WO1997018314A1 - Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine - Google Patents
Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine Download PDFInfo
- Publication number
- WO1997018314A1 WO1997018314A1 PCT/EP1996/004850 EP9604850W WO9718314A1 WO 1997018314 A1 WO1997018314 A1 WO 1997018314A1 EP 9604850 W EP9604850 W EP 9604850W WO 9718314 A1 WO9718314 A1 WO 9718314A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- peptide
- fusion protein
- pth
- seq
- streptavidin
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/58—Atrial natriuretic factor complex; Atriopeptin; Atrial natriuretic peptide [ANP]; Cardionatrin; Cardiodilatin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/36—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Actinomyces; from Streptomyces (G)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/635—Parathyroid hormone (parathormone); Parathyroid hormone-related peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/22—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a Strep-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/50—Fusion polypeptide containing protease site
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
- C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
Definitions
- the invention relates to a process for the recombinant production of peptides by expression of fusion proteins with streptavidin and subsequent enzymatic cleavage of the fusion protein
- Peptides are usually understood to mean substances which consist of up to about 100 amino acids.
- the production of such peptides is either chemical (Kent, SBH et al (1988) (I), Hodson, JH, (1993) (2) or recombinant ( Kopetzki, E et al (1994) (3) Winnacker, E -L (1987) (4), Harris, TJR (1983) (5))
- peptides can be used for the recombinant production of peptides.
- direct expression in the cytoplasm of microorganisms or cell lines can take place.However, this requires a minimum polypeptide length of approx. 80 to 100 amino acids. Smaller peptides are not stable and are broken down by proteolysis As a rule, an additional N-terminal methionine and the yields are very low
- the object of the present invention is to provide a method by means of which peptides can be made available via streptavidin fusion proteins in high yield and purity with complete separation from the streptavidin portion
- the object is achieved according to the invention by a process for the recombinant production of a peptide by expression of a DNA in microorganisms, preferably prokaryotes, which codes for a fusion protein of streptavidin and the peptide mentioned, streptavidin and peptide via a peptide sequence which can be cleaved by an endoproteinase, isolation of the insoluble, inactive fusion protein, solubilization of the inactive fusion protein with a denaturing agent, dilution of the denaturing agent at a pH value between 8.5 and 11 until the fusion protein can be cleaved by an endoproteinase, cleavage of the fusion protein, Lower the pH until the cleaved streptavidin and uncleaved fusion protein precipitate and purify the desired peptide from the supernatant
- streptavidin fusion proteins can be expressed very well in prokaryotes and can be isolated in the form of insoluble inactive proteins (inclusion bodies). Streptavidin fusion proteins solubilized in denaturing agents can be diluted so far at pH values above 8.5 that they can be digested with an endoproteinase without precessing
- the fusion protein does not have to be renatured to the active protein.
- the released streptavidin and possibly not cleaved streptavidin fusion protein can be separated from the desired peptide by precipitation at pH values below 6
- the method according to the invention is suitable for producing a large number of short-chain peptides.
- the method is suitable for the production of natriuretic peptides and parathyroid hormone peptides.
- Natriuretic peptides are peptides with natriuretic activity, which are formed in the cardiac ventricle, the adrenal gland and the brain from a precursor polypeptide (prohormone) and have a ring of 17 amino acids as structural element, which is separated by a disulfide bridge between two Cysteine residues is formed.
- Precursor polypeptides are e.g. B. the "atriaT natriuretic peptide (ANP 1-126) or cardiodilatin (CCD 1-126) and the" brain "natriuretic peptides of the B and C type.
- Preferred NP peptides are derived from the" human ⁇ atrial -natriuretic peptide "(h ⁇ ANP).
- the C-terminal h ⁇ ANP fragments of amino acids 95-126, 99-126 and 102-126 are particularly preferred.
- Urodilatin (CDD 95-126) is a natriuretic peptide which can be obtained from human urine (Forssmann, K. et al. (1988) (23).
- the peptide has a length of 32 amino acids and forms a ring from 17 amino acids through the formation of a disulfide bridge between two cysteine residues and belongs to the cardiodilatin / "atriar -natriuretic peptide (CDD / ANP) family.
- ⁇ -ANP 99-126
- Urodilatin (CCD 95 - 126) is probably created in vivo by cleavage of this propeptide between amino acids 94 and 95.
- the approximately 3.5 kDa urodilatin peptide differs from ⁇ -ANP (99 - 126) -Peptide through a 4-amino acid extension at the N-terminus
- the amino acid sequence and the structure of urodilatin are described, for example, in Drummer, C. et al. (1993) (24)
- Urodilatin binds to the membrane-bound ANP receptors A and B. and activates an intracellular guanylate cycla coupled to the receptor This causes the formation of the "second messenger" cGMP, which mediates the diuretic and natriuretic effects in the kidney and the relaxing effect on the smooth vascular muscles. (Heim, J.M. (1989) (25)).
- Urodilatin is thus a preferred therapeutic agent for the prophylaxis and therapy of acute kidney failure, e.g. B. in patients after heart or liver transplants.
- B. kidney failure
- Urodilatin is thus a preferred therapeutic agent for the prophylaxis and therapy of acute kidney failure, e.g. B. in patients after heart or liver transplants.
- parathyroid hormone parathyroid hormone
- the method according to the invention for producing parathyroid hormone (PTH) and its fragments can also be used advantageously.
- the DNA and amino acid sequence of PTH is described, for example, in Rokkones, E. et al. (1994) (16).
- the human parathyroid gene codes for a pre-pro-PTH protein of 115 amino acids. After splitting off the signal sequence and the prosegement, the matured PTH hormone has 84 amino acids (PTH 1 - 84). It has been shown that PTH, which is produced recombinantly in E. coli and S. cerevisiae, is unstable and degrades rapidly.
- the production of PTH fusion proteins is described by Forsberg, G. et al. (1991) (17).
- a nucleic acid is produced which codes for a fusion protein from mature PTH (1-84) and a 15 kD IgG binding protein.
- a cleavage site for thrombin or subtilisin is inserted between the two protein parts.
- This fusion protein is also unstable and is already degraded to a considerable extent when expressed in E. coli.
- the degradation of PTH (1-84) could not be prevented even by secretion of the mature PTH (1-84) hormone into the periplasm of E.coli using the protein A signal sequence.
- the half-life of PTH (1 - 84) in E. coli is only a few minutes.
- the fusion proteins can be cleaved enzymatically with a specifically cleaving proteinase (restriction proteinase).
- the proteinase is selected taking into account the amino acid sequence of the peptide to be produced. Care should be taken to ensure that the recognition / cleavage sequence of the restriction proteinase does not occur in the desired peptide and preferably not in the carrier portion (streptavidin portion) of the fusion protein, ie it should only occur once in the cleavage region (linker region).
- cleaving endoproteinases z. B.
- enterokinase factor Xa, thrombin, subtilisin BPN variants / ubiquitin protein peptidase, renin, collagenase, trypsin, chymotrypsin, endoproteinase Lys-C, Kallekrein (Carter, P., (12)), TEV proteinase (Parks, TD et al ., Anal. Biochem. 216 (1994) 413-417) (36), IgA proteinase (Pohlner, J. et al., Nature 325 (1987) 458-462) (37), Kex2p proteinase (EP-A 0467 839) (38) or S. aureus V8 proteinase.
- Endoproteinase LysC which specifically cleaves proteins and peptides at the C-terminal end of lysine, is preferably used.
- Such an enzyme is known, for example, from fungi or bacteria (DE 30 34 045 C2).
- Endoproteinase LysC is particularly well suited for the production of peptides that do not contain a lysine residue, such as. B. Urodilatin.
- a peptide sequence which can be cleaved by an endoproteinase is a short-chain peptide sequence which preferably consists of 5-15 amino acids and which contains a cleavage site for the desired endoproteinase at the C-terminal.
- This N-terminal linker preferably contains, in addition to the desired endoproteinase recognition sequence, a combination of several amino acids, selected from the amino acids Gly, Thr, Ser, Ala, Pro, Asp, Glu, Arg and Lys.
- a linker is particularly preferably used in which 2-8 of these additional amino acids are the negatively charged amino acids Asp and / or Glu.
- Streptavidin for example, as described in EP-B 0 198 015 (7) and EP-A 0 612 325 (8), can be used as streptavidin.
- Other streptavidin derivatives or fragments as described for example by Sano, T. et al., (9), are also suitable.
- a streptavidin which is truncated (shortened) at the N-terminus and / or C-terminus is preferably used. This prevents aggregation and proteolysis (Sano, T. et al., (9)).
- a streptavidin is preferably used which begins with amino acids 10-20 and ends with amino acids 130-140 (numbering analogously: Argarana, C.E. et al. (1986) (33)).
- a streptavidin of amino acids 16-133 or 13-139 is particularly preferably used.
- the fusion proteins are produced by expressing a DNA (nucleic acid sequence) which codes for the fusion protein in microorganisms, preferably in prokaryotes.
- a DNA nucleic acid sequence
- the expression vector used should not contain any elements which mediate secretion of the protein into the medium.
- a DNA suitable for expression can preferably be produced synthetically. Such methods are known to the person skilled in the art common and described, for example, in Beattie, KL and Fowler, RF (1991) (34), EP-B 0 424 990 (35), Itakura, K et al (1977) (20).
- the nucleic acid sequence of the proteins according to the invention can be appropriately modified Such modifications are, for example
- Fusion proteins can be found both in prokaryotes and in other cells, for example in eukaryotic host cells such as yeasts (for example Saccharomyces, Pichia, Hansenula and Kluyveromyces) and fungi such as Aspergillis and Trichoderma in the form of insoluble protein aggregates, so-called "inclusion bodies" (IBs ), Inclusion bodies occur when the rate of synthesis of the protein in the cell is greater than the rate of folding to the active native protein. In this case, the protein aggregates in the cell, preferably in the cytoplasm. There the protein becomes denatured, compressed and insoluble Form deposited in the cell. As a result, the cell experiences as little interference as possible with its other cell functions
- Suitable prokaryotic host organisms are, for example, Escherichia, Streptomyces or Bacillus.
- the microorganisms preferably prokaryotes, are transformed in the usual way with the vector which contains the DNA coding for the fusion protein, and then fermented in the usual manner.
- the insoluble, inactive protein (IBs) is isolated from the cells in a conventional manner, for example by centrifugation (pellet fraction). Protein aggregates can be obtained by washing the pellet with z.
- B. detergent-containing buffers are further enriched.
- the IBs are treated with a denaturing agent, e.g. Guanidine hydrochloride, urea or a urea derivative (see, for example, US Pat. No. 5,453,363) is solubilized and transferred to a suitable non-denaturing buffer (pH> 8.5) by dilution or dialysis.
- a denaturing agent e.g. Guanidine hydrochloride, urea or a urea derivative (see, for example, US Pat. No. 5,453,363) is solubilized and transferred to a suitable non-denaturing buffer (pH> 8.5) by dilution or dialysis.
- the dilution is carried out in such a way that the remaining denaturing agent does not significantly affect the enzymatic hydrolysis of the fusion protein.
- the dilution is preferably carried out in a pulsed manner, for example by dropping the IB solubilizate in buffer (pH> 8.5) which contains no denaturing agent.
- Such a pulse-like dilution enables a practically simultaneous removal of the effect of the denaturing agent and separation of the molecules to be solubilized. This largely avoids an undesired intermolecular interaction (aggregation) of the molecules to be solubilized.
- the fusion proteins produced by the process according to the invention are not broken down in the host cells and can be completely cleaved enzymatically without any significant cleavage taking place in the peptide portion itself (for example PTH or urodilatin).
- the method according to the invention is particularly suitable for the production of urodilatin, parathyroid hormone and their fragments.
- the urodilatin fragments of amino acids 95-126, 99-126 or 102-126 and the parathyroid fragment of amino acids 1-37 are particularly preferably produced.
- Example 1 shows the DNA segments A and B obtained according to Example 1.
- the expression vector for the core-SA-URO (95-126) fusion gene with endoproteinase LysC cleavage site is based on the expression vector pSAM-CORE for core streptavidin.
- the preparation and description of the plasmid pSAM-CORE is described in WO 93/09144 (11).
- the unique Nhel restriction site located at the 3 'end in front of the stop codon of the core-SA gene was used to construct core-SA fusion proteins.
- GGCCGCATGGACCGTATCGGTGCTCAGTCCGGACTGGGTTGCAACTCCTTCCGTT ACTAATGA SEQ ID NO: 5
- DNA segment B (FIG. 1) "aged” (reaction buffer: 12.5 mmol / l Tris-HCl, pH 7.0 and 12.5 mmol / l MgCl2; oligonucleotide concentration: 1 pmol / 60 ⁇ l in each case ) and the hybridization products A and B each subcloned into the polylinker region of the E. coli pUCBM21 vector (Boehringer Mannheim GmbH, Mannheim, Germany) (DNA segment A, interfaces: EcoRI and Notl; DNA segment B, interfaces: Notl and Hindill). The DNA sequence of the two subcloned DNA segments was confirmed by means of DNA sequencing.
- the expression plasmid pSA-EK-URO for the core-SA-URO (95-126) fusion gene was then used in a three-fragment ligation from the Nhe / Notl-DNA segment A, the Notl / Hindlll-DNA segment B and the approx. 2.9 kBp long Nhel / Hindlll-pSAM-CORE vector fragment composed. After double digestion, the DNA segments A and B were isolated with the corresponding endonucleases from the corresponding pUCBM21 plasmid derivatives. The desired plasmid pSA-EK-URO was identified by restriction mapping and the DNA sequence of the linker-urodilatin region was checked again by DNA sequencing.
- PTH Parathormone fragment of amino acids 1-37, amino acid sequence described in Handy, G.N. et al., Proc. Natl. Acad. Be. USA 78 (1981) 7365-7369 (39).
- the vector pSA-EK-PTH for expressing the core-SA-PT ⁇ (1-37) fusion gene with enterokinase cleavage site was produced according to the strategy described in Example 1 for the core-SA-URO (95-126) fusion gene with enterokinase cleavage site.
- the DNA sequence of the two subcloned DNA segments was confirmed by means of DNA sequencing.
- the expression plasmid pSA was then confirmed - EK-PT ⁇ for the core-SA-EK-PTH (l-37) fusion gene in a three-fragment ligation from the Nhel / NcoI-DNA segment C, the NcoI / HindüI-DNA segment D and the approx. 2.9 kBp long Nhel / Hindlll-pSAM-CORE vector fragment composed.
- the DNA segments C and D were isolated after double digestion with the corresponding endonucleases from the corresponding pUCBM21 plasmid derivatives.
- the desired plasmid pSA-EK-PTH was identified by restriction mapping and the DNA sequence of the enterokina elinker PTH region checked again by DNA sequencing
- the plasmid pSA-THRO-PTH is derived from the core-SA-EK-PTH expression plasmid pSA-EK-PTH (see Example 2) by replacing the coding region for the enterokinase linker with a thrombin linker
- the amino acid sequence of the thrombin linker [GDFLAEGLVPR] used (SEQ ID NO 15) is based on the natural thrombin cleavage site in fibrinogen (amino acid position 6-16) and the minimal recognition sequence for thrombin (Carter, P In Ladisch, MR, Willson, RC, Painton, CC, Builder, SE eds (1990) (12))
- the plasmid pSA-EK-PTH was digested with Nhel and PvuII, the approximately 2.9 kbp long Nhel / PvuII-pSA-EK-PTH vector fragment was isolated and with that from the 2 complementary oligonucleotides 9 (SEQ ID NO 11) and 10 (SEQ ID NO 12) DNA segment E (FIG. 3) produced by hybridization
- the desired plasmid construction pSA-THRO-PTH was identified by restriction mapping and the exchanged left region was checked by DNA sequencing.
- the plasmid pSA-TEV-PTH is derived from the core-SA-EK-PTH expression plasmid pSA-EK-PTH (see Example 2) by replacing the coding region for the enterokinase linker with a TEV linker.
- the plant virus TEV NIa proteinase ("tobacco etch virus”) recognizes the amino acid sequence ENLYFQiG / S and cleaves between gin and gly or ser (Dougherty, W.G. et al., (1988)) (13).
- tobacco etch virus recognizes the amino acid sequence ENLYFQiG / S and cleaves between gin and gly or ser (Dougherty, W.G. et al., (1988)) (13).
- the recombinantly produced enzyme was obtained from GIBCO BRL (Life Technologies, Ine Gaithersburg, MD, USA).
- the plasmid pSA-EK-PTH was digested with Nhel and PvuII, the approx. 2.9 kbp long Nhel / PvuII-pSA-EK-PTH vector fragment was isolated and with that from the 2 complementary oligonucleotides JI (SEQ ID NO: 13) and ⁇ 2 (SEQ ID NO: 14) DNA segment F (FIG. 3) produced by hybridization.
- the E. coli Kl 2 strain RM82 (a methionine revertant from ED 8654, Murray, NE et al. (1977)) (14) was in each case with one of the expression plasmids pSA described in Examples 1-4 -EK-URO, pSA-EK-PTH, pSA-THRO-PTH and pSA-TEV-PTH (ampicillin resistance) and the lacW repressor plasmid pUBS500 (kanamycin resistance, preparation and description see: EP-A 0368342) transformed.
- the RM82 / pUBS500 / pSA-EK-URO, RM82 / pUBS500 / pSA-EK-PTH, RM82 / pUBS500 / pSA-THRO-PTH and RM82 / pUBS500 / pSA-TEV-PTH cells were in DYT medium (1% ( w / v) yeast extract, 1% (w / v) Bacto Tryptone (Difco, Detroit, USA) and 0.5% NaCl), with 50 mg / l ampicillin and 50 mg / l kanamycin up to an optical density at 550 nm attracted from 0.6-0.9 and then induced with IPTG (isopropyl- ⁇ -D-thiogalactoside) (1-5 mmol / l final concentration). After an induction phase of 4-8 hours, the cells were harvested by centrifugation and the cell pellets were washed with 25 mmol / l potassium phosphate buffer
- the cell pellets each from 1 ml of centrifuged growth medium (RM82 / pUBS500 / pSA-EK-URO, RM82 / pUBS500 / pSA-EK-PTH, RM82 / pUBS500 / pSA-THRO-PTH and
- RM82 / ⁇ UBS500 / pSA-TEV-PTH cells were resuspended in 0.25 ml 10 mmol / l phosphate buffer, pH 6.8 and 1 mmol / l EDTA and the cells were disrupted by ultrasound treatment. After centrifugation, 1/5 volume of 5xSDS sample buffer (1xSDS sample buffer: 50 mmol / l Tris-HCl, pH 6.8, 1% SDS, 1% mercaptoethanol, 10% glycerol, 0.001% bromophenol blue) was added to the supernatant.
- 5xSDS sample buffer 50 mmol / l Tris-HCl, pH 6.8, 1% SDS, 1% mercaptoethanol, 10% glycerol, 0.001% bromophenol blue
- the insoluble cell debris fraction was resuspended in 0.3 ml of lxSDS sample buffer with 6-8 M urea, the samples were incubated for 5 minutes at 95 ° C. and centrifuged. The proteins were then separated by SDS-polyacrylamide gel electrophoresis (PAGE) (Laemmli, UK (1970)) (15) and stained with Coomassie Brilliant Blue R dye.
- the core-SA fusion proteins synthesized in E. coli were homogeneous and were found exclusively in the insoluble cell debris fraction (IBs). The expression level for the core-SA fusion proteins was 30-50% based on the total E. coli protein
- E coli RM82 / pUBS500 / pSA-EK-URO, RM82 / pUBS500 / pSA-EK-PTH, RM82 / pUBS500 / pSA-THRO-PTH and RM82 / pUBS500 / pSA-TEV-PTH cells were in 1 1 0, 1 mol / 1 Tris-HCl, pH 7.0 suspended at 0 ° C, 300 mg of lysozyme added and incubated for 20 minutes at 0 ° C.
- the cells were then mechanically disrupted by means of high pressure dispersion and the DNA by addition of 2 ml 1 mol / 1 MgCl2 and 10 mg DNAse (Boehringer Mannheim # 154709) digested in 30 minutes at 25 ° C. Then 500 ml 60 mmol / l EDTA, 6% Triton® XI 00 and 1.5 mol / 1 NaCl, pH 7.0 was added and incubated for a further 30 minutes at 0 ° C. The insoluble constituents (cell dummies and IBs) were then sedimented by centrifugation
- the pellet was suspended in 1 1 0.1 mol / 1 Tris-HCl, 20 mmol / l EDTA, pH 6.5, incubated for 30 minutes at 25 ° C. and the IB preparation was isolated by centrifugation
- IB pellet 25 g were suspended in 200 ml of 10 mmol / l Tris-HCl buffer, 8 mol / 1 urea, 10 mmol / l EDTA, pH 7.0 by stirring for 2 hours at 25 ° C. The insoluble constituents were separated by centrifugation and the clear supernatant processed further
- the core-SA fusion proteins with enterokinase interface were in a concentration of 0.3 to 3 mg / ml and a substrate / proteinase ratio of 1:20 to 1: 250 (enterokinase, restriction proteinase from calf intestine, Boehringer Mannheim, Mannheim, Germany) in 50 mmol / l Tris-HCl, pH 8.0 digested at 30 ° C. and the time course of the enzymatic cleavage (kinetics) was analyzed by analytical reversed phase HPLC (see Example 9.1). For this purpose, samples (10 to 100 ⁇ l) were taken at intervals of 1 to 3 hours from the reaction mixture over a period of 6 to 24 hours.
- LysC endoproteinase cleavage (Lys cleavage site)
- the core SA-EK-URO fusion protein was obtained in a concentration of 0.3 to 3 mg / ml and a substrate / proteinase ratio of 1: 1000 to 1: 25000 (LysC endoproteinase from Lysobacter enzymogenes, sequencing grade; Boehringer Mannheim, Mannheim , Germany) in 50 mmol / l Tris-HCl, pH 8.0 at 30 to 35 ° C and the time course of the enzymatic cleavage was analyzed by analytical reversed phase HPLC (see Example 9.1). For this purpose, samples (10 to 100 ⁇ l) were taken at intervals of 1 to 3 hours from the reaction mixture over a period of 6 to 24 hours.
- the core-SA-THRO-PTH fusion protein was in a concentration of 0.3 to 3 mg / ml and a substrate / proteinase ratio of 1:50 to 1: 500 (thrombin from human plasma, Boehringer Mannheim, Mannheim, Germany) in 50 mmol / l Tris-HCl, pH 8.8 digested at 25 to 30 ° C and the time course of the enzymatic cleavage was analyzed by analytical reversed phase HPLC (see Example 9.1). For this purpose, samples (10 to 100 ⁇ l) were taken at intervals of 1 to 3 hours from the reaction mixture over a period of 6 to 24 hours. TEV NIa proteinase cleavage (GluAsnLeuTyrPheGln-i-Gly / Ser cleavage sequence)
- the core-SA-TEV-PTH fusion protein was obtained in a concentration of 0.3 to 3 mg / ml and a substrate / proteinase ratio of 1:50 to 1: 500 (recombinant TEV NIa restriction proteinase, GIBCO BRL Life Technologies, Inc. Gaithersburg , MD, USA) in 50 mmol / l Tris-HCl, pH 8.0, 0.5 mmol / l EDTA and 1 mmol / l DTT at 30 ° C and the time course of the enzymatic cleavage by analytical reversed phase HPLC ( see example 9.1).
- the reaction mixture was used over a period of 6 to
- the released core-SA carrier protein and uncleaved core-SA fusion protein were precipitated from the cleavage mixture by lowering the pH (pH ⁇ 6).
- the cleavage mixture was treated with 1 mol / 1 citric acid to a final concentration of
- the enzymatically released peptides can be further purified using chromatographic methods known to the person skilled in the art.
- the bound material was eluted by a gradient of 0 to 1 mmol / l NaCl in equilibration buffer (10 up to 20 SV, 1 SV / hour). 10.2 Purification of the peptides by reversed phase HPLC
- the sample volume was 10 - 100 ⁇ l, corresponding to 1 100 ⁇ g protein
- the detection was carried out with a UV detector at 220 nm. Chromatography was carried out at a flow rate of 0.5 ml / min.
- the identity and purity of the purified peptides was determined by mass spectroscopy (PD-MS and laser desorption spectroscopy), analytical reversed phase HPLC, isoelectric focusing (Bark, JE et al., J. Forensic Sei. Soc. 16 (1976) 115-120 ( 42), SDS PAGE (Laemmli, UK, Nature 227 (1970) 680-685 (43)) and capillary electrophoresis, compared with a chemically produced standard.
Abstract
Description
Claims
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US09/068,738 US6136564A (en) | 1995-11-16 | 1996-11-06 | Process for the production of peptides by way of streptavidin fusion proteins |
CA002237296A CA2237296C (en) | 1995-11-16 | 1996-11-06 | Process for the preparation of peptides by way of streptavidin fusion proteins |
EP96938115A EP0861325A1 (de) | 1995-11-16 | 1996-11-06 | Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine |
AU75663/96A AU7566396A (en) | 1995-11-16 | 1996-11-06 | Process for the preparation of peptides by way of streptavidin fusion proteins |
JP9518551A JP2000500019A (ja) | 1995-11-16 | 1996-11-06 | ストレプトアビジン融合タンパク質経由でのペプチドの生産方法 |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE19542702 | 1995-11-16 | ||
DE19542702.5 | 1995-11-16 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1997018314A1 true WO1997018314A1 (de) | 1997-05-22 |
Family
ID=7777604
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP1996/004850 WO1997018314A1 (de) | 1995-11-16 | 1996-11-06 | Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine |
Country Status (6)
Country | Link |
---|---|
US (1) | US6136564A (de) |
EP (1) | EP0861325A1 (de) |
JP (1) | JP2000500019A (de) |
AU (1) | AU7566396A (de) |
CA (1) | CA2237296C (de) |
WO (1) | WO1997018314A1 (de) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000075333A1 (en) * | 1999-06-07 | 2000-12-14 | Neorx Corporation | Streptavidin expressed gene fusions and methods of use thereof |
WO2006067221A2 (en) * | 2004-12-22 | 2006-06-29 | Kuros Biosurgery Ag | Michael-type addition reaction functionalised peg hydrogels with factor xiiia incorporated biofactors |
US7144991B2 (en) | 1999-06-07 | 2006-12-05 | Aletheon Pharmaceuticals, Inc. | Streptavidin expressed gene fusions and methods of use thereof |
US8034618B2 (en) | 2001-12-18 | 2011-10-11 | Eldgenossische Technische Hochschule Zurich | PTH containing cell growth matrix |
US8226942B2 (en) | 2007-12-28 | 2012-07-24 | Kuros Biosurgery Ag | PDGF fusion proteins incorporated into fibrin foams |
US8961947B2 (en) | 2007-04-13 | 2015-02-24 | Kuros Biosurgery Ag | Polymeric tissue sealant |
Families Citing this family (30)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20020168718A1 (en) * | 1997-04-03 | 2002-11-14 | California Institute Of Technology | Enzyme-mediated modification of fibrin for tissue engineering |
US7601685B2 (en) * | 1998-08-27 | 2009-10-13 | Eidgenossische Technische Hochschule Zurich | Growth factor modified protein matrices for tissue engineering |
US6958212B1 (en) * | 1999-02-01 | 2005-10-25 | Eidgenossische Technische Hochschule Zurich | Conjugate addition reactions for the controlled delivery of pharmaceutically active compounds |
ATE514729T1 (de) | 1999-02-01 | 2011-07-15 | Eidgenoess Tech Hochschule | Biomaterialien die durch nukleophile reaktion auf konjugierten ungesättigten gruppen addiert sind |
US7291673B2 (en) * | 2000-06-02 | 2007-11-06 | Eidgenossiche Technische Hochschule Zurich | Conjugate addition reactions for the controlled delivery of pharmaceutically active compounds |
MXPA04006021A (es) * | 2001-12-18 | 2005-08-19 | Eth Zuerich | Matrices de proteina modificada con factor de crecimiento para ingenieria de tejidos. |
EP1465989B1 (de) * | 2001-12-18 | 2008-02-20 | Eidgenossisch Technische Hochschule Zurich | Wachstumsfaktor-modifizierte proteinmatrizes zur geweberekonstruktion (tissue engineering) |
US8282912B2 (en) * | 2002-03-22 | 2012-10-09 | Kuros Biosurgery, AG | Compositions for tissue augmentation |
GB0426394D0 (en) * | 2004-12-01 | 2005-01-05 | Health Prot Agency | Fusion proteins |
US8512984B2 (en) | 2004-12-01 | 2013-08-20 | Syntaxin, Ltd. | Non-cytotoxic protein conjugates |
US8399400B2 (en) | 2004-12-01 | 2013-03-19 | Syntaxin, Ltd. | Fusion proteins |
US8778634B2 (en) | 2004-12-01 | 2014-07-15 | Syntaxin, Ltd. | Non-cytotoxic protein conjugates |
US8603779B2 (en) | 2004-12-01 | 2013-12-10 | Syntaxin, Ltd. | Non-cytotoxic protein conjugates |
WO2006073711A2 (en) * | 2005-01-06 | 2006-07-13 | Kuros Biosurgery Ag | Use of a matrix comprising a contrast agent in soft tissues |
US8575101B2 (en) | 2005-01-06 | 2013-11-05 | Kuros Biosurgery Ag | Supplemented matrices for the repair of bone fractures |
EP1833522B1 (de) * | 2005-01-06 | 2016-06-22 | Kuros Biosurgery AG | Ergänzte matrizen zur wiederherstellung von knochenbrüchen |
GB0610867D0 (en) | 2006-06-01 | 2006-07-12 | Syntaxin Ltd | Treatment of pain |
AU2010230563A1 (en) | 2009-04-02 | 2011-09-22 | Roche Glycart Ag | Multispecific antibodies comprising full length antibodies and single chain Fab fragments |
NZ701769A (en) | 2009-09-16 | 2016-06-24 | Genentech Inc | Coiled coil and/or tether containing protein complexes and uses thereof |
TW201138821A (en) | 2010-03-26 | 2011-11-16 | Roche Glycart Ag | Bispecific antibodies |
CN103068846B9 (zh) | 2010-08-24 | 2016-09-28 | 弗·哈夫曼-拉罗切有限公司 | 包含二硫键稳定性Fv片段的双特异性抗体 |
EP2655413B1 (de) | 2010-12-23 | 2019-01-16 | F.Hoffmann-La Roche Ag | Polypeptid-polynukleotid-komplex und verwendung bei der gezielten effektorrest-bereitstellung |
EP2678002A2 (de) | 2011-02-25 | 2014-01-01 | Medtronic, Inc. | Therapie für nierenerkrankungen und/oder herzinsuffizienz |
ES2882852T3 (es) | 2011-03-16 | 2021-12-02 | Kuros Biosurgery Ag | Formulación farmacéutica para la utilización en la fusión espinal |
EP2750697A4 (de) | 2011-09-02 | 2015-03-25 | Medtronic Inc | Chimäre natriuretische peptidzusammensetzungen und verfahren zu ihrer herstellung |
MX2014009565A (es) | 2012-02-10 | 2014-11-10 | Genentech Inc | Anticuerpos monocatenarios y otros heteromultimeros. |
RU2015100656A (ru) | 2012-06-27 | 2016-08-20 | Ф. Хоффманн-Ля Рош Аг | Способ получения конъюгатов fc-фрагмента антитела, включающих по меньшей мере одну связывающую группировку, которая специфически связывается с мишенью, и их применения |
KR20150023889A (ko) | 2012-06-27 | 2015-03-05 | 에프. 호프만-라 로슈 아게 | 2 개 이상의 상이한 결합 단위를 함유하는 맞춤-제작된 고도로 선별적이고 다중-특이적인 표적화 단위의 선별 및 제조 방법 및 이의 용도 |
US20140056870A1 (en) | 2012-08-27 | 2014-02-27 | Allergan, Inc. | Fusion proteins |
WO2016087416A1 (en) | 2014-12-03 | 2016-06-09 | F. Hoffmann-La Roche Ag | Multispecific antibodies |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1986002077A1 (en) * | 1984-10-02 | 1986-04-10 | Meade Harry M | Production of streptavidin-like polypeptides |
GB2180539A (en) * | 1985-07-24 | 1987-04-01 | Glaxo Group Ltd | Microbiological products |
WO1988006596A1 (en) * | 1987-03-02 | 1988-09-07 | Bissendorf Peptide Gmbh | New cardiodilatin fragment, process for preparing same and use thereof |
WO1989003422A1 (en) * | 1987-10-08 | 1989-04-20 | British Bio-Technology Limited | Synthetic gene |
WO1991006564A1 (de) * | 1989-10-27 | 1991-05-16 | Forssmann Wolf Georg | hPTH-FRAGMENT-(1-37), SEINE HERSTELLUNG, DIESES ENTHALTENDE ARZNEIMITTEL UND SEINE VERWENDUNG |
EP0528686A2 (de) * | 1991-08-19 | 1993-02-24 | Suntory Limited | Verfahren zur Herstellung von Peptiden |
-
1996
- 1996-11-06 US US09/068,738 patent/US6136564A/en not_active Expired - Fee Related
- 1996-11-06 EP EP96938115A patent/EP0861325A1/de not_active Withdrawn
- 1996-11-06 AU AU75663/96A patent/AU7566396A/en not_active Abandoned
- 1996-11-06 JP JP9518551A patent/JP2000500019A/ja not_active Ceased
- 1996-11-06 WO PCT/EP1996/004850 patent/WO1997018314A1/de not_active Application Discontinuation
- 1996-11-06 CA CA002237296A patent/CA2237296C/en not_active Expired - Fee Related
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1986002077A1 (en) * | 1984-10-02 | 1986-04-10 | Meade Harry M | Production of streptavidin-like polypeptides |
GB2180539A (en) * | 1985-07-24 | 1987-04-01 | Glaxo Group Ltd | Microbiological products |
WO1988006596A1 (en) * | 1987-03-02 | 1988-09-07 | Bissendorf Peptide Gmbh | New cardiodilatin fragment, process for preparing same and use thereof |
WO1989003422A1 (en) * | 1987-10-08 | 1989-04-20 | British Bio-Technology Limited | Synthetic gene |
WO1991006564A1 (de) * | 1989-10-27 | 1991-05-16 | Forssmann Wolf Georg | hPTH-FRAGMENT-(1-37), SEINE HERSTELLUNG, DIESES ENTHALTENDE ARZNEIMITTEL UND SEINE VERWENDUNG |
EP0528686A2 (de) * | 1991-08-19 | 1993-02-24 | Suntory Limited | Verfahren zur Herstellung von Peptiden |
Non-Patent Citations (3)
Title |
---|
E. WINGENDER ET AL: "Expression of human parathyroid hormone in Escherichia coli", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 264, no. 8, 15 March 1989 (1989-03-15), MD US, pages 4367 - 4373, XP002024630 * |
T. GARDELLA ET AL: "Expression of human parathyroid hormone-(1-84) in Escherichia coli as a Factor X-cleavable fusion protein", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 265, no. 26, 15 September 1990 (1990-09-15), MD US, pages 15854 - 15859, XP002024631 * |
Y. SAITO ET AL: "Bacterial synthesis of recombinant alpha human atrial natriuretic polypeptide", JOURNAL OF BIOCHEMISTRY, vol. 102, no. 1, July 1987 (1987-07-01), pages 111 - 122, XP002022296 * |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000075333A1 (en) * | 1999-06-07 | 2000-12-14 | Neorx Corporation | Streptavidin expressed gene fusions and methods of use thereof |
US7144991B2 (en) | 1999-06-07 | 2006-12-05 | Aletheon Pharmaceuticals, Inc. | Streptavidin expressed gene fusions and methods of use thereof |
US8034618B2 (en) | 2001-12-18 | 2011-10-11 | Eldgenossische Technische Hochschule Zurich | PTH containing cell growth matrix |
WO2006067221A2 (en) * | 2004-12-22 | 2006-06-29 | Kuros Biosurgery Ag | Michael-type addition reaction functionalised peg hydrogels with factor xiiia incorporated biofactors |
WO2006067221A3 (en) * | 2004-12-22 | 2006-09-28 | Kuros Biosurgery Ag | Michael-type addition reaction functionalised peg hydrogels with factor xiiia incorporated biofactors |
US8961947B2 (en) | 2007-04-13 | 2015-02-24 | Kuros Biosurgery Ag | Polymeric tissue sealant |
US9180222B2 (en) | 2007-04-13 | 2015-11-10 | Kuros Biosurgery Ag | Polymeric tissue sealant |
US8226942B2 (en) | 2007-12-28 | 2012-07-24 | Kuros Biosurgery Ag | PDGF fusion proteins incorporated into fibrin foams |
Also Published As
Publication number | Publication date |
---|---|
JP2000500019A (ja) | 2000-01-11 |
US6136564A (en) | 2000-10-24 |
CA2237296C (en) | 2008-10-07 |
AU7566396A (en) | 1997-06-05 |
EP0861325A1 (de) | 1998-09-02 |
CA2237296A1 (en) | 1997-05-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO1997018314A1 (de) | Verfahren zur herstellung von peptiden über streptavidin-fusionsproteine | |
JP3054192B2 (ja) | 副甲状腺ホルモンの製造のための組換えdna法 | |
EP0542863B1 (de) | Expression rekombinanter polypeptide mit verbesserter möglichkeit zur reinigung | |
EP1819729B1 (de) | Verfahren zur herstellung von carboxy-terminal amidierten peptiden | |
EP0305500B1 (de) | Verfahren zur reinigung von rekombinanten polypeptiden | |
DE69233008T2 (de) | Fusionierung von Peptiden und Proteinen mit Thioredoxin und thioredoxin-ähnlichen Molekülen | |
US7105638B1 (en) | Product and process for the production, isolation, and purification of recombinant polypeptide | |
DE69434083T2 (de) | Expression eines fusionspolypeptides, das ohne leadersequenz aus dem cytoplasma transportiert wird | |
EP1931705B1 (de) | Verfahren zur amidierung von polypeptiden mit c-terminalen basischen aminosäuren unter verwendung spezifischer endoproteasen | |
DE60208343T2 (de) | FUSIONSPROTEINE aus hirudin und proinsulin oder insulin | |
HUT73394A (en) | Process for production of protein | |
US20100145033A1 (en) | Novel orthogonal process for purification of recombinant human parathyroid hormone (rhpth) (1-34) | |
NZ338004A (en) | Process for producing peptide with glucagon like peptide-1 (GLP-1) activity by incorporating a protective and helper component to facilitate purification | |
US5389529A (en) | Modified lamβ signal sequence and processes for producing recombinant neurotrophins | |
AU665034B2 (en) | Production of human parathyroid hormone from microorganisms | |
JPH03228682A (ja) | E.コリでの非融合タンパク質の調製方法 | |
EP1066328A1 (de) | Chimäres protein welches eine intramolekulare chaperon-ähnliche sequenz enthältund dessen anwendung zur insulinproduktion | |
AU2238792A (en) | Production and recovery of recombinant neurotrophins | |
Barthelemy et al. | Production and secretion of human interleukin 6 into the periplasm of Escherichia coli: efficient processing of N-terminal variants of hIL6 by the E. coli signal peptidase | |
USRE37919E1 (en) | Recombinant DNA method for production of parathyroid hormone | |
EP0851930A1 (de) | Verfahren zur herstellung von natriuretischen peptiden über streptavidin-fusionsproteine | |
WO1999010483A2 (de) | Autokatalytisch aktivierbare vorstufen von proteasen und deren verwendung | |
KR100473443B1 (ko) | 단백질의 생산방법 | |
JP2002533072A (ja) | β−リポトロピンおよび他のペプチドの組換え合成 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 1996938115 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2237296 Country of ref document: CA Ref country code: CA Ref document number: 2237296 Kind code of ref document: A Format of ref document f/p: F |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1997 518551 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09068738 Country of ref document: US |
|
WWP | Wipo information: published in national office |
Ref document number: 1996938115 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1996938115 Country of ref document: EP |