for new delivery systems to meet the challenge of getting foreign DNA into eukaryotic cells. The invention satisfies this need.
- the invention provides an infectious papiUomavirus pseudoviral particle.
- the invention provides a HPV16 ⁇ BPV1 ⁇ vino ⁇
- the invention provides an infectious papiUomavirus pseudoviral particle comprising: a papiUomavirus vector DNA which comprises an E2 binding site and an expression cassette comprising a gene and a sequence controlling expression of the gene; and a papiUomavirus capsid which comprises L1 and L2 structural proteins, such that the capsid encapsidates the vector DNA, where the gene is derived from a first biological species and the L1 structural protein is derived from a second biological species and the first biological species is different from the second biological species.
- the invention provides the here described infectious papiUomavirus pseudoviral particle, where the first biological species is BPV1 and the second biological species is HPV16.
- the invention relates to a method of making infectious papiUomavirus pseudoviral particles comprising: providing a cell line which expresses papiUomavirus E2 DNA binding protein and LI and L2 structural proteins; transforming the cell line with a papiUomavirus vector DNA which comprises an E2 binding site and an expression cassette comprising a gene and a sequence controlling expression of the gene, where the papiUomavirus E2 binding site is a cognate binding site of the E2 DNA binding protein, and where the gene is derived from a first biological species and the L1 structural protein is derived from a second biological species and the first biological species is different from the second biological species; providing conditions for the encapsidation of the vect ⁇ r DNA by a capsid which comprises the L1 and L2
- the cell line may be a mammalian cell line, an insect cell line, or a yeast cell line.
- the invention relates to a cell line comprising the here-described infectious papiUomavirus pseudoviral particle.
- the invention relates to a method of transferring a gene into a cultured mammalian cell comprising: providing the here-described infectious papiUomavirus pseudoviral particle; and infecting a cultured mammalian cell with the particle such that the cultured mammalian cell is transformed with the gene.
- the invention provides a method of screening for infectious papiUomavirus pseudoviral particles comprising administering test particles to cultured mammalian cells capable of being infected thereby and scoring for infectivity thereof.
- the invention provides a composition comprising the here-described infectious papiUomavirus pseudoviral particle, where the gene in the expression cassette encodes a product capable of having a therapeutic effect when administered in a therapeutically effective amount to a host subject in need thereof.
- the invention provides a composition comprising the here-described infectious papiUomavirus pseudoviral particle, where the gene in the expression cassette encodes a product capable of having an immunogenic effect when administered in an immunoge ⁇ ically effective amount to a host subject in need thereof.
- the invention also relates to a method of providing a human with an immunogenic protein comprising: infecting cells of the human in vivo with the here-described infectious papiUomavirus pseudoviral particle, where the gene in the expression cassette encodes the immunogenic protein, the cells expressing an immunoge ⁇ ically effective amount of the immunogenic protein.
- the invention further relates to a method of providing a human with a therapeutic protein comprising: infecting cells of the human in vivo with the here-described infectious papiUomavirus pseudoviral particle, where the gene in the expression cassette encodes the therapeutic protein, the cells expressing a therapeutically effective amount of the therapeutic protein.
- the cells may be epithelial cells, and the therapeutic protein may have a systemic effect.
- the therapeutic protein may have a local effect on the epithelial cells.
- the therapeutic protein may be Factor
- the expression of the therapeutic protein may result in treatment of hemophilia.
- the therapeutic protein may be herpes simplex virus thymidine kinase and the expression of the therapeutic protein may result in treatment of skin cancer.
- This method may involve serial administration of different serotypes and thus comprise infecting cells of the human in vivo with a second infectious papiUomavirus pseudoviral particle where the second infectious papiUomavirus pseudoviral particle differs from the first infectious papiUomavirus pseudoviral particle in that the second is a different serotype from the first.
- the invention additionally relates to an infectious papiUomavirus pseudoviral particle comprising a papiUomavirus genome, which comprises an E2 binding site and an expression cassette comprising a gene and a sequence controlling expression of the gene, and a papiUomavirus capsid, which comprises L1 and L2 structural proteins, such that the capsid encapsidates the genome, where the E2 binding site is derived from a first papiUomavirus serotype and the L1 structural protein is derived from a second papiUomavirus serotype and the first papiUomavirus serotype is different from the second papiUomavirus serotype.
- the invention moreover relates to a method of making infectious virus pseudoviral virions in nonmammalian cells comprising: providing a nonmammalian cell line which expresses the ⁇ onstructural protein(s) of the virus for packaging the viral genome of the virus in the empty capsid of the virus, and which expresses the structural proteins of the virus capsid; transforming the cell line with the viral genome which comprises the packaging signal, and which further comprises an expression cassette comprising a gene and a sequence controlling expression of the gene, and where the gene is derived from a first biological species and the viral capsid is derived from a second biological species and the first biological species is different from the second biological species; providing conditions for the e ⁇ capsidation of the viral genome by the viral capsid to generate the virions; and harvesting the virions.
- the invention satisfies the need for new delivery systems to meet the challenge of getting cloned DNA into eukaryotic cells by providing infectious papiUomavirus pseudoviral particles.
- Section I describes in vitro generation of infectious BPV virions and infectious HPV16 ⁇ BPV1 ⁇ pseudoviral particles in mammalian cells.
- Section II elaborates the requirements for the papiUomavirus capsid proteins, the viral transcription/replication protein, E2, and POD nuclear structures for encapsidatio ⁇ .
- Section III details the in vitro generation of infectious BPV virions in nonmammalian cells.
- Section IV describes the use of infectious papiUomavirus pseudoviral particles in a specialized case of gene transfer, that of gene therapy and gene immunization.
- Example 2 Using the protocol described in Example 1, a system was developed for generating infectious papillomaviruses in vitro that facilitates the analysis of papiUomavirus assembly and infectivity.
- Cultured hamster BPHE-1 cells harboring autonomously replicating bovine papiUomavirus type 1 (BP 1) genomes were infected with defective Semliki Forest Viruses (SFVs) that express the structural proteins of BPV1.
- SFVs Semliki Forest Viruses
- BPV L1 expressed from recombinant SFV in mammalian cells binds L2 and assembles into VLPs.
- SFV is a simple positive strand RNA virus.
- the pSFV-1 expression vector contains the gene for the SFV RNA replicase, the inserted gene and a cis acting virion packaging signal.
- In vitro synthesized RNA from this vector is co-transfected with a helper vector (pHelper-2) RNA that encodes the SFV structural genes. Upon transfection, the replicase is translated and initiates successive rounds of RNA replication and translation, thereby amplifying the viral RNAs.
- helper vector helper vector
- helper RNA Translation of the helper RNA leads to production of the SFV virion proteins and encapsidation of the expression vector RNA, but not that of the helper, which lacks the packaging signal. Therefore, the high titer virus generated is defective because it does not encode the SFV virion proteins.
- susceptible cells e.g., BHK-21 or BPHE-1
- the replicase again amplifies the infecting RNA. Amplification of subgenomic RNAs encoding the cloned gene leads to high level expression of the encoded protein.
- BPV-BL1 and BPV1 L2 recombinant Semliki Forest Viruses were generated by co-transfecting BHK-21 cells with in vitro transcribed Helper- 2 RNA (Life Technologies) (Berglund, P., et al., 1993, BioTechnology 11, 916-920) and a recombinant pSFV-1 RNA encoding the BPV1 L1 or BPV1 L2 gene. BHK-21 cells were infected with the recombinant SFVs and harvested 72h later.
- BPV1 L1 and L2 were demonstrated by Western blot analysis with monoclonal antibody 1H8 (Chemicon) (Cowsert, L. ., et al., 1988, Virology 165, 613-15)) for L1 and rabbit antiserum to a bacterially-produced glutathione-S transferase-BPVI L2 fusion protein for L2 (Kirnbauer, R., et al., 1992, Proc. Natl. Acad. Sci. USA 89, 12180-84). Cell fractionation studies demonstrated that at least 80% of both L1 and L2 resided in the nuclear fraction at the time of harvest.
- BHK-21 cells were infected for 3 days with either SFV-BL1 alone or SFV-BL2 alone or were co-infected with the two defective viruses.
- the cells were harvested and VLPs were prepared by ce ⁇ trifugation through a 40% (w/v) sucrose cushion and cesium chloride isopyc ⁇ ic density gradient centrifugation (Kirnbauer, R., et al., 1993, J. Virol. 67, 6929-36).
- a visible band with a density of approximately 1.28 g/cm was extracted from cesium chloride density gradients of the SFV-BL1 alone and SFV-BL1 plus SFV-BL2 infected cell extract and dialysed into PBS containing 0.5 M NaCI.
- L2 Full length ( ⁇ 70kDa) L2 was detected by Western blot analysis with rabbit antiserum to bacterially expressed glutathione-S transferase-BPVI L2 fusion protein in the L1 plus L2, but not the L1 alone, preparation. Co-immu ⁇ oprecipitation and co-purification of L1 and L2 showed that L2 co-assembled with L1 into VLPs. Infectious BPV1 virions are generated by co-expression of both BPV1 L1 and L2 in BPHE-1 cells.
- SFV recombinant SFVs Since expression of the recombinant SFVs led to efficient assembly of VLPs in mammalian cells, generation of infectious BPV in vitro and determination of which capsid proteins were required for virion formation was attempted. To this end, the SFV recombinants were used to infect a hamster cell line, BPHE-1 , that maintains 50-200 copies of episomal BPV1 genomes per cell (Zhang, Y. L., et al., 1987, J. Virol. 61, 2924-2928). The BPHE-1 cells were infected with either SFV-BL1 alone or SFV-BL2 alone or co-infected with the two recombinant viruses.
- BPHE-1 hamster cell line
- the cells were maintained for 30h, harvested and lysed by sonication, and the extracts were incubated in the medium of monolayers of mouse C127 fibroblasts for 1h at 37°C.
- the cells were washed and maintained for 3 weeks in complete medium and stained, and the foci were counted (Dvoretzky, I., et al., 1980, Virology 103, 369-375).
- BPV DNA was transferred to the C127 cells by transfection rather than infection by in vitro generated virions. Since neutralizing antibodies should not inhibit transfection, extracts from the LI and L2 co-expressing BPHE-1 cells were incubated for In at 4°C in the presence of a 1:100 dilution (10 ⁇ ) of rabbit antiserum to either BPV1 or HPV16 L1 VLPs (purified from insect cells) or denatured BPV virions (DAKO) prior to addition to the C127 cells.
- a 1:100 dilution (10 ⁇ ) of rabbit antiserum to either BPV1 or HPV16 L1 VLPs (purified from insect cells) or denatured BPV virions (DAKO) prior to addition to the C127 cells.
- L2 is required for efficient encapsidation of the BPV genome. LI assembles into VLPs when expressed in eukaryotic cells, but the function of L2 in generating infectious virus is less clear (Kirnbauer, R., et al., 1992, Proc. Natl. Acad. Sci. USA 89, 12180-84). L2 may be necessary for some step during the infectious process and/or is necessary for encapsidation of the genome (Zhou, J., et al., 1993, J. Gen. Virol. 74, 763-68).
- BPHE-1 cells were infected with SFV-L1 alone or SFV-L2 alone or were co-infected with SFV-L1 and SFV-L2.
- the cells were harvested 30h post infection, sonicated and treated with DNAsel (2000 U) for 1h at 37°C, and particles were purified.
- the cesium chloride gradients were fractionated, and the density of each fraction measured.
- Nucleic acid was purified from 200 ⁇ of each fraction, and BPV DNA was detected by Southern blot analysis.
- BPV-pML plasmid DNA 0.1 ng was run as a size standard for uncut, DNAsel-resistant BPV genomes (Sarver, N., et al., 1982, Proc. Natl. Acad. Sci. USA 79, 7147-7151 ). Only that fraction from the BPHE-1 extracts expressing both L1 and L2 demonstrated significant accumulation of DNAsel-resistant BPV DNA. This fraction had a density (1.31 g/ml) consistent with that of infectious BPV virions obtained from warts under the same conditions (1.32 g/ml). This fraction was examined by cryo-electron microscopy.
- cryo-electron microscopy allows the DNA inside the full capsids to be visualized directly as an electron dense core as opposed to the lower density core of empty particles. Many well formed particles were observed with electron dense cores, as well as a smaller fraction that had a lower density core or were damaged or rod shaped. It was not possible to estimate the number or percentage of full versus empty particles, as the L1 was spread over a large number of fractions as determined by Western blot analysis. However, comparative Southern blot analysis using the cloned BPV genome as a standard indicated that approximately 1 ng of full length DNAsel-resistant DNA was observed in these extracts, which corresponds to approximately 10 DNA molecules.
- L1 and L2 derived from a wild type HPV16 isolate (114K) were cloned into SFV vectors and expressed in BPHE-1 cells (Heino, P., et al., 1996, Virology 214, 349-359; Kirnbauer, R., et al., 1993, J. Virol. 67, 6929-36). Expression was confirmed by Western blot analysis using monoclonal antibody CamVir-1 (Pharmi ⁇ gen) for L1 and rabbit antiserum to bacteriall ⁇ expressed glutathione-S-transferase-HPV16 L2 fusion protein for L2. Production of infectious virions was assessed using the C127 focus forming assay, as described above.
- Type-specific neutralization of pseudotyped virions Treatment of the HPV16 ⁇ BPV1 ⁇ extracts with 5 or 50 ⁇ of rabbit antiserum to 1 14K HPV16 VLPs prevented focus formation, whereas addition of antiserum to BPV1 VLPs, denatured BPV virions, or assembly deficient HPV16 L1 of the prototype strain did not prevent focus formation. Both antiserum to HPV16 LI alone and antiserum to L1/L2 VLPs were neutralizing. Antiserum generated to the L1 VLPs of a divergent Zairian isolate of HPV16 also neutralized the HPV16 ⁇ BPV1 ⁇ virions (Cheng, G., et al., 1995, J Infect Dis. 172, 1584 1587). This finding demonstrates that infectious virus with HPV16 capsids, not BPV capsids, were produced and that infection of the C127 cells and not transfection by the BPV DNA had occurred
- raft cultures of human keratinocytes can undergo relatively normal terminal differentiation, thereby permitting expression of the late proteins and virion biosynthesis (Dollard, S.C., et al., 1992, Genes Dev 6, 1131 42; Meyers, C , et al , 1992, Science 257, 971 73)
- Small quantities of morphologically correct HPV31 b virions have been produced by this method, but no quantitative infectivity assay has been developed using this system (Meyers, C , et al , 1992, Science 257, 971 73)
- neither the xenografts nor raft cultures are readily amenable to genetic manipulation
- infectious papiUomavirus have been produced by expressing the virion capsid proteins in trans, via defective SFV vectors, in cells that contain an intact viral genome
- Production of infectious BPV was monitored by a standard, quantitative, in vitro BPV infectivity assay (Dvoretzky, I., et al., 1980, Virology 103, 369 375).
- BPV induced focal transformation of C127 cells was specifically inhibited by incubating infectious preparations with neutralizing BPV-antisera, which confirmed that the transformation resulted from BPV infection and not from transfection of viral DNA.
- This method of virus production provides the opportunity to determine the functions of the virion proteins in virion formation and to generate virions with specific modifications
- L1 alone or L2 alone demonstrates that L2 is required for encapsidation of the BPV genome.
- the ability of L1 and L2 derived from HPV16 to encapsidate the BPV genome establishes that any viral DNA packaging signal that exists for papiUomavirus genomes is conserved between BPV1 and HPV16, and that, because
- BPV1 and HPV16 are so highly evolutionarily divergent, such a signal is moreover conserved among papillomaviruses.
- HPV16 LI and L2 in cells containing the BPV genome produced infectious pseudotyped virions with HPV16 capsids. They induced typical BPV type foci, and their infectivity was neutralized by HPV16 antisera and not by BPV antisera. Since HPV16 is not more closely related to BPV1 than are other high risk HPV types, it is expected that a strategy similar to the one reported here for HPV16 can be used to generate infectious pseudotypes for other high risk HPVs, and presumably for any papiUomavirus. See Example 4.
- focal transformation assay requires 2 to 3 weeks, this problem should in principle be circumvented by incorporation of a rapid and easily detectable marker in the BPV genome.
- HVP16 ⁇ BPV1 ⁇ virions to induce focal transformation of C127 cells establishes that C127 cells express the cell surface receptor for HPV16 virions and are competent to perform the subsequent steps of internalization and uncoating that are required for initiating viral infection.
- the simplest interpretation of these observations is that BPV and HPV 16 share a common intracellular pathway of infection as well as a common cell surface receptor.
- HPV16 ⁇ BPV1 ⁇ pseudotyped virus has allowed, for the first time, the development of an antibody neutralization assay for HPV16 and other high risk HPVs, since there is neither a source of infectious HPV16 or other high risk HPVs, nor an easily scored quantitative assay for the genome of HPV16 or other high risk HPVs.
- Titers of neutralizing antibodies induced by vaccination are the best correlate of protection for most previously developed prophylactic vaccines (Robbins, J.B., et al., 1995, J. Infect. Dis. 171, 1387-98), as also seems true for the animal papiUomavirus protection studies (Breitburd, F., et al., 1995, J Virol.
- VLP ELISA is relatively non-stringent because it may recognize non-neutralizing antibodies, while hemagglutination may be overly stringent because a class of neutralizing antibodies (defined for BPV, CRPV and HPV11 ) does not score in that assay (Roden, R.B.S., et al., 1996, J. Virol. 70, 3298-3301). It is no longer necessary to rely on these surrogate assays for neutralization since presented with the described quantitative in vitro neutralization assay. See Example 5.
- the assembly-deficient mutant L1 of the reference HPV16 strain did not induce detectable neutralizing antibodies, reinforcing the concept that most neutralizing epitopes are displayed only on intact particles.
- the observation that antibodies to a divergent assembly-competent variant (Zaire 1194 (Cheng, G Representative et al., 1995, J. of Infect. Dis. 172, 1584-1587)), which differs from the 114/K HPV16 isolate at seven L1 amino acids, can efficiently neutralize the HPV16 ⁇ BPV1 ⁇ virions made with the 1 14/K isolate further suggests that VLPs of a single HPV16 variant will induce protection against divergent HPV16 variants (Cheng, G submit et al., 1995, J. of Infect. Dis.
- HPV16 ⁇ BPV1 ⁇ neutralization assay 70, 3298-3301; therefore the negative results in the HPV16 ⁇ BPV1 ⁇ neutralization assay were not due to a poor antibody response to these VLPs.
- L2 has been shown here to be essential for the generation of infectious BPV
- the current results provide evidence for a role for L2 in the organization of virion components by recruiting them to a distinct nuclear domain
- This L2 dependent colocalization probably serves as a mechanism to promote assembly of papillomaviruses either by increasing the local concentration of virion constituents or by providing the physical architecture necessary for efficient packaging and assembly.
- the data also establish a role for a nonstructural viral protein, E2, which binds a conserved sequence motif in papiUomavirus genomes, in the localization of the viral genome to the PODs.
- BPHE 1 is a hamster fibroblast cell line that is latently infected with multiple copies of autonomously replicating BPV genomes and expresses the nonstructural viral proteins (Zhang, Y L , et al., 1987, J. Virol. 61, 2924-2928)
- the SFV expression system was used to introduce the L2 minor capsid protein into BPHE 1 cells and localize the L2 protein by immunofluorescent staining and laser scanning confocal microscopy.
- the typical distribution of L2 6 hours after SFV infection indicates the protein was displayed in a distinct intranuclear punctate pattern To rule out the possibility that this distribution depended upon the BPV components in the BPHE 1 cells,
- L2 was expressed, via the SFV vector, in cells that did not harbor papiUomavirus sequences. A similar punctate nuclear pattern of L2 staining was also observed in these other cells types, including COS 7, BHK 21 and the human fibroblast cell line 1634. Therefore, this distinct L2 localization is dependent only upon cellular factors and appears to be independent of cell lineage To determine if this localization was a common feature of papiUomavirus L2, the distribution of the human papiUomavirus 16 (HPV16) L2 protein, expressed via an SFV vector, was also examined in these cell lines. The pattern with HPV16 L2 protein was similar to that seen with BPV L2, establishing that this localization is characteristic of papiUomavirus L2.
- L2 containing punctate structures are PODs.
- double staining experiments against a number of described nuclear proteins and L2 were performed. No colocalization of the L2 protein was found with coiled bodies, the retinoblastoma protein, p53 or the splicing factor SC35 Although the staining pattern seen with the ant ⁇ -SC35 antibody was similar to that seen with the anti L2 antibody, it was evident from the merged image that these regions were exclusive. However, when the distribution of the L2 protein was compared with that of anti-promyelocytic leukemia (PML) protein staining, a nearly complete overlap in protein distribution was observed.
- the PML protein is a putative growth suppressor gene product that localizes in subnuclear organelles termed
- L1 might display a nuclear staining pattern similar to L2.
- L1 was present in a nuclear pattern that varied from a diffuse to slightly speckled arrangement with nucleolar exclusion. This result led to the exploration of the possibility that the subcellular distribution of LI protein might be affected by coexpression of L2. Therefore, BPHE-1 cells were coinfected with recombinant L1 SFV and recombinant L2 SFV, which are the conditions that lead to the formation of infectious BPV in BPHE-1 cells.
- the L1 staining pattern was dramatically altered from the diffuse nuclear pattern seen after L1 SFV infection alone.
- L2 staining pattern in the coinfected cells was consistent with the distribution of L2 observed in the absence of L1.
- LI did not appear as tightly coalesced as L2.
- L1 was observed mostly surrounding, rather than overlapping, the L2 domain. This variability may be due to differences in the kinetics of the infection of individual cells or may reflect intermediate stages in L1 relocation.
- L2 induced the redirection of a substantial proportion of L1 to PODs.
- L2 induces colocalization of E2.
- L2 is sufficient to redistribute full-length E2.
- BPV-transformed cells with autonomously replicating genomes express three forms of the E2 protein: a full-length 48 kD form that functions in genome replication and transcriptional transactivation and two smaller forms which act as repressers of viral transcription (Hubbert, N.L., et al., 1988, Proc. Natl. Acad. Sci. USA. 85, 5864-5868; Lambert, P.F., J. Virol. 63, 3151-3154; McBride, A.A., et al., 1991 , J. Biol. Chem. 266, 18411-18414).
- the antibody used in the immunofluorescent studies recognizes an epitope in the C-terminal DNA binding domain common to all three proteins and would not distinguish among them.
- Another feature of the BPHE-1 cells is that an unknown proportion of E2 molecules are bound to the viral genome. Therefore, it was unclear whether the L2-dependent redistribution of E2 in the BPHE-1 might depend on the presence of the viral genome in the cells.
- BHK-21 cells which do not contain the papiUomavirus genome
- BHK-21 cells which do not contain the papiUomavirus genome
- BHK-21 cells were infected with an El recombinant SFV, which resulted in clear immunostaining in a speckled nuclear pattern, while uninfected cells were negative.
- Coinfection with the L2 and E1 recombinant SFVs resulted in the typical punctate L2 staining pattern, but this expression did not alter the E1 pattern in the coinfected cells. Therefore, the L2 protein does not directly induce a redistribution of E1.
- Distribution of the viral genome is altered by L2 expression. It has been estimated that each BPHE-1 nucleus contains 50-200 autonomously replicating copies of the BPV genome (Zhang, Y.-L, et al., 1987, J. Virol. 61 , 2924-2928). To determine if expression of the BPV virion proteins might influence the distribution of the BPV genome, FISH analysis was performed on BPHE-1 cells that were infected with LI or L2 recombinant SFV. A f luorescein labeled PCR probe was generated to the upstream regulatory region of the genome and hybridized in situ after DNA denaturation.
- the minor capsid protein L2 has been found to possess the intrinsic capacity to localize to PODs in the absence of other viral components. Further, the presence of L2 in PODs is associated with the recruitment of the major capsid protein L1, the nonstructural protein E2, as well as the viral genome. It is therefore attractive to speculate that PODs are the main structure in which papillomaviruses assemble.
- PODs are interchromati ⁇ ic matrix-bound nuclear bodies with average diameters of 0.3 mm to 0.5 mm in most cells.
- the cellular function(s) of PODs is largely unknown (Ascoli, C, and Maul, 6.J., 1991 , J. Cell. Biol. 112, 785-795; Grande, M.A., et al., 1996, J. Cell. Bioche . 63, 280-91 ). They have also been designated Kr bodies or nuclear domain 10 (ND10) based on the average number of bodies per cell, although their number actually varies and may be higher in transformed cells (Ascoli, C, and Maul, 6.J., 1991, J. Cell. Biol. 112, 785-795; Lamond, A.
- PODs may be required for normal maturation of myeloid cells, as their fragmentation is often seen in acute promyelocytic leukemia (Dyck, J.A., et al., 1994, Cell 76, 333-43).
- PODs Disruption of PODs in this leukemia is associated with heterodi er formation between the normal PML protein and a PML-retinoic acid receptor a (PML-RARa) fusion protein that results from a characteristic t(15;17) chromosomal translocation (de The, H., et al., 1990, Nature 347, 558-561; de The, H., et al., 1991 , Nature 347, 558-561, Kakizuka, A., et al., 1991 , Cell 66, 663-674).
- PODs contain at least 6 other proteins.
- SP100 protein which was originally identified as an autoantigen in patients with primary biliary cirrhosis, lnt-6, the PIC-1 protein, as well as 52 kD (NP52), 55 kD (NDP55), and 65 kD proteins (Ascoli, C, and Maul, G.J., 1991, J. Cell. Biol. 112, 785-795; Boddy, M.N., et al., 1996, Oncogene 13, 971-982; Desbois, C, et al., 1996, Science 273, 951-53; Epstein, A.L, 1984, J. Virol. 50, 372-379; Szostecki, D., et al., 1990, J. Immunol. 145, 4338- 4347).
- HSV-1 herpes simplex virus 1
- Ad- 5 ade ⁇ ovirus 5
- SV40 simian virus 40
- POD association may be a cellular mechanism that has evolved to limit initial virus replication (Ishov, A.M., and Maul, G.G., 1996, J. Cell. Biol. 134:815-826).
- Ad-5 E4-0RF3 and HSV-1 ICPO encode proteins that disrupt PODs as infection proceeds has been taken as evidence supporting this possibility (Doucas, V., et al., 1996, Genes Dev. 10, 196-207; Everett, R.O., and Maul, G.G., 1994, EMBO J.
- POD association may possibly play a positive role in viral replication. This localization might: 1 ) increase local concentration of viral products and so promote assembly, 2) interfere with normal differentiation and/or apoptotic responses to the viruses in the epithelial cells that are their usual sites of initial replication, 3) facilitate access to cellular transcription and/or replication factors (although there is little evidence that PODs possess these functions), 4) promote essential processing of viral products. In the latter regard, it is interesting that a ubiquitin-dependent protease has recently been shown to be POD associated (Boddy, M.N., et al., 1996, Oncogene 13, 971-982).
- the recruitment to PODs is likely to represent an important feature that distinguishes productive from latent papiUomavirus infection. It is possible that the POD-binding proteins HSV-1 ICPO and EBV EBNA-5, which have been implicated in the escape from latency, may serve an analogous function for their respective viruses.
- the results of this study suggest the following model for the productive phase of the papiUomavirus life cycle (Figure 1). The productive cycle begins when L1 and L2 expression is induced by differentiation specific signals in the infected epithelial cells (Dollard, S.C., et al., 1992, Genes Dev. 6, 1 131 -42; Meyers, C, et al., 1992, Science 257, 971-73).
- SFV-mediated expression of these two genes substitutes for this induced expression in the present system and demonstrates that differentiation per se is not required for virus production.
- Virus assembly appears to be triggered by the association of L2 with PODs and the colocalization of L1. It is likely that L1 association with the PODs is the result of a direct interaction of L1 with L2, as stable L1/L2 complexes form in both fully assembled VLPs in vivo and also in partially assembled viral capsid structures, including L1 pentamers, in vitro.
- L1 can self-assemble into VLPs in the absence of L2 (Kirnbauer, R render et al., 1992, Proc. Natl. Acad. Sci. USA.
- L2 increases VLP production 4-fold in insect cells and 100 fold in mammalian cells (Hage ⁇ see, M.E., et al., 1993, J. Virol. 67, 315-22; Kirnbauer, R., et al., 1993, J. Virol. 67, 6929-36; Zhou, J., et al., 1993, J. Gen. Virol. 74, 763-68).
- This greater efficiency could be the result of an increased rate of capsid assembly as a consequence of the L2-mediated concentration of L1 at the PODs.
- L1 protein was predominately located around the perimeter of the L2 domains rather than overlapping them. These variations may reflect temporal differences in the SFV infection of individual cells, since all infections appeared to show a mixture of the two patterns. It is likely that a variety of L1 assembly states was detected with the anti-Li antibody employed here. In vitro, the antibody recognizes pentameric L1 as well as intact virions. It is possible that the LI detected around the POD perimeter is due to mature virions that have been released from the sites of assembly and show a diminished reactivity with the anti-L2 antibody. Alternatively, the peripheral anti-L1 staining could be due to LI pentamers in the process of assembling with L2. L2 also induced the redistribution of E2. The experiments in the BHK-21 cells clearly demonstrated that
- E2 association with the PODs is L2 dependent, but is independent of L1, other early papiUomavirus gene products, or the viral genome.
- E2 interacts directly with L2.
- soluble E2-L2 complexes have not been detected in vivo or in vitro.
- E2 avidly binds multiple sites on the viral genome (Androphy, A.J., et al., 1987, Nature 325, 70-73; Li, R., et al., 1989, Genes Dev. 3, 510-526). Since it has not been possible to detect E2 in infectious BPV virions extracted from cattle warts, E2 is visualized as acting catalytically in the process of vi ⁇ o ⁇ assembly. SV40 T antigen, which is a nonstructural protein of that virus, may be functionally analogous to E2 in this regard.
- T antigen is a viral genome binding transcription/replication factor that associates with PODs, but does not cause their disruption (Jiang, W.Q., et al., 1996, Exp. Cell. Res. 229, 289-300).
- a signal on the SV40 viral genome that is required for its packaging into virions has been mapped to a segment on the viral DNA that includes the T antigen binding sites (Oppenheim, A., 1992, J. Virol. 66,5320 5328) III.
- infectious BPV has been obtained in Sf9 insect cells by transfecti ⁇ g the cells with full length circular BPV DNA and infecting them with baculoviruses expressing various combinations of BPV proteins.
- focal transformation on C127 cells was not obtained if cells infected with L1 + L2 and E2 baculoviruses had been transfected with the BPVpML plasmid (which contains the bacterial pML-2d plasmid inserted within the BPV genome), rather than the isolated religated BPV genome
- focal transformation of C127 cells could be prevented if the infectious extract from the LI , L2, and E2 baculovirus infected Sf9 cells was incubated with a neutralizing anti-BPV serum
- E2 is a viral transcription/replication regulator.
- the BPV full length E2 gene encodes a protein that functions as a di er that binds to sequences present in multiple copies in the upstream regulatory region (URR) of all papillomaviruses (Turek, L., 1994, Adv. Virus Res. 44, 305-356).
- URR upstream regulatory region
- the E2 protein has been shown to stimulate viral RNA synthesis and viral DNA synthesis. Both of these activities depend upon the binding of E2 to its cognate binding sites (E2BS) in the URR, while viral DNA replication requires the viral E1 gene in addition to E2 protein (Chiang, C.-M., et al., 1992, Proc. Natl. Acad. Sci.
- Exogenous E2 does not stimulate BPV DNA synthesis.
- BPV E1, E2, L1 and L2 were expressed from recombinant baculoviruses separately and in combination in BPV DNA transfected Sf9 cells. After 3 days the cells were harvested, and Hirt extracts prepared (Hirt, B., 1967, J. Mol. Biol. 26, 365-369). The development of resistance to digestion by Dpn I was used to assay for BPV DNA replication in the Sf9 cells.
- the extrachromosomal DNA was digested with excess Dpn I, separated on a 1 % agarose gel, and Southern blotted.
- the presence of BPV DNA was detected with a [ Pj-labeled probe generated by random priming from the Spe l-Kpn I fragment of BPV DNA. No evidence of Dpn I resistant BPV DNA was observed (to a sensitivity of 1 ng of DNA per sample). These results indicate that viral replication had not occurred in the insect cells in the presence of E1, or E2, or both proteins. Therefore E2 is not required in BPV DNA transfected Sf9 cells to replicate the BPV genome for packaging.
- E2 does not increase the amount of BPV L1 or L2. Having ruled out that E2 was stimulating expression of a nonstructural viral gene or fostering the replication of BPV DNA in the Sf9 cells, the question was asked whether E2 expression might be increasing the amount of L1 or L2 to a level critical for virion assembly. To address this possibility, Western blot analysis was used to assess the levels of L1 and L2 in BPV DNA transfected Sf9 cells that had been infected with recombinant baculoviruses expressing L1, L2 and E2 in all combinations and maintained for 3 days. E2 did not increase the level of capsid gene expression; rather, increasing the number of different baculoviruses used for each infection of a plate of BPV-transfected Sf9 cells tended to decrease gene expression from each.
- infectious BPV can be obtained if the BPV DNA genome is introduced into cells, and the cells are infected with baculoviruses expressing an appropriate combination of BPV proteins. It is expected that a similar approach for other papillomaviruses, including HPV, will also produce infectious virus of that serotype. It is also expected that this approach will be successful for other nonmammalian systems, including yeast, in which expression of structural viral proteins leads to self assembly of properly folded viral capsids (Sasagawa, T , et al., 1995, Virology 206, 126 35).
- E2 has a different role, which is that of mediating encapsidation of the BPV genome by structural viral proteins
- E2 dimers when bound to their cognate E2 binding sites in the viral genome form a complex that associates with the viral capsid as it is being formed into fully assembled particles
- Presumably some aspect of the E2 DNA complex recognizes the assembling viral capsid in a manner that fosters encapsidation of the viral DNA.
- E2 might be incorporated into the viral capsid along with the viral genome.
- encapsidation of the viral DNA might lead to the release of E2, in which case it might be re-used to assist in the encapsidation of other viral DNA genomes.
- This latter possibility is favored, as the examination of infectious BPV from bovine warts has thus far failed to detect E2 (at a sensitivity of 1 E2 molecule per 10 virions).
- the key feature of this model is that it provides specificity for genome encapsidation through the well documented high affinity binding of E2 to viral DNA sequences. It is expected that all papillomaviruses encapsidate their genomes via this mechanism. The results showing that L2 can recruit E2 and the viral genome to PODs are consistent with this model.
- the ability to pseudotype the BPV genome with HPV16 L1 and L2 in mammalian ceils establishes that the mechanism of encapsidation is conserved among papillomaviruses Furthermore, the model, in which a nonstructural DNA binding protein brings viral DNA to the developing virion, may apply to other viruses as well. In most instances, the DNA binding protein (or RNA binding protein for RNA viruses) will be virally encoded. However, there could be viruses in which the DNA binding protein is cell encoded See Example 6.
- encapsidation of a DNA by papiUomavirus machinery requires that the DNA contain the E2BS This means that any DNA sequence, such as a gene and a preferred regulatory element, can be encapsidated as a papiUomavirus pseudotype so long as it contains the E2BS. Determination of the rules regarding the number and location of E2BS, and whether the E2BS-conta ⁇ n ⁇ ng DNA must also be episomal, circular, and approximately 8 kb, is empirical.
- PapiUomavirus pseudotypes can be made in mammalian cells (Section I). Given the success in making infectious BPV in insect cells (Section III), it is expected additionally to be possible to make papiUomavirus pseudotypes in insect cells, providing the cells express E2, L1 and L2. Since L1 and L1/L2 virus-like particles have been made in yeast (Sasagawa, T., et al., 1995, Virology 206, 126-35), and E2 has been shown to function as an E2BS dependent transcription factor here (Lambert, P., et al., 1989, Genes Dev. 3, 38-48; Morrissey, L., et al., 1989, J. Virol.
- papiUomavirus pseudotypes in yeast, with the requirements in yeast being similar to those in insect and, presumably, mammalian cells.
- Addition of a DNA replication origin that functions in yeast or insect cells may increase infectious virus production in the homologous system.
- virus-like particles have now been expressed in bacteria (Nardelli-Haefliger et al., 1-6 Dec. 1996, 15 Intl.
- papiUomavirus Workshop which finding raises the expectation that papiUomavirus pseutotypes can be made in bacteria that are engineered to operably encode E2, L1 and L2 genes. Taken together, these properties may make it relatively inexpensive to produce papiUomavirus pseudotypes.
- E2 with the other viral components, L1, L2, and E2BS-co ⁇ taining DNA, provides the start of an assay to determine the requirements for in vitro packaging of viral DNA. Efficient packaging may also require cellular components or structures, such as those present in PODs, a fact that would be established empirically.
- papiUomavirus pseudotypes should be infectious for a wide variety of cells, they are expected to have broad application in gene transfer.
- gene transfer in the context of gene therapy and gene immunization is a clinical strategy in which the genetic repertoire of somatic cells is modified for therapeutic or immunogenic purposes.
- gene transfer also involves the delivery, to target cells, of an expression cassette made up of one or more genes and the sequences controlling their expression. This can be carried out ex vivo in a procedure in which the cassette is transferred to cells in the laboratory and the modified cells are then administered to the recipient.
- gene transfer can be done in vivo, in a procedure in which the expression cassette is transferred directly to cells within an individual. In both strategies, the transfer process is usually aided by a vector that delivers the cassette to the cell where it can function appropriately.
- Retrovirus vectors can accommodate up to 9 kb of exogenous information. Retroviruses transfer their genetic information into the genome of the target cell. This is an advantage when treating hereditary and chronic disorders, but it has risks, including the potential for toxicity associated with chronic overexpression or insertional mutagenesis.
- the use of retrovirus vectors is limited by the sensitivity of the vector to inactivation, by the fact that target cells must proliferate in order to integrate the proviral DNA into the genome, and by production problems associated with recombination, rearrangements, and low titers.
- Adenovirus vectors in current use accommodate expression cassettes up to 7.5 kb.
- Adenovirus vectors are well suited for transfer applications because they can be produced in high titers and they efficiently transfer genes to nonreplicati ⁇ g and replicating cells.
- the transferred genetic information remains extrachromosomaf, thus avoiding the risks of permanently altering the cellular genotype or of insertional mutagenesis.
- adenovirus vectors in current use evoke nonspecific inflammation and antivector immunity. These responses, together with the extrachromoso al position of the expression cassette, limit the duration of expression to periods ranging from weeks to months. Thus adenovirus vectors will have to be readministered periodically to maintain their persistent expression. Although it is unlikely that repeat administration will be risky, it is not known whether antibodies directed against vector capsid proteins will limit the efficacy of repetitive administration of these vectors.
- plasmid-liposome complexes have many advantages as gene transfer vectors, in that they can be used to transfer expression cassettes of essentially unlimited size, cannot replicate or recombine to form an infectious agent, and may evoke fewer inflammatory or immune responses because they lack proteins.
- the disadvantage of these vectors is that they are inefficient, requiring that thousands of plasmids be presented to the target cell in order to achieve successful gene transfer.
- the ideal vector will overcome the hurdles presented by current vectors, including reduction of the risk for insertional mutagenesis in retrovirus vectors, minimization of the amount of immunity and inflammation evoked by the adenovirus vectors, and enhancement of delivery of the gene to the cell for the plasmid-liposome complexes.
- a papiUomavirus vector in gene therapy and gene immunization has many desireable qualities as a vector, for it reduces the risk for insertional mutagenesis characteristic of retrovirus vectors (by virtue of its distinct life cycle), it minimizes the amount of immunity and inflammation attributable to adenovirus vectors (see below), and it enhances delivery in contrast to the problem intrinsic to plasmid-liposome complexes (based on its being an animal virus).
- papiUomavirus vectors An attractive feature of papiUomavirus vectors is that there are many different serotypes whose neutralizing antibodies cross-react poorly or not at all. Since neutralizing antibodies can interfere with viral infection, the existence of multiple serotypes means that patients who have developed neutralizing antibodies to one papiUomavirus serotype would remain susceptible to infection by other viral serotypes. Encapsidation of the same DNA in different capsid types would allow for multiple "boosts" in a gene therapy or gene immunization protocol without progressive ioss in effectiveness of delivery. It would be reasonable to change serotypes by switching L1 molecules, but it may also be necessary to switch L2 molecules as well as L1. Although L1 contains the major neutralizing epitopes, L2 also contains minor neutralizing epitopes. This point may be important in a sequential administration protocol.
- a strength of the papiUomavirus vector is that, even though it is an animal virus, it can be propagated in nonmammalian cells, such as insect and yeast cells, thus enjoying the advantages of being an animal virus while avoiding the pitfalls.
- the pseudoviral particles of the invention are useful in the context of gene therapy and gene immunization.
- the papiUomavirus vector uses a E2BS-containing DNA as a base, with the viral genes possibly being deleted from the virus.
- the expression cassette is inserted, and the infectious papiUomavirus is produced in a packaging cell line that contains the E2, L1 and L2 sequences that provide the proteins necessary to package the virus.
- the vector with its expression cassette enters the target cell via a specific receptor, gets internalized into the cytoplasm, and is u ⁇ coated to deliver its DNA genome with the expression cassette into the nucleus, where it functions in an epichromosomal fashion to direct the expression of its product. See Example 7.
- genes carried by the expression cassettes are genes that encode expression products, such as proteins, polypeptides, and peptides (that may be modified by glycosylation, phosphorylation, or amidation, etc.) that are useful in gene therapy or gene immunization (see below).
- Sequences controlling their expression include promoters (for example, RSV or CMV), enhancers, leader peptides, termination and polyadenylation signals, splicing signals, viral replicons, and genes encoding selectable markers.
- Gene therapy is understood to be applicable to the treatment of inherited diseases and, also, acquired diseases, ranging from cardiovascular disorders to cancer to AIDS. Examples of cancer are melanoma, renal cell, ovarian, cervical, neuroblastoma, brain, head and neck, lung, liver, breast, colon, prostate, mesothelioma, leukemia, lymphoma, multiple myeloma, and skin.
- Examples of other diseases amenable to gene therapy include he oglobinopathies, severe combined immunodeficiency, hemophilias, familial hypercholesterolemia, inherited emphysema, cystic fibrosis, muscular dystrophy, lysosomal storage diseases, Gaucher's disease, puri ⁇ e nucl ⁇ oside phosphorylase deficiency, alpha- 1 antitrypsin deficiency, Fanconi's anemia, Hunter's syndrome, chronic granulomatous disease, rheumatoid arthritis, peripheral vascular disease, Parkinson's disease, diabetes, osteoporosis, chronic wounds, psoriasis, and atopic dermatitis.
- gene immunization it is understood to be applicable to raising a desired immune reaction, generating desired antibodies, or eliciting a desired CTL response. It typically results in protection against disease.
- diseases include infectious disease, like viral disease (for example, viral influenza), bacterial disease, and parasitic disease.
- genes carried by the pseudoviral particles of the invention are those that encode, without limitation, constituents of hemoglobin, adenosine deaminase, blood clotting factors [e.g., Factor VIII, Factor IX), receptors (for example, LDL receptor, ACh receptor, hormone receptors), purine ⁇ ucleoside phosphorylase, alpha-1 antitrypsin, ion channels (for example, CFTR), dystrophin, lysosomal enzymes, insulin, calcitonin, hormones, growth factors, cytokines; growth hormone, erythropoietin, parathyroid hormone, TNF, CSF, IGF, MDR, IL-1, IL-2, IL-4, interferons, p53; suicide gene products (for example, herpes simplex virus thymidine kinase, cytosine deaminase, vericella thymidine kinase); antibodies and fragments thereof, components of MHC
- the pseudoviral particles of the invention are used in gene transfer by infecting cells. While ex vivo approaches are plausible, in vivo protocols are preferred. Using either scenario, any cells that express the appropriate cell surface receptors by which the particles gain entry are amenable to infection. PapiUomavirus pseudoviral particle-mediated gene transfer into epithelial cells is particularly useful.
- Use of a tissue is contemplated as a bioreactor (to produce proteins for systemic release to treat disease), or to treat the tissue itself.
- Use of the epithelium, particularly the epidermis is thus envisioned as a bioreactor, or to treat the epithelium, or the epidermis, itself.
- the pharmacologically or biologically active compounds of this invention are generally administered to animals, particularly humans.
- active compounds can be processed in accordance with conventional methods of galenic pharmacy to produce medicinal agents for administration to patients, e.g., mammals, including humans.
- the compounds of this invention can be employed in admixture with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for parenteral, enteral ⁇ e.g., oral) or topical application which do not deleteriously react with the active compounds.
- suitable pharmaceutically acceptable carriers include water, salt solutions, alcohols, vegetable oils, synthetic fatty vehicles, etc.
- the pharmaceutical preparations can be mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, and the like which do not deleteriously react with the active compounds. They can also be combined where desired with other active agents, e.g., vitamins.
- compositions are injectable, sterile solutions, preferably oily or aqueous solutions, as well as suspensions, emulsions, or implants.
- auxiliary agents e.g., preservatives, stabilizers, buffers or salts for influencing osmotic pressure, etc.
- Suitable enteral application particularly suitable are tablets, dragees, liquids, drops, suppositories, or capsules.
- a syrup, elixir, or the like can be used where a sweetened vehicle is employed.
- these are employed as nonsprayable forms, viscous to semi-solid or solid forms comprising a carrier compatible with topical application and having a dynamic viscosity preferably greater than water.
- Suitable formulations include solutions, suspensions, emulsions, creams, ointments, powders, liniments, salves, aerosols, etc.
- sprayable aerosol preparations where the active ingredient, preferably in combination with a solid or liquid inert carrier material, is packaged in a bottle or in admixture with a pressurized volatile, normally gaseous propellent, e.g., a freon.
- a pressurized volatile, normally gaseous propellent e.g., a freon.
- compositions can be administered intravenously, orally, or through the nose or lung. They can also be administered parenterally or subcutaneously. Administration to the epithelium, or the epidermis, can be by bombardment (for example, with a gene gun) or topical application (for example, with a gene cream) which may or may not require exposure of underlying cells by tape stripping or penetration enhancers.
- the actual preferred amounts of active compound in a specific case will vary according to the specific compound being utilized, the particular compositions formulated, the mode of application, the particular situs, and the organism being treated. Dosages for a given host can be determined using conventional considerations, e.g., by customary comparison of the differential activities of the subject compounds and of a known agent, and, e.g., by means of an appropriate, conventional pharmacological protocol.
- BPHE-1 cells were obtained from A. Lewis (NIH, Bethesda) (Zhang, Y. L., et al., 1987, J. Virol. 61, 2924-2928).
- C127 Clone C cells were obtained from W. Vass (NIH, Bethesda), and BHK-21 cells were obtained from the ATCC. All antisera to VLPs (Roden, R.B.S., et al., 1996, J. Virol.
- BPV L1 was amplified by PCR in two separate reactions from Bam HI cut and religated BPVpML DNA using oiigonucleotides CCGCTGGATCCCA CTATTATATAGCACCATGGCGTTGTG GCAACAAGGCCAG (SEQ ID N0 : 1 ) and CAGTTGAGACTAGAGAGCCAC (SEQ ID N0:2) for one reaction, and GTGGCTCTCTAGTCTCAACTG (SEQ ID N0:3) and
- BPV L2 was amplified by PCR from Bam HI cut and religated BPVpML DNA using GCGGTAGATCTAATATGAGTGCACGAAAAAGAGTAAAACGTGCCAGT ⁇ SEQ ID N0:5) and CCGCTAGATCTAGGGAGATACAGCTTCTGGCCTTGTTGCCACAACGC (SEQ ID N0:6) for primers.
- the product ( — 1.5kB) was gel purified, digested with Bgl II, cloned into the Bam HI site of pSFV 1 and sequenced Wild type (1 14/K) and capsid assembly deficient mutant (pAT) HPV16 L1 were excised from pEVmod using Bgl II and subcloned into pSFV 1 HPV16 L2 was subcloned from a pEVmod vector into the Bam HI site of pSFV 1 Nrul (which is linearized using Nru I rather than Spe I) All plasmids were purified from E.coli HB101 by alkaline lysis and cesium chloride isopy c density cent ⁇ fugation.
- RNA samples were incubated for 1h at 37°C and 2.5 ⁇ was analyzed on a 0.7% agarose gel to assess the integrity of the SFV RNAs
- the remaining RNA was diluted in 1 ml OptiMEM medium, mixed with 100 ⁇ of Lipofectin in 1 ml of OptiMEM and incubated for 1 mm at ambient temperature.
- BHK-21 cells in a T 75 tissue culture flask were washed and covered with 2 ml of OptiMEM The RNA/Lipofectin mix was added, and the cells were incubated for 4f ⁇ at 37°C.
- the cells were washed once and maintained for 24h in 13 ml of complete medium (5% fetal calf serum, 10% tryptose phosphate broth, 10 mM Hepes pH 7 4, 1 x nonessential am o acids, 100 U/ml penicillin and 100 g/ml streptomycin in Glasgow's MEM)
- complete medium 5% fetal calf serum, 10% tryptose phosphate broth, 10 mM Hepes pH 7 4, 1 x nonessential am o acids, 100 U/ml penicillin and 100 g/ml streptomycin in Glasgow's MEM
- the medium was harvested, clarified by centnfugation (1000 x g, 10 mm), a quoted and stored at -80°C.
- papiUomavirus in BPHE-1 cells.
- the recombinant SFV stock was rendered infectious by incubation with 0.5 mg/ml chymotrypsin A4 (Boehnnger Mannheim) for 30 mm on ice and treatment with 0 5 mg/ml aprotimn (Sigma).
- BPHE 1 cells maintained for 12 20ft in DMEM containing 10% fetal calf serum, 100 U/ml penicillin and 100 ⁇ g/ml streptomycin in a 100 mm tissue culture plate were washed in D-PBS (containing 0.9 mM calcium and 0.5 mM magnesium) The cells were incubated for 2h at 37°C with activated recombinant SFV (titrated to give maximum expression levels, but generally 0.5 ml of each high titre stock) diluted to 25 ml in D PBS. The virus was aspirated, replaced with complete medium and maintained for 30h.
- the cells were scraped from the dish into the medium, which was collected and centnfuged (1000 x g, 10 mm), and the cell pellet was resuspended in 1 ml of D PBS.
- the cells were lysed by somcation (10s, 60% power, Fischer model 150 sonic dismembra ⁇ ator with a microtip).
- BHK 21 cells were maintained for 3 days post infection with recombinant SFV.
- BPHE 1 cells were maintained for only 3 Oh after infection with recombinant SFV.
- Ten 500 cm 2 culture dishes of cells were scraped from the plates into the medium which was centnfuged (1000 x g, 10 mm, 4°C) and the cell pellet resuspended in 5 ml ice cold PBS.
- the cells were lysed by somcation (1 mm, 60% power) and treatment with 0.5% NP-40 Extracts were layered over 30ml 40% (w/v) sucrose in PBS cushion and centnfuged for 150 mm at 80,000 x g at 4°C
- the pellets were resuspended in 12 ml of 27% (w/w) cesium chloride in PBS and centnfuged for 20h at 275,000 x g.
- the isopymc density gradient was fractionated and the density of each fraction determined using an Abbe3L refractometer (Milton Roy, Rochester, N.Y ) (Kirnbauer, R., et al., 1993, J. Virol. 67, 6929 36).
- BPV DNA was detected using [ 32 P)-labeled random primed Spel-Kpnl fragment of BPVpML under high stringency conditions (Sambrook, J., Fritsch, E.F., and Maniatis, T., 1989, Molecular Cloning, A Laboratory Manual. 2nd ed , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.).
- Electron microscopy Transmission electron microscopy was performed by binding 5 ⁇ samples to carbon coated copper grids, staining with 1 % (w/v) ura ⁇ yl acetate and examination using a Philips EM400RT electron microscope at 100KV. Samples for cryo-electron microscopy were spun for 15 mm in an airfuge onto carbon coated copper grids, frozen in liquid ethane and also examined in a Philips EM400RT electron microscope at 100KV (Booy, F.P., et al., 1991, Cell 64, 1007 1015).
- Example 2 Antibodies The monoclonal antibody, B201, directed against the BPV E2 protein, and the polyclonal antiserum, 150-1, which recognizes the BPV E1 protein, were provided by Dr. Elliot Androphy (New England Medical Center, Tufts University School of Medicine).
- Lewis (NIH, Bethesda), were grown in DMEM supplemented with antibiotics and 10% FCS (Zhang, Y. L., et al., 1987, J. Virol. 61, 2924-2928).
- BHK 21 cells obtained from the ATCC, were grown in Glasgow's medium supplemented with 10% tryptose phosphate broth, antibiotics, nonessential ammo acids, HEPES and 5% FCS. For microscopic analyses, cells were seeded onto acid-washed #01 coverslips in 24 well plates at a density of 1x10 cells/well and cultured overnight.
- BPV E1 and E2 were cloned into the BamH1 site of pSFV-1 as PCR products amplified from the BPV genome, the primers for El being: 5' CCGCTGGATCCGCACCATGGCAAACGATAAAGGTAGC (SEQ ID N0:7) and 3' GCGGTGGATCCGATCTTGCAACTTATCACTAC (SEQ ID N0:8), and the primers for E2 being: 5' CCGCTGGATCCGCACCATGGAGACAGCATGCGAACG ⁇ SEQ ID N0:9) and 3' GCGGTGGATCCGAAGAAAAGGCAATGGCAGTG fSEQ ID N0:10).
- Recombinant viruses expressing each gene were generated as described for L1 and L2.
- high titer recombinant SFV stock was treated with 500 //g/ml of chymotrypsm A4 on ice for 30 minutes and then aprotinin was added to 500 //g/ml for an additional 10 minutes
- the activated virus was diluted in Dulbecco's PBS with calcium and magnesium to 1/100 and added to cells in 24 well plates.
- virus-containing medium was removed and replaced with the normal growth medium supplemented with 100 mM KCI for the remainder of the infection to maintain cellular protein expression Infections were allowed to continue for 5-6 hours prior to cell fixation and immunolocalization Although SFV infection will induce cell death in 48 hr., the morphology of the infected cells was not visibly altered at this early time point
- Purified antibodies were used at a concentration of 5 / g/ml. For double immunofluorescent staining the primary antibodies were incubated in unison. After incubation, coverslips were washed three times with PBS/0.1 % B ⁇ j. Secondary antibodies were diluted to 5 /g/ml in PBS/0.1 % B ⁇ j and incubation was performed at 4°C. After this incubation, cells were washed thoroughly in PBS/0.1 % B ⁇ j and inverted onto Fluoromount-G mounting solution (Southern Biotechnology Associates, Birmingham, AL) on a glass slide. Fluorescence was examined using a BioRad MRC 1024 laser scanning confocal system attached to a Zeiss Axioplan microscope.
- Fluorescent in situ hybridization FISH.
- a probe to the upstream regulatory region of the BPV genome (7173 28) was PCR amplified using the 5' oligo, CGGCAAGCTTGCAATGTGCTGTGTCAGTTG (SEQ ID NO: 11 ), and the 3' o go, CGCGAAGCTTAACGGTGATGGTGTGATTAT fSEQ ID NO: 12).
- the Hmdlll cloning site is in bold and the BPV sequence overlap is underlined.
- the PCR reactions were performed using a fluorescein labeling mix (Boeh ⁇ nger Mannheim Indianapolis, IN) in which fluorescein-labeled dUTP is incorporated into the PCR product.
- Labeled probe 150 ng/coverslip was brought to a final volume of 10 ⁇ with IX SSC and dried under vacuum. The probe was resuspended in 7 ⁇ of 100% deionized formamide and heated to 90°C for 5 min. 7 ⁇ of hybridization buffer was added to the probe to give a final concentration of 50% formamide, 2X SSC, 1 X Denhardt's solution, 10% dextran sulfate and 50 mM Tris pH 7.5. In rapid succession, this mixture was applied to the coverslip, inverted onto a glass slide, covered with a second glass slide spaced with a 1mm spacer, sealed with Parafilm (American National Can, Greenwich, CT) and incubated for 10 minutes at 90°C.
- Parafilm American National Can, Greenwich, CT
- the slides were then transferred to a humid 37°C chamber overnight. After overnight incubation, the coverslips were washed in several changes of 50% formamide/2X SSC at 37°C for 60 min., 2X SSC at 37°C for 30 min. and 2X SSC at room temperature for 30 min.
- antibody staining was performed as described above except that detergent was not included in the incubations or washes.
- Example 3 Generation of BPV genome.
- cesium chloride purified BPVpML plasmid DNA which contains the BPV genome cloned via its unique Bam HI site, was digested with Bam HI, phenol/chloroform extracted, and precipitated.
- the DNA was resuspended at 500 ⁇ g/ml in ligation buffer (50 mM TrisHCI pH7.6, 5 M MgCI 2 , 1 M ATP, 1 mM DTT) containing 0.05 Weiss units/ g of T4 DNA ligase and incubated overnight at 16°C to promote self -ligation of the BPV genome.
- ligation buffer 50 mM TrisHCI pH7.6, 5 M MgCI 2 , 1 M ATP, 1 mM DTT
- baculoviruses expressing BPV late and/or early genes.
- Baculoviruses (Summers, M.D., and Smith, G.E., 1987, A manual of methods for baculovirus vectors and insect cell culture procedures. Bulletin No. 1555, Texas Agricultural Experiment Station, College Station, Texas) that expressed BPV LI alone, L2 alone, or LI plus L2 (L1 + L2) together have been described (Kirnbauer, R., et al., 1993, J. Virol.
- papillomaviruses in insect cells. Prior to infection, the Sf9 cells were maintained in spinner flasks at 27°C with Grace's medium containing 10% fetal calf serum and 0.01 % (v/v) pluronic F-68. Cells c were harvested by ce ⁇ trifugation (300 x g, for 5 min) and resuspended at 10 /ml in serum-free Grace's medium.
- the medium was removed and replaced with 5 ml of Grace's medium containing 10% fetal calf serum, 100 U/ml penicillin G and 100 ⁇ g/ml streptomycin.
- the cells were maintained at 27°C for 72ft in a humidified atmosphere and harvested by scraping from the plate.
- the plates were washed once with PBS to remove all remaining cells, and the cells were then collected by centrifugation (300 x g, 5 min). The medium was aspirated and the cell pellet stored at -80°C.
- the cell lysates were mixed into 5 ml of medium (DMEM containing 10% fetal calf serum, 100 U/ml penicillin G, and 100 /g/ml streptomycin maintained at 37°C in a humidified 5% C0 2 /95% air atmosphere) over confluent monolayers of low passage number mouse C127 clone C cells in 60 mm culture dishes. After a 1 h incubation at 37°C, the cells were washed once and then 5 ml of fresh medium was added. The following day the medium was replaced with DMEM containing 10% fetal calf serum that was used to maintain the cells for 2-3 weeks, replenishing twice weekly. The foci were stained with methyle ⁇ e blue (Sigma, M9140) and carbol fuchsin (Sigma, C-4165) in methanol and scored.
- DMEM containing 10% fetal calf serum, 100 U/ml penicillin G, and 100 /g/ml streptomycin maintained at 37°C
- HPV11 genome is produced by isolating a HPV11 DNA clone.
- Baculoviruses expressing the E2, L1 and L2 genes of HPV18 are prepared.
- Sf9 insect cells are transfected with the HPV11 genome and infected with the E2, L1 and L2 expressing baculoviruses.
- Conditions are provided for generation of HPV18 ⁇ HPV1 1 ⁇ pseudotypes, and the particles are harvested.
- cultured mammalian cells are identified that can be infected by HPV18 virions.
- in vitro infectivity assay is then carried out using these cells.
- focal transformation may not be the e ⁇ dpoint
- infection can be identified by incorporation of a rapidly and easily detectable marker into the papiUomavirus genome.
- neutralization studies are conducted. Neutralizing antibodies are generated against HPV18 virions. The HPV18 ⁇ HPV11 ⁇ pseudotypes are preincubated with these antibodies and then administered to cells. If the neutralization step blocks infectivity, then infection and not transfection by the HPV18 ⁇ HPV11 ⁇ virions will have occurred.
- PapiUomavirus VLPs are attractive candidates for vaccines against papiUomavirus infections because they present confor ational virion surface epitopes but lack the potentially oncogenic viral genome. Supporting the vaccine potential of VLPs are the findings that they induce high titers of apparently type-specific neutralizing antibodies against infectious papillomaviruses. In addition, vaccination with VLPs stimulated type-specific, antibody- mediated in vivo protection against high-dose experimental infection by papillomaviruses. As described here, in vitro assays have now been developed that directly measure neutralizing antibodies to high-risk HPVs, e.g., HPV16.
- HPV16 high-risk HPVs
- This assay is used in this protocol, for example, to monitor the generation of neutralizing antibodies in the development of an immunoprophylactic vaccine against papiUomavirus infection using papiUomavirus VLPs, or in the monitoring of protection for previously developed immunoprophylactic vaccines since titer of neutralizing antibodies are the best correlate of protection.
- the focal transformation assay requires 2 to 3 weeks, this problem is circumvented by incorporation of a rapid and easily detectable marker into the papiUomavirus genome.
- a ⁇ -galatosidase expression cassette is substituted for most of a viral genome, such as the BPV genome, leaving only those ⁇ s-elements, such as the E2 binding sites, required for efficient encapsidation.
- the BPV genomes are encapsidated with HPV16 L1 and L2 structural proteins to produce HPV16 ⁇ BPV1/ ⁇ -galactosidase ⁇ pseudotyped virions. Protection for immunoprophylactic vaccines against HPV16 infection using HPV16 VLPs is monitored by testing for neutralizing antibodies against HPV 16. A sample is obtained from a vaccinee and mixed with HPV16 ⁇ BPV1/ ⁇ galactosidase ⁇ pseudotyped virions.
- Infection of C127 cells with HPV16 ⁇ BPV1/ ⁇ -galactosidase ⁇ represents a quantitative in vitro neutralization assay that can be conducted in 3-4 days.
- Neutralizing antibodies will block infectivity.
- the presence of neutralizing antibodies can be determined by relating the amount of infectivity measured with the amount of infectivity measured for a control sample known to be free of neutralizing antibodies.
- the concentration of neutralizing antibodies can be established by relating the amount of infectivity measured with the amount of infectivity measured for samples containing known amounts of neutralizing antibodies. The waning of neutralizing antibodies in a vaci ⁇ ee is used as an indication that a booster inoculation with the HVP16 VLP vaccine is warranted.
- Example 6 The following is a laboratory protocol for preparing infectious herpesvirus pseudoviral virions in non- mammalian cells.
- the herpesvirus genome is produced by isolating a herpesvirus DNA clone.
- An expression cassette is prepared operably encoding a cloned DNA.
- the expression cassette is substituted for the viral genes, while maintaining the packaging signal, to obtain a herpesvirus vector DNA.
- Baculoviruses expressing the nonstructural protein(s) for the packaging the viral genome in the empty capsid, and expressing the structural proteins of the herpesvirus capsid are prepared.
- Sf9 insect cells are transfected with the herpesvirus vector DNA and infected with the nonstructural and structural protein-expressing baculoviruses.
- herpesvirus pseudotypes Conditions are provided for generation of herpesvirus pseudotypes, and the virions are harvested.
- cultured mammalian cells are identified that can be infected by wild type virions.
- An in vitro infectivity assay is then carried out using these cells.
- Infection is identified by testing for the production of the protein encoded by the cloned DNA.
- neutralization studies are conducted. Neutralizing antibodies are generated against wild type virions.
- the herpesvirus pseudotypes are prei ⁇ cubated with these antibodies and then administered to cells. If the neutralization step blocks infectivity, then infection and not transfection by the pseudotyped virions will have occurred.
- the infectious herpesvirus pseudoviral virions are used to transfer the cloned DNA into mammalian cells of the central nervous system.
- Example 7 The following is a clinical protocol for treatment of wrinkles of the face.
- the HPV1 genome is produced by isolating a HPV1 DNA clone.
- An expression cassette is prepared operably encoding proelastin, the precursor for elastin, a molecule found in the connective tissue of the skin.
- the expression cassette is substituted for the viral genes, while maintaining the E2BS, to obtain a HPV1 vector DNA.
- Baculoviruses expressing the E2, L1 and L2 genes of HPV1 are prepared.
- Sf9 insect cells are transfected with the HPV1 vector DNA and infected with the E2, L1 and L2 expressing baculoviruses.
- Conditions are provided for generation of HPV1 ⁇ HPV1/elastin ⁇ pseudotypes, and the particles are harvested.
- cultured mammalian cells are identified that can be infected by HPV1 virions.
- An in vitro infectivity assay is then carried out using these cells.
- Infection is identified by testing for the production of elastin.
- neutralization studies are conducted. Neutralizing antibodies are generated against HPV1 virions.
- the HPV1 pseudotypes are preincubated with these antibodies and then administered to cells. If the neutralization step blocks infectivity, then infection and not transfection by the HPV1 ⁇ HPV1/elastin ⁇ virions will have occurred.
- Infectious HVP1 ⁇ HPV1/eiasti ⁇ particles are formulated in a cream.
- the cream is applied topically to the face of a patient.
- the particular dose of virus is selected based on clinical trials in which increasing the concentration does not appreciably increase the efficiency of gene transfer and decreasing the concentration results in the efficiency of gene transfer being significantly decreased.
- About 10 days following the administration of virus the patient is evaluated for reduction of wrinkles to the face, and the cream is reapplied for another treatment on an as-needed basis.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Dermatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE69734829T DE69734829D1 (de) | 1996-07-17 | 1997-07-14 | Infektiöse pseudovirale papillomavirus partikel |
| JP10506187A JP2000515741A (ja) | 1996-07-17 | 1997-07-14 | 感染性パピローマウイルス偽ウイルス粒子 |
| AT97934126T ATE312178T1 (de) | 1996-07-17 | 1997-07-14 | Infektiöse pseudovirale papillomavirus partikel |
| US09/509,748 US6599739B1 (en) | 1996-07-17 | 1997-07-14 | Infectious papillomavirus pseudoviral particles |
| AU37256/97A AU732125B2 (en) | 1996-07-17 | 1997-07-14 | Infectious papillomavirus pseudoviral particles |
| EP97934126A EP0922105B1 (en) | 1996-07-17 | 1997-07-14 | Infectious papillomavirus pseudoviral particles |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US2210496P | 1996-07-17 | 1996-07-17 | |
| US60/022,104 | 1996-07-17 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09/509,748 A-371-Of-International US6599739B1 (en) | 1996-07-17 | 1997-07-14 | Infectious papillomavirus pseudoviral particles |
| US10/446,060 Continuation US20030207446A1 (en) | 1996-07-17 | 2003-05-27 | Infectious papillomavirus pseudoviral particles |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO1998002548A2 true WO1998002548A2 (en) | 1998-01-22 |
| WO1998002548A3 WO1998002548A3 (en) | 1998-03-05 |
Family
ID=21807834
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1997/012115 Ceased WO1998002548A2 (en) | 1996-07-17 | 1997-07-14 | Infectious papillomavirus pseudoviral particles |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US6599739B1 (https=) |
| EP (1) | EP0922105B1 (https=) |
| JP (1) | JP2000515741A (https=) |
| AT (1) | ATE312178T1 (https=) |
| AU (1) | AU732125B2 (https=) |
| CA (1) | CA2257822A1 (https=) |
| DE (1) | DE69734829D1 (https=) |
| WO (1) | WO1998002548A2 (https=) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001002551A3 (en) * | 1999-06-30 | 2001-11-08 | Evotec Biosystems Ag | Virus like particles, preparation and use in screening and functional genomics |
| JP2003527863A (ja) * | 2000-03-24 | 2003-09-24 | カイロン エセ.ピー.アー. | 遺伝子送達のための改変ノダウイルスrna |
| US6841157B2 (en) * | 2000-07-07 | 2005-01-11 | Merck & Co., Inc. | Production of chimeric human papillomavirus |
| US6878541B2 (en) * | 2001-05-15 | 2005-04-12 | Liang Qiao | Papilloma pseudo-virus and preparation |
| EP1708148A2 (en) | 2005-04-01 | 2006-10-04 | BIUCCHI, Sergio | Method and system for self-administrating 'off-line' monetary transactions |
| US7247433B2 (en) | 2001-08-13 | 2007-07-24 | University Of Rochester | Transcutaneous immunization against papillomavirus with papillomavirus virus-like particles |
| WO2007064971A3 (en) * | 2005-12-01 | 2007-11-15 | Us Gov Health & Human Serv | Infectious papovavirus particle comprising a cytocidal gene and methods of use thereof |
| US7419802B2 (en) | 1999-06-30 | 2008-09-02 | Evotec Ag | Virus like particles, their preparation and their use preferably in pharmaceutical screening and functional genomics |
| US7476517B2 (en) | 1999-06-30 | 2009-01-13 | Evotec Ag | Virus like particles, their preparation and their use preferably in pharmaceutical screening and functional genomics |
| US7498314B2 (en) | 2001-05-03 | 2009-03-03 | Fit Biotech Oyj Plc | Expression vectors and uses thereof |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008082719A2 (en) * | 2006-08-30 | 2008-07-10 | University Of Rochester | Combined human papillomavirus vlp/gene delivery system and use thereof as a vaccine for prophylaxis and immunotherapy of infectious diseases and tumors |
| WO2010118424A2 (en) * | 2009-04-10 | 2010-10-14 | The Johns Hopkins University | Papillomavirus-like particles (vlp) as broad spectrum human papillomavirus (hpv) vaccines |
| EP3427755B1 (en) | 2009-04-13 | 2020-10-21 | INSERM - Institut National de la Santé et de la Recherche Médicale | Hpv particles and uses thereof |
| WO2011017162A2 (en) * | 2009-08-03 | 2011-02-10 | The Johns Hopkins University | Methods for enhancing antigen-specific immune responses |
| CN107617110A (zh) * | 2009-08-26 | 2018-01-23 | 西莱克塔生物科技公司 | 诱导t细胞辅助的组合物 |
| WO2013119877A1 (en) | 2012-02-07 | 2013-08-15 | Aura Biosciences, Inc. | Virion-derived nanospheres for selective delivery of therapeutic and diagnostic agents to cancer cells |
| MX385842B (es) | 2013-09-18 | 2025-03-18 | Aura Biosciences Inc | Conjugados de partículas de tipo virus y uso de las mismas. |
| KR20180083868A (ko) | 2015-10-30 | 2018-07-23 | 알레타 바이오쎄라퓨틱스, 인크. | 종양 형질도입용 조성물 및 방법 |
| WO2017075440A1 (en) | 2015-10-30 | 2017-05-04 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Targeted cancer therapy |
| JP7115982B2 (ja) | 2015-10-30 | 2022-08-09 | アレタ・バイオセラピューティクス・インコーポレイテッド | 癌の治療のための組成物及び方法 |
| DE102016215500B4 (de) * | 2016-08-18 | 2020-02-20 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Sensorsystem zur Charakterisierung des Zustandes von in einem Kultivierungsgefäß enthaltenen Proben einer heterogenen Biomassestruktur |
| IL269986B2 (en) | 2017-04-12 | 2024-06-01 | Aura Biosciences Inc | Targeted combination therapy |
| EP3706783A1 (en) | 2017-11-06 | 2020-09-16 | The United States of America, as represented by the Secretary, Department of Health and Human Services | Cancer treatment utilizing pre-existing microbial immunity |
| CN116350803B (zh) * | 2023-05-19 | 2023-11-24 | 健通(济南)生物科技有限公司 | 一种以乳头瘤病毒样颗粒为载体的mRNA递药系统及制备方法 |
| WO2026055208A1 (en) | 2024-09-04 | 2026-03-12 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Virus-like particle conjugates comprising photoactivatable dye compounds and methods of making and using the same |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5618536A (en) * | 1992-09-03 | 1997-04-08 | The United States Of America As Represented By The Department Of Health And Human Services | Chimeric papillomavirus-like particles |
| US5437951A (en) | 1992-09-03 | 1995-08-01 | The United States Of America As Represented By The Department Of Health And Human Services | Self-assembling recombinant papillomavirus capsid proteins |
| US5792931A (en) * | 1994-08-12 | 1998-08-11 | Pioneer Hi-Bred International, Inc. | Fumonisin detoxification compositions and methods |
| WO1996011272A2 (de) | 1994-10-07 | 1996-04-18 | Medigene Gesellschaft Für Molekularbiologische Diagnostik, Theraphie Und Technologie Mbh | Papillomavirusähnliche partikel, fusionsproteine sowie verfahren zu deren herstellung |
| FR2749323B1 (fr) | 1996-06-04 | 1998-07-10 | Pasteur Merieux Serums Vacc | Pseudo-particules virales utiles en tant que vecteur de delivrance d'acide nucleique |
| ES2572628T3 (es) * | 1997-09-05 | 2016-06-01 | Medimmune, Inc. | Método in vitro para desmontaje/remontaje de partículas análogas al virus del papiloma humano (VLP) |
-
1997
- 1997-07-14 JP JP10506187A patent/JP2000515741A/ja not_active Withdrawn
- 1997-07-14 AT AT97934126T patent/ATE312178T1/de not_active IP Right Cessation
- 1997-07-14 CA CA002257822A patent/CA2257822A1/en not_active Abandoned
- 1997-07-14 US US09/509,748 patent/US6599739B1/en not_active Expired - Lifetime
- 1997-07-14 AU AU37256/97A patent/AU732125B2/en not_active Expired
- 1997-07-14 WO PCT/US1997/012115 patent/WO1998002548A2/en not_active Ceased
- 1997-07-14 EP EP97934126A patent/EP0922105B1/en not_active Expired - Lifetime
- 1997-07-14 DE DE69734829T patent/DE69734829D1/de not_active Expired - Lifetime
-
2003
- 2003-05-27 US US10/446,060 patent/US20030207446A1/en not_active Abandoned
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001002551A3 (en) * | 1999-06-30 | 2001-11-08 | Evotec Biosystems Ag | Virus like particles, preparation and use in screening and functional genomics |
| US7419802B2 (en) | 1999-06-30 | 2008-09-02 | Evotec Ag | Virus like particles, their preparation and their use preferably in pharmaceutical screening and functional genomics |
| US7476517B2 (en) | 1999-06-30 | 2009-01-13 | Evotec Ag | Virus like particles, their preparation and their use preferably in pharmaceutical screening and functional genomics |
| JP2003527863A (ja) * | 2000-03-24 | 2003-09-24 | カイロン エセ.ピー.アー. | 遺伝子送達のための改変ノダウイルスrna |
| US7179457B2 (en) | 2000-03-24 | 2007-02-20 | Chiron S.R.L. | Modified nodavirus RNA for gene delivery |
| JP4815091B2 (ja) * | 2000-03-24 | 2011-11-16 | ノバルティス ヴァクシンズ アンド ダイアグノスティクス エスアールエル | 遺伝子送達のための改変ノダウイルスrna |
| US6841157B2 (en) * | 2000-07-07 | 2005-01-11 | Merck & Co., Inc. | Production of chimeric human papillomavirus |
| US7498314B2 (en) | 2001-05-03 | 2009-03-03 | Fit Biotech Oyj Plc | Expression vectors and uses thereof |
| US9725486B2 (en) | 2001-05-03 | 2017-08-08 | Fit Biotech Oy | Methods of treating HIV diseases using novel expression vectors |
| US7510718B2 (en) | 2001-05-03 | 2009-03-31 | Fit Biotech Oyj Plc | Expression vectors and uses thereof |
| US6878541B2 (en) * | 2001-05-15 | 2005-04-12 | Liang Qiao | Papilloma pseudo-virus and preparation |
| US7247433B2 (en) | 2001-08-13 | 2007-07-24 | University Of Rochester | Transcutaneous immunization against papillomavirus with papillomavirus virus-like particles |
| EP1708148A2 (en) | 2005-04-01 | 2006-10-04 | BIUCCHI, Sergio | Method and system for self-administrating 'off-line' monetary transactions |
| WO2007064971A3 (en) * | 2005-12-01 | 2007-11-15 | Us Gov Health & Human Serv | Infectious papovavirus particle comprising a cytocidal gene and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2000515741A (ja) | 2000-11-28 |
| EP0922105A2 (en) | 1999-06-16 |
| AU3725697A (en) | 1998-02-09 |
| DE69734829D1 (de) | 2006-01-12 |
| AU732125B2 (en) | 2001-04-12 |
| EP0922105B1 (en) | 2005-12-07 |
| ATE312178T1 (de) | 2005-12-15 |
| CA2257822A1 (en) | 1998-01-22 |
| US20030207446A1 (en) | 2003-11-06 |
| US6599739B1 (en) | 2003-07-29 |
| WO1998002548A3 (en) | 1998-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU732125B2 (en) | Infectious papillomavirus pseudoviral particles | |
| Day et al. | The papillomavirus minor capsid protein, L2, induces localization of the major capsid protein, L1, and the viral transcription/replication protein, E2, to PML oncogenic domains | |
| EP1700911B1 (en) | In vitro method for disassembly/reassembly of papillomavirus virus-like particles (VLPs) | |
| Buck et al. | Arrangement of L2 within the papillomavirus capsid | |
| Okun et al. | L1 interaction domains of papillomavirus l2 necessary for viral genome encapsidation | |
| Stauffer et al. | Infectious human papillomavirus type 18 pseudovirions | |
| Volpers et al. | Binding and internalization of human papillomavirus type 33 virus-like particles by eukaryotic cells | |
| EP1292328B1 (en) | Chimeric human papillomavirus (hpv) l1 molecules and uses therefor | |
| Rossi et al. | Assembly of human papillomavirus type 16 pseudovirions in Saccharomyces cerevisiae | |
| US7351533B2 (en) | In vitro method for disassmbly/reassembly of papillomavirus virus-like particles (VLPs). Homogeneous VLP and cavsomere compositions produced by said methods: use thereof as vehicle for improved purification, and delivery of active agents | |
| EP1305039B1 (en) | Stable (fixed) forms of viral l1 capsid proteins, fusion proteins and uses thereof | |
| Schäfer et al. | DNA binding of L1 is required for human papillomavirus morphogenesis in vivo | |
| US6380364B1 (en) | Chimeric biotin-binding papillomavirus protein | |
| AU753391B2 (en) | Protein delivery system using human papillomavirus virus-like particles | |
| Gašparić et al. | Prophylactic DNA immunization against multiple papillomavirus types | |
| KR100540043B1 (ko) | 감염성 파필로마바이러스 위바이러스성 입자 | |
| EP1250593B1 (en) | IN VITRO METHOD FOR DISASSEMBLY/REASSEMBLY OF PAPILLOMAVIRUS VIRUS-LIKE PARTICLES (VLPs) | |
| US6962777B1 (en) | In vitro method for disassembly/reassembly of papillomavirus virus-like particles (vlps), homogeneous vlp and capsomere compositions produced by said methods; use thereof as vehicle for improved purification, and delivery of active agents | |
| US20030096259A1 (en) | In vitro method for disassembly/reassembly of papillomavirus virus-like particles (VLPs), homogeneous VLP and capsomere compositions produced by said methods; use thereof as vehicle for improved purification, and delivery of active agents | |
| To | Human Papillomavirus Types 16, 31, and 58 | |
| HK1030797B (en) | In vitro method for disassembly/reassembly of papillomavirus virus-like particles (vlps) | |
| KR19990055876A (ko) | 사람 파필로마바이러스 18형의 외피단백질 및 바이러스 유사입자의 제조 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2257822 Country of ref document: CA Ref country code: CA Ref document number: 2257822 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1019997000363 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1997934126 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1997934126 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 09509748 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 1019997000363 Country of ref document: KR |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1019997000363 Country of ref document: KR |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1997934126 Country of ref document: EP |