WO1997006260A1 - Materiel viral et fragments nucleotidiques associes a la sclerose en plaques, a des fins de diagnostic, prophylactiques et therapeutiques - Google Patents
Materiel viral et fragments nucleotidiques associes a la sclerose en plaques, a des fins de diagnostic, prophylactiques et therapeutiques Download PDFInfo
- Publication number
- WO1997006260A1 WO1997006260A1 PCT/FR1996/001244 FR9601244W WO9706260A1 WO 1997006260 A1 WO1997006260 A1 WO 1997006260A1 FR 9601244 W FR9601244 W FR 9601244W WO 9706260 A1 WO9706260 A1 WO 9706260A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- sequence
- sequences
- nucleotide
- msrv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Definitions
- MS Multiple Sclerosis
- CNS central nervous system
- retrovirus different from known human retroviruses
- MS patients 3,4 and 5
- the authors were also able to show that this retrovirus could be transmitted in vitro, that MS patients produced antibodies capable of recognizing proteins associated with the infection of leptomeningeal cells by this retrovirus, and that the expression of the latter could be strongly stimulated by the immediate-early genes of certain herpesviruses (6).
- endogenous retrovirus is very important in the context of our discovery because, in the case of MSRV-1, it has been observed that endogenous retroviral sequences comprising sequences homologous to the MSRV-1 genome, exist in normal human DNA.
- endogenous retroviral elements ERP related to MSRV-1 by all or part of their genome, explains the fact that the expression of the MSRV-1 retrovirus in human cells can interact with close endogenous sequences.
- interactions mainly consist of (i) a transactivation or co-activation of VREs by the replicating retrovirus, (ii) an "illegitimate" packaging of related RNAs of ERVS, or of ERVs - or even cellular RNA - having simply compatible packaging sequences, in the retroviral particles produced by the expression of the replicative strain, sometimes transmissible and sometimes with their own pathogenicity, and (iii) more or less significant recombinations between the co-packaged genomes, in particular in reverse transcription phases, which lead to the formation of hybrid genomes, sometimes transmissible and sometimes with their own pathogenicity.
- any agent associated with, or, co-factor of these interactions responsible for the pathogenesis in question can participate developing a comprehensive and very effective strategy for diagnosis, prognosis, therapeutic monitoring and / or integrated therapy of MS in particular, but also of any other disease associated with the same agents.
- RA rheumatoid arthritis
- the present invention relates first of all to a viral material, in the isolated or purified state, which can be apprehended or characterized in different ways: its genome comprises a nucleotide sequence chosen from the group including the sequences SEQ ID NO 46, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 56, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 89, their complementary sequences, and their equivalent sequences, in particular the nucleotide sequences having, for any series of 100 contiguous monomers, at least 50% and preferably at least 70% homology with respectively said sequences SEQ ID NO 46, SEQ ID NO 51, SEQ ID NO 52, SEQ ID NO 53, SEQ ID NO 56, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60, SEQ ID NO 61, SEQ ID NO 89, and their complementary sequences;
- the pol gene comprises a nucleotide sequence identical or equivalent, partially or totally, to SEQ ID NO 57, excluding SEQ ID NO 1.
- the gag gene comprises a nucleotide sequence identical or equivalent, partially or totally, to SEQ ID NO 88.
- the viral material as defined above is associated with MS. And as defined by reference to the pol or gag gene of MSRV-1, and more particularly to sequences SEQ ID NOS 51, 56, 57, 59, 60, 61, 88 and 89, this viral material is associated with RA.
- the present invention also relates to various nucleotide fragments, each comprising a nucleotide sequence chosen from the group including: (a) all the genomic sequences, partial and total, of the pol gene of the MSRV-1 virus, except the total sequence of the nucleotide fragment defined by SEQ ID NO 1; (b) all genomic sequences, partial and total, of the env gene of MSRV-1;
- genomic sequences, partial or total we include all sequences associated by co-packaging or by co-expression, or recombined.
- such a fragment comprises: - or a nucleotide sequence identical to a partial or total genomic sequence of the pol gene of the MSRV-1 virus, except for the total sequence of the nucleotide fragment defined by SEQ ID NO 1, or identical to any equivalent sequence to said partial or total genomic sequence, in particular homologous to the latter; - Or a nucleotide sequence identical to a partial or total genomic sequence of the env gene of the MSRV-1 virus, or identical to any sequence complementary to said nucleotide sequence, or identical to any sequence equivalent to said nucleotide sequence, in particular homologous to the latter.
- the invention relates to a nucleotide fragment comprising a coding nucleotide sequence, partially or totally identical to a nucleotide sequence chosen from the group including:
- SEQ ID NO 39, SEQ ID NO 63 or SEQ ID NO 90 which may be recognized by sera from patients infected with MSRV-1 virus, or in which the MSRV-1 virus has been reactivated.
- the invention also relates to any nucleic probe for detecting a pathogenic and / or infecting agent associated with MS, capable of hybridizing specifically on any fragment as defined above, belonging to or included in the genome of said pathogenic agent. It also relates to any nucleic probe for detecting a pathogenic and / or infecting agent associated with RA, capable of hybridizing specifically on any fragment as defined above with reference to the pol and gag genes, and in particular with respect to sequences SEQ ID NOS 40, 51, 56, 59, 60, 61, 62, 89 and SEQ ID NOS 39, 63 and 90.
- the invention also relates to a primer for the amplification by polymerization of an RNA or of a DNA of a viral material, comprising a nucleotide sequence identical to or equivalent to at least part of the nucleotide sequence of any fragment as defined above, in particular a nucleotide sequence having, for any series of 10 contiguous monomers, at least 70% of homology with at least said part of said fragment.
- the nucleotide sequence of such a primer is identical to any of the sequences chosen from the group including SEQ ID NO 47 to SEQ ID NO 50, SEQ ID NO 55 and SEQ ID NO 64 SEQ ID NO 86.
- the invention also embraces any RNA or DNA, and in particular a replication vector, comprising a genomic fragment of the viral material as previously defined, or a nucleotide fragment as previously defined.
- the invention also relates to the different peptides encoded by any open reading frame belonging to a nucleotide fragment as defined above, in particular any polypeptide, for example any oligopeptide forming or comprising a antigenic determinant recognized by sera from patients infected with the MSRV-1 virus, and / or in whom the MSRV-1 virus has been reactivated.
- this polypeptide is antigenic, and is encoded by the open reading frame starting in the 5'-3 'direction, at nucleotide 181, and ending at nucleotide 330 of SEQ ID NO 1.
- the invention relates to an antigenic polypeptide, recognized by the sera of patients infected with the MSRV-1 virus, and / or in which the MSRV-1 virus has been reactivated, the peptide sequence of which is identical, partially or completely , or equivalent to the sequence defined by SEQ ID NO 39, SEQ ID NO 63 and SEQ ID NO 87; such a sequence is identical, for example, to any sequence chosen from the group including the sequences SEQ ID NO 41 to SEQ ID NO 44, SEQ ID NO 63 and SEQ ID NO 87.
- the present invention also provides mono- or polyclonal antibodies, directed against the MSRV-1 virus, obtained by immunological reaction of a human or animal organism, to an immunogenic agent constituted by an antigenic polypeptide as defined above.
- - MSRV-1 virus detection reagents comprising as reactive substance, a peptide, in particular antigenic, as defined above, or an anti-ligand, in particular antibody to said peptide;
- diagnostic, prophylactic or therapeutic compositions comprising one or more peptides, in particular antigenic, as defined above, or one or more anti-ligands, in particular antibodies to the peptides, considered above; such a composition is preferably, and by way of example, a vaccine composition.
- the invention also relates to any diagnostic, prophylactic or therapeutic composition, in particular for inhibiting the expression of at least one pathogenic and / or infecting agent associated with MS, comprising a nucleotide fragment as defined above, or a polynucleotide, in particular oligonucleotide, the sequence of which is partially identical to that of said fragment, except that of the fragment having the nucleotide sequence SEQ ID NO 1.
- any diagnostic, prophylactic, or therapeutic composition in particular for inhibiting the expression of at least one pathogen and / or infecting agent associated with RA, comprising a nucleotide fragment as previously defined with reference to the pol and gag genes, and in particular with respect to the sequences SEQ ID NOS 40, 51 , 56, 59, 60, 61, 62 and 89.
- these same fragments, or polynucleotides, in particular oligonucleotides can enter into any suitable compositions, for detecting, according to any suitable method or method, a pathological agent, and / or infecting agent, associated respectively with MS and with RA , in a biological sample.
- a pathological agent and / or infecting agent, associated respectively with MS and with RA
- an RNA and / or a DNA presumed to belong to or originating from said pathological and / or infecting agent, and / or their complementary RNA and / or DNA are brought into contact with such a composition.
- the present invention also relates to any method for detecting the presence or exposure to such a pathological and / or infecting agent, in a biological sample, by bringing this sample into contact with a peptide, in particular antigenic, as defined above, or a anti-ligand, in particular antibodies to this peptide, as defined above.
- a device for detecting the MSRV-1 virus comprises a reagent as defined above, supported by a solid support, immunologically compatible with the reagent, and a means for bringing the biological sample into contact, for example a blood or cerebrospinal fluid sample, capable of containing anti-MSRV-1 antibodies, with this reagent, under conditions allowing a possible immunological reaction, all this with means for detecting the immune complex formed with this reagent.
- the invention also relates to the detection of anti-MSRV-1 antibodies in a biological sample, for example a sample of blood or cerebrospinal fluid, according to which this sample is brought into contact with a reagent such as previously defined, consisting of an antibody, under conditions allowing their possible immunological reaction, and then detecting the presence of the immune complex thus formed with the reagent.
- a biological sample for example a sample of blood or cerebrospinal fluid
- a reagent such as previously defined, consisting of an antibody
- - by strain or isolate is meant any infectious and / or pathogenic biological fraction, containing for example viruses and / or bacteria and / or parasites, generating a pathogenic and / or antigenic power, hosted by a culture or a living host ; by way of example, a viral strain according to the preceding definition may contain a co-infecting agent, for example a pathogenic protist,
- MSRV designates any pathogenic and / or infecting agent associated with MS, in particular a viral species, the attenuated strains of said viral species, or the defective interfering particles or containing coencapsidated genomes or genomes recombined with part of the MSRV-1 genome, derived from this species. It is known that viruses and particularly viruses containing RNA have a variability, consecutive in particular at relatively high rates of spontaneous mutation (7), which will be taken into account below to define the concept of equivalence,
- - by human virus is meant a virus capable of infecting or being hosted by human beings
- homologous nucleotide or peptide sequences - the variant of a virus or of a pathogenic and / or infecting agent according to the invention, comprises at least one antigen recognized by at least one antibody raised against at least one corresponding antigen of said virus and / or of said pathogenic and / or infecting agent, and / or a genome of which any part is detected by at least one hybridization probe, and / or at least one nucleotide amplification primer specific for said virus and / or pathogen and / or infecting agent, such as for example for the virus known as MSRV-1, those having a nucleotide sequence chosen from SEQ ID No.
- SEQ ID N ° 24 20 to SEQ ID N ° 24, SEQ ID N ° 26, SEQ ID N ° 16 to SEQ ID N ° 19, SEQ ID N ° 31 to SEQ ID N ° 33, SEQ ID N ° 45, SEQ ID N ° 47, SEQ ID N ° 48, SEQ ID N ° 49, SEQ ID N ° 50, SEQ ID N ° 45 and their complementary sequences, under determined hybridization conditions well known to those skilled in the art,
- a nucleotide fragment or an oligonucleotide or a polynucleotide is a chain of monomers, or a biopolymer, characterized by the informational sequence of natural nucleic acids, capable of hybridizing to any other nucleotide fragment under predetermined conditions, the chain which can contain monomers of different chemical structures and can be obtained from a natural nucleic acid molecule and / or by genetic recombination and / or by chemical synthesis;
- a nucleotide fragment may be identical to a genomic fragment of the MSRV-1 virus considered by the present invention, in particular a gene of the latter, for example pol or env in the case of said virus;
- a monomer can be a natural nucleotide of nucleic acid, the constituent elements of which are a sugar, a phosphate group and a nitrogenous base; in RNA the sugar is ribose, in DNA the sugar is deoxy-2-ribose; depending on whether it is DNA or RNA, the nitrogen base is chosen from adenine, guanine, uracil, cytosine, thymine; or the nucleotide can be modified in at least one of the three constituent elements; for example, the modification can take place at the base level, generating modified bases such as inosine, methyl-5-deoxycytidine, deoxyuridine, dimethylamino-5-deoxyuridine, diamino-2,6-purine , bromo-5-deoxyuridine and any other modified base promoting hybridization; at the sugar level, the modification can consist in the replacement of at least one deoxyribose by a polyamide (8), and at the phosphate group level
- the capture probe can be immobilized on a solid support by any suitable means, that is to say directly or indirectly, for example by covalence or passive adsorption,
- the detection probe can be marked by means of a marker chosen in particular from radioactive isotopes, enzymes notably chosen from peroxidase and alkaline phosphatase and those capable of hydrolyzing a chromogenic, fluorigenic or luminescent substrate, chromophoric chemical compounds , chromogenic, fluorigenic or luminescent compounds, nucleotide base analogs, and biotin,
- a marker chosen in particular from radioactive isotopes, enzymes notably chosen from peroxidase and alkaline phosphatase and those capable of hydrolyzing a chromogenic, fluorigenic or luminescent substrate, chromophoric chemical compounds , chromogenic, fluorigenic or luminescent compounds, nucleotide base analogs, and biotin
- the probes used for diagnostic purposes of the invention can be used in all known hybridization techniques, and in particular the so-called “DOT-BLOT” (9), “SOUTHERN BLOT” (10), “ NORTHERN BLOT “which is a technique identical to the" SOUTHERN BLOT “technique but which uses RNA as target, the SANDWICH technique (11); advantageously, the SANDWICH technique is used in the present invention, comprising a specific capture probe and / or a specific detection probe, it being understood that the capture probe and the detection probe must have an at least partially different nucleotide sequence,
- any probe according to the present invention can hybridize in vivo or in vitro on RNA and / or on DNA, to block the phenomena of replication, in particular translation and / or transcription, and / or to degrade said DNA and / or RNA,
- a primer is a probe comprising at least six monomers, and advantageously from 10 to 30 monomers, having a specificity of hybridization under determined conditions, for the initiation of an enzymatic polymerization, for example in an amplification technique such that PCR (Polymerase Chain Reaction), in an elongation process, such as sequencing, in a reverse transcription method or the like,
- PCR Polymerase Chain Reaction
- two nucleotide or peptide sequences are said to be equivalent or derived from one another, or from a reference sequence, if functionally the corresponding biopolymers can play substantially the same role, without being identical, vis the application or use considered, or in the technique in which they intervene; two sequences obtained in particular due to natural variability, in particular spontaneous mutation of the species from which they were identified, or induced, are equivalent, as are two homologous sequences, the homology being defined below,
- variable means any modification, spontaneous or induced of a sequence, in particular by substitution, and / or insertion, and / or deletion of nucleotides and / or nucleotide fragments, and / or extension and / or shortening of the sequence at at least one of the ends; unnatural variability can result from the genetic engineering techniques used, for example from the choice of degenerate or non-degenerate synthetic primers, chosen to amplify a nucleic acid; this variability can result in modifications of any starting sequence, considered as a reference, and which can be expressed by a degree of homology with respect to said reference sequence, - homology characterizes the degree of identity of two nucleotide fragments or compared peptides; it is measured by the percentage of identity which is notably determined by direct comparison of nucleoditic or peptide sequences, with respect to reference nucleotide or peptide sequences,
- this percentage of identity has been specifically determined for the nucleotide fragments, in particular clones falling within the scope of the present invention, homologous to the fragments identified for the virus MSRV-1 by SEQ ID N ° 1 to N ° 9, SEQ ID NO 46, SEQ ID NO 51 to SEQ ID NO 53, SEQ ID NO 40, SEQ ID NO 56 and SEQ ID NO 57, as well as for probes and primers homologous to the probes and primers identified by SEQ ID NO 20 to SEQ ID NO 24, SEQ ID NO 26, SEQ ID NO 16 to SEQ ID NO 19, SEQ ID NO 31 to SEQ ID NO 33, SEQ ID NO 45, SEQ ID NO 47, SEQ ID NO 48, SEQ ID NO 49, SEQ ID NO 50, SEQ ID NO 55, SEQ ID NO 40, SEQ ID NO 56 and SEQ ID NO 57; for example, the lowest percentage of identity observed between the various general consensuses in nucleic acids obtained from viral RNA fragments of MSRV-1, derived from the LM7PC
- any nucleotide fragment is said to be equivalent or derived from a reference fragment, if it has a nucleotide sequence equivalent to the sequence of the reference fragment; according to the previous definition, are in particular equivalent to a reference nucleotide fragment:
- any fragment comprising at least eight contiguous nucleotides, coding for a peptide homologous or identical to the peptide coded by the reference fragment,
- any fragment different from the reference fragment by insertion, deletion, substitution of at least one monomer, extension, or shortening at at least one of its ends; for example, any fragment corresponding to the reference fragment, flanked at at least one of its ends by a nucleotide sequence not coding for a polypeptide,
- polypeptide in particular any peptide of at least two amino acids, in particular oligopeptide, protein, extract, separated, or substantially isolated or synthesized, by the intervention of the human hand, in particular those obtained by chemical synthesis , or by expression in a recombinant organism,
- polypeptide partially coded by a nucleotide fragment is meant a polypeptide having at least three amino acids coded by at least nine contiguous monomers included in said nucleotide fragment, -
- An amino acid is said to be analogous to another amino acid, when their respective physico-chemical characteristics, such as polarity, hydrophobicity, and / or basicity, and / or acidity, and / or neutrality, are substantially the same; thus, a leucine is analogous to an isoleucine.
- Any polypeptide is said to be equivalent or derived from a reference polypeptide, if the polypeptides compared have substantially the same properties, and in particular the same antigenic, immunological, enzymological and / or molecular recognition properties; is in particular equivalent to a reference polypeptide:
- any polypeptide in the sequence of which one or more amino acids of the L series are replaced by an amino acid of the D series, and vice versa (e) any polypeptide in the sequence of which a modification of the side chains has been introduced amino acids, such as for example an acetylation of the amino functions, a carboxylation of the thiol functions, an esterification of the carboxylic functions, (f) any polypeptide in the sequence of which one or more peptide bonds have been modified, such as for example the carba bonds , retro, inverso, retro-inverso, reduced, and methylene-oxy,
- the percentage of identity characterizing 1 * homology of two peptide fragments compared is according to the present invention at least 50% and preferably at least 70%. Since a virus possessing reverse transcriptase enzymatic activity can be genetically characterized in the form of both RNA and DNA, both DNA and viral RNA will be used to characterize the sequences relating to a virus having such reverse transcriptase activity, known as MSRV-1 according to the present description.
- first nucleotide sequence is not used to express a particular order, but to define the invention more clearly.
- detection of a substance or agent is meant below both an identification, a quantification, or a separation or isolation of said substance or of said agent.
- FIG. 1 represents general consensuses in nucleic acids of the MSRV-IB clones amplified by the PCR technique in the "pol" region defined by Shih (12), from viral DNA originating from the LM7PC and PLI-2 lines, and identified under the references SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, and SEQ ID NO 6, and the common consensus with amplification primers bearing the reference SEQ ID NO 7,
- FIG. 2 gives the definition of a functional reading frame for each family of type MSRV-1B / "PCR pol", said families A to D being defined respectively by the nucleotide sequences SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, and SEQ ID NO 6, described in Figure l,
- FIG. 3 gives an example of consensus of the sequences of MSRV-2B, identified by SEQ ID NO 11,
- FIG. 4 is a representation of the reverse transcriptase (RT) activity in dpm (disintegration per minute), in the sucrose fractions taken from a gradient of purification of the virions produced by the B lymphocytes in culture of a patient suffering from SEP,
- RT reverse transcriptase
- FIG. 5 gives, under the same experimental conditions as in FIG. 4, the assay of the reverse transcriptase activity in the culture of a line of B lymphocytes obtained from a control free from MS,
- FIG. 8 shows the nucleotide sequence SEQ ID NO 2 of the clone Fll-1; the part identified between the two arrows in the region of the primer corresponds to a variability imposed by the choice of the primer used for the cloning of Fll-1; in this same figure, the translation into amino acids is shown,
- FIG. 9 shows the nucleotide sequence SEQ ID NO 1, and a functional frame for possible reading in amino acids of SEQ ID NO 1; on this sequence, the consensus sequences of the pol gene are underlined,
- FIGS. 10 and it give the results of a PCR, in the form of a photograph under ultraviolet light of an agarose gel impregnated with ethidium bromide, of the amplification products obtained from the primers identified by SEQ ID NO 16, SEQ ID NO 17, SEQ ID NO 18, and SEQ ID NO 19.
- FIG. 12 gives a matrix representation of the homology between SEQ ID NO 1 of MSRV-1 and that of an endogenous retrovirus called HSERV9; this homology of at least 65% is highlighted by a solid line, the absence of a line signifying homology of less than 65%;
- FIG. 13 represents the nucleotide sequence SEQ ID NO 46 of the clone FBd3,
- FIG. 14 shows the sequence homology between the clone FBd3 and the HSERV-9 retrovirus
- - Figure 15 shows the nucleotide sequence SEQ ID NO 51 of the t pol clone;
- Figures 16 and 17 respectively represent the nucleotide sequences SEQ ID NO 52 and SEQ ID NO 53, of the clones JLBcl and JLBc2 respectively;
- FIG. 18 represents the sequence homology between the clone JLBcl and the clone FBd3,
- FIG. 20 shows the sequence homology between the JLBcl and JLBc2 clones
- - Figures 21 and 22 show the sequence homology between the HSERV-9 retrovirus, and respectively the JLBcl and JLBc2 clones;
- FIG. 23 shows the nucleotide sequence SEQ ID NO 56 of the clone GM3;
- - Figure 24 shows the sequence homology between the HSERV-9 retrovirus and the GM3 clone;
- - Figure 25 shows the location of the different clones studied, relative to the genome of the known retrovirus ERV9;
- - Figure 26 shows the position of clones F11-1, M003-P004, MSRV-IB and PSJ17 in the region hereinafter called MSRV-1 pol *;
- - Figure 27 exploded into three successive figures 27a, 27b, 27c shows a possible reading frame, covering the entire pol gene;
- - Figure 28 shows according to SEQ ID NO 40, the nucleotide sequence coding for the peptide fragment POL2B, having the amino acid sequence identified by SEQ ID NO 39;
- - Figure 29 shows the OD values
- FIG. 30 represents the OD values (ELISA tests) at 492 nm obtained for 36 patient sera
- the bar on the far right represents a graphical scale standard unrelated to the serological test; - Figure 34 shows SEQ ID NO 41 and
- FIG. 35 represents the nucleotide sequence SEQ ID NO 59 of the clone LB19 and three potential reading frames in amino acids of SEQ ID NO 59;
- - Figure 36 shows the nucleotide sequence SEQ ID NO 88 (GAG *) and a potential reading frame in amino acids of SEQ ID NO 88;
- - Figure 37 shows the sequence homology between the clone FBdl3 and the HSERV-9 retrovirus; according to this representation, the solid line means a percentage of homology greater than or equal to 70% and the absence of line means a percentage of less homology;
- FIG. 38 shows the nucleotide sequence SEQ ID NO 61 of the FP6 clone and three potential reading frames in amino acids of SEQ ID NO 61;
- FIG. 39 represents the nucleotide sequence SEQ ID NO 89 of the clone G + E + A and three potential reading frames in amino acids of SEQ ID NO 89;
- FIG. 40 shows a reading frame found in region E and coding for a retroviral protease MSRV-1 identified by SEQ ID NO 90;
- FIG. 41 represents the response of each serum of patients suffering from MS indicated by the symbol (+) and of healthy patients symbolized by (-), tested with an anti-IgG antibody expressed in net optical density at 492 nm;
- FIG. 42 shows the response of each serum from MS patients indicated by the symbols (+) and (QS) and healthy patients (-), tested with an anti-IgM antibody expressed in net optical density at 492 nm.
- EXAMPLE 1 OBTAINING CLONES NAMED MSRV-IB AND MSRV-2B, DEFINING RESPECTIVELY AN MSRV-1 RETROVIRUS AND A CO-INFECTING AGENT MSRV2, BY "NICHEATED” PCR AMPLIFICATION OF POL CONSERVED RETROVIRUS REGIONS, ON PREPARATIONS OF VIRIES LM7PC AND PLI-2 LINES
- a PCR technique derived from the technique published by Shih (12) was used. This technique allows, by treatment of all the components of the reaction medium by DNase, to eliminate all traces of contaminating DNA. It allows in parallel, by the use of different but overlapping primers in two successive series of PCR amplification cycles, to increase the chances of amplifying a cDNA synthesized from a small quantity of RNA at the start and again reduced in the sample by the parasitic action of DNAse on RNA. Indeed, DNase is used under conditions of excess activity which make it possible to eliminate all traces of contaminating DNA, before inactivation of this enzyme remaining in the sample by heating at 85 ° C for 10 minutes.
- sequences cloned and sequenced from these samples correspond in particular to two types of sequences: a first type of sequence, found in the majority of clones (55% of the clones originating from POL-2 isolates from PLI-2 cultures, and, 67 % of clones from MS7PG isolates from LM7PC cultures), which corresponds to a family of “pol” sequences close but different from the endogenous human retrovirus called ERV-9 or HSERV-9, and a second type of sequence which corresponds to sequences very highly homologous to a sequence attributed to another infectious and / or pathogenic agent called MSRV-2.
- the first type of sequence representing the majority of clones consists of sequences whose variability makes it possible to define four subfamilies of sequences. These subfamilies are close enough to each other that they can be considered as quasi-species originating from the same retrovirus, as is well known for the HIV-1 retrovirus (14), or as the result of l interference with several endogenous proviruses co-regulated in producer cells. These more or less defective endogenous elements are sensitive to the same regulatory signals possibly generated by a replicative provirus, since they belong to the same family of endogenous retroviruses (15).
- This new family of endogenous retroviruses or, alternatively, this new retroviral species from which the generation of quasi-species has been obtained in culture, and which contains a consensus of the sequences described below is called MSRV-IB.
- FIG. 1 are presented the general consensuses of the sequences of the different MSRV-IB clones sequenced during this experiment, these sequences being respectively identified by SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, and SEQ ID NO 6. These sequences have a nucleic acid homology ranging from 70% to 88% with the HSERV9 sequence referenced X57147 and M37638 in the Genebank® database.
- SEQ ID NO 3 SEQ ID NO 4
- SEQ ID NO 5 SEQ ID NO 6
- SEQ ID NO 6 SEQ ID NO 6
- sequence MSRV-2B The second type of sequence representing the majority of the clone sequences is represented by the sequence MSRV-2B presented in FIG. 3 and identified by SEQ ID NO 11. The differences observed in the sequences corresponding to the PCR primers are explained by the use of degenerate primers in mixture used under different technical conditions.
- sequence MSRV-2B (SEQ ID NO 11) is sufficiently different from the retroviral sequences already described in the databases so that it can be argued that it is a region of sequence belonging to a new infectious agent, called MSRV-2.
- This infectious agent would appear a priori, according to the analysis of the first sequences obtained, to a retrovirus, but, given the technique used to obtain this sequence, it could also be a DNA virus whose genome codes for an enzyme that incidentally has reverse transcriptase activity, as is the case, for example, for the hepatitis B virus, HBV (12).
- the random nature of the degenerate primers used for this PCR amplification technique may very well have made it possible, due to unforeseen sequences of sequences or of sites conserved in the gene of a related enzyme, to amplify a nucleic acid from a prokaryotic or eukaryotic (protist) pathogen and / or co-infecting agent.
- EXAMPLE 2 OBTAINING CLONES CALLED MSRV-IB
- RNA nucleic material present in a fraction of virions purified at the peak of reverse transcriptase activity "of LM7 type", on a sucrose gradient. according to the technique described by H. Perron (13), and according to the protocols mentioned in Example 1, from a spontaneous lymphoblastoid line, obtained by self-immortalization in culture of B lymphocytes of an MS patient seropositive for the Epstein-Barr virus (EBV), after culturing blood lymphoid cells in an appropriate culture medium containing an appropriate concentration of cyclosporin A.
- FIG. 4 A representation of reverse transcriptase activity in the sucrose fractions taken on a gradient of purification of the virions produced by this line is presented in FIG. 4.
- the culture supernatants of a line B obtained under the same conditions itions from an MS-free control were treated under the same conditions, and the assay of reverse transcriptase activity in the fractions of the sucrose gradient was negative everywhere (background noise) and is presented in the FIG. 5.
- Fraction 3 of the gradient corresponding to the SEP line B and the same fraction without reverse transcriptase activity of the non-SEP control gradient were analyzed by the same RT-PCR technique as previously, derived from Shih (12), followed by the same cloning and sequencing steps as described in example 1.
- EXAMPLE 3 OBTAINING A PSJ17 CLONE, DEFINING AN MSRV-1 RETROVIRUS, BY REACTION OF ENDOGENOUS REVERSE TRANSCRIPTASE ON A VIRION PREPARATION FROM THE PLI-2 LINE.
- This approach aims to obtain DNA sequences retrotranscribed from the RNA supposed to be retroviral in the isolate, by using the reverse transcriptase activity present in this same isolate.
- This reverse transcriptase activity can theoretically only work in the presence of a retroviral RNA, linked to a primer tRNA or hybridized to short strands of DNA already retranscribed in retroviral particles (16).
- obtaining specific retroviral sequences in material contaminated with cellular nucleic acids has been optimized according to these authors thanks to the specific enzymatic amplification of the viral RNA portions by viral reverse transcriptase activity.
- the authors have for this, determined the particular physicochemical conditions under which this reverse transcription enzymatic activity on RNA contained in virions could be effective in vitro. These conditions correspond to the technical description of the protocols presented below (endogenous RT reaction, purification, cloning and sequencing).
- the molecular approach consisted in using a concentrated, but not purified, virion preparation obtained from culture supernatants of the PLI-2 line prepared according to the following method: the culture supernatants are collected twice a week, pre- centrifuged at 10,000 rpm for 30 minutes to remove cell debris, and then frozen at -80 ° C or used as is for the following steps. The fresh or thawed supernatants are centrifuged on a cushion of PBS-glycerol 30% at 100,000 g (or 30,000 rpm in an LKB-HITACHI rotor of the 45 T type) for 2 h at 4 ° C.
- the sedimented pellet After removal of the supernatant, the sedimented pellet is taken up in a small volume of PBS and constitutes the concentrated, but not purified, virion fraction.
- This concentrated but not purified viral sample was used to carry out a so-called endogenous reverse transcription reaction, as described below.
- a volume of 200 ⁇ l of virion purified according to the protocol described above and containing a reverse transcriptase activity of approximately 1-5 million dpm is thawed at 37 ° C. until a liquid phase appears, then placed on ice.
- a 5-fold concentrated buffer was prepared with the following components: Tris-HCl pH 8.2, 500 mM; 75 mM NaCl; 25 mM MgC12; DTT 75 mM and NP 40 0.10%; 100 ⁇ l of 5X buffer + 25 ⁇ l of a 100 mM dATP solution + 25 ⁇ l of a 100 mM dTTP solution + 25 ⁇ l of a 100 mM dGTP solution + 25 ⁇ l of a 100 mM dCTP solution + 100 ⁇ l of sterile distilled water + 200 ⁇ l of the suspension of virions (TI activity of 5 million DPM) in PBS were mixed and incubated at 42 ° C for 3 hours.
- the reaction mixture is directly added to a buffered phenol / chloroform / isoamyl alcohol mixture (Sigma ref. P 3803); the aqueous phase is collected and a volume of sterile distilled water is added to the organic phase to re-extract the residual nucleic material.
- the collected aqueous phases are combined and the nucleic acids contained are precipitated by addition of 3M sodium acetate, pH 5.2 at 1/10 volume + 2 volumes of ethanol + 1 ⁇ l of glycogen (Boehringer-Mannheim ref. 901 393) and placing the sample at -20 ° C for 4 hours or overnight at + 4 ° C.
- the precipitate obtained after centrifugation is then washed with 70% ethanol and resuspended in 60 ml of distilled water.
- the products of this reaction were then purified, cloned and sequenced according to the protocol described below: blunt-ended DNA with unpaired adenines at the ends were generated: a "filling" reaction was first carried out: 25 ⁇ l of the previously purified DNA solution were mixed with 2 ⁇ l of a 2.5 mM solution containing, in equimolar amount, dATP + dGTP + dTTP + dCTP / 1 ⁇ l of T4 DNA polymerase (Boehringer-Mannheim ref .
- the DNA precipitated after centrifugation is resuspended in 10 ⁇ l of 10 mM Tris pH 7.5 buffer. Then, 5 ⁇ l of this suspension were mixed with 20 ⁇ l of Taq 5X buffer, 20 ⁇ l of 5mM dATP, 1 ⁇ l (5U) of Taq DNA polymerase (Amplitaq TM) and 54 ⁇ l of sterile distilled water. This mixture is incubated for 2 h at 75 ° C. with an oil film on the surface of the solution. The DNA suspended in the aqueous solution taken from below the oil film after incubation is precipitated as described above and resuspended in 2 ⁇ l of sterile distilled water.
- the DNA obtained was inserted into a plamide using the TA Cloning TM kit.
- the 2 ⁇ l of DNA solution were mixed with 5 ⁇ l of sterile distilled water, l ⁇ l of 10 times concentrated ligation buffer "10X LIGATION BUFFER", 2 ⁇ l of "pCR TM VECTOR” (25 ng / ml) and 1 ⁇ l of "TA DNA LIGASE”. This mixture was incubated overnight at 12 ° C. The following steps were carried out according to the instructions in the TA Cloning® kit (British Biotechnology).
- the white colonies of recombinant bacteria were subcultured to be cultured and allow the extraction of the plasmids incorporated according to the so-called "miniprep" procedure (17).
- the plasmid preparation of each recombinant colony was cut with an appropriate restriction enzyme and analyzed on agarose gel.
- the plasmids having an insert detected under UV light after labeling the gel with ethidium bromide, were selected for sequencing the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA cloning kit® .
- P004 and P005 have been defined to amplify RNA from purified POL-2 virions. Control reactions were carried out in order to control the presence of contaminants (reaction on water).
- the amplification consists of an RT-PCR step according to the protocol described in Example 2, followed by a "nested" PCR according to the PCR protocol described in document EP-A-0 569 272.
- primers M001 and P004 or P005 are used.
- the primers M002-A or M003-BCD, and the primer P004 are used.
- the primers are positioned as follows:
- primer M001 GGTCITICCICAIGG (SEQ ID NO 20)
- primer M002-A TTAGGGATAGCCCTCATCTCT (SEQ ID NO 21)
- primer M003-BCD TCAGGGATAGCCCCCATCTAT (SEQ ID NO 22)
- primer P004 AACCCTTTGCCACTACATCAATTT 23) : GCGTAAGGACTCCTAGAGCTATT (SEQ ID NO 24)
- the “nested” amplification product obtained and called M003-P004 is presented in FIG. 7, and corresponds to the sequence SEQ ID NO 8.
- the specific primers 3 • used in the kit protocol for the synthesis of cDNA and the PCR amplification are respectively complementary to the following MSRV-1 sequences: CDNA: TCATCCATGTACCGAAGG (SEQ ID N ° 25) amplification: ATGGGGTTCCCAAGTTCCCT (SEQ ID N ° 26 )
- the products resulting from the PCR were purified after purification on agarose gel according to conventional methods (17), then resuspended in 10 ml of distilled water.
- One of the properties of Taq polymerase consists in adding an adenine to the 3 'end of each of the two DNA strands, the DNA obtained was directly inserted into a plamide using the TA Cloning TM kit (British Biotechnology ).
- the plasmid preparation of each recombinant colony was cut with an appropriate restriction enzyme and analyzed on agarose gel.
- the plasmids having an insert detected under UV light after labeling the gel with ethidium bromide, were selected for sequencing the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA Cloning Kit® .
- the reaction prior to sequencing was then carried out according to the method recommended for the use of the sequencing kit "Prism ready reaction kit dye deoxyterminator cycle sequencing kit" (Applied Biosystems, ref. 401384) and automatic sequencing was carried out with the "Automatic Sequencer, model 373 A" Applied Biosystems device according to the manufacturer's instructions.
- This technique was first applied to two fractions of purified virion as described below, on sucrose from the "POL-2" isolate produced by the PLI-2 line on the one hand, and from the MS7PG isolate produced by the LM7PC line on the other hand.
- the culture supernatants are collected twice a week, pre-centrifuged at 10,000 rpm for 30 minutes to remove cell debris, and then frozen at -80 ° C or used as such for the following steps.
- the fresh or thawed supernatants are centrifuged on a cushion of PBS-glycerol 30% at 100,000 g (or 30,000 rpm in an LKB-HITACHI rotor of the 45 T type) for 2 h at 4 ° C.
- the sedimented pellet is taken up in a small volume of PBS and constitutes the fraction of concentrated, but not purified, virions.
- the concentrated virus is then deposited on a sucrose gradient in a sterile PBS buffer (15 to 50% w / w) and ultracentrifuged at 35,000 rpm (100,000 g) for 12 h at + 4 ° C in a bucket rotor . 10 fractions are collected and 20 ⁇ l are taken from each fraction after homogenization to assay the reverse transcriptase activity therein according to the technique described by H. Perron (3).
- the fractions containing the RT activity peak "of LM7 type" are then diluted in sterile PBS buffer and ultracentrifuged for one hour at 35,000 rpm (100,000 g) to sediment the viral particles.
- the purified virion pellet thus obtained is then taken up in a small volume of a buffer suitable for the extraction of RNA.
- the cDNA synthesis reaction mentioned above is carried out on this RNA extracted from purified extracellular virion.
- the PCR amplification according to the technique cited above made it possible to obtain the clone Fl-11 whose sequence identified by SEQ ID NO 2, is presented in FIG. 8.
- This clone makes it possible to define, with the different clones previously sequenced, a region of considerable length (1.2 kb) representative of the "pol" gene of the MSRV-1 retrovirus, as presented in FIG. 9.
- This sequence called SEQ ID NO 1 is reconstructed from different clones overlapping at their ends, correcting the artefacts linked to the primers and to the amplification or cloning techniques, which would artificially interrupt the reading frame of " the whole.
- This sequence will be identified below under the name "MSRV-1 pol * region. Its degree of homology with the HSERV-9 sequence is represented in FIG. 12. In FIG. 9, the potential reading frame with its translation in amino acids is presented below the nucleic acid sequence.
- MSRV-1 and MSRV-2 IN DIFFERENT PLASMA SAMPLES FROM PATIENTS WITH MS OR WITNESSES.
- a PCR technique was used to detect the MSRV-1 and MSRV-2 genomes in plasmas obtained after blood sampling on EDTA from patients with MS and non-MS controls.
- Extraction of plasma RNA was carried out according to the technique described by P. Chomzynski (20), after adding a volume of the buffer containing guanidinium thiocyanate to 1 ml of plasma kept frozen at -80 ° C after collection.
- the primers used for this second step are the following:
- RNA MSRV-1 For MSRV-1, the amplification was carried out in two stages. In addition, the nucleic acid sample is previously treated with DNase and a PCR control without RT (reverse transcriptase AMV) is carried out on the two amplification stages, so as to verify that the RT-PCR amplification comes exclusively RNA MSRV-1. In the event of a control without positive RT, the aliquoted sample of starting RNA is again treated with DNase and amplified again.
- RNAse . Inhibitor Boehringer-Mannheim
- RNAse-free DNAse Boehringer-Mannheim
- buffer pH 5 containing 0.1 M / 1 of sodium acetate and 5 mM / 1 of MgS ⁇ 4
- ⁇ e mixture is incubated 15 min. at 20 ° C and brought to 95 ° C for 1.5 min. in a "thermocycler”.
- the first stage of MSRV-1 RT-PCR is carried out according to a variant of the RNA amplification method as described in patent application No. EP-A-0 569 272.
- the stage of synthesis of CDNA is performed at 42 ° C for one hour; PCR amplification takes place over 40 cycles, with an annealing temperature of 53 ° C.
- the reaction volume is lOO ⁇ l.
- the primers used for this first step are the following:
- the primers used for this second step are the following:
- FIGS. 10 and 11 the PCR results are presented in the form of photographs under ultraviolet light of agarose gels impregnated with ethidium bromide, in which an electrophoresis of the PCR amplification products deposited separately in electrophoresis was carried out. the different wells.
- the top photograph ( Figure 10) shows the result of the specific MSRV-2 amplification.
- Well number 8 contains a mixture of DNA molecular weight markers and wells 1 to 7 represent, in order, the products amplified from total plasma RNAs from 4 healthy controls free of MS (wells 1 to 4) and 3 patients with MS, at different stages of the disease (wells 5 to 7).
- MSRV-2 nucleic material is detected in the plasma of one of the 3 MS cases tested and in none of the 4 control plasmas. Other results obtained over larger series confirm these results.
- FIG. 11 represents the result of the specific amplification by RT-PCR "nested" MSRV-1: well No. 1 contains the PCR product carried out with water alone, without addition of AMV reverse transcriptase ; well No. 2 contains the PCR product carried out with water alone, with the addition of AMV reverse transcriptase; well number 3 contains a mixture of DNA molecular weight markers; wells 4 to 13 contain, in order, the products amplified from the total RNAs extracted from sucrose gradient fractions (collected from top to bottom) on which a virion pellet from a culture supernatant infected with MSRV-1 and MSRV-2 was centrifuged at equilibrium according to the protocol described by H. Perron (13); in well 14 nothing has been deposited; in wells 15 to 17, the amplified products of RNA extracted from plasmas originating from 3 different patients suffering from MS were deposited at different stages of the disease.
- the MSRV-1 retroviral genome is well found in the fraction of the sucrose gradient containing the peak of reverse transcriptase activity measured according to the technique described by H. Perron (3), with very high intensity (fraction 5 of the gradient, deposited in well # 8). A slight amplification took place in the first fraction (well No. 4) probably corresponding to RNA released by lysed particles which floated on the surface of the gradient; similarly, aggregated debris sedimented in the last fraction (bottom of tube) resulting in some copies of the MSRV-1 genome which gave rise to a weak amplification. On the 3 MS plasmas tested in this series, the MSRV-1 RNA was found in one case, producing a very intense amplification (well n ° 17).
- MSRV-1 For MSRV-1, the above-mentioned nested PCR products can be tested in two ELOSA systems making it possible to separately detect a consensus A and a consensus B + C + D of MSRV-1, corresponding to the subfamilies described in Example 1 and Figures 1 and 2. Indeed, the sequences close to consensus B + C + D are found essentially in RNA samples from MSRV-1 virions purified from cultures or amplified in extracellular biological fluids of MS patients, whereas the sequences close to consensus A are essentially found in normal human cellular DNA.
- the ELOSA / MSRV-1 system for the capture and specific hybridization of PCR products of subfamily A uses a capture oligonucleotide cpVIA with a 5 'amine bond and a biotinylated detection oligonucleotide dpVIA respectively having the sequence:
- the ELOSA capture oligonucleotide of the PCR-nested products MSRV-1 carried out with the primers identified by SEQ ID NO 16 and SEQ ID NO 17, optionally followed by amplification with the primers identified by SEQ ID NO 18 and SEQ ID NO 19 on patient samples;
- the ELOSA / MSRV-1 system for the capture and specific hybridization of PCR products of the B + C + D subfamily uses the same biotinylated detection oligonucleotide dpVIA and a capture oligonucleotide cpVlB with a 5'amine bond. for sequence:
- the ELOSA capture oligonucleotide of the subfamily B + C + D of PCR products - "nested" MSRV-1 carried out with the primers identified by SEQ ID NO 16 and SEQ ID NO 17, optionally followed by amplification with the primers identified by SEQ ID NO 18 and SEQ ID NO 19 on patient samples.
- This ELOSA detection system made it possible to verify that none of the PCR products thus amplified from plasmas of MS patients treated with DNase contained sequence of the subfamily A and that all of them were positive with the consensus of the subfamilies. B, C and D.
- MSRV-2 For MSRV-2, a similar ELOSA technique was evaluated on isolates from infected cell cultures using the following PCR amplification primers:
- 5 'GMGGCCAGCAGSAKGTCATCCA 3' corresponding to a PCR primer MSRV-2 3 •, for PCR on culture samples, and capture oligonucleotides with an amine bond in 5 'cpV2, and biotinylated detection dpV2, having as respective sequences:
- MSRV-2 carried out with the primers SEQ ID NO 34 and SEQ ID NO 35, or possibly with the degenerate primers defined by Shih (12).
- This PCR amplification system with a pair of primers different from those previously described for amplification on patient samples, made it possible to confirm infection with MSRV-2 of in vitro cultures and of samples d nucleic acids used for molecular biology work.
- Example 5 a PCR technique derived from the technique published by Frohman (19) was used.
- the derived technique allows, using a specific primer 3 ′ of the genome to be amplified, to extend the sequence towards the 5 * region of the genome to be analyzed.
- This technical variant is described in the documentation of the firm "Clontech Laboratories Inc., (Palo-Alto California, USA) supplied with its product” 5'-AmpliFINDER TM RACE Kit ", which was used on a fraction of purified virion as previously described.
- the products resulting from the PCR were extracted after purification on agarose gel according to conventional methods (17), then resuspended in 10 ml of distilled water.
- One of the properties of Taq polymerase consists in adding an adenine to the 3 'end of each of the two DNA strands, the DNA obtained was directly inserted into a plamide using the TA Cloning TM kit (British Biotechnology ).
- the 2 ⁇ l of DNA solution were mixed with 5 ⁇ l of sterile distilled water, 1 ⁇ l of 10 times concentrated ligation buffer "10X LIGATION BUFFER", 2 ⁇ l of "pCR TM VECTOR" (25 ng / ml ) and 1 ⁇ l of "TA DNA LIGASE".
- the plasmids having an insert detected under UV light after labeling the gel with ethidium bromide were selected for sequencing the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA Cloning Kit®.
- the reaction prior to sequencing was then carried out according to the method recommended for the use of the sequencing kit "Prism ready reaction kit dye deoxyterminator cycle sequencing kit” (Applied Biosystems, ref. 401384) and automatic sequencing was carried out with the "automatic sequencer” model 373 A Applied Biosystems according to the manufacturer's instructions.
- the sedimented pellet constitutes the sample of concentrated, but not purified, virions.
- the pellet thus obtained is then taken up in a small volume of a buffer suitable for the extraction of RNA.
- the cDNA synthesis reaction mentioned above is carried out on this RNA extracted from concentrated extracellular virion.
- the RT-PCR amplification according to the technique cited above made it possible to obtain the clone FBd3 whose sequence identified by SEQ ID No. 46, is presented in FIG. 13.
- the sequence homology between the clone FBd3 and the HSERV-9 retrovirus is represented on the matrix table with a solid line, for any partial homology greater than or equal to 65%.
- homologies exist in the flanking regions of the clone (with the pol gene in 5 'and with the env gene and then the LTR in 3'), but that the internal region is completely divergent and has no homology, even weak , with the HSERV9 "env" gene.
- the FBd3 clone contains a longer "env” region than that described for the defective endogenous HSERV-9; it can thus be seen that the internal diverging region constitutes an "insert" between the regions of partial homology with the defective genes HSERV-9.
- oligonucleotides F1, B4, F6 and B1 were defined to amplify RNA from concentrated virions of the POL2 and MS7PG strains. Control reactions were carried out in order to control the presence of contaminants (reaction on water).
- the amplification consists of a first RT-PCR step according to the protocol described in the patent application
- EP-A-0 569 272 followed by a second stage of PCR carried out on 10 ⁇ l of product of the first stage with primers internal to the first amplified region
- primers F1 and B4 are used in the first RT-PCR cycle.
- primers F6 and the primer B1 are used in the second PCR cycle.
- the primers are positioned as follows: Fl F6 Bl B4
- primer Fl TGATGTGAACGGCATACTCACTG (SEQ ID NO 47)
- primer B4 CCCAGAGGTTAGGAACTCCCTTTC (SEQ ID NO 48)
- primer F6 GCTAAAGGAGACTTGTGGTTGTCAG (SEQ ID NO 49)
- primer Bl CAACATGGGCATTTCGGATTAG (SEQ ID 50)
- the “nested” amplification product obtained and called “t pol” is presented in FIG. 15, and corresponds to the sequence SEQ ID NO 51.
- a cDNA bank was produced according to the procedure described by the manufacturer of the kits "cDNA synthesis module, cDNA rapid adaptator ligation module, cDNA rapid cloning module, lambda gtlO in vitro packaging module" (Amersham, ref RPN1256Y / Z, RPN1712, RPN1713, RPN1717, N334Z) from the messenger RNA extracted from cells of a B lymphoblastoid line as described in Example 2, established from the lymphocytes of a patient suffering from MS and having a reverse transcriptase activity detectable according to the technique described by Perron et al. (3).
- Oligonucleotides were defined to amplify cDNA cloned in the nucleic bank between the 3 'region of the clone PSJ17 (pol) and the 5' region (LTR) of the clone FBd3. Control reactions were carried out in order to control the presence of contaminants (reaction on water). PCR reactions carried out on the nucleic acids cloned in the library with different pairs of primers made it possible to amplify a series of clones linking pol sequences to env or LTR sequences of MSRV-1 type.
- Two clones are representative of the sequences obtained in the cell cDNA bank: - the clone JLBcl, whose sequence SEQ ID NO 52 is presented in FIG. 16; - the clone JLBc2, whose sequence SEQ ID NO 53 is presented in FIG. 17.
- JLB2 and FBd3 includes, with some sequence and size variations of the "insert", the additional sequence absent ("inserted") in the env HSERV-9 sequence, as described in Example 8.
- the cloned "pol" region is very homologous to HSERV-9, does not have a reading frame (taking into account sequence errors induced by the techniques used, up to and including the automatic sequencer) and diverges from the sequences MSRV-1 obtained from virions. Since these sequences were cloned from the RNA of cells expressing MSRV-1 particles, it is likely that they originate from endogenous retroviral elements related to the ERV9 family; this is all the more so since the pol and env genes are present on the same RNA which is obviously not the MSRV-1 genomic RNA. Some of these ERV9 elements have functional LTRs which can be activated by replicative viruses coding for homologous or heterologous transactivators. Under these conditions, the relationship between MSRV-1 and HSERV-9 makes it probable that transactivation of defective endogenous ERV9 elements (or not) will be carried by homologous or even identical MSRV-l transactivating proteins.
- Such a phenomenon can induce viral interference between the expression of MSRV-1 and related endogenous elements.
- Such interference generally leads to a so-called “defective-interfering" expression, certain characteristics of which have been found in the cultures studied infected with MSRV-1.
- such a phenomenon is not without generating the expression of polypeptides, or even endogenous retroviral proteins which are not necessarily tolerated by the immune system.
- Such a pattern of aberrant expression of endogenous elements related to and induced by MSRV-1 is capable of multiplying the aberrant antigens and, therefore, of contributing to the induction of autoimmune processes as observed in MS .
- JLBcl and JLBc2 clones differ from the ERV9 or HSERV9 sequence already described, in that they have a longer env region comprising an additional region totally divergent from ERV9.
- EXAMPLE 10 OBTAINING SEQUENCES LOCATED IN THE 5 'pol and 3' gag REGION OF THE RETROVIRAL GENOME MSRV-1.
- a PCR technique derived from the technique published by Frohman (19) was used.
- the derived technique allows, using a specific primer 3 ′ of the genome to be amplified, to extend the sequence towards the 5 ′ region of the genome to be analyzed.
- ADNC (SEQ ID NO 54)
- CCTGAGTTCTTGCACTAACCC amplification (SEQ ID NO 55) GTCCGTTGGGTTTCCTTACTCCT
- the products from the PCR were extracted after purification on agarose gel according to the methods conventional (17), then resuspended in 10 ml of distilled water.
- One of the properties of Taq polymerase consists in adding an adenine to the 3 'end of each of the two DNA strands, the DNA obtained was directly inserted into a plamide using the TA Cloning TM kit (British Biotechnology ).
- the 2 ⁇ l of DNA solution were mixed with 5 ⁇ l of sterile distilled water, 1 ⁇ l of 10 ⁇ concentrated ligation buffer "10X LIGATION BUFFER", 2 ⁇ l of "pCR TM VECTOR" (25 ng / ml) and 1 ⁇ l of "TA DNA LIGASE".
- the plasmids having an insert detected under UV light after labeling the gel with ethidium bromide were selected for sequencing the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA Cloning Kit® .
- the reaction prior to sequencing was then carried out according to the method recommended for the use of the sequencing kit "Prism ready reaction kit dye deoxyterminator cycle sequencing kit” (Applied Biosystems, ref. 401384) and automatic sequencing was carried out with the "automatic sequencer” model 373 A Applied Biosystems according to the manufacturer's instructions.
- the sedimented pellet constitutes the sample of concentrated, but not purified, virions.
- the pellet thus obtained is then taken up in a small volume of a buffer suitable for the extraction of RNA.
- the cDNA synthesis reaction mentioned above is carried out on this RNA extracted from concentrated extracellular virion.
- the RT-PCR amplification according to the technique cited above made it possible to obtain the GM3 clone whose sequence identified c by SEQ ID No. 56, is presented in FIG. 23.
- the sequence homology between the clone GMP3 and the retrovirus HSERV-9 is represented on the matrix table by a solid line, for any partial homology greater than or equal to 65%.
- FIG. 25 is shown the location of the different clones previously studied, relative to the known ERV9 genome.
- the env region MSRV-1 being longer than the reference ERV9 env gene, the additional region is represented above the insertion point according to a "V", it being understood that the material inserted has a sequence and size variability between the clones represented (JLBcl, JLBc2, FBd3).
- Figure 26 the position of different clones studied in the MSRV-1 pol * region is shown. Thanks to the GM3 clone described above, we were able to define a possible reading frame, covering the whole of the pol gene, referenced according to SEQ ID NO 57, shown in successive figures 27a to 27c.
- the peptides were synthesized chemically by solid phase synthesis, according to the technique of Merrifield (Barany G, and Merrifielsd R.B, 1980, In the Peptides, 2,
- HOBT hydroxybenzotriazole esters
- the chemical synthesis was carried out using a double coupling protocol with N-methylpyrrolidone (NMP) as solvent.
- NMP N-methylpyrrolidone
- the peptides were cut from the resin as well as the side protections, simultaneously, using hydrofluoric acid (HF) in an appropriate device (type I switching device, Peptide Instiute, Osaka, Japan).
- peptidylresin For 1 g of peptidylresin, 10 ml of HF, 1 ml of anisole and 1 ml of dimethylsulfide 5DMS are used. The mixture is stirred for 45 minutes at -2 ° C. The HF is then evaporated under vacuum. After intensive washing with ether, the peptide is eluted from the resin with 10% acetic acid, then lyophilized. The peptides are purified by preparative high performance liquid chromatography on a VYDAC column of type C18 (250 x 21 mm) (The Separation Group, Hesperia, CA, USA). Elution is carried out by an acetonitrile gradient at a flow rate of 22 ml / min.
- the collected fractions are controlled by an elution under isocratic conditions on a VYDAC® column. C18 analytical (250 x 4.6 mm), at a flow rate of lml / min. The fractions which have the same retention time are combined and lyophilized. The majority fraction is then analyzed by analytical high performance liquid chromatography, with the system described above. The peptide which is considered to be of acceptable purity results in a single peak representing 95% minimum of the chromatogram.
- the purified peptides are then analyzed in order to control their amino acid composition, using an automatic Applied Biosystems 420H amino acid analyzer.
- the measurement of the (average) chemical molecular mass of the peptides is obtained using the L.S.I.M.S. in positive ion mode on a VG double focus instrument.
- ZAB.ZSEQ connected to a DEC-VAX 2000 acquisition system (VG analytical Ltd, Manchester, England).
- the lyophilized POL2B peptide was dissolved in sterile distilled water at a concentration of 1 mg / ml. This stock solution was aliquoted and kept at + 4 ° C for use within two weeks, or frozen at -20 ° C, for use within 2 months. An aliquot is diluted in a PBS (Phosphate Buffer Saline) solution in order to obtain a final peptide concentration of 1 microgram / ml. 100 microliters of this dilution are deposited in each well of microtitration plates ("high-binding" plastic, COSTAR ref: 3590).
- PBS Phosphate Buffer Saline
- the plates are covered with an adhesive of the "plate-sealer” type and kept overnight at + 4 ° C., for the phase of adsorption of the peptide on the plastic.
- the adhesive is removed and the plates are washed three times with a volume of 300 microliters of solution A (PBS lx, 0.05% Tween 20®), then inverted on an absorbent tissue.
- the plates thus drained are filled with 200 microliters per well of solution B (solution A + 10% goat serum), then covered with an adhesive and incubated for 45 minutes to 1 hour, at 37 ° C.
- the plates are then washed three times with solution A, as described above.
- the serum samples to be tested are previously diluted to 1/50 in solution B and 100 microliters of each diluted serum to be tested are placed in the wells of each micritration plate.
- a negative control is deposited in a well of each plate, in the form of 100 microliters of buffer B.
- the plates covered with an adhesive are then incubated for 1 to 3 hours, at 37 ° C.
- the plates are then washed three times times with solution A, as described above.
- a goat antibody labeled with peroxidase and directed against human IgG Sigma Immunochemicals ref.
- the plates are immediately placed in a spectrophotometric reader of ELISA plates, and the optical density (OD) of each well is read at a wavelength of 492 nm.
- OD optical density
- 30 microliters of HCL IN are deposited in each well to stop the reaction and the plates are read on a spectrophotometer within 24 hours.
- the serological samples are deposited in duplicate or in triplicate and the optical density (OD) corresponding to the tested serum is calculated by averaging the OD obtained for the same sample, at the same dilution.
- ELISA The technique described above was used with the peptide POLB2 to search for the presence of specific anti-MSRV-1 IgG antibodies in the serum of 29 patients, for whom a certain or probable diagnosis of MS was made according to the criteria of Ask (23), and 32 healthy controls (blood donors).
- each vertical bar represents the net optical density (OD at 492 nm) of a tested serum.
- the ordinate axis indicates the net O.D. at the top of the vertical bars.
- the first 29 vertical bars located to the left of the vertical dotted line represent the sera of 29 cases of MS tested and the 32 vertical bars located to the right of the vertical dotted line represent the sera of 32 healthy controls (blood donors).
- the average net D.O of the MS tested is: 0.62.
- the graph allows you to visualize 5 controls whose net O.D. emerges above the grouped values of the control population. These values may represent the presence of specific IgG in non-sick HIV-positive patients. Two methods were therefore evaluated to determine the statistical threshold of positivity of the test.
- the mean of the control net D.O., including controls with high net D.O., is 0.36. Without the 5 controls whose net O.D. are greater than or equal to 0.5, the average of the "negative" controls is 0.33.
- the standard deviation of the negative controls is 0.10.
- a theoretical positivity threshold can be calculated according to the formula:
- threshold value (mean net OD of seronegative controls) + (2 or 3 x standard deviation of net OD of seronegative controls).
- the negative results represent a non-specific "background noise" of the presence of antibodies specifically directed against an epitope of the peptide.
- the test is specific for MS.
- the test is specific for MS, since as shown in table 1, no control has a clear OD above this threshold.
- this result reflects the fact that the antibody titers in MS patients are mostly higher than in healthy controls who have been in contact with MSRV-1.
- 26 of the 29 MS sera give a positive result (net OD greater than or equal to 0.50) indicating the presence of IgG specifically directed against the peptide POL2B, therefore against part of the reverse transcriptase enzyme of the MSRV-1 retrovirus encoded by its pol gene and, consequently, against the MSRV-1 retrovirus.
- net OD greater than or equal to 0.50
- the ELISA technique with the POL2B peptide was used to search for the presence of specific anti-MSRV-1 IgM antibodies in the serum of 36 patients, for whom a certain or probable diagnosis of MS was made according to the criteria of Poser (23 ), and 42 healthy witnesses (blood donors).
- each vertical bar represents the net optical density (OD at 492 nm) of a tested serum.
- the ordinate axis indicates the net O.D. at the top of the vertical bars.
- the horizontal line drawn in the middle of the graph represents a theoretical threshold delimiting the positive results (whose top of the bar is located above) and the negative results (whose top of the bar is located below).
- the average of the net O.D. of the SEPs tested is: 0.19.
- the standard deviation of the negative controls is: 0.05.
- the theoretical positivity threshold can be calculated according to the formula:
- threshold value (mean net O.D. of seronegative controls) + (3 x standard deviation of net O.D. of seronegative controls).
- the negative results represent a non-specific "background noise" of the presence of antibodies specifically directed against an epitope of the peptide.
- the IgM test is specific for MS, since no control has a clear D.O. above the threshold. 7 of 36 MS sera produce a positive IgM result; however, the study of clinical data reveals that these positive sera were collected during an initial MS attack or an acute attack in untreated patients. It is known that IgM directed against pathogenic agents are produced during primary infections or during reactivation following a latent phase of said pathogenic agent.
- the synthesis is carried out with esterified amino acids in which the ⁇ -amino group is protected by an FMOC group (Nova Biochem) and the lateral groups by protective groups such as trityl, t-butyl ester or t-butyl ether.
- the esterified amino acids are solubilized in N-methyl pyrrolidone (NMP) at a concentration of 300 nM, and 0.9 ⁇ l are deposited at the spots of bromophenol blue deposition. After incubation for 15 minutes, a new deposit of amino acids is carried out, followed by another incubation for 15 minutes. If the coupling between two amino acids has been carried out correctly, a change in color is observed (change from blue to green-yellow).
- an acetylation step is carried out with acetic anhydride. Then, the terminal amino groups of the peptides being synthesized are deprotected with 20% piperidine in DMF. The deposit spots are recolored with a 1% solution of bromophenol blue in DMF, washed three times with methanol and dried. All of these operations constitute a cycle of addition of an amino acid and this cycle is repeated until the synthesis is completed. When all the amino acids have been added, the NH 2 -terminal group of the last amino acid is deprotected with 20% piperidine in DMF and acetylated with acetic anhydride.
- the protective groups of the side chain are removed by a mixture of dichloromethane / trifluoroacetic acid / triisobutylsilane (5ml / 5ml / 250 ⁇ l). The immunoreactivity of the peptides is then tested by ELISA.
- EXAMPLE 12 OBTAINING AN LB19 CLONE CONTAINING
- PCR technique derived from the technique published by Gonzalez-Quintial R et al. (19) and PLAZA et al (25) was used. From the total RNAs extracted from a fraction of virion purified as described above, the cDNA was synthesized using a specific primer (SEQ ID No. 64) 3 'to the genome to be amplified, using EXPAND TM REVERSE TRANSCRIPTASE (BOEHRINGER MANNHEIM).
- a poly G tail was added to the 5 ′ end of the cDNA using the "Terminal transferases kit” kit sold by the company Boehringer Mannheim, according to the manufacturer's protocol.
- the products resulting from the PCR were purified after purification on agarose gel according to conventional methods (17), then resuspended in 10 microliters of distilled water.
- One of the properties of Taq polymerase consists in adding an adenine to the 3 'end of each of the two DNA strands, the DNA obtained was directly inserted into a plamide using the TA Cloning TM kit (British Biotechnology ).
- the 2 ⁇ l of DNA solution were mixed with 5 ⁇ l of sterile distilled water, 1 ⁇ l of 10 times concentrated ligation buffer "10X LIGATION BUFFER", 2 ⁇ l of "pCR TM VECTOR" (25 ng / ml ) and 1 ⁇ l of "T4 DNA LIGASE".
- the plasmids having an insert detected under UV light after labeling the gel with ethidium bromide were selected for sequencing the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA Cloning Kit ®.
- the reaction prior to sequencing was then carried out according to the method recommended for the use of the sequencing kit "Prism ready reaction kit dye deoxyterminator cycle sequencing kit” (Applied Biosystems, ref. 401384) and the automatic sequencing was carried out with the "Automatic Sequencer, model 373 A" Applied Biosystems device according to the manufacturer's instructions.
- This clone makes it possible to define, with the GM3 clone previously sequenced and the G + E + A clone (cf. Example 15), a region of 690 base pairs representative of a significant part of the gag gene of the MSRV-1 retrovirus, such as presented in FIG. 36.
- This sequence called SEQ ID NO 88 is reconstituted from different clones overlapping at their ends. This sequence is identified under the name region MSRV-1 "gag *".
- a potential reading frame with amino acid translation is shown below the nucleic acid sequence.
- EXAMPLE 13 OBTAINING A FBdl3 CLONE CONTAINING
- RNAs were extracted according to the method briefly described below.
- a "pool" of culture supernatant from B lymphocytes from MS patients (650 ml) is centrifuged for 30 minutes at 10,000 g.
- the viral pellet obtained is resuspended in 300 microliters of PBS / 10 mM MgCl 2 -
- the material is treated with a DNAse (100 mg / ml) / RNAse (50 mg / ml) mixture for 30 minutes at 37 ° C. then with proteinase K (50 mg / ml) 30 minutes at 46 ° C.
- the nucleic acids are extracted with a volume of a 0.1% phenol / SDS mixture (V / V) heated to 60 ° C. and then reextracted with a volume of phenol / chloroform (1/1; V / V).
- the pellet obtained after centrifugation is resuspended in 50 microliters of sterile DEPC water.
- the sample is again treated with 50 mg / ml of DNAse "RNAse free" 30 minutes at room temperature, extracted with a volume of phenol / chloroform, and precipitated in the presence of sodium acetate and ethanol.
- RNA obtained is quantified by a reading of D.O. at 260 nm.
- the presence of MSRV-1 and the absence of DNA contaminant is checked by PCR and RTPCR
- RNA 5 mg are used to synthesize a cDNA primed with a polydT oligonucleotide according to the instructions in the “cDNA Synthesis Module” kit (ref RPN 1256,
- the synthetic product is purified by double extraction and double purification according to the manufacturer's instructions.
- the presence of MSRV-1 is verified by a PCR
- MSRV-l associated with an ELOSA specific for the MSRV-l genome.
- primer 5 ' GGAGAAGAGC AGCATAAGTG G (SEQ ID N ° 66)
- primer 3' GTGCTGATTG GTGTATTTAC AATCC (SEQ ID N ° 67).
- the amplification conditions are as follows: 94 ° C 10 seconds 56 ° C 30 seconds 68 ° C 5 minutes;
- the LD-PCRs are carried out in a Perkin model 9600 PCR apparatus in thin-walled microtubes (Boehringer).
- Amplification products are checked by electrophoresis of 1/5 of the amplification volume
- the PCR product was purified by passage over a preparative agarose gel and then over a Costar column.
- the recombinant vector obtained is isolated by transformation of competent DH5aF 'bacteria. Bacteria selected for resistance to ampicillin and loss of metabolism for Xgal
- the sequencing of the clone FBdl3 is carried out using the Prism Ready Amplitaq FS dye terminator Perkin kit (ref. 402119) according to the manufacturer's instructions.
- the sequence reactions are deposited on a Perkin automatic sequencer of type 377 or 373A.
- the sequencing strategy consists of a "gene walk" performed on the two strands of the FBdl3 clone.
- sequence of the clone FBdl3 is identified by SEQ ID NO 58.
- sequence homology between the clone FBdl3 and the HSERV-9 retrovirus is represented on the matrix table by a solid line, for any partial homology greater than or equal to 70%.
- homologies exist in the flanking regions of the clone (with the pol gene in 5 ′ and with the env gene then the LTR in 3 *), but that the internal region is completely divergent and has no homology, even weak , with the HSERV-9 env gene.
- the FBdl3 clone contains a longer "env” region than that described for the defective endogenous HSERV-9; it can thus be seen that the internal diverging region constitutes an "insert" between the regions of partial homology with the defective genes HSERV-9.
- ORF B13 This additional sequence determines a potential orf, called ORF B13, which is represented by its amino acid sequence SEQ ID NO 87.
- SEQ ID NO 87 The molecular structure of the clone FBdl3 was analyzed using GeneWork software and the Genebank and SwissProt databases.
- the protein has no significant homology with already known sequences. It is likely that this clone comes from a recombination with an endogenous retroviral element (ERV), linked to the replication of MSRV-1.
- ERP retroviral element
- Such a phenomenon is not without generating the expression of polypeptides, or even endogenous retroviral proteins which are not necessarily tolerated by the immune system.
- Such a pattern of aberrant expression of endogenous elements related to and / or induced by MSRV-1 is capable of multiplying the aberrant antigens and, therefore, of contributing to the induction of autoimmune processes as observed in MS. It is obviously an original element, never described to date. Indeed, the interrogation of the databases of nucleic sequence available in version n ° 19 (1996) of the "Enter” software (NCBI, NIH, Bethesda, USA) did not allow to identify a known homologous sequence including the entire env region of this clone.
- EXAMPLE 14 OBTAINING AN FP6 CLONE CONTAINING
- a 3 'RACE was performed on total RNA extracted from plasma of a patient suffering from MS. Healthy control plasma, treated under the same conditions, was used as a negative control.
- the synthesis of cDNA was carried out with the following modified oligo dT primer: 5 'GACTCGCTGC AGATCGATTT TTTTTTTTTT TTTT 3' (SEQ ID NO 68) and the reverse transcriptase "Expand RT" from Boehringer according to the conditions recommended by the company.
- a PCR was carried out with the enzyme Klentaq (Clontech) under the following conditions: 94 ° C 5 min then 93 ° C 1 min, 58 ° C 1 min, 68 ° C 3 min for 40 cycles and 68 ° C for 8 min and with a final reaction volume of 50 ⁇ l.
- a second so-called “semi-nested” PCR was carried out with a 5 'primer located inside the already amplified region. This second PCR was carried out under the same experimental conditions as those used during the first PCR, using 10 ⁇ l of the amplification product resulting from the first PCR. Primers used for semi-nested PCR:
- SEQ ID NO 70 The primers SEQ ID NO 69 and SEQ ID NO 70 are specific to the pol region *: position No. 403 to No. 422 and No. 641 to No. 670 respectively.
- the amplified DNA was inserted into a plasmid using the TA Cloning TM kit.
- the 2 ⁇ l of DNA solution were mixed with 5 ⁇ l of sterile distilled water, 1 ⁇ l of 10 times concentrated ligation buffer "10X LIGATION BUFFER", 2 ⁇ l of "pCR TM VECTOR” (25 ng / ml ) and 1 ⁇ l of "TA DNA LIGASE”. This mixture was incubated overnight at 12 ° C.
- the following steps were carried out in accordance with the instructions in the TA Cloning® kit (British Biotechnology).
- the white colonies of bacteria recombinants (white) were transplanted to be cultured and allow the extraction of the plasmids incorporated according to the procedure known as "miniprep" (17).
- the plasmid preparation of each recombinant colony was cut with an appropriate restriction enzyme and analyzed on agarose gel.
- the plasmids having an insert detected under UV light after labeling the gel with ethidium bromide, were selected for sequencing the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA cloning kit® .
- the clone obtained, named FP6 makes it possible to define a region of 467 bp homologous to 89% to the pol * region of the MSRV-1 retrovirus, and a region of 1167 bp homologous to 64% to the pol region of ERV-9 ( n ° 1634 to 2856).
- the FP6 clone is represented in FIG. 38 by its nucleotide sequence identified by SEQ ID NO 61.
- the three potential reading frames of this clone are presented by their amino acid sequence under the nucleotide sequence.
- EXAMPLE 15 OBTAINING A REGION CALLED G + E + A CONTAINING AN ORF FOR A RETROVIRAL PROTEASE BY PCR AMPLIFICATION OF THE NUCLEIC SEQUENCE CONTAINED BETWEEN REGION 5 'DEFINED BY THE CLONE "GM3" AND REGION 3 * DEFINED BY THE CLONE POL *, FROM RNA EXTRACTED FROM A POOL OF PLASMAS OF PATIENTS WITH MS. Oligonucleotides specific for the MSRV-1 sequences already identified by the Applicant have been defined to amplify the retroviral RNA originating from virions present in the plasma of patients suffering from MS.
- Control reactions were carried out in order to control the presence of contaminants (reaction on water).
- the amplification consists of an RT-PCR step, followed by a "nested" PCR. Couples of primers were defined to amplify three overlapping regions (designated G, E and A) on the regions defined by the sequences of the GM3 and pol * clones, previously described.
- primer 1 SEQ ID NO 71 (sense) primer 2: SEQ ID NO 72 (antisense) -in the second PCR cycle, the following primers are used: primer 1: SEQ ID NO 73 (sense) primer 4: SEQ ID NO 74 (antisense) RT-PCR nested for amplification of region E:
- primer 5 SEQ ID NO 75 (sense) primer 6: SEQ ID NO 76 (antisense) -in the second PCR cycle, the following primers are used: primer 7: SEQ ID NO 77 (sense) primer 8: SEQ ID NO 78 (antisense)
- primer 9 SEQ ID NO 79 (sense) primer 10: SEQ ID NO 80 (antisense) in the second PCR cycle, the following primers are used: primer 9: SEQ ID NO 81 (sense) primer 11: SEQ ID NO 82 (antisense)
- primer 9 SEQ ID NO 81 (sense) primer 11: SEQ ID NO 82 (antisense)
- the sequence of the region defined by the different clones G, E and A was determined after cloning and sequencing of the "nested" amplification products.
- Clones G, E and A were pooled by PCR with the primers 1 in 5 'of fragment G and 11 in 3' of fragment A, previously described.
- a G + E + A fragment of approximately 1580bp was amplified and inserted into a plasmid using the TA Cloning kit (trademark).
- the sequence of the amplification product corresponding to G + E + A was determined and the analysis of the G + E and E + A recoveries was carried out.
- the sequence is represented in FIG. 39, and corresponds to the sequence SEQ ID NO 89.
- a reading frame coding for a retroviral protease MSRV-1 was found in region E.
- the amino acid sequence of the protease, identified by SEQ ID NO 90, is shown in Figure 40.
- EXAMPLE 16 OBTAINING A LTRGAG12 CLONE
- a nested PCR was carried out on the DNA extracted from a lymphoblastoid line (B lymphocytes immortalized by the EBV virus, strain B95, as described previously and as is well known to those skilled in the art) expressing the retrovirus MSRV -l and from the peripheral blood lymphocytes of a patient with MS.
- a lymphoblastoid line B lymphocytes immortalized by the EBV virus, strain B95, as described previously and as is well known to those skilled in the art
- primers are used: primer 4327: CTCGATTTCT TGCTGGGCCT TA (SEQ ID NO 83)
- primer 3512 GTTGATTCCC TCCTCAAGCA (SEQ ID NO 84)
- This step includes 35 amplification cycles with the following conditions: 1 min at 94 ° C, 1 min at 54 ° C and 4 min at 72 ° C.
- primer 4294 CTCTACCAAT CAGCATGTGG (SEQ ID NO 85)
- primer 3591 TGTTCCTCTT GGTCCCTAT (SEQ ID NO 86)
- This step includes 35 amplification cycles with the following conditions: 1 min at 94 ° C, 1 min at 54 ° C and 4 min at 72 ° C.
- the products resulting from the PCR were purified after purification on agarose gel according to conventional methods (17), then resuspended in 10 ml of distilled water.
- One of the properties of Taq polymerase consists in adding an adenine to the 3 ′ end of each of the two strands of DNA, the DNA obtained was directly inserted into a plamide using the TA Cloning TM kit
- LTRGAG12 a clone called LTRGAG12 could be obtained and is represented by its internal sequence identified by SEQ ID NO 60.
- This clone is probably representative of endogenous elements close to ERV-9, present in human DNA, in particular in the DNA of patients suffering from MS, and which can interfere with the expression of the MSRV-1 retrovirus, and therefore may have a role in the pathogenesis associated with the MSRV-1 retrovirus and which can serve as a marker for specific expression in the pathology concerned.
- EXAMPLE 17 DETECTION OF SPECIFIC ANTI-MSRV-1 ANTIBODIES IN HUMAN SERUM.
- the identification of the pol gene sequence of the MSRV-1 retrovirus and of an open reading frame for this gene made it possible to determine the sequence SEQ ID NO 63 in amino acids of a region of said gene, referenced by SEQ ID NO 62.
- the peptides were synthesized on a phenylacetamidomethyl (PAM) / polystyrene / divinylbenzene resin (Applied Biosystems, Inc. Foster City, CA), using an "Applied Biosystems 430A" automatic synthesizer.
- Amino acids are coupled in the form of hydroxybenzotriazole esters (HOBT).
- the amino acids used come from Novabiochem (La ⁇ flerlfingen, Switzerland) or Bachem (Bubendorf, Switzerland).
- the chemical synthesis was carried out using a double coupling protocol with N-methylpyrrolidone (NMP) as solvent.
- NMP N-methylpyrrolidone
- the peptides were cut from the resin as well as the side protections, simultaneously, using hydrofluoric acid (HF) in an appropriate apparatus (type I cleavage apparatus, Peptide Instiute, Osaka, Japan).
- HF hydrofluoric acid
- peptidylresin For 1 g of peptidylresin, 10 ml of HF, 1 ml of anisole and 1 ml of 5DMS dimethylsulfide are used. The mixture is stirred for 45 minutes at -2 ° C. The HF is then evaporated under vacuum. After intensive washing with ether, the peptide is eluted from the resin with 10% acetic acid, then lyophilized. The peptides are purified by preparative high performance liquid chromatography on a VYDAC column of type C18 (250 x 21 mm) (The Separation Group, Hesperia, CA, USA). Elution is carried out by an acetonitrile gradient at a flow rate of 22 ml / min.
- the fractions collected are checked by elution under isocratic conditions on an analytical VYDAC® C18 column (250 x 4.6 mm), at a flow rate of 1 ml / min.
- the fractions which have the same retention time are combined and lyophilized.
- the majority fraction is then analyzed by analytical high performance liquid chromatography, with the system described above.
- the peptide which is considered to be of acceptable purity results in a single peak representing 95% minimum of the chromatogram.
- the purified peptides are then analyzed in order to control their amino acid composition, using an automatic Applied Biosystems 42OH amino acid analyzer.
- the measurement of the chemical (average) molecular weight of the peptides is obtained using LSIMS mass spectrometry in positive ion mode on a double-focus VG instrument.
- ZAB.ZSEQ connected to a DEC-VAX 2000 acquisition system (VG analytical Ltd, Manchester, England).
- the lyophilized S24Q peptide was dissolved at a concentration of 1 mg / ml in 10% acetic acid. This stock solution was aliquoted and kept at + 4 ° C for use within two weeks, or frozen at -20 ° C, for use within 2 months. An aliquot is diluted in a PBS (Phosphate Buffer Saline) solution in order to obtain a final peptide concentration of 5 micrograms / ml. 100 microliters of this dilution are deposited in each well of Nunc Maxisorb microtiter plates (trade name).
- PBS Phosphate Buffer Saline
- the plates are covered with an adhesive of the "plate-sealer” type and kept for 2 hours at + 37 ° C., for the phase of adsorption of the peptide on the plastic.
- the adhesive is removed and the plates are washed three times with a volume of 300 microliters of solution A (PBS lx, 0.05% Tween 20®), then inverted on an absorbent tissue.
- the plates thus drained are filled with 250 microliters per well of solution B (solution A + 10% goat serum), then covered with an adhesive and incubated for 1 hour, at 37 ° C.
- the plates are then washed three times with solution A, as described above.
- the serum samples to be tested are previously diluted to 1/100 in solution B and 100 microliters of each diluted serum to be tested are deposited in the wells of each microtiter plate.
- a negative control is deposited in a well of each plate, in the form of 100 microliters of buffer B.
- the plates covered with an adhesive are then incubated for 1 hour 30 min. at 37 ° C.
- the plates are then washed three times with solution A, as described above.
- a goat antibody labeled with peroxidase and directed against human IgG (marketed by Jackson Immuno Research Inc.) is diluted in solution B (dilution 1 / 10,000).
- the serological samples are deposited in duplicate or in triplicate and the optical density (OD) corresponding to the tested serum is calculated by averaging the OD obtained for the same sample, at the same dilution.
- each vertical bar represents the net optical density (OD at 492 nm) of a tested serum.
- the ordinate axis indicates the net OD at the top of the vertical bars.
- the first 15 vertical bars located to the left of the vertical dotted line represent the sera of 15 healthy controls (blood donors) and the 15 bars vertical to the right of the vertical dotted line represent the sera from 15 MS cases tested.
- the graph allows to visualize 2 controls whose OD emerges above the grouped values of the control population. These values may represent the presence of specific IgG in non-sick HIV-positive patients. Two methods were therefore evaluated to determine the statistical threshold of positivity of the test.
- the mean of the net control O.D. including controls with high net OD, is 0.129 and the standard deviation is 0.06. Without the 2 controls whose O.D.s are greater than 0.2, the mean of the "negative" controls is 0.107 and the standard deviation is 0.03.
- the detection of anti-S24Q antibodies in only one out of two MS " tested here may reflect the fact that this peptide does not represent an immunodominant MSRV-1 epitope, that inter ⁇ individual variations of strains can induce immunization against a divergent peptide motif in the same region, or that the course of the disease and the treatments followed can modulate over time the antibody response against the peptide S24Q.
- each vertical bar represents the net optical density (OD at 492 nm) of a tested serum.
- the ordinate axis indicates the net OD at the top of the vertical bars.
- the first 15 vertical bars to the left of ; the vertical line intersecting the abscissa axis represent the sera of 15 healthy controls (blood donors) and the vertical bars located to the right of the vertical dotted line represent the sera of 15 cases of MS tested.
- the mean D.O. of the MS tested is: 1.6.
- the average of the net O.D. of the witnesses is: 0.7.
- the standard deviation of the negative controls is: 0.6.
- threshold value (mean OD of negative controls) + (3 x standard deviation of OD of negative controls)
- the negative results represent a non-specific "background noise" of the presence of antibodies specifically directed against an epitope of the peptide.
- the IgM test is specific for MS, since no control has a clear D.O. above the threshold. 6 of 15 MS sera produce a positive IgM result
- the detection of the antibodies IgM and IgG against the peptide S24Q makes it possible to evaluate, alone or in combination with other MSRV-1 peptides, MSRV-1 infection and / or MSRV-1 viral reactivation.
- CCCTTTGCCA CTACATCAAT TTTAGGAGTA AGGAAACCCA ACGGACAGTG GAGGTTAGTG 60 CAAGAACTCA GGATTATCAA TGAGGCTGTT GTTCCTCTAT ACCCAGCTGT ACCTAACCCT 120 TATACAGTGC TTTCCCAAAT ACCAGAGGAA GCAGAGTGGT TTACAGTCCT GGACCTTAAG 180 GATGCCTTTT TCTGCATCCC TGTACGTCCT GACTCTCAAT TCTTGTTTGC CTTTGAAGAT 240 CCTTTGAACC CAACGTCTCA ACTCACCTGG ACTGTTTTAC CCCAAGGGTT CAGGGATAGC 300 CCCCATCTAT TTGGCCAGGC ATTAGCCCAA GACTTGAGTC AATTCTCATA CCTGGACACT 360 CTTGTCCTTC AGTACATGGA TGATTTACTT TTAGTCGCCC GTTCAGAAAC CTTGTGCCAT 420 CAAGCCACCC AAGAACTCTT AACTTTCCTC
- CCCTTTGCCA CTACATCAAT TTTAGGAGTA AGGAAACCCA ACGGACAGTG GAGGTTAGTG 60 CAAGAACTCA GGATTATCAA TGAGGCTGTT GTTCCTCTAT ACCCAGCTGT ACCTAACCCT 120 TATACAGTGC TTTCCCAAAT ACCAGAGGAA GCAGAGTGGT TTACAGTCCT GGACCTTAAG 180 GATGCCTTTT TCTGCATCCC TGTACGTCCT GACTCTCAAT TCTTGTTTGC CTTTGAAGAT 240 CCTTTGAACC CAACGTCTCA ACTCACCTGG ACTGTTTTAC CCCAAGGGTT CAAGGGA 297
- SEQ ID NO: 7 GTGTTGCCAC AGGGGTTTAR RGATANCYCY CATCTMTTTG GYCWRGYAYT RRCYCRAKAY 60 YTRRGYCAVT TCTYAKRYSY RGSNAYTCTB KYCCTTYRGT ACATGGATGA 111
- ATATTCTTCT TATGTGGAAC ATCAACCTAT ATCTGCCTCC CCACTAACTG 250
- GACAGGCACC TGAACCTTAG TCTTTCTAAG TCCCAACATT AACATTGCCC 300 CAGGAAATCA GACCCTATTG GTACCTGTCA AAGCTAAAGT CCCGTCAGTG 350
- TCTTACTTTA CAATCCCAAT TAGACTCTTT GGCAGCAATG ACTCTCCAAA 550 ACCGCCGAGG CCCACACCTC CTCACTGCTG AGAAAGGAGG ACTCTGCACC 600
- TTTCAAACTC TTATACCAAC CTCTGGAGTT GGGCAACATG GCTTCTTCCA 750
- CTTCCCCAAC TAATAAGGAC CCCCCTTTCA ACCCAAACAG TCCAAAAGGA CATAGACAAA 60 GGAGTAAACA ATGAACCAAA GAGTGCCAAT ATTCCCTGGT TATGCACCCT CCAAGCGGTG 120 GGAGAAGAAT TCGGCCCAGC CAGAGTGCAT GTACCTTTTT CTCTCACA CTTGAAGCAA 180 ATTAAAATAG ACNTAGGTNA ATTNTCAGAT AGCCCTGATG GYTATATTGA TGTTTTACAA 240 GGATTAGGAC AATCCTTTGA TCTGACATGG AGAGATATAA TATTACTGCT AAATCAGACG 300 CTAACCTCAA ATGAGAAG TGCTGCCATA ACTGGAGCCC GAGAGTTTGG CAATCTCTGG 360 TATCTCAGTC AGGTCAATGA TAGGATGACA ACGGAGGAAA GAGAACGATT CCACAGGG 420 CAGCAGGCAG TTCCCAGTGT AGCTCCTCAT TGGGACACAG A
- GACTCGCTGC AGATCGATTT TTTTTTTTTTTT TTTT 34
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Rheumatology (AREA)
- Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Communicable Diseases (AREA)
- Neurosurgery (AREA)
- Pain & Pain Management (AREA)
- Oncology (AREA)
- Physical Education & Sports Medicine (AREA)
- Neurology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Biomedical Technology (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PL96319512A PL319512A1 (en) | 1995-08-03 | 1996-08-02 | Viral material and nucleotidic fragments associated with sclerosis multiplex or diagnostic, prophylactic and therapeutic purposes |
| AU68232/96A AU730080B2 (en) | 1995-08-03 | 1996-08-02 | Viral material and nucleotide fragments associated with multiple sclerosis, for diagnostic, prophylactic and therapeutic purposes |
| CA2201282A CA2201282C (fr) | 1995-08-03 | 1996-08-02 | Materiel viral et fragments nucleotidiques associes a la sclerose en plaques, a des fins de diagnostic, prophylactiques et therapeutiques |
| SK567-97A SK56797A3 (en) | 1995-08-03 | 1996-08-02 | Viral material and nucleotide fragments associated with multiple sclerosis useful for diagnostic, preventive and therapeutic purposes |
| BR9606566A BR9606566A (pt) | 1995-08-03 | 1996-08-02 | Material viral no estado isolado ou purificado fragmento de nicliotideos sonda nucleica de detecção de um agente patógeno e/ou infeccioso iniciador para a amplificação por polimerização de uma rna ou um dna de material viral rna ou dna e notadamente vetor de replicação peptideo anticorpo mono- ou policlonal reativo de detecção de virus-1 ou de uma exposição do referido virus composição diagnóstica profilática ou terapéutica processos para detectar um agente patológico e/ou infeccioso e a presenç |
| JP50817997A JP4444372B2 (ja) | 1995-08-03 | 1996-08-02 | 診断、予防および治療のための多発性硬化症に関与するウイルス性物質およびヌクレオチドフラグメント |
| BG101355A BG62977B1 (bg) | 1995-08-03 | 1997-03-25 | Вирусен материал и нуклеотидни фрагменти, свързани с диагностика, профилактика и лечение на мултиплената склероза |
| IS4455A IS4455A (is) | 1995-08-03 | 1997-03-26 | Veiruefni og kirnisbrot tengd MS sjúkdómi sem nýta má til sjúkdómsgreiningar, hindrunar og lækningar |
| NZ316080A NZ316080A (en) | 1995-08-03 | 1997-03-27 | Viral material and nucleotide fragments associated with multiple sclerosis retrovirus useful for diagnostic, preventive and therapeutic |
| NO971493A NO971493L (no) | 1995-08-03 | 1997-04-02 | Virusmateriale og nukleotidfragmenter som er forbundet med multippel sklerose, og som kan anvendes til diagnostiske, preventive og terapeutiske formål |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR95/09643 | 1995-08-03 | ||
| FR9509643A FR2737500B1 (fr) | 1995-08-03 | 1995-08-03 | Materiel viral et fragments nucleotidiques associes a la sclerose en plaques, a des fins de diagnostic, prophylactiques et therapeutiques |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1997006260A1 true WO1997006260A1 (fr) | 1997-02-20 |
Family
ID=9481811
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/FR1996/001244 Ceased WO1997006260A1 (fr) | 1995-08-03 | 1996-08-02 | Materiel viral et fragments nucleotidiques associes a la sclerose en plaques, a des fins de diagnostic, prophylactiques et therapeutiques |
Country Status (19)
| Country | Link |
|---|---|
| US (4) | US6001987A (https=) |
| EP (2) | EP0789077B1 (https=) |
| JP (2) | JP4444372B2 (https=) |
| AT (2) | ATE374252T1 (https=) |
| AU (1) | AU730080B2 (https=) |
| BG (1) | BG62977B1 (https=) |
| BR (1) | BR9606566A (https=) |
| CA (1) | CA2201282C (https=) |
| CZ (1) | CZ135797A3 (https=) |
| DE (1) | DE69637264T2 (https=) |
| ES (2) | ES2293645T3 (https=) |
| FR (1) | FR2737500B1 (https=) |
| HU (1) | HUP9900425A3 (https=) |
| IS (1) | IS4455A (https=) |
| NO (1) | NO971493L (https=) |
| NZ (1) | NZ316080A (https=) |
| PL (1) | PL319512A1 (https=) |
| SK (1) | SK56797A3 (https=) |
| WO (1) | WO1997006260A1 (https=) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998023755A1 (en) * | 1996-11-26 | 1998-06-04 | Bio Merieux | Viral material and nucleotide fragments associated with multiple sclerosis, for diagnostic, prophylactic and therapeutic purposes |
| FR2762600A1 (fr) * | 1997-04-29 | 1998-10-30 | Bio Merieux | Polypeptide capable de reagir avec les anticorps de patients atteints de sclerose en plaques et utlisations |
| WO1998049285A1 (fr) * | 1997-04-29 | 1998-11-05 | Bio Merieux | Polypeptide capable de reagir avec les anticorps de patients atteints de sclerose en plaques et utilisations |
| WO1999002696A1 (fr) * | 1997-07-07 | 1999-01-21 | Bio Merieux | Sequences retroviraux endogenes, associees a des maladies auto-immunes et/ou a des perturbations de la grossesse |
| WO1999053103A1 (en) * | 1998-04-08 | 1999-10-21 | Ms Research A/S | Diagnosis of multiple sclerosis and other demyelinating diseases |
| WO2001014564A3 (en) * | 1999-08-20 | 2001-11-22 | Curagen Corp | Polynucleotides expressed in activated t-lymphocytes and proteins encoded thereby |
| EP1612270A2 (fr) | 1997-07-07 | 2006-01-04 | Biomerieux | Matérial nucléique retroviral et fragments nucléotidiques notamment associés à la sclérose en plaques et/ou la polyarthrite rhumatoide, à des fins de diagnostic, prophylactiques et thérapeutiques |
| US7241876B2 (en) | 1996-01-11 | 2007-07-10 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of breast cancer |
| EP1997895A1 (fr) | 1998-06-23 | 2008-12-03 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Famille de séquences nucléiques et de séquences protéiques déduites presentant des motifs rétroviraux endogènes humains, et leurs applications |
Families Citing this family (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2737500B1 (fr) * | 1995-08-03 | 1997-08-29 | Bio Merieux | Materiel viral et fragments nucleotidiques associes a la sclerose en plaques, a des fins de diagnostic, prophylactiques et therapeutiques |
| ATE471150T1 (de) * | 1996-03-26 | 2010-07-15 | Kopreski Michael S | Methoden aus plasma oder serum extrahierte extrazelluraere rna zur diagnoseüberwachung oder evaluation von krebs verwenden |
| US8043835B1 (en) | 1996-03-26 | 2011-10-25 | Oncomedx, Inc. | Methods for detecting and monitoring cancer using extracellular RNA |
| US7785842B2 (en) * | 1996-03-26 | 2010-08-31 | Oncomedx, Inc. | Comparative analysis of extracellular RNA species |
| US6759217B2 (en) * | 1996-03-26 | 2004-07-06 | Oncomedx, Inc. | Method enabling use of extracellular RNA extracted from plasma or serum to detect, monitor or evaluate cancer |
| JP4044142B2 (ja) * | 1996-10-04 | 2008-02-06 | ビー. アーノビッツ,ハワード | 核酸の診断検出 |
| US20070009934A1 (en) * | 1997-03-14 | 2007-01-11 | Kopreski Michael S | Method enabling use of extracellular RNA extracted from plasma or serum to detect, monitor or evaluate cancer |
| US8440396B2 (en) * | 1997-03-14 | 2013-05-14 | Oncomedx, Inc. | Method enabling use of extracellular RNA extracted from plasma or serum to detect, monitor or evaluate cancer |
| US20040176314A1 (en) * | 1997-07-07 | 2004-09-09 | Bio Merieux | Endogenetic retroviral sequences, associated with autoimmune diseases or with pregnancy disorders |
| US20060204989A1 (en) * | 1998-09-22 | 2006-09-14 | Kopreski Michael S | Comparative analysis of extracellular RNA species |
| US8163524B2 (en) * | 1998-09-22 | 2012-04-24 | Oncomedx, Inc. | Comparative analysis of extracellular RNA species |
| US20090233276A1 (en) * | 1998-09-22 | 2009-09-17 | Oncomedx, Inc. | Method Enabling the Use of Extracellular Ribonucleic Acid (RNA) Extracted from Plasma or Serum to Detect, Monitor or Evaluate Cancer or Premalignant Conditions |
| FR2788784A1 (fr) * | 1999-01-21 | 2000-07-28 | Bio Merieux | Fragment nucleique endogene associe a une maladie auto-immune, procede de marquage et reactif |
| EP1029917A1 (en) | 1999-02-15 | 2000-08-23 | Bio Merieux | The LTR region of MSRV-1 and the proteins it encodes, and probes and methods for detecting MSRV-1 retrovirus |
| DE10012875B4 (de) * | 2000-03-16 | 2004-04-01 | Infineon Technologies Ag | Mobilfunkempfänger |
| CA2403815A1 (en) * | 2000-03-21 | 2001-09-27 | Ms Research A/S | An infective endogenous retrovirus in association with demyelinating diseases e.g. multiple sclerosis |
| DE60239470D1 (de) * | 2001-07-25 | 2011-04-28 | Oncomedx Inc | Verfahren zur bewertung pathologischer krankheitszustände unter verwendung extrazellulärer rna |
| US20100159464A1 (en) * | 2001-11-05 | 2010-06-24 | Oncomedx, Inc. | Method for Detection of DNA Methyltransferase RNA in Plasma and Serum |
| US20030104454A1 (en) * | 2001-11-05 | 2003-06-05 | Kopreski Michael S. | Method for detection of DNA methyltransferase RNA in plasma and serum |
| US20090136942A1 (en) * | 2007-09-18 | 2009-05-28 | Oncomedx, Inc. | Analysis of Extracellular RNA |
| US8680065B2 (en) * | 2008-09-11 | 2014-03-25 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Oligonucleotides of human endogenous retrovirus 9 (ERV-9) long terminal repeat (LTR) and methods of use |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1994028138A1 (en) * | 1993-05-24 | 1994-12-08 | University College London | Multiple sclerosis virus |
Family Cites Families (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5871996A (en) | 1994-02-04 | 1999-02-16 | Bio Merieux | Retrovirus agents MSRV1 and MSRV2 associated with multiple sclerosis |
| WO1980000412A1 (en) * | 1978-08-24 | 1980-03-20 | N Gilmour | Pasteurellosis vaccines |
| US4311686A (en) * | 1979-04-30 | 1982-01-19 | The Immunology Development Corporation | Methodology for the immunodiagnosis of multiple sclerosis and/or malignant diseases from blood sample analysis |
| US4396600A (en) * | 1980-12-18 | 1983-08-02 | Gus Gallucci | Adult schistosome worm-derived antigenic substance and method of obtaining same |
| US4388298A (en) * | 1982-07-14 | 1983-06-14 | The United States Of America As Represented By The Secretary Of Agriculture | Propagation of hemorrhagic enteritis virus in a turkey cell line and vaccine produced |
| GB8324800D0 (en) * | 1983-09-15 | 1983-10-19 | Pasteur Institut | Antigens |
| US4520113A (en) * | 1984-04-23 | 1985-05-28 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Serological detection of antibodies to HTLV-III in sera of patients with AIDS and pre-AIDS conditions |
| US4647773A (en) * | 1984-04-23 | 1987-03-03 | The United States Of America As Represented By The Department Of Health And Human Services | Method of continuous production of retroviruses (HTLV-III) from patients with AIDS and pre-AIDS |
| NZ218050A (en) * | 1985-11-13 | 1989-05-29 | Wistar Inst | Test for the presence of htlv-1v |
| US4900553A (en) * | 1987-09-11 | 1990-02-13 | Case Western Reserve University | Method of reducing glial scar formation and promoting axon and blood vessel growth and/or regeneration through the use of activated immature astrocytes |
| EP0326395A2 (en) * | 1988-01-29 | 1989-08-02 | City Of Hope | Method of detecting and identifying certain viral sequences |
| FR2651581B1 (fr) * | 1989-09-06 | 1994-05-13 | Centre Nal Recherc Scientifique | Moyens pour le diagnostic de neuropathies demyelinisantes, en particulier de la sclerose en plaques. |
| US5219837A (en) * | 1990-06-21 | 1993-06-15 | Trustees Of The University Of Pennsylvania | Method of stimulating myelination of cells |
| US5158976A (en) * | 1990-10-29 | 1992-10-27 | The Children's Medical Center Corporation | Controlling glutamine/glutamate related neuronal injury |
| DE69233158T2 (de) * | 1991-03-07 | 2004-05-13 | Connaught Technology Corp., Greenville | Gentechnologisch hergestellter stamm für impfstoffe |
| DK173091D0 (da) * | 1991-10-11 | 1991-10-11 | Schleroseforeningen The Danish | Biologisk materiale |
| FR2689521B1 (fr) * | 1992-04-03 | 1996-07-19 | Bio Merieux | Procede d'obtention et maintien d'une culture cellulaire viable, infectee par un virus associe a la sclerose en plaques, et produits biologiques derives de ladite culture. |
| FR2689520B1 (fr) | 1992-04-03 | 1996-07-19 | Bio Merieux | Procede et milieu de culture pour l'obtention de cellules infectees par un virus associe a la sclerose en plaques. |
| DK0642585T3 (da) * | 1992-05-18 | 2006-05-15 | Genentech Inc | Aktiviering af oligomeriserende receptorer ved anvendelse af fusionerede receptorligander |
| US5580766A (en) * | 1994-01-14 | 1996-12-03 | Alexion Pharmaceuticals, Inc. | Retroviral vector particles for transducing non-proliferating cells |
| US5691147A (en) * | 1994-06-02 | 1997-11-25 | Mitotix, Inc. | CDK4 binding assay |
| US5710037A (en) * | 1994-06-10 | 1998-01-20 | The United States Of America As Represented By The Department Of Health And Human Services | Retroviral vector particles |
| FR2731356B1 (fr) * | 1995-03-09 | 1997-04-30 | Bio Merieux | Virus msrv-1 et agent pathogene et/ou infectant msrv-2 associes a la polyarthrite rhumatoide |
| FR2737500B1 (fr) * | 1995-08-03 | 1997-08-29 | Bio Merieux | Materiel viral et fragments nucleotidiques associes a la sclerose en plaques, a des fins de diagnostic, prophylactiques et therapeutiques |
-
1995
- 1995-08-03 FR FR9509643A patent/FR2737500B1/fr not_active Expired - Fee Related
-
1996
- 1996-08-02 AU AU68232/96A patent/AU730080B2/en not_active Ceased
- 1996-08-02 DE DE69637264T patent/DE69637264T2/de not_active Expired - Lifetime
- 1996-08-02 EP EP96420265A patent/EP0789077B1/fr not_active Expired - Lifetime
- 1996-08-02 WO PCT/FR1996/001244 patent/WO1997006260A1/fr not_active Ceased
- 1996-08-02 ES ES96420265T patent/ES2293645T3/es not_active Expired - Lifetime
- 1996-08-02 CZ CZ971357A patent/CZ135797A3/cs unknown
- 1996-08-02 EP EP07018564A patent/EP1916304B1/fr not_active Expired - Lifetime
- 1996-08-02 CA CA2201282A patent/CA2201282C/fr not_active Expired - Lifetime
- 1996-08-02 SK SK567-97A patent/SK56797A3/sk unknown
- 1996-08-02 JP JP50817997A patent/JP4444372B2/ja not_active Expired - Lifetime
- 1996-08-02 AT AT96420265T patent/ATE374252T1/de not_active IP Right Cessation
- 1996-08-02 HU HU9900425A patent/HUP9900425A3/hu unknown
- 1996-08-02 AT AT07018564T patent/ATE541933T1/de active
- 1996-08-02 PL PL96319512A patent/PL319512A1/xx unknown
- 1996-08-02 BR BR9606566A patent/BR9606566A/pt unknown
- 1996-08-02 US US08/691,563 patent/US6001987A/en not_active Expired - Lifetime
- 1996-08-02 ES ES07018564T patent/ES2379011T3/es not_active Expired - Lifetime
-
1997
- 1997-03-25 BG BG101355A patent/BG62977B1/bg unknown
- 1997-03-26 IS IS4455A patent/IS4455A/is unknown
- 1997-03-27 NZ NZ316080A patent/NZ316080A/en unknown
- 1997-04-02 NO NO971493A patent/NO971493L/no not_active Application Discontinuation
-
1999
- 1999-08-16 US US09/374,766 patent/US6579526B1/en not_active Expired - Lifetime
-
2003
- 2003-05-07 US US10/430,442 patent/US20030186391A1/en not_active Abandoned
-
2006
- 2006-08-08 US US11/463,109 patent/US7932350B2/en not_active Expired - Fee Related
-
2009
- 2009-11-20 JP JP2009265658A patent/JP5143814B2/ja not_active Expired - Lifetime
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1994028138A1 (en) * | 1993-05-24 | 1994-12-08 | University College London | Multiple sclerosis virus |
Non-Patent Citations (2)
| Title |
|---|
| H. PERRON ET AL.: "In vitro transmission and antigenicity of a retrovirus isolated from a multiple sclerosis patient", RESEARCH IN VIROLOGY, vol. 143, no. 5, 1992, pages 337 - 350, XP000569296 * |
| H. PERRON ET AL.: "Isolation of retrovirus from patients with multiple sclerosis", LANCET THE, vol. 337, 6 April 1991 (1991-04-06), LONDON GB, pages 862 - 863, XP002001596 * |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7241876B2 (en) | 1996-01-11 | 2007-07-10 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of breast cancer |
| WO1998023755A1 (en) * | 1996-11-26 | 1998-06-04 | Bio Merieux | Viral material and nucleotide fragments associated with multiple sclerosis, for diagnostic, prophylactic and therapeutic purposes |
| FR2762600A1 (fr) * | 1997-04-29 | 1998-10-30 | Bio Merieux | Polypeptide capable de reagir avec les anticorps de patients atteints de sclerose en plaques et utlisations |
| WO1998049285A1 (fr) * | 1997-04-29 | 1998-11-05 | Bio Merieux | Polypeptide capable de reagir avec les anticorps de patients atteints de sclerose en plaques et utilisations |
| US6555091B1 (en) | 1997-04-29 | 2003-04-29 | Bio Merieux | Polypeptide capable of reacting with antibodies of patients suffering from multiple sclerosis and uses |
| WO1999002696A1 (fr) * | 1997-07-07 | 1999-01-21 | Bio Merieux | Sequences retroviraux endogenes, associees a des maladies auto-immunes et/ou a des perturbations de la grossesse |
| EP1612270A2 (fr) | 1997-07-07 | 2006-01-04 | Biomerieux | Matérial nucléique retroviral et fragments nucléotidiques notamment associés à la sclérose en plaques et/ou la polyarthrite rhumatoide, à des fins de diagnostic, prophylactiques et thérapeutiques |
| US7771927B1 (en) | 1997-07-07 | 2010-08-10 | Biomerieux | Multiple sclerosis-associated retroviral (MSRV) nucleic acids corresponding to the Env region |
| US8088910B2 (en) | 1997-07-07 | 2012-01-03 | Biomerieux | Isolated multiple sclerosis (MS)-associated retrovirus (MSRV) nucleic acids corresponding to the gag region |
| WO1999053103A1 (en) * | 1998-04-08 | 1999-10-21 | Ms Research A/S | Diagnosis of multiple sclerosis and other demyelinating diseases |
| EP1997895A1 (fr) | 1998-06-23 | 2008-12-03 | Institut National de la Santé et de la Recherche Médicale (INSERM) | Famille de séquences nucléiques et de séquences protéiques déduites presentant des motifs rétroviraux endogènes humains, et leurs applications |
| WO2001014564A3 (en) * | 1999-08-20 | 2001-11-22 | Curagen Corp | Polynucleotides expressed in activated t-lymphocytes and proteins encoded thereby |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1916304B1 (fr) | Polypeptides antigéniques associés à la sclérose en plaques et utilisations | |
| EP0674004B1 (fr) | Virus MSRV1 associé à la Sclérose en Plaques, ses constituants nucléiques et leurs applications | |
| US7674888B2 (en) | Viral material and nucleotide fragments associated with multiple sclerosis, for diagnostic, prophylactic and therapeutic purposes | |
| CA2298834C (fr) | Sequences retroviraux endogenes, associees a des maladies auto-immunes et/ou a des perturbations de la grossesse | |
| EP1612270B1 (fr) | Matérial nucléique retroviral et fragments nucléotidiques, associés à la sclérose en plaques, à des fins de diagnostic, prophylactiques et thérapeutiques | |
| FR2731356A1 (fr) | Virus msrv-1 et agent pathogene et/ou infectant msrv-2 associes a la polyarthrite rhumatoide | |
| FR2715937A1 (fr) | Virus MSRV1 et MSRV2 associés ensemble à la sclérose en plaques et leurs constituants nucléiques. | |
| FR2715938A1 (fr) | Constituants nucléiques du virus MSRV1, associé à la sclérose en plaques. | |
| FR2715939A1 (fr) | Virus MSRV2 associé à la sclérose en plaques, et ses constituants nucléiques. | |
| FR2715936A1 (fr) | Virus MSRV1 associé à la sclérose en plaques, et ses constituants nucléiques. | |
| FR2727428A1 (fr) | Virus msrv1 associe a la sclerose en plaques et ses constituants nucleiques |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA |
|
| ENP | Entry into the national phase |
Ref document number: 2201282 Country of ref document: CA Kind code of ref document: A Ref document number: 2201282 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 1997 508179 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 316080 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PV1997-1357 Country of ref document: CZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 56797 Country of ref document: SK |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: PV1997-1357 Country of ref document: CZ |
|
| 122 | Ep: pct application non-entry in european phase | ||
| WWR | Wipo information: refused in national office |
Ref document number: PV1997-1357 Country of ref document: CZ |