WO1997018314A1 - Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine - Google Patents

Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine Download PDF

Info

Publication number
WO1997018314A1
WO1997018314A1 PCT/EP1996/004850 EP9604850W WO9718314A1 WO 1997018314 A1 WO1997018314 A1 WO 1997018314A1 EP 9604850 W EP9604850 W EP 9604850W WO 9718314 A1 WO9718314 A1 WO 9718314A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
fusion protein
pth
seq
streptavidin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP1996/004850
Other languages
German (de)
English (en)
French (fr)
Inventor
Erhard Kopetzki
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Roche Diagnostics GmbH
Original Assignee
Boehringer Mannheim GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boehringer Mannheim GmbH filed Critical Boehringer Mannheim GmbH
Priority to EP96938115A priority Critical patent/EP0861325A1/de
Priority to US09/068,738 priority patent/US6136564A/en
Priority to AU75663/96A priority patent/AU7566396A/en
Priority to CA002237296A priority patent/CA2237296C/en
Priority to JP9518551A priority patent/JP2000500019A/ja
Publication of WO1997018314A1 publication Critical patent/WO1997018314A1/de
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/58Atrial natriuretic factor complex; Atriopeptin; Atrial natriuretic peptide [ANP]; Cardionatrin; Cardiodilatin
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/36Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Actinomyces; from Streptomyces (G)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/635Parathyroid hormone, i.e. parathormone; Parathyroid hormone-related peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/22Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a Strep-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/50Fusion polypeptide containing protease site
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones

Definitions

  • the invention relates to a process for the recombinant production of peptides by expression of fusion proteins with streptavidin and subsequent enzymatic cleavage of the fusion protein
  • Peptides are usually understood to mean substances which consist of up to about 100 amino acids.
  • the production of such peptides is either chemical (Kent, SBH et al (1988) (I), Hodson, JH, (1993) (2) or recombinant ( Kopetzki, E et al (1994) (3) Winnacker, E -L (1987) (4), Harris, TJR (1983) (5))
  • peptides can be used for the recombinant production of peptides.
  • direct expression in the cytoplasm of microorganisms or cell lines can take place.However, this requires a minimum polypeptide length of approx. 80 to 100 amino acids. Smaller peptides are not stable and are broken down by proteolysis As a rule, an additional N-terminal methionine and the yields are very low
  • the object of the present invention is to provide a method by means of which peptides can be made available via streptavidin fusion proteins in high yield and purity with complete separation from the streptavidin portion
  • the object is achieved according to the invention by a process for the recombinant production of a peptide by expression of a DNA in microorganisms, preferably prokaryotes, which codes for a fusion protein of streptavidin and the peptide mentioned, streptavidin and peptide via a peptide sequence which can be cleaved by an endoproteinase, isolation of the insoluble, inactive fusion protein, solubilization of the inactive fusion protein with a denaturing agent, dilution of the denaturing agent at a pH value between 8.5 and 11 until the fusion protein can be cleaved by an endoproteinase, cleavage of the fusion protein, Lower the pH until the cleaved streptavidin and uncleaved fusion protein precipitate and purify the desired peptide from the supernatant
  • streptavidin fusion proteins can be expressed very well in prokaryotes and can be isolated in the form of insoluble inactive proteins (inclusion bodies). Streptavidin fusion proteins solubilized in denaturing agents can be diluted so far at pH values above 8.5 that they can be digested with an endoproteinase without precessing
  • the fusion protein does not have to be renatured to the active protein.
  • the released streptavidin and possibly not cleaved streptavidin fusion protein can be separated from the desired peptide by precipitation at pH values below 6
  • the method according to the invention is suitable for producing a large number of short-chain peptides.
  • the method is suitable for the production of natriuretic peptides and parathyroid hormone peptides.
  • Natriuretic peptides are peptides with natriuretic activity, which are formed in the cardiac ventricle, the adrenal gland and the brain from a precursor polypeptide (prohormone) and have a ring of 17 amino acids as structural element, which is separated by a disulfide bridge between two Cysteine residues is formed.
  • Precursor polypeptides are e.g. B. the "atriaT natriuretic peptide (ANP 1-126) or cardiodilatin (CCD 1-126) and the" brain "natriuretic peptides of the B and C type.
  • Preferred NP peptides are derived from the" human ⁇ atrial -natriuretic peptide "(h ⁇ ANP).
  • the C-terminal h ⁇ ANP fragments of amino acids 95-126, 99-126 and 102-126 are particularly preferred.
  • Urodilatin (CDD 95-126) is a natriuretic peptide which can be obtained from human urine (Forssmann, K. et al. (1988) (23).
  • the peptide has a length of 32 amino acids and forms a ring from 17 amino acids through the formation of a disulfide bridge between two cysteine residues and belongs to the cardiodilatin / "atriar -natriuretic peptide (CDD / ANP) family.
  • ⁇ -ANP 99-126
  • Urodilatin (CCD 95 - 126) is probably created in vivo by cleavage of this propeptide between amino acids 94 and 95.
  • the approximately 3.5 kDa urodilatin peptide differs from ⁇ -ANP (99 - 126) -Peptide through a 4-amino acid extension at the N-terminus
  • the amino acid sequence and the structure of urodilatin are described, for example, in Drummer, C. et al. (1993) (24)
  • Urodilatin binds to the membrane-bound ANP receptors A and B. and activates an intracellular guanylate cycla coupled to the receptor This causes the formation of the "second messenger" cGMP, which mediates the diuretic and natriuretic effects in the kidney and the relaxing effect on the smooth vascular muscles. (Heim, J.M. (1989) (25)).
  • Urodilatin is thus a preferred therapeutic agent for the prophylaxis and therapy of acute kidney failure, e.g. B. in patients after heart or liver transplants.
  • B. kidney failure
  • Urodilatin is thus a preferred therapeutic agent for the prophylaxis and therapy of acute kidney failure, e.g. B. in patients after heart or liver transplants.
  • parathyroid hormone parathyroid hormone
  • the method according to the invention for producing parathyroid hormone (PTH) and its fragments can also be used advantageously.
  • the DNA and amino acid sequence of PTH is described, for example, in Rokkones, E. et al. (1994) (16).
  • the human parathyroid gene codes for a pre-pro-PTH protein of 115 amino acids. After splitting off the signal sequence and the prosegement, the matured PTH hormone has 84 amino acids (PTH 1 - 84). It has been shown that PTH, which is produced recombinantly in E. coli and S. cerevisiae, is unstable and degrades rapidly.
  • the production of PTH fusion proteins is described by Forsberg, G. et al. (1991) (17).
  • a nucleic acid is produced which codes for a fusion protein from mature PTH (1-84) and a 15 kD IgG binding protein.
  • a cleavage site for thrombin or subtilisin is inserted between the two protein parts.
  • This fusion protein is also unstable and is already degraded to a considerable extent when expressed in E. coli.
  • the degradation of PTH (1-84) could not be prevented even by secretion of the mature PTH (1-84) hormone into the periplasm of E.coli using the protein A signal sequence.
  • the half-life of PTH (1 - 84) in E. coli is only a few minutes.
  • the fusion proteins can be cleaved enzymatically with a specifically cleaving proteinase (restriction proteinase).
  • the proteinase is selected taking into account the amino acid sequence of the peptide to be produced. Care should be taken to ensure that the recognition / cleavage sequence of the restriction proteinase does not occur in the desired peptide and preferably not in the carrier portion (streptavidin portion) of the fusion protein, ie it should only occur once in the cleavage region (linker region).
  • cleaving endoproteinases z. B.
  • enterokinase factor Xa, thrombin, subtilisin BPN variants / ubiquitin protein peptidase, renin, collagenase, trypsin, chymotrypsin, endoproteinase Lys-C, Kallekrein (Carter, P., (12)), TEV proteinase (Parks, TD et al ., Anal. Biochem. 216 (1994) 413-417) (36), IgA proteinase (Pohlner, J. et al., Nature 325 (1987) 458-462) (37), Kex2p proteinase (EP-A 0467 839) (38) or S. aureus V8 proteinase.
  • Endoproteinase LysC which specifically cleaves proteins and peptides at the C-terminal end of lysine, is preferably used.
  • Such an enzyme is known, for example, from fungi or bacteria (DE 30 34 045 C2).
  • Endoproteinase LysC is particularly well suited for the production of peptides that do not contain a lysine residue, such as. B. Urodilatin.
  • a peptide sequence which can be cleaved by an endoproteinase is a short-chain peptide sequence which preferably consists of 5-15 amino acids and which contains a cleavage site for the desired endoproteinase at the C-terminal.
  • This N-terminal linker preferably contains, in addition to the desired endoproteinase recognition sequence, a combination of several amino acids, selected from the amino acids Gly, Thr, Ser, Ala, Pro, Asp, Glu, Arg and Lys.
  • a linker is particularly preferably used in which 2-8 of these additional amino acids are the negatively charged amino acids Asp and / or Glu.
  • Streptavidin for example, as described in EP-B 0 198 015 (7) and EP-A 0 612 325 (8), can be used as streptavidin.
  • Other streptavidin derivatives or fragments as described for example by Sano, T. et al., (9), are also suitable.
  • a streptavidin which is truncated (shortened) at the N-terminus and / or C-terminus is preferably used. This prevents aggregation and proteolysis (Sano, T. et al., (9)).
  • a streptavidin is preferably used which begins with amino acids 10-20 and ends with amino acids 130-140 (numbering analogously: Argarana, C.E. et al. (1986) (33)).
  • a streptavidin of amino acids 16-133 or 13-139 is particularly preferably used.
  • the fusion proteins are produced by expressing a DNA (nucleic acid sequence) which codes for the fusion protein in microorganisms, preferably in prokaryotes.
  • a DNA nucleic acid sequence
  • the expression vector used should not contain any elements which mediate secretion of the protein into the medium.
  • a DNA suitable for expression can preferably be produced synthetically. Such methods are known to the person skilled in the art common and described, for example, in Beattie, KL and Fowler, RF (1991) (34), EP-B 0 424 990 (35), Itakura, K et al (1977) (20).
  • the nucleic acid sequence of the proteins according to the invention can be appropriately modified Such modifications are, for example
  • Fusion proteins can be found both in prokaryotes and in other cells, for example in eukaryotic host cells such as yeasts (for example Saccharomyces, Pichia, Hansenula and Kluyveromyces) and fungi such as Aspergillis and Trichoderma in the form of insoluble protein aggregates, so-called "inclusion bodies" (IBs ), Inclusion bodies occur when the rate of synthesis of the protein in the cell is greater than the rate of folding to the active native protein. In this case, the protein aggregates in the cell, preferably in the cytoplasm. There the protein becomes denatured, compressed and insoluble Form deposited in the cell. As a result, the cell experiences as little interference as possible with its other cell functions
  • Suitable prokaryotic host organisms are, for example, Escherichia, Streptomyces or Bacillus.
  • the microorganisms preferably prokaryotes, are transformed in the usual way with the vector which contains the DNA coding for the fusion protein, and then fermented in the usual manner.
  • the insoluble, inactive protein (IBs) is isolated from the cells in a conventional manner, for example by centrifugation (pellet fraction). Protein aggregates can be obtained by washing the pellet with z.
  • B. detergent-containing buffers are further enriched.
  • the IBs are treated with a denaturing agent, e.g. Guanidine hydrochloride, urea or a urea derivative (see, for example, US Pat. No. 5,453,363) is solubilized and transferred to a suitable non-denaturing buffer (pH> 8.5) by dilution or dialysis.
  • a denaturing agent e.g. Guanidine hydrochloride, urea or a urea derivative (see, for example, US Pat. No. 5,453,363) is solubilized and transferred to a suitable non-denaturing buffer (pH> 8.5) by dilution or dialysis.
  • the dilution is carried out in such a way that the remaining denaturing agent does not significantly affect the enzymatic hydrolysis of the fusion protein.
  • the dilution is preferably carried out in a pulsed manner, for example by dropping the IB solubilizate in buffer (pH> 8.5) which contains no denaturing agent.
  • Such a pulse-like dilution enables a practically simultaneous removal of the effect of the denaturing agent and separation of the molecules to be solubilized. This largely avoids an undesired intermolecular interaction (aggregation) of the molecules to be solubilized.
  • the fusion proteins produced by the process according to the invention are not broken down in the host cells and can be completely cleaved enzymatically without any significant cleavage taking place in the peptide portion itself (for example PTH or urodilatin).
  • the method according to the invention is particularly suitable for the production of urodilatin, parathyroid hormone and their fragments.
  • the urodilatin fragments of amino acids 95-126, 99-126 or 102-126 and the parathyroid fragment of amino acids 1-37 are particularly preferably produced.
  • Example 1 shows the DNA segments A and B obtained according to Example 1.
  • the expression vector for the core-SA-URO (95-126) fusion gene with endoproteinase LysC cleavage site is based on the expression vector pSAM-CORE for core streptavidin.
  • the preparation and description of the plasmid pSAM-CORE is described in WO 93/09144 (11).
  • the unique Nhel restriction site located at the 3 'end in front of the stop codon of the core-SA gene was used to construct core-SA fusion proteins.
  • GGCCGCATGGACCGTATCGGTGCTCAGTCCGGACTGGGTTGCAACTCCTTCCGTT ACTAATGA SEQ ID NO: 5
  • DNA segment B (FIG. 1) "aged” (reaction buffer: 12.5 mmol / l Tris-HCl, pH 7.0 and 12.5 mmol / l MgCl2; oligonucleotide concentration: 1 pmol / 60 ⁇ l in each case ) and the hybridization products A and B each subcloned into the polylinker region of the E. coli pUCBM21 vector (Boehringer Mannheim GmbH, Mannheim, Germany) (DNA segment A, interfaces: EcoRI and Notl; DNA segment B, interfaces: Notl and Hindill). The DNA sequence of the two subcloned DNA segments was confirmed by means of DNA sequencing.
  • the expression plasmid pSA-EK-URO for the core-SA-URO (95-126) fusion gene was then used in a three-fragment ligation from the Nhe / Notl-DNA segment A, the Notl / Hindlll-DNA segment B and the approx. 2.9 kBp long Nhel / Hindlll-pSAM-CORE vector fragment composed. After double digestion, the DNA segments A and B were isolated with the corresponding endonucleases from the corresponding pUCBM21 plasmid derivatives. The desired plasmid pSA-EK-URO was identified by restriction mapping and the DNA sequence of the linker-urodilatin region was checked again by DNA sequencing.
  • PTH Parathormone fragment of amino acids 1-37, amino acid sequence described in Handy, G.N. et al., Proc. Natl. Acad. Be. USA 78 (1981) 7365-7369 (39).
  • the vector pSA-EK-PTH for expressing the core-SA-PT ⁇ (1-37) fusion gene with enterokinase cleavage site was produced according to the strategy described in Example 1 for the core-SA-URO (95-126) fusion gene with enterokinase cleavage site.
  • the DNA sequence of the two subcloned DNA segments was confirmed by means of DNA sequencing.
  • the expression plasmid pSA was then confirmed - EK-PT ⁇ for the core-SA-EK-PTH (l-37) fusion gene in a three-fragment ligation from the Nhel / NcoI-DNA segment C, the NcoI / HindüI-DNA segment D and the approx. 2.9 kBp long Nhel / Hindlll-pSAM-CORE vector fragment composed.
  • the DNA segments C and D were isolated after double digestion with the corresponding endonucleases from the corresponding pUCBM21 plasmid derivatives.
  • the desired plasmid pSA-EK-PTH was identified by restriction mapping and the DNA sequence of the enterokina elinker PTH region checked again by DNA sequencing
  • the plasmid pSA-THRO-PTH is derived from the core-SA-EK-PTH expression plasmid pSA-EK-PTH (see Example 2) by replacing the coding region for the enterokinase linker with a thrombin linker
  • the amino acid sequence of the thrombin linker [GDFLAEGLVPR] used (SEQ ID NO 15) is based on the natural thrombin cleavage site in fibrinogen (amino acid position 6-16) and the minimal recognition sequence for thrombin (Carter, P In Ladisch, MR, Willson, RC, Painton, CC, Builder, SE eds (1990) (12))
  • the plasmid pSA-EK-PTH was digested with Nhel and PvuII, the approximately 2.9 kbp long Nhel / PvuII-pSA-EK-PTH vector fragment was isolated and with that from the 2 complementary oligonucleotides 9 (SEQ ID NO 11) and 10 (SEQ ID NO 12) DNA segment E (FIG. 3) produced by hybridization
  • the desired plasmid construction pSA-THRO-PTH was identified by restriction mapping and the exchanged left region was checked by DNA sequencing.
  • the plasmid pSA-TEV-PTH is derived from the core-SA-EK-PTH expression plasmid pSA-EK-PTH (see Example 2) by replacing the coding region for the enterokinase linker with a TEV linker.
  • the plant virus TEV NIa proteinase ("tobacco etch virus”) recognizes the amino acid sequence ENLYFQiG / S and cleaves between gin and gly or ser (Dougherty, W.G. et al., (1988)) (13).
  • tobacco etch virus recognizes the amino acid sequence ENLYFQiG / S and cleaves between gin and gly or ser (Dougherty, W.G. et al., (1988)) (13).
  • the recombinantly produced enzyme was obtained from GIBCO BRL (Life Technologies, Ine Gaithersburg, MD, USA).
  • the plasmid pSA-EK-PTH was digested with Nhel and PvuII, the approx. 2.9 kbp long Nhel / PvuII-pSA-EK-PTH vector fragment was isolated and with that from the 2 complementary oligonucleotides JI (SEQ ID NO: 13) and ⁇ 2 (SEQ ID NO: 14) DNA segment F (FIG. 3) produced by hybridization.
  • the E. coli Kl 2 strain RM82 (a methionine revertant from ED 8654, Murray, NE et al. (1977)) (14) was in each case with one of the expression plasmids pSA described in Examples 1-4 -EK-URO, pSA-EK-PTH, pSA-THRO-PTH and pSA-TEV-PTH (ampicillin resistance) and the lacW repressor plasmid pUBS500 (kanamycin resistance, preparation and description see: EP-A 0368342) transformed.
  • the RM82 / pUBS500 / pSA-EK-URO, RM82 / pUBS500 / pSA-EK-PTH, RM82 / pUBS500 / pSA-THRO-PTH and RM82 / pUBS500 / pSA-TEV-PTH cells were in DYT medium (1% ( w / v) yeast extract, 1% (w / v) Bacto Tryptone (Difco, Detroit, USA) and 0.5% NaCl), with 50 mg / l ampicillin and 50 mg / l kanamycin up to an optical density at 550 nm attracted from 0.6-0.9 and then induced with IPTG (isopropyl- ⁇ -D-thiogalactoside) (1-5 mmol / l final concentration). After an induction phase of 4-8 hours, the cells were harvested by centrifugation and the cell pellets were washed with 25 mmol / l potassium phosphate buffer
  • the cell pellets each from 1 ml of centrifuged growth medium (RM82 / pUBS500 / pSA-EK-URO, RM82 / pUBS500 / pSA-EK-PTH, RM82 / pUBS500 / pSA-THRO-PTH and
  • RM82 / ⁇ UBS500 / pSA-TEV-PTH cells were resuspended in 0.25 ml 10 mmol / l phosphate buffer, pH 6.8 and 1 mmol / l EDTA and the cells were disrupted by ultrasound treatment. After centrifugation, 1/5 volume of 5xSDS sample buffer (1xSDS sample buffer: 50 mmol / l Tris-HCl, pH 6.8, 1% SDS, 1% mercaptoethanol, 10% glycerol, 0.001% bromophenol blue) was added to the supernatant.
  • 5xSDS sample buffer 50 mmol / l Tris-HCl, pH 6.8, 1% SDS, 1% mercaptoethanol, 10% glycerol, 0.001% bromophenol blue
  • the insoluble cell debris fraction was resuspended in 0.3 ml of lxSDS sample buffer with 6-8 M urea, the samples were incubated for 5 minutes at 95 ° C. and centrifuged. The proteins were then separated by SDS-polyacrylamide gel electrophoresis (PAGE) (Laemmli, UK (1970)) (15) and stained with Coomassie Brilliant Blue R dye.
  • the core-SA fusion proteins synthesized in E. coli were homogeneous and were found exclusively in the insoluble cell debris fraction (IBs). The expression level for the core-SA fusion proteins was 30-50% based on the total E. coli protein
  • E coli RM82 / pUBS500 / pSA-EK-URO, RM82 / pUBS500 / pSA-EK-PTH, RM82 / pUBS500 / pSA-THRO-PTH and RM82 / pUBS500 / pSA-TEV-PTH cells were in 1 1 0, 1 mol / 1 Tris-HCl, pH 7.0 suspended at 0 ° C, 300 mg of lysozyme added and incubated for 20 minutes at 0 ° C.
  • the cells were then mechanically disrupted by means of high pressure dispersion and the DNA by addition of 2 ml 1 mol / 1 MgCl2 and 10 mg DNAse (Boehringer Mannheim # 154709) digested in 30 minutes at 25 ° C. Then 500 ml 60 mmol / l EDTA, 6% Triton® XI 00 and 1.5 mol / 1 NaCl, pH 7.0 was added and incubated for a further 30 minutes at 0 ° C. The insoluble constituents (cell dummies and IBs) were then sedimented by centrifugation
  • the pellet was suspended in 1 1 0.1 mol / 1 Tris-HCl, 20 mmol / l EDTA, pH 6.5, incubated for 30 minutes at 25 ° C. and the IB preparation was isolated by centrifugation
  • IB pellet 25 g were suspended in 200 ml of 10 mmol / l Tris-HCl buffer, 8 mol / 1 urea, 10 mmol / l EDTA, pH 7.0 by stirring for 2 hours at 25 ° C. The insoluble constituents were separated by centrifugation and the clear supernatant processed further
  • the core-SA fusion proteins with enterokinase interface were in a concentration of 0.3 to 3 mg / ml and a substrate / proteinase ratio of 1:20 to 1: 250 (enterokinase, restriction proteinase from calf intestine, Boehringer Mannheim, Mannheim, Germany) in 50 mmol / l Tris-HCl, pH 8.0 digested at 30 ° C. and the time course of the enzymatic cleavage (kinetics) was analyzed by analytical reversed phase HPLC (see Example 9.1). For this purpose, samples (10 to 100 ⁇ l) were taken at intervals of 1 to 3 hours from the reaction mixture over a period of 6 to 24 hours.
  • LysC endoproteinase cleavage (Lys cleavage site)
  • the core SA-EK-URO fusion protein was obtained in a concentration of 0.3 to 3 mg / ml and a substrate / proteinase ratio of 1: 1000 to 1: 25000 (LysC endoproteinase from Lysobacter enzymogenes, sequencing grade; Boehringer Mannheim, Mannheim , Germany) in 50 mmol / l Tris-HCl, pH 8.0 at 30 to 35 ° C and the time course of the enzymatic cleavage was analyzed by analytical reversed phase HPLC (see Example 9.1). For this purpose, samples (10 to 100 ⁇ l) were taken at intervals of 1 to 3 hours from the reaction mixture over a period of 6 to 24 hours.
  • the core-SA-THRO-PTH fusion protein was in a concentration of 0.3 to 3 mg / ml and a substrate / proteinase ratio of 1:50 to 1: 500 (thrombin from human plasma, Boehringer Mannheim, Mannheim, Germany) in 50 mmol / l Tris-HCl, pH 8.8 digested at 25 to 30 ° C and the time course of the enzymatic cleavage was analyzed by analytical reversed phase HPLC (see Example 9.1). For this purpose, samples (10 to 100 ⁇ l) were taken at intervals of 1 to 3 hours from the reaction mixture over a period of 6 to 24 hours. TEV NIa proteinase cleavage (GluAsnLeuTyrPheGln-i-Gly / Ser cleavage sequence)
  • the core-SA-TEV-PTH fusion protein was obtained in a concentration of 0.3 to 3 mg / ml and a substrate / proteinase ratio of 1:50 to 1: 500 (recombinant TEV NIa restriction proteinase, GIBCO BRL Life Technologies, Inc. Gaithersburg , MD, USA) in 50 mmol / l Tris-HCl, pH 8.0, 0.5 mmol / l EDTA and 1 mmol / l DTT at 30 ° C and the time course of the enzymatic cleavage by analytical reversed phase HPLC ( see example 9.1).
  • the reaction mixture was used over a period of 6 to
  • the released core-SA carrier protein and uncleaved core-SA fusion protein were precipitated from the cleavage mixture by lowering the pH (pH ⁇ 6).
  • the cleavage mixture was treated with 1 mol / 1 citric acid to a final concentration of
  • the enzymatically released peptides can be further purified using chromatographic methods known to the person skilled in the art.
  • the bound material was eluted by a gradient of 0 to 1 mmol / l NaCl in equilibration buffer (10 up to 20 SV, 1 SV / hour). 10.2 Purification of the peptides by reversed phase HPLC
  • the sample volume was 10 - 100 ⁇ l, corresponding to 1 100 ⁇ g protein
  • the detection was carried out with a UV detector at 220 nm. Chromatography was carried out at a flow rate of 0.5 ml / min.
  • the identity and purity of the purified peptides was determined by mass spectroscopy (PD-MS and laser desorption spectroscopy), analytical reversed phase HPLC, isoelectric focusing (Bark, JE et al., J. Forensic Sei. Soc. 16 (1976) 115-120 ( 42), SDS PAGE (Laemmli, UK, Nature 227 (1970) 680-685 (43)) and capillary electrophoresis, compared with a chemically produced standard.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cardiology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/EP1996/004850 1995-11-16 1996-11-06 Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine Ceased WO1997018314A1 (de)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP96938115A EP0861325A1 (de) 1995-11-16 1996-11-06 Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine
US09/068,738 US6136564A (en) 1995-11-16 1996-11-06 Process for the production of peptides by way of streptavidin fusion proteins
AU75663/96A AU7566396A (en) 1995-11-16 1996-11-06 Process for the preparation of peptides by way of streptavidin fusion proteins
CA002237296A CA2237296C (en) 1995-11-16 1996-11-06 Process for the preparation of peptides by way of streptavidin fusion proteins
JP9518551A JP2000500019A (ja) 1995-11-16 1996-11-06 ストレプトアビジン融合タンパク質経由でのペプチドの生産方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19542702.5 1995-11-16
DE19542702 1995-11-16

Publications (1)

Publication Number Publication Date
WO1997018314A1 true WO1997018314A1 (de) 1997-05-22

Family

ID=7777604

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1996/004850 Ceased WO1997018314A1 (de) 1995-11-16 1996-11-06 Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine

Country Status (6)

Country Link
US (1) US6136564A (https=)
EP (1) EP0861325A1 (https=)
JP (1) JP2000500019A (https=)
AU (1) AU7566396A (https=)
CA (1) CA2237296C (https=)
WO (1) WO1997018314A1 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000075333A1 (en) * 1999-06-07 2000-12-14 Neorx Corporation Streptavidin expressed gene fusions and methods of use thereof
WO2006067221A3 (en) * 2004-12-22 2006-09-28 Kuros Biosurgery Ag Michael-type addition reaction functionalised peg hydrogels with factor xiiia incorporated biofactors
US7144991B2 (en) 1999-06-07 2006-12-05 Aletheon Pharmaceuticals, Inc. Streptavidin expressed gene fusions and methods of use thereof
US8034618B2 (en) 2001-12-18 2011-10-11 Eldgenossische Technische Hochschule Zurich PTH containing cell growth matrix
US8226942B2 (en) 2007-12-28 2012-07-24 Kuros Biosurgery Ag PDGF fusion proteins incorporated into fibrin foams
US8961947B2 (en) 2007-04-13 2015-02-24 Kuros Biosurgery Ag Polymeric tissue sealant

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020168718A1 (en) * 1997-04-03 2002-11-14 California Institute Of Technology Enzyme-mediated modification of fibrin for tissue engineering
US7601685B2 (en) * 1998-08-27 2009-10-13 Eidgenossische Technische Hochschule Zurich Growth factor modified protein matrices for tissue engineering
US6958212B1 (en) * 1999-02-01 2005-10-25 Eidgenossische Technische Hochschule Zurich Conjugate addition reactions for the controlled delivery of pharmaceutically active compounds
DK1181323T3 (da) 1999-02-01 2011-10-17 Eidgenoess Tech Hochschule Biomaterialer dannet med nukleofil additionsreaktion med konjugerede uimættede grupper
US7291673B2 (en) * 2000-06-02 2007-11-06 Eidgenossiche Technische Hochschule Zurich Conjugate addition reactions for the controlled delivery of pharmaceutically active compounds
EP1465989B1 (en) * 2001-12-18 2008-02-20 Eidgenossisch Technische Hochschule Zurich Growth factor modified protein matrices for tissue engineering
JP4560291B2 (ja) * 2001-12-18 2010-10-13 イジュノシッヒ テクニッヒ ホッフシューラ チューリッヒ 組織操作のための成長因子改変タンパク質マトリクス
US8282912B2 (en) * 2002-03-22 2012-10-09 Kuros Biosurgery, AG Compositions for tissue augmentation
US8778634B2 (en) 2004-12-01 2014-07-15 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US8399400B2 (en) * 2004-12-01 2013-03-19 Syntaxin, Ltd. Fusion proteins
US8603779B2 (en) 2004-12-01 2013-12-10 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US8512984B2 (en) 2004-12-01 2013-08-20 Syntaxin, Ltd. Non-cytotoxic protein conjugates
GB0426394D0 (en) * 2004-12-01 2005-01-05 Health Prot Agency Fusion proteins
US8575101B2 (en) 2005-01-06 2013-11-05 Kuros Biosurgery Ag Supplemented matrices for the repair of bone fractures
MX2007008319A (es) * 2005-01-06 2007-10-04 Kuros Biosurgery Ag Matrices suplementadas para la reparacion de fracturas oseas.
WO2006073711A2 (en) * 2005-01-06 2006-07-13 Kuros Biosurgery Ag Use of a matrix comprising a contrast agent in soft tissues
GB0610867D0 (en) 2006-06-01 2006-07-12 Syntaxin Ltd Treatment of pain
CA2756244A1 (en) 2009-04-02 2010-10-07 Roche Glycart Ag Multispecific antibodies comprising full length antibodies and single chain fab fragments
EP2478013B1 (en) * 2009-09-16 2018-10-24 F.Hoffmann-La Roche Ag Coiled coil and/or tether containing protein complexes and uses thereof
TW201138821A (en) 2010-03-26 2011-11-16 Roche Glycart Ag Bispecific antibodies
CN103068846B9 (zh) 2010-08-24 2016-09-28 弗·哈夫曼-拉罗切有限公司 包含二硫键稳定性Fv片段的双特异性抗体
SG191153A1 (en) 2010-12-23 2013-07-31 Hoffmann La Roche Polypeptide-polynucleotide-complex and its use in targeted effector moiety delivery
US20120277155A1 (en) 2011-02-25 2012-11-01 Medtronic, Inc. Therapy for kidney disease and/or heart failure
EP2686027B1 (en) 2011-03-16 2021-05-05 Kuros Biosurgery AG Pharmaceutical formulation for use in spinal fusion
EP2750697A4 (en) 2011-09-02 2015-03-25 Medtronic Inc CHIMERIC NATRIURETIC PEPTIDE COMPOSITIONS AND METHOD FOR THE PRODUCTION THEREOF
CA2861124A1 (en) 2012-02-10 2013-08-15 Genentech, Inc. Single-chain antibodies and other heteromultimers
KR20150030744A (ko) 2012-06-27 2015-03-20 에프. 호프만-라 로슈 아게 표적에 특이적으로 결합하는 하나 이상의 결합 단위를 포함하는 항체 Fc-영역 접합체의 제조 방법 및 그의 용도
RU2639287C2 (ru) 2012-06-27 2017-12-20 Ф. Хоффманн-Ля Рош Аг Способ отбора и получения высокоселективных и мультиспецифичных нацеливающих групп с заданными свойствами, включающих по меньшей мере две различные связывающие группировки, и их применения
US20140056870A1 (en) 2012-08-27 2014-02-27 Allergan, Inc. Fusion proteins
EP3227332B1 (en) 2014-12-03 2019-11-06 F.Hoffmann-La Roche Ag Multispecific antibodies

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986002077A1 (en) * 1984-10-02 1986-04-10 Meade Harry M Production of streptavidin-like polypeptides
GB2180539A (en) * 1985-07-24 1987-04-01 Glaxo Group Ltd Microbiological products
WO1988006596A1 (en) * 1987-03-02 1988-09-07 Bissendorf Peptide Gmbh New cardiodilatin fragment, process for preparing same and use thereof
WO1989003422A1 (en) * 1987-10-08 1989-04-20 British Bio-Technology Limited Synthetic gene
WO1991006564A1 (de) * 1989-10-27 1991-05-16 Forssmann Wolf Georg hPTH-FRAGMENT-(1-37), SEINE HERSTELLUNG, DIESES ENTHALTENDE ARZNEIMITTEL UND SEINE VERWENDUNG
EP0528686A2 (en) * 1991-08-19 1993-02-24 Suntory Limited Process for producing peptides

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986002077A1 (en) * 1984-10-02 1986-04-10 Meade Harry M Production of streptavidin-like polypeptides
GB2180539A (en) * 1985-07-24 1987-04-01 Glaxo Group Ltd Microbiological products
WO1988006596A1 (en) * 1987-03-02 1988-09-07 Bissendorf Peptide Gmbh New cardiodilatin fragment, process for preparing same and use thereof
WO1989003422A1 (en) * 1987-10-08 1989-04-20 British Bio-Technology Limited Synthetic gene
WO1991006564A1 (de) * 1989-10-27 1991-05-16 Forssmann Wolf Georg hPTH-FRAGMENT-(1-37), SEINE HERSTELLUNG, DIESES ENTHALTENDE ARZNEIMITTEL UND SEINE VERWENDUNG
EP0528686A2 (en) * 1991-08-19 1993-02-24 Suntory Limited Process for producing peptides

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
E. WINGENDER ET AL: "Expression of human parathyroid hormone in Escherichia coli", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 264, no. 8, 15 March 1989 (1989-03-15), MD US, pages 4367 - 4373, XP002024630 *
T. GARDELLA ET AL: "Expression of human parathyroid hormone-(1-84) in Escherichia coli as a Factor X-cleavable fusion protein", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 265, no. 26, 15 September 1990 (1990-09-15), MD US, pages 15854 - 15859, XP002024631 *
Y. SAITO ET AL: "Bacterial synthesis of recombinant alpha human atrial natriuretic polypeptide", JOURNAL OF BIOCHEMISTRY, vol. 102, no. 1, July 1987 (1987-07-01), pages 111 - 122, XP002022296 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000075333A1 (en) * 1999-06-07 2000-12-14 Neorx Corporation Streptavidin expressed gene fusions and methods of use thereof
US7144991B2 (en) 1999-06-07 2006-12-05 Aletheon Pharmaceuticals, Inc. Streptavidin expressed gene fusions and methods of use thereof
US8034618B2 (en) 2001-12-18 2011-10-11 Eldgenossische Technische Hochschule Zurich PTH containing cell growth matrix
WO2006067221A3 (en) * 2004-12-22 2006-09-28 Kuros Biosurgery Ag Michael-type addition reaction functionalised peg hydrogels with factor xiiia incorporated biofactors
US8961947B2 (en) 2007-04-13 2015-02-24 Kuros Biosurgery Ag Polymeric tissue sealant
US9180222B2 (en) 2007-04-13 2015-11-10 Kuros Biosurgery Ag Polymeric tissue sealant
US8226942B2 (en) 2007-12-28 2012-07-24 Kuros Biosurgery Ag PDGF fusion proteins incorporated into fibrin foams

Also Published As

Publication number Publication date
CA2237296A1 (en) 1997-05-22
JP2000500019A (ja) 2000-01-11
AU7566396A (en) 1997-06-05
US6136564A (en) 2000-10-24
EP0861325A1 (de) 1998-09-02
CA2237296C (en) 2008-10-07

Similar Documents

Publication Publication Date Title
WO1997018314A1 (de) Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine
AU605291B2 (en) Process for the purification of recombinant polypeptides
JP3054192B2 (ja) 副甲状腺ホルモンの製造のための組換えdna法
EP0542863B1 (en) Expression of recombinant polypeptides with improved purification
US5013653A (en) Product and process for introduction of a hinge region into a fusion protein to facilitate cleavage
DE69521752T2 (de) Verfahren für die Herstellung von Proteinen
DE69233008T2 (de) Fusionierung von Peptiden und Proteinen mit Thioredoxin und thioredoxin-ähnlichen Molekülen
DE69434083T2 (de) Expression eines fusionspolypeptides, das ohne leadersequenz aus dem cytoplasma transportiert wird
EP1819729B1 (de) Verfahren zur herstellung von carboxy-terminal amidierten peptiden
DE60208343T2 (de) FUSIONSPROTEINE aus hirudin und proinsulin oder insulin
US8298789B2 (en) Orthogonal process for purification of recombinant human parathyroid hormone (rhPTH) (1-34)
NZ338004A (en) Process for producing peptide with glucagon like peptide-1 (GLP-1) activity by incorporating a protective and helper component to facilitate purification
US5389529A (en) Modified lamβ signal sequence and processes for producing recombinant neurotrophins
EP1931705B1 (de) Verfahren zur amidierung von polypeptiden mit c-terminalen basischen aminosäuren unter verwendung spezifischer endoproteasen
AU665034B2 (en) Production of human parathyroid hormone from microorganisms
JPH03228682A (ja) E.コリでの非融合タンパク質の調製方法
EP1066328A1 (en) Chimeric protein containing an intramolecular chaperone-like sequence and its application to insulin production
WO1992022665A1 (en) Production and recovery of recombinant neurotrophins
EP0851930A1 (de) Verfahren zur herstellung von natriuretischen peptiden über streptavidin-fusionsproteine
USRE37919E1 (en) Recombinant DNA method for production of parathyroid hormone
KR100473443B1 (ko) 단백질의 생산방법
JP2002533072A (ja) β−リポトロピンおよび他のペプチドの組換え合成

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1996938115

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2237296

Country of ref document: CA

Ref country code: CA

Ref document number: 2237296

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1997 518551

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 09068738

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1996938115

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1996938115

Country of ref document: EP