WO1995020661A1 - Procedes et substances destines a la prise en charge du rejet hyperaigu suite a une heterogreffe chez l'homme - Google Patents

Procedes et substances destines a la prise en charge du rejet hyperaigu suite a une heterogreffe chez l'homme Download PDF

Info

Publication number
WO1995020661A1
WO1995020661A1 PCT/IB1995/000088 IB9500088W WO9520661A1 WO 1995020661 A1 WO1995020661 A1 WO 1995020661A1 IB 9500088 W IB9500088 W IB 9500088W WO 9520661 A1 WO9520661 A1 WO 9520661A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
gene
sequence
porcine
Prior art date
Application number
PCT/IB1995/000088
Other languages
English (en)
Inventor
Martin J. Pearse
Robert J. Crawford
Allan J. Robbins
Peter D. Rathjen
Anthony J. F. D'apice
Original Assignee
Bresatec Ltd.
St. Vincent's Hospital (Melbourne) Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bresatec Ltd., St. Vincent's Hospital (Melbourne) Limited filed Critical Bresatec Ltd.
Priority to MX9603037A priority Critical patent/MX9603037A/es
Priority to AU15445/95A priority patent/AU695373B2/en
Priority to EP95907116A priority patent/EP0755451B1/fr
Priority to JP7519965A priority patent/JPH09508277A/ja
Priority to BR9506652A priority patent/BR9506652A/pt
Priority to AT95907116T priority patent/ATE296349T1/de
Priority to DE69534227T priority patent/DE69534227T2/de
Priority to CA2181433A priority patent/CA2181433C/fr
Publication of WO1995020661A1 publication Critical patent/WO1995020661A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7004—Monosaccharides having only carbon, hydrogen and oxygen atoms
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/108—Swine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/02—Animal zootechnically ameliorated
    • A01K2267/025—Animal producing cells or organs for transplantation
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT

Definitions

  • This invention relates generally to the field of xenotransplantation.
  • this invention relates to methods and materials for reduction or elimination of the hyperacute rejection response in humans. More particularly, this invention relates to 10 methods for treating human serum to reduce or eliminate hyperacute rejection.
  • This invention also relates to methods and materials for generating non-human organs lacking or having reduced a 1,3 galactosyl transferase activity.
  • xenografts transplants between species
  • Non-viable, non- antigenic xenografts are commonly used in vascular reconstruction (bovine arteries) and in cardiac surgery (porcine cardiac valves) .
  • vascular reconstruction bovine arteries
  • cardiac surgery porcine cardiac valves
  • immunological barriers have prevented the common use of viable xenografts.
  • a total of 27 non-human primate to human organ xenografts was reported; the longest reported patient survival was 9 months.
  • Two liver transplants from baboon to human were recently performed in anticipation that modern immunosuppressive therapies could cope with the severe rejection problems likely to occur in xenotransplantation.
  • Baboons have single pregnancies, long gestation times, are difficult and expensive to maintain and may be infected with or carry organisms, particularly viruses, that are pathogenic in humans.
  • organ size may be a consideration
  • the smaller primates are unsatisfactory as donors to human adults.
  • the use of primates is likely to arouse considerable opposition from the public.
  • the pig is a widely acknowledged choice for xenotransplantation into humans.
  • the pig erythrocyte diameter (6.5/zm) and, by implication, its capillary size, are similar to humans, facilitating connection of xenografts to the human circulatory system.
  • pigs can be bred and maintained in low pathogen facilities, can be reared to any size and do not arouse the level of public reaction associated with primates.
  • the immunological barriers to use of pig organs in human patients include a) an immediate severe ("hyperacute") rejection phenomenon that develops in minutes to hours after transplantation, and b) a proposed acute rejection that develops in days to weeks. Once the hyperacute rejection phenomenon has been overcome, it is expected that normal acute rejection would ensue. This form of rejection is thought to be similar to that experienced with allografts (transplants between individuals of the same species) and should be amenable to normal immunosuppressive therapies.
  • xenoantibodies Both preformed “natural antibodies” (xenoantibodies) and complement regulating factors in human serum are thought to be involved in the process of hyperacute rejection. Hyperacute rejection is thought to be initiated when xenoantibodies bind to epitopes on the endothelium of a donor organ, activating the classical complement pathway.
  • a purified and isolated nucleic acid molecule of the present invention comprises the porcine nucleic acid sequence depicted in Figure 4 (SEQ ID NO: 7) , which encodes a porcine polypeptide having ⁇ -1,3 galactosyltransferase activity.
  • SEQ ID NO: 7 which encodes a porcine polypeptide having ⁇ -1,3 galactosyltransferase activity.
  • Variations on this sequence that may be routinely generated by the skilled artisan include those sequences corresponding to Figure 4 but varying within the scope of the degeneracy of the genetic code. That is, the present invention includes variants of the sequence set out in Figure 4, readily determined by the skilled artisan, that code for the same amino acid sequence encoded by the sequence set out in Figure 4.
  • the present invention also includes a purified and isolated nucleic acid molecule that encodes a porcine ⁇ -1,3 galactosyltransferase and that hybridizes under standard high stringency conditions with a sequence complementary to the sequence set out in Figure 4, or with a sequence complementary to a variation of the sequence set out in Figure 4 within the scope of the degeneracy of the genetic code.
  • the complementary strands to the above-described nucleic acid sequences are readily determined by standard methods, and are also within the scope of the present invention.
  • the present invention includes variants of the porcine ⁇ -1,3 galactosyltransferase coding sequence that preserve the functional characteristics of the native gene product.
  • Such variants include, for example, minor nucleotide variations in the 5' untranslated region or in various coding regions of the disclosed sequence. Minor amino acid variations deriving from changes in the coding regions, that leave a functional ⁇ -1,3 galactosyltransferase catalytic site, membrane anchor domain and stem region as described below, are within the scope of the present invention.
  • Such routine variations in nucleic acid and amino acid sequences can be identified by those having ordinary skill in the art based on the sequence and structural information provided herein.
  • high stringency conditions are those hybridization conditions generally understood by the skilled artisan to reflect standard conditions of high stringency as set out in widely recognized protocols for nucleic acid hybridization. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual (2nd
  • the present invention also includes a host cell transformed with any of the above-described purified and isolated nucleic acid molecules, as well as a porcine ⁇ -1,3 galactosyltransferase encoded by such transforming nucleic acid molecules and expressed from the host cell.
  • the invention further includes a DNA construct useful for inactivating the porcine ⁇ -1,3 galactosyltransferase gene by insertion of a desired DNA sequence into an insertion site of the gene.
  • ⁇ -1,3 galactosyltransferase gene includes the exons encoding or potentially encoding ⁇ -1,3 galactosyltransferase, introns contiguous with such exons, and regulatory elements associated with such exons and introns.
  • the DNA construct includes the desired DNA sequence flanked by first and second homology sequences. These first and second homology sequences are sufficiently homologous, respectively, to first and second genomic sequences flanking the insertion site to allow for homologous recombination of the DNA construct with the porcine ⁇ -1,3 galactosyltransferase gene when the DNA construct is introduced into a target cell containing the porcine ⁇ -1,3 galactosyltransferase gene.
  • the insertion site is within exon 4, exon 7, exon 8 or exon 9 of the porcine ⁇ -1,3 galactosyltransferase gene.
  • the desired DNA sequence is preferably a selectable marker, including but not limited to the neo R gene, the hydromycin resistance (hyg R ) gene and the thymidine kinase gene.
  • the desired DNA sequence may be bordered at both ends by FRT DNA elements, with stop codons for each of the three reading frames being inserted 3' to the desired DNA sequence. Presence of the FRT elements allows the selectable marker to be deleted from the targeted cell, and the stop codons ensure that the ⁇ -1,3 galactosyltransferase gene remains inactivated following deletion of the selectable marker.
  • the invention further includes a DNA construct useful for inactivating the murine ⁇ -1,3 galactosyltransferase gene by insertion of a desired DNA sequence into an insertion site of the gene.
  • the DNA construct includes the desired DNA sequence flanked by first and second homology sequences. These first and second homology sequences are sufficiently homologous, respectively, to first and second genomic sequences flanking the insertion site to allow for homologous recombination of the DNA construct with the murine ⁇ -1,3 galactosyltransferase gene when the DNA construct is introduced into a cell containing the murine ⁇ -1,3 galactosyltransferase gene.
  • the insertion site is within exon 4, exon 7, exon 8 or exon 9 of the murine ⁇ -1,3 galactosyltransferase gene.
  • the desired DNA sequence is preferably a selectable marker, including but not limited to the neo R gene, the hyg R gene and the thymidine kinase gene.
  • the desired DNA sequence may be bordered at both ends by FRT DNA elements, with stop codons for each of the three reading frames being inserted 3' to the desired DNA sequence. Presence of the FRT elements allows the selectable marker to be deleted from the targeted cell, and the stop codons ensure that the ⁇ -1,3 galactosyltransferase gene remains inactivated following deletion of the selectable marker.
  • the invention also includes methods for generating a mammalian totipotent cell having at least one inactivated (non-functional) ⁇ -1,3 galactosyltransferase allele, where the totipotent cell is derived from a mammalian species in which alleles for the ⁇ -1,3 galactosyltransferase gene normally are present and functional.
  • a "functional" allele is capable of being transcribed and translated to produce a polypeptide having an activity the same as or substantially similar to the native ⁇ -1,3 galactosyltransferase.
  • the methods include providing a plurality of cells characterized as totipotent cells of the aforementioned mammalian species, introducing into the totipotent cells a nucleic acid construct effective for inactivating the ⁇ -1,3 galactosyltransferase gene by insertion of a desired DNA sequence into an insertion site of the gene through homologous recombination, and then identifying a totipotent cell having at least one inactivated ⁇ -1,3 galactosyltransferase allele.
  • the totipotent cells can include, without limitation, embryonic stem (ES) cells, primordial germ cells (PGC's) and eggs.
  • ES embryonic stem
  • PSC primordial germ cells
  • the cells can be taken from a variety of mammalian species in which alleles for the ⁇ - 1,3 galactosyltransferase gene are present and functional, including without limitation murine and porcine species.
  • the invention further includes methods for generating a mammal lacking a functional ⁇ -1,3 galactosyltransferase gene, where the mammal belongs to a species having a functional ⁇ -1,3 galactosyltransferase gene.
  • the methods include providing a mammalian totipotent cell having at least one inactivated ⁇ -1,3 galactosyltransferase allele, where the totipotent cell is derived from the aforementioned mammalian species having a functional ⁇ -1,3 galactosyltransferase gene, manipulating the totipotent cell such that mitotic descendants of the cell constitute all or part of a developing embryo, allowing the embryo to develop to term, recovering a neonate individual derived from the embryo, and raising and breeding the neonate to obtain a mammal homozygous for an inactivated ⁇ -1,3 galactosyltransferase alleles, i.e., a mammal in which both ⁇ -1,3 galactosyltransferase allele are inactivated.
  • the totipotent cells can include, without limitation, ES cells, PGC , s and eggs.
  • the cells can be taken from a variety of mammalian species in which alleles for the ⁇ -1,3 galactosyltransferase gene are present and functional, including without limitation murine and porcine species.
  • ES cells and PGC's are manipulated in various ways such that their mitotic descendants are found in a developing embryo. These manipulations can include, without limitation, injection into a blastocyst or morula, co-culture with a zona pellucida-disrupted morula, and fusion with an enucleated zygote.
  • chimeric embryos can be obtained by co-culturing at least one ES cell or PGC with a morula embryo in which the zona pellucida is sufficiently disrupted to allow direct contact between the ES cell/PGC and at least one cell of the morula.
  • the zona pellucida-disrupted embryo may be an embryo that is completely free of the zona pellucida.
  • the genome of an ES cell or PGC can be incorporated into an embryo by fusing the ES cell/PGC with an enucleated zygote.
  • Such a procedure is capable of generating a non-chimeric embryo, i.e., an embryo in which all nuclei are mitotic descendants of the fused ES cell/PGC nucleus.
  • the resulting embryos are implanted in a recipient female, or surrogate mother, and allowed to develop to term.
  • eggs when eggs, as opposed to ES cells or PGC's, are directly injected with a nucleic acid construct effective for inactivating the ⁇ -1,3 galactosyltransferase gene, the eggs can be manipulated to form an embryo by implanting into a recipient female.
  • the invention also includes a mammal, produced through human intervention, that lacks a functional ⁇ -1,3 galactosyltransferase gene.
  • the mammal belongs to a species in which the ⁇ -1,3 galactosyltransferase gene is normally present and functional.
  • the mammal can be, without limitation, a mouse or a pig.
  • the invention further includes a purified and isolated nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of (1) the nucleic acid sequence depicted in Figure 26 (SEQ ID NO: 25) , (2) a sequence corresponding to the sequence of (1) within the scope of the degeneracy of the genetic code, and (3) a sequence that encodes murine T-LIF and that hybridizes under standard high stringency conditions with a sequence complementary to the sequence of (1) or (2) .
  • the complementary strands to the above-described nucleic acid sequences are readily determined by standard methods, and are also within the scope of the present invention.
  • the present invention also includes a host cell transformed with any of the purified and isolated nucleic acid molecules described in the preceding paragraph, as well as a T-LIF polypeptide encoded by such transforming nucleic acid molecules and expressed from the host cell.
  • the invention further includes a purified and isolated nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of (1) the nucleic acid sequence depicted in Figure 27 (SEQ ID NO: 31) , (2) a sequence corresponding to the sequence of (l) within the scope of the degeneracy of the genetic code. and (3) a sequence that encodes human T-LIF and that hybridizes under standard high stringency conditions with a sequence complementary to the sequence of (1) or (2) .
  • the complementary strands to the above-described nucleic acid sequences are readily determined by standard methods, and are also within the scope of the present invention.
  • the present invention also includes a host cell transformed with any of the purified and isolated nucleic acid molecules described in the preceding paragraph, as well as a T-LIF polypeptide encoded by such transforming nucleic acid molecules and expressed from the host cell.
  • the invention further includes a method for eliminating or reducing hyperacute rejection of non- primate mammalian cells by human serum, comprising adding, to the human serum, a physiologically acceptable amount of galactose or a saccharide in which the terminal carbohydrate is an ⁇ galactose linked at position 1, prior to exposure of the human serum to the non-primate cells.
  • the amount of galactose or saccharide added is sufficient to reduce or eliminate the hyperacute rejection response.
  • the saccharide can be, without limitation, melibiose, galactose ⁇ l-3 galactose or stachyose.
  • the human serum can be treated so as to be substantially depleted of immunoglobulin, IgM antibodies, anti-GAL IgM and IgG antibodies, or anti-GAL IgM antibodies.
  • the invention further includes affinity- treated human serum substantially free of anti-GAL antibodies or of anti-GAL IgM antibodies.
  • FIGURE 1 is a graphical representation of fluorescence intensity following immunofluorescent staining of porcine aortic endothelial cells with anti- GAL antibody alone or with anti-GAL antibody that was preincubated with selected saccharides.
  • FIGURE 2 shows the results of an experiment in which lysis of porcine aortic endothelial cells by human serum and by purified anti-GAL antibodies was determined using a 51 CR release assay.
  • FIGURE 3 depicts physiograph tracings of perfused rat heart contractions in the presence of human serum with or without selected saccharides.
  • FIGURE 4 is a comparison of the porcine ⁇ -1,3 galactosyltransferase cDNA sequence with the corresponding murine and bovine sequences.
  • PGTCD porcine sequence.
  • BOVGSTA bovine sequence.
  • MUSGLYTNG murine sequence.
  • FIGURE 5 is a comparison of the porcine ⁇ -1,3 galactosyltransferase amino acid sequence with the corresponding murine and bovine amino acid sequences.
  • PGT porcine sequence.
  • BGT bovine sequence.
  • MGT murine sequence.
  • FIGURE 6 depicts the Sail restriction sites in four overlapping phage clones spanning a portion of the murine ⁇ -1,3 galactosyltransferase genomic region.
  • FIGURE 7 is a detailed restriction map of murine ⁇ -1,3 galactosyltransferase subclone p ⁇ GT-S5.5.
  • FIGURE 8 is a detailed restriction map of murine ⁇ -1,3 galactosyltransferase subclone p ⁇ GT-S4.0.
  • FIGURE 9 is a detailed restriction map of murine ⁇ -1,3 galactosyltransferase subclone p ⁇ GT-Sll.
  • FIGURE 10 is a detailed restriction map of murine ⁇ -1,3 galactosyltransferase subclone p ⁇ GT-S13.
  • FIGURE 11 is an additional detailed restriction map of murine ⁇ -1,3 galactosyltransferase subclone p ⁇ GT- S5.5.
  • FIGURE 12 is an additional detailed restriction map of murine ⁇ -1,3 galactosyltransferase subclone p ⁇ GT- S4.0.
  • FIGURE 13 is a diagram of a knockout construct carrying the 4.0 and 5.5kb Sail fragments from p ⁇ GT-S5.5 and p ⁇ GT-S4.0, which flank the Exon 9 Sail site.
  • FIGURE 14 depicts the 8.3kb and 6.4kb Bglll fragments that are diagnostic for the uninterrupted ⁇ -1,3 galactosyltransferase gene and the targeted (inactivated) ⁇ -1,3 galactosyltransferase gene, respectively, using the probes identified in the text.
  • FIGURE 15 is a schematic representation of the generation of a knockout construct using the vector p ⁇ GT- S5.5 as the starting vector.
  • FIGURE 16 sets out the nucleotide sequence of a neomycin resistance cassette used in the construction of a DNA construct for interrupting the ⁇ -l,3-GalT gene in mice.
  • FIGURE 17 is a diagram of one example of a final knockout construct that has been sequenced to confirm the identity, copy number and orientation of the various inserts.
  • FIGURE 18 is a Southern blot of genomic DNA from various murine ES cell lines transformed with the knockout construct of Figure 16, probed to reveal the diagnostic fragments depicted in Figure 14.
  • FIGURE 19 depicts the "long" PCR products derived from wild type and interrupted ⁇ -l,3-GalT genes using the designated primers.
  • FIGURE 20 is a Southern blot of long PCR products obtained from wild type and knockout mice.
  • FIGURE 21 depicts the PCR products used for identification of the interrupted (targeted) galT locus.
  • FIGURE 22 shows PCR products generated from mice carrying interrupted (inactivated) GalT alleles.
  • FIGURE 23 depicts the PCR products expected from PCR analysis of cDNA generated from ⁇ -1,3-GalT mRNA in normal and knockout mice. The ferrochelatase primers and PCR fragment represent a control demonstrating that cDNA synthesis had occurred.
  • FIGURE 24 shows the PCR fragments generated from cDNA obtained from RNA isolated from kidney (K) , heart (H) and liver (L) of a wild-type mouse (+/+) , a mouse heterozygous for the interrupted ⁇ -l,3-GalT allele (+/-) and a mouse homozygous for the interrupted ⁇ -l,3-GalT allele (-/-) .
  • FIGURE 25 is a graphical representation of the relative protection of spleen cells, derived from GalT knockout mice, from lysis by human serum.
  • FIGURE.26 is a representation of the nucleotide sequence and deduced amino acid sequence for murine T- LIF.
  • FIGURE 27 is a representation of the nucleotide sequence and deduced amino acid sequence for human T-LIF.
  • FIGURE 28 is a Western blot of LIF polypeptides expressed from transfected COS cells.
  • FIGURE 29 is a diagram of the expression plasmid used for transfection of the COS cells of Figure 27.
  • FIGURE 30 is a Southern blot of PCR-amplified cDNA from murine ES cells, using a LIF-specific probe.
  • DETAILED DESCRIPTION Evidence presented herein establishes that a substantial portion of human pre-formed, anti-pig xenoantibodies recognize a specific terminal galactose linkage on the surface of pig endothelial cells. As demonstrated in experiments carried out by the present inventors, it is possible to reduce the titers of preformed xenoantibodies by adsorption with immobilized antigens containing the appropriate epitopes. This leads to reduction or elimination of cellular responses associated with the hyperacute rejection response. Conversely, it is demonstrated to be possible to neutralize such antibodies by addition of appropriate carbohydrate antigens to human serum.
  • the epitope defined by the ⁇ - 1,3 galactose linkage (termed the GAL epitope) is generated by the enzyme UDP-galactose:, ⁇ -D-galactosyl-l,4- N-acetyl-D-glucosaminide ⁇ -1,3 galactosyl- transferase (" ⁇ -1,3 galactosyltransferase" or " ⁇ -l,3-GalT” ) .
  • This enzyme transfers galactose to the terminal galactose residue of N-acetyllactosamine-type carbohydrate chains and lactosaminoglycans.
  • the reaction catalyzed by ⁇ -1,3- GalT may be summarized as follows:
  • the ⁇ -l,3-Gal T enzyme is found in most mammals, but is not present in Old World monkeys and humans. For purposes of xenotransplantation, it is significant that humans and Old World monkeys have naturally occurring xenoantibodies directed against the GAL epitope.
  • the use of pig organs lacking the GAL epitope could reduce or eliminate the hyperacute rejection of such organs by human recipients.
  • the utility of such an approach is buttressed by the present inventors' demonstration that the GAL epitope is, in fact, central to the hyperacute rejection phenomenon in cells and whole organs.
  • One approach to obtaining such organs would be to generate pigs in which the gene encoding the ⁇ -l,3-GalT enzyme is "knocked out" by homologous recombination.
  • the present inventors have affinity purified antibodies directed against the GAL epitope (anti-GAL antibodies) from human serum. This was accomplished with affinity columns comprising the appropriate epitopes (e.g., galactosyl-galactose or melibiose) attached to a solid phase. Total anti-GAL IgG and IgM were obtained in one set of experiments. In an alternative approach, anti-GAL IgG was obtained by passage of serum over an affinity column with specificity for all proteins except albumin and IgG. The wash-through from this column was then applied to a galactosyl-galactose affinity column and purified anti-GAL IgG was collected as the eluate.
  • anti-GAL antibodies directed against the GAL epitope
  • affinity columns comprising the appropriate epitopes (e.g., galactosyl-galactose or melibiose) attached to a solid phase.
  • Total anti-GAL IgG and IgM were obtained in one
  • the obtained anti-GAL IgG can be further purified by passage over a protein G column, which specifically binds IgG but not other antibody isotypes.
  • the wash-through from the above-described columns can be used as sources of total anti-GAL (IgG + IgM)-depleted serum or of anti-GAL IgG-depleted serum in further experiments.
  • the anti-GAL antibody preparations are characterized for protein content, molecular weight and purity, and for antibody class and isotype.
  • the present inventors investigated the binding of human anti-GAL antibodies to porcine cells and tissues using immunofluorescent staining.
  • selected human antibody preparations are reacted with intact porcine cells and then reacted with signal antibody comprising non-human anti-human IgG or IgM labeled with fluorescein isothiocyanate (FITC) .
  • signal antibody comprising non-human anti-human IgG or IgM labeled with fluorescein isothiocyanate (FITC) .
  • Stained cells may be detected and quantified with a fluorescence-activated cell sorter (FACS) or other appropriate detection means.
  • FACS fluorescence-activated cell sorter
  • Other methods for detecting the presence of a bound antibody on a cell surface for example through use of enzyme-labeled signal antibody reagents, are known to the skilled artisan.
  • Total anti-GAL IgM and IgG
  • purified anti-GAL IgG stained cells from a porcine epithelial cell line (P ⁇ ) as well as cells from a porcine aortic endothelial cell line (PAE) .
  • Neither anti-GAL (total IgM + IgG) antibody-depleted serum nor anti-GAL IgG-depleted serum gave detectable staining.
  • the present inventors have established that antibody binding is inhibited by galactose and by disaccharides having terminal galactose residues in the ⁇ l configuration. Staining was not inhibited with sugars having a terminal galactose in a 31 ⁇ 4 configuration. These results demonstrate the specificity of the antibody binding and the ability of appropriate sugars to inhibit such binding.
  • sugars such as melibiose, stachyose, galactose and fucose, having terminal residues in the ⁇ l-6 configuration, were found to inhibit agglutination in the ⁇ M to mM range.
  • Sugars with other configurations were only inhibitory at very high doses, where the observed effects are likely due to simple changes in osmolarity or other non-specific mechanisms.
  • assays that provide quantitative data on cell lysis.
  • such assays measure a cell-sequestered component that is released into the medium upon complement-mediated cell lysis.
  • Such experiments should control for involvement of complement in the induced lysis by employing both native complement proteins as well as heat-inactivated complement.
  • the present inventors have used a 51 Cr- release assay and a lactate dehydrogenase (LDH)-release assay to investigate the complement-mediated lysis of porcine epithelial and endothelial cells by human serum.
  • LDH lactate dehydrogenase
  • porcine cells were pre-labeled with 51 Cr and then incubated in the presence of heat-inactivated human serum plus rabbit complement (PAE' s) or human complement in non-heat-inactivated normal human serum (-?K_' s) . Release of 51 Cr into the medium was measured with a gamma counter following addition of scintillation fluid.
  • PAE' s heat-inactivated human serum plus rabbit complement
  • -?K_' s human complement in non-heat-inactivated normal human serum
  • LDH-release assay cells were labeled with LDH as per the manufacturer' s instructions (Promega, USA) . Release of LDH into the medium was measured using an ELISA format, with absorbance read at 492nm. For both assays, the ability of various sugars to inhibit the complement- induced lysis was also tested.
  • Rat hearts were connected to a Langendorf perfusion apparatus, as described in Do ing and Dehnert, The Isolated Perfused Heart According to Langendorf, Bionesstechnik-Verlag March GmbH, D7806, West Germany. The connected hearts were then stabilized by perfusion with a physiological buffer system, and perfused with the same buffer containing either melibiose or lactose (lOmM) . Human plasma was then added to a final concentration of 13% and the effect of the added sugar on heart rate, strength of contraction and output were measured.
  • melibiose or lactose lactose
  • the present inventors' experiments with cultured cells, tissues and whole organs provide important confirmation that anti-GAL antibodies are a critical element in the hyperacute rejection response.
  • the disclosed results point to various approaches that can be employed to eliminate or reduce the hyperacute rejection of xenogeneic mammalian organs by humans.
  • the intravenous administration of the specific disaccharide galactose ⁇ 1-3 galactose will block the naturally occurring anti-GAL antibodies of all classes and prevent them binding to their specific epitopes on the surface of the endothelial cells of the xenograft, thus preventing them from initiating or participating in hyperacute rejection.
  • the present inventors' results indicate that the concentration of galactose ⁇ 1-3 galactose required to achieve this effect is in a physiologically tolerated range.
  • the experiments also indicate that various other carbohydrates can be substituted for the specific disaccharide.
  • These include the monosaccharide galactose and various other di-, tri- or tetra-saccharides in which there is a terminal ⁇ galactose linked to the next sugar via position 1.
  • These other sugars include, but are not limited to, melibiose and stachyose.
  • IgM total immunoglobulin M
  • all or a substantial portion of total IgM can be removed from the serum of the patient by extracorporeal immunoabsorption.
  • anti-GAL antibodies of all classes can be removed by extracorporeal immunoabsorption.
  • the patient' s pre-formed natural anti-GAL IgM antibodies can be removed. In this way, many or most of the primary immunological agents of the hyperacute response are eliminated, resulting in reduction or elimination of the response following xenotransplantation.
  • the present inventors have succeeded in cloning the entire coding region of the porcine ⁇ -l,3-GalT gene. This is desirable for full exploitation of the gene in genetic engineering of pigs for purposes of human xenotransplantation.
  • Previous attempts to obtain the entire coding region of the porcine gene have, to the knowledge of the inventors, failed to generate the 5' coding regions. See, e.g., Dabkowski et al., Transplant. Proc. 25: 2921 (1993).
  • the present inventors have employed a PCR-based approach to generate the full sequence. In designing the primers and experimental conditions required to obtain the 5' and 3' regions of the gene, the present inventors overcame significant theoretical and practical obstacles to success.
  • porcine sequence is similar to the bovine sequence in this regard.
  • Analysis of the amino acid sequence demonstrates that the structure of the porcine ⁇ -l,3-GalT is similar to that of other glycosyltransferases, and in particular is closely related to bovine and murine ⁇ -l,3-GalTs.
  • a short cytoplasmic amino-terminal domain of about 6 residues precedes a hydrophobic membrane-anchoring domain (extending from residues 7 to 22) .
  • the stem region which serves as a flexible tether, and the catalytic domain, which catalyses the synthesis of ⁇ -l,3-GAL linkages, are located in the lumen of the Golgi and extend from amino acid 23 to the carboxyl terminus at amino acid 371.
  • the precise boundary between the stem and catalytic domains is not well-defined. Based on the suggested characteristics of the stem region, it appears to be the least conserved region and is rich in glycine and proline residues. Paulson and Colley, J. Biol. Chem. 264: 17615 (1989); Joziasse et al., J. Biol. Chem. 267: 5534 (1992).
  • the stem/catalytic boundary may occur around amino acid 60.
  • the gene is preferably interrupted within an appropriate coding exon by insertion of an additional DNA fragment.
  • exons 4, 7, 8 and 9 as preferred locations for disruption of the gene by homologous recombination.
  • identification of these exons as preferred sites should not be construed as limiting the scope of the present invention, as interruptions in exons 5 and 6 may be useful in particular cell types or in situations where less-than- complete inhibition of ⁇ -l,3-GalT gene expression is desired.
  • regulatory elements associated with the coding sequence may also present useful targets for inactivation.
  • a Sail site located within exon 9 of the mouse ⁇ -l,3-GalT gene at codons 221- 222 is chosen as the site for disruption of the murine coding sequence.
  • a Sail site is engineered into the corresponding location of the pig sequence for convenient construction of a knockout sequence. Sail cuts only rarely in genomic DNA. Since multiple restriction sites can be a problem in manipulating large fragments of DNA, the presence of a Sail site in the exon is very useful since it is not likely that other Sail sites will be present at other locations in the knockout constructs.
  • a gene coding for a selectable marker is generally used to interrupt the targeted exon site by homologous recombination.
  • the selectable marker is flanked by sequences homologous to the sequences flanking the desired insertion site. Thomas and Capecchi, Cell 51: 503-12 (1987); Capecchi, Trends in Genetics 5: 70-76 (1989) . It is not necessary for the flanking sequences to be immediately adjacent to the desired insertion site.
  • the gene imparting resistance to the antibiotic G418 (a neomycin derivative) frequently is used, although other antibiotic resistance markers (e.g., hygromycin) also may be employed.
  • selection systems include negative- selection markers such as the thymidine kinase (TK) gene from herpes simplex.
  • TK thymidine kinase
  • Any selectable marker suitable for inclusion in a knockout vector is within the scope of the present invention.
  • one or more genetic elements are included in the knockout construct that permit the antibiotic resistance gene to be excised once the construct has undergone homologous recombination with the ⁇ -1,3-GalT gene.
  • FLP/FRT recombinase system from yeast represents one such set of genetic elements. 0' Gorman et al.. Science 251, 1351-1355 (1991).
  • FLP recombinase is a protein of approximately 45 kD molecular weight. It is encoded by the FLP gene of the 2 micron plasmid of the yeast Saccharomyces cerevisiae .
  • the protein acts by binding to the FLP Recombinase Target site, or FRT; the core region of the FRT is a DNA sequence of approximately 34 bp.
  • FLP can mediate several kinds of recombination reactions including excision, insertion and inversion, depending on the relative orientations of flanking FRT sites.
  • FLP will act to excise the intervening DNA, leaving only a single FRT.
  • FLP has been shown to function in a wide range of systems, including in the cultured mammalian cell lines CV-1 and F9, O' Gorman et al., Science 251: 1351 (1991), and in mouse ES cells, Jung et al.. Science 259: 984 (1993).
  • Targeted cells carrying a genomic copy of an antibiotic resistance gene flanked by direct repeats of the FRT are supplied with FLP recombinase by 1) introduction into cells of partially purified FLP protein by electroporation, or 2) transfection with expression plasmids containing the FLP gene.
  • the antibiotic resistance gene is deleted by action of the FLP recombinase, and cells are generated that contain the inactivated ⁇ -l,3-GalT gene and are free of the exogenous antibiotic resistance gene.
  • the term "transformed” is defined as introduction of exogenous DNA into the target cell by any means known to the skilled artisan. These methods of introduction can include, without limitation, transfection, microinjection, infection (with, for example, retroviral- based vectors) , electroporation and microballistics.
  • transfection unless otherwise indicated, is not intended herein to indicate alterations in cell behavior and growth patterns accompanying immortalization, density-independent growth, malignant transformation or similar acquired states in culture.
  • heterozygous cells can be used in the methods of the present invention
  • various manipulations can be employed to generate homozygous cells in culture.
  • homozygous cells can be generated by performing a second homologous recombination procedure on cells heterozygous for the inactivated allele.
  • a second construct may be employed in a second round of transformation in which the neo R gene is replaced with a gene conferring resistance to a separate antibiotic (e.g., hygromycin) .
  • a separate antibiotic e.g., hygromycin
  • Cells resistant to both G418 and hygromycin can be screened by Southern blots in order to detect any "double knockouts" (i.e., homozygotes) .
  • Both antibiotic resistance genes can be removed subsequently in a single procedure using FLP recombinase. By maintaining selection with G418, this approach ensures that the second construct does not simply replace the previously knocked-out allele, leaving the cells heterozygous
  • the neo R gene can be deleted from an original heterozygous cell using FLP recombinase and a second knockout procedure conducted using the original neo R gene-containing construct. Double knockouts could be detected by Southern analysis. The newly introduced neo R gene then could be deleted by FLP recombinase. This alternative approach does not allow one to direct the knockout construct specifically to the non-inactivated allele. Nevertheless, screening of appropriate numbers of targeted cells can lead to identification of cells homozygous for the inactivated locus.
  • a knockout construct into the germ cells (sperm or eggs, i.e., the "germ line") of the desired species.
  • Genes or other DNA sequences can be introduced into the pronuclei of fertilized eggs by microinjection. Following pronuclear fusion, the developing embryo may carry the introduced gene in all its somatic and germ cells since the zygote is the mitotic progenitor of all cells in the embryo. Since targeted insertion of a knockout construct is a relatively rare event, it is desirable to generate and screen a large number of animals when employing such an approach.
  • a cultured cell containing the desired knockout construct be capable of generating a whole animal. This is generally accomplished by placing the cell into a developing embryo environment of some sort.
  • Cells capable of giving rise to at least several differentiated cell types are hereinafter termed “pluripotent” cells.
  • Pluripotent cells capable of giving rise to all cell types of an embryo, including germ cells are hereinafter termed “totipotent” cells.
  • Totipotent murine cell lines have been isolated by culture of cells derived from very young embryos (blastocysts) . Such cells are capable, upon incorporation into an embryo, of differentiating into all cell types, including germ cells, and can be employed to generate animals lacking a functional ⁇ -l,3-GalT gene. That is, cultured ES cells can be transformed with a knockout construct and cells selected in which the ⁇ -l,3-GalT gene is inactivated through insertion of the construct within, for example, an appropriate exon. In fact, ES cell lines have been derived for both mice and pigs.
  • DIF's useful for prevention of ES cell differentiation include, without limitation, Oncostatin M (Gearing and Bruce, The New Biologist 4: 61-65 (1992); personal communication from A. Smith) , interleukin 6 (IL-6) with soluble IL-6 receptor (SIL-6R) (Taga et al., Cell 58: 573-81 (1989); personal communication from A. Smith) , and ciliary neurotropic factor (CNTF) (Conover et al.. Development 19: 559-65 (1993) .
  • IL-6R interleukin 6
  • SIL-6R soluble IL-6 receptor
  • CNTF ciliary neurotropic factor
  • Other known cytokines may also function as appropriate DIF's, alone or in combination with other DIF's.
  • T-LIF LIF-LIF
  • the transcript was cloned from murine ES cells using the RACE technique, Frohman et al., Proc. Natl. Acad. Sci. USA 85: 8998-9002 (1988), and subjected to sequence analysis. Analysis of the obtained nucleic acid sequence and deduced amino acid sequence indicates that T-LIF is a truncated form of the LIF sequence previously reported in the literature.
  • T-LIF nucleic acid in an appropriate host cell yields a 17 kD protein that is unglycosylated.
  • This protein is useful for inhibiting differentiation of murine ES cells in culture.
  • the protein is expected to have a similar activity with porcine cells, since murine D-LIF is effective at inhibiting both murine and porcine ES cell differentiation.
  • the present inventors have also determined the sequence of the human form of T-LIF.
  • ES cells having at least one inactivated ⁇ -l,3-GalT allele are identified and incorporated into a developing embryo. This can be accomplished through injection into the blastocyst cavity of a murine blastocyst-stage embryo, by injection into a morula-stage embryo, by co-culture of ES cells with a morula-stage embryo, or through fusion of the ES cell with an enucleated zygote. The resulting embryo is raised to sexual maturity and bred in order to obtain animals, all of whose cells (including germ cells) carry the inactivated ⁇ -l,3-GalT allele. If the original ES cell was heterozygous for the inactivated ⁇ -l,3-GalT allele, several of these animals must be bred with each other in order to generate animals homozygous for the inactivated allele.
  • Embryos derived from microinjected eggs can be screened for homologous recombination events in several ways. For example, if the GalT gene is interrupted by a coding region that produces a detectable (e.g., fluorescent) gene product, then the injected eggs are cultured to the blastocyst stage and analyzed for presence of the indicator polypeptide. Embryos with fluorescing cells, for example, are then implanted into a surrogate mother and allowed to develop to term. Alternatively, injected eggs are allowed to develop and the resulting piglets analyzed by polymerase chain reaction (PCR) or reverse transcription PCR (RT/PCR) for evidence of homologous recombination.
  • PCR polymerase chain reaction
  • RT/PCR reverse transcription PCR
  • GalT mRNA should be absent from homozygous knockout animals. This can be confirmed, for example, with reverse transcription PCR (RT-PCR) using appropriate GalT-specific primers. In addition, various tests can be performed to evaluate expression of the GAL epitope in homozygous knockout animals.
  • anti-GAL antibodies and IB 4 Lectin (which has an exclusive affinity for terminal ⁇ -D- galactosyl residues) can be used in various assay or immunohistological formats to test for the presence of the GAL epitope in an array of tissues.
  • lysis of cells by human serum can be tested through use of a 51 chromium release assay.
  • Anti-GAL antibodies were purified from normal heat inactivated AB serum (from CS1, Parkville, Victoria, Australia) using the following sets of procedures.
  • the wash- through from the 3rd passage through the Synsorb column is collected and the volume adjusted to the original volume of the serum with phosphate-buffered saline (PBS) pH 7 +0.05% azide. This is used as a source of anti-GAL antibody-depleted serum.
  • PBS phosphate-buffered saline
  • anti-GAL IgG was further purified using a protein G column, which efficiently binds IgG but not other antibody isotypes. IgG was then eluted from the protein G column using glycine pH 2.4.
  • porcine epithelial cell line LLC PK X obtained from the American Type Culture Collection (ATCC) , Accession No. CRL1392.
  • PAE' s were cultured in RPMI medium containing 10% fetal calf serum (FCS) , supplemented with 150 ⁇ g/ml endothelial cell supplement (Sigma) and 50 ⁇ g/ml heparin (Sigma) .
  • FCS fetal calf serum
  • the cells were identified as endothelial cells by their typical cobblestone morphology and by their immunoreactivity with Factor VIII antibodies, as identified using immunofluorescence. In all the assays described below, the PAE' s were used between the 8th and 12th passages.
  • tissue culture was performed in a laminar flow hood, using appropriate tissue culture sterile technique. All tissue culture reagents, unless otherwise indicated, were purchased from CSL, Melbourne, Australia. Media were constituted as follows:
  • FCS 10ml Endothelial cell supplement ( 3mg/ml ) ( Sigma) 1. 5ml
  • Endothelial cell supplement was purchased from
  • the specificity of the anti-GAL antibody binding to porcine cells was determined by examining the ability of sugars of various structures to inhibit antibody binding. In these competition studies the anti-GAL antibodies were pre-incubated with sugar (0.1M) at 37'C for 30 min before adding to the cells. D. Results
  • the staining with anti-GAL IgM and/or IgG was inhibited with purified galactose and with disaccharides having terminal galactose residues in the ⁇ l-configuration such as melibiose (6-O- ⁇ -D- galactopyranosyl- D-glucose) and stachyose ( ⁇ -D-Gal-[l- >6]- ⁇ -D-Glc-[l->2]-/3-D-Fru) .
  • melibiose 6-O- ⁇ -D- galactopyranosyl- D-glucose
  • stachyose ⁇ -D-Gal-[l- >6]- ⁇ -D-Glc-[l->2]-/3-D-Fru
  • Pig kidney was fixed in formalin and dehydrated before embedding in Paraplast.
  • Pig heart and liver were fixed in paraformaldehyde-lysine-periodate fixative and snap frozen in O.C.T. embedding compound (10.24% w/w polyvinyl alcohol, 4.26% w/w polyethylene glycol, 85.50% w/w nonreactive ingredients; Tissue Tek®, Miles, Inc., Elkhart, Indiana, USA) .
  • Four ⁇ m-thick sections of pig heart and liver and 2 ⁇ m-thick sections of kidney were incubated with purified anti-GAL antibodies (undiluted, 1:2 and 1:4) for 60 min.
  • Endothelium Intertubular sinusoids Variable Endothelium: Arteries and veins Strong
  • Heart Endothelium Arteries, veins, capillaries Strong
  • Endothelium Arteries, veins Strong Intertubular sinusoids Negative
  • anti-GAL antibodies The specificity of the binding of anti-GAL antibodies was tested on sections of pig renal cortex by inhibition with 0.1 M melibiose, lactose, sucrose and glucose. Reactivity of the anti-GAL antibodies with proximal tubule brush borders was reduced to near background by preincubation of antibody with melibiose, but was not inhibited by the other saccharides .
  • HSA Human Serum Albumin
  • Heparinised pig blood (Animal Resources , Clayton, Australia) is centrifuged at 800
  • the RBC pellet is washed by resuspension in PBS ( 10ml) and recentrifugation (repeated 3 times) . After the final wash, the RBC pellet is resuspended in 10ml PBS.
  • a 0.5% solution of RBC' s is prepared by adding 50ul RBC solution (from step 2 , above) to 10 ml PBS containing 0.5g/100 ml of HSA.
  • C Preparation of 96-well microtitre plates (Titretek. USA) 1. Add 25ul of PBS to each well.
  • 3 x 10 7 PK 2 cells are obtained per 10 ml flask. About 1 x 10 5 cells are required for each well in the 51 CR Release Assay. b) Wash cells 4 times in 10 ml RPMI (no FCS) ; spin 1200 rpm for 5 min. c) Resuspend cells in 100 ⁇ l RPMI (with 10% heat-inactivated FCS; see below) . 2. Labelling Cells with 51 CR: a) Combine in a 10 ml tube: Cells in 195 ⁇ l RPMI/10% FCS (heat inactivated); 5 ⁇ l 51 CR (120 ⁇ Ci) . b) Incubate at 37°C for 2 hr. c) Add 2 ml RPMI/10% FCS (heat inactivated) . d) Centrifuge cells through a layer of FCS (heat inactivated) to remove excess label. e) Gently overlay the labelled cells onto a
  • PAE' s 50 ⁇ l absorbed rabbit complement (25% final)
  • % Lysis Experimental cpm - Spontaneous Release cpm x 100 Max. Release cpm - Spontaneous Release cpm
  • Pig Spleen-Absorbed Rabbit Complement a) Cut pig spleen (obtained from local abattoir) into small pieces and prepare a single-cell suspension by passage through a fine metal sieve b) Pellet cells by centrifugation at 700g, 7 min. at 4°C c) Resuspend cell pellet in RPMI/10% FCS and repeat centrifugation d) Resuspend in RPMI/10% FCS/10% dimethylsulfoxide (DMSO) e) Count cells and store frozen aliquots (3 x 10 9 cells/aliquot)
  • Xenoantibodies (NXAb) in human serum in the presence of complement are capable of lysing porcine cells. Lysis increases with increasing concentrations of serum.
  • PAE' s were incubated in the presence of 50% human serum as the source of xenoantibody and complement, together with various concentrations of each sugar (lmM to lOOmM) . Under these conditions, melibiose, which has the Gal ⁇ l ⁇ 6 Gal configuration, but not lactose, which has the terminal Gal moiety by in a ⁇ l ⁇ 4 configuration, protected the pig cells from lysis.
  • Plasma prepared from different blood packs is thawed at 37°C, pooled and filtered (100 ⁇ m steel mesh, 8.0 ⁇ m and 4.5 ⁇ m Millipore filters, sequentially).
  • CaCl 2 is added at 0.58 mg/ml plasma, and the plasma kept on ice until ready for perfusion.
  • mice with ether 1. Anesthetize rats with Nembutal (1 ⁇ l sodium pentobarbitone (60 mg/ml)/g body weight) and mice with ether.
  • Henseleit buffer containing heparin (0.2 ml/50 ml buffer.
  • anti-Gal antibody fraction - combine the eluted anti-GAL antibody fractions, dilute to 5 liters with Krebs Henseleit buffer and add EDTA to 10 mM
  • Anti-GAL reactivity Use as primary reagents to stain porcine cells (PK ⁇ s) . Detect staining as described in Example 2, above. Analyze stained samples using a FACScan II (Becton Dickinson) , according to the manufacturer' s instructions.
  • Protein content Determine using the colorimetric method of Bradford, Anal. Biochem. 72: 248-54 (1976) , with purified human IgG as the standard.
  • Electrolyte concentration On the day of the perfusion, the anti-GAL antibody depleted plasma is also tested to determine the calcium, magnesium and potassium levels using an electrolyte autoanalyser (Olympus) ; the levels of each are adjusted to normal as required.
  • Rat hearts were connected to the Langendorf apparatus and then stabilized by perfusion with Krebs Henseleit buffer for 10 min., and then a further 10 min. with the same buffer containing either melibiose or lactose (lOmM) . Human plasma was then added in stages as described above to a final concentration of 13 % and the effect of the added sugar on cardiac function was assessed. The parameters measured were heart rate, amplitude (strength) of contraction and output (Figure 3).
  • the sequence of the PCR primers was based on identifying conserved regions within the published sequences for murine and bovine ⁇ -l,3-GalT genes. Joziazze et al., J. Biol. Chem 264: 14290-97 (1989); Joziazze et al., Biol. Chem 267: 5534-5541 (1992). All primers were synthesized with EcoRl linkers at the 5' end for ease of cloning.
  • the PCR conditions used to generate porcine ⁇ -l,3-GalT cDNA fragments were as follows:
  • GTE2F + GTE9R and GTE4F + GTE9R heat to 94°C (60 seconds) ; then proceed with 35 reiterations (cycles) of the following three steps: (1) 94°C, 40 seconds, (2) 57°C, 50 seconds, and (3) 72°C, 80 seconds.
  • GTE9F + GT3UR heat to 94°C (120 seconds); then proceed with 35 cycles of: (1) 94°C, 40 seconds, (2) 48°C, 45 seconds, and (3) 72°C, 60 seconds.
  • the PCR fragments were subcloned into EcoRl- restricted pBluescript II KS+ (Stratagene, Cat, # 2 12206) and the DNA sequence was determined using the chain termination method. The DNA sequence was assembled and analyzed using DNASIS-Mac v2.01 (Hitachi)
  • the nucleotide sequence of porcine ⁇ -l,3-GalT (SEQ ID NO: 7) and the derived amino acid sequence (SEQ ID NO: 10) of the enzyme are shown in Figures 4 and 5.
  • a single large open reading frame extends from the initiating methionine at nucleotide 91 to a stop codon located at nucleotide 1204.
  • the sequence surrounding the putative initiating methionine conforms to the consensus eukaryotic initiation sequence. Kozak, Cell 44, 283-92 (1986) .
  • the porcine cDNA sequence is compared to the corresponding murine (SEQ ID NO: 9) and bovine (SEQ ID NO: 8) sequences in Figure 4.
  • the locations of introns within the murine gene are also shown. Joziazze et al., J. Biol. Chem 267: 5534 (1992). This alignment demonstrates that exon 3, located within the 5' untranslated region of the mouse gene, is not found in either the porcine or bovine cDNAs.
  • the overall sequence identities between the coding sequences are as follows: a) pig compared to mouse:- 75.02% (exon 3 not considered) b) pig compared to bovine:- 85.15%
  • the amino acid sequences of the porcine (SEQ ID NO: 10), murine (SEQ ID NO: 12) and bovine (SEQ ID NO: 11) ⁇ -l,3-GalT enzymes are depicted in Figure 5.
  • the locations of introns are also shown, based on their positions within the mouse gene (Joziasse et al., 1992). This alignment illustrates that the overall amino acid homologies are: a) pig compared to mouse: 71.98% b) pig compared to bovine: 82.87% c) bovine compared to mouse: 73.72%
  • EXAMPLE 7 Identification of Potential Sites to Interrupt the ⁇ -l-3-GalT Gene
  • the present inventors' choice of a site for interrupting the ⁇ -l,3-GalT gene has been influenced by several characteristics of the gene and its expression.
  • several mRNAs for ⁇ -l,3-GalT have been detected in the mouse. Joziazze et al., J. Biol. Chem. 267: 5534 (1992). These mRNAs are products of alternative splicing events in which exons 5 and/or 6 may be deleted.
  • these exons are not appropriate interruption sites in the mouse, since a transcript encoding a functional ⁇ -l,3-GalT enzyme presumably could be formed when exons 5 or 6 are spliced out.
  • the present inventors have isolated two different classes of ⁇ -l,3-GalT cDNA clones from the pig - one that includes exon 5 and one with exon 5 deleted. It is possible that mRNA' s with and without exon 6 are also formed by alternative splicing in the pig. Thus, for initial experiments the present inventors have not chosen these exons as sites for interruption.
  • exon 4 which encodes the cytoplasmic NH 2 -terminal domain and the membrane-anchoring domain; see Figure 5
  • this exon is an appropriate site to disrupt the ⁇ -l,3-GalT gene.
  • exons 7 and 8 which encode the NH 2 -terminal region of the catalytic domain, are suitable disruption sites. Insertion of a interrupting DNA fragment within these exons would prevent the synthesis of an active catalytic domain.
  • a preferred site for interrupting the mouse gene is located at a Sail site found within exon 9 of the mouse ⁇ -1,3-GalT gene, at codons 221 + 222 (see Figure 5) .
  • This site is positioned 150 amino acids from the COOH-terminus, within the catalytic domain.
  • the mouse gene within the present inventors' constructs for homologous recombination is interrupted at this Sail site.
  • the amino acids encoded by nucleotides at this Sail site are conserved in the pig and bovine sequences, although the Sail site itself is not. Construction of a Sail site at this position in the pig gene (e.g., by in vitro mutagenesis) provides a useful construct to inactivate the gene.
  • EXAMPLE 8 Choice of a DNA Fragment to Interrupt the ⁇ -1.3-GalT Gene
  • the present inventors have used both the neomycin resistance (neo R ) gene and the hygromycin resistance gene (hyg R ) to interrupt the ⁇ -l,3-GalT gene.
  • the neo R and hyg R genes are linked to the murine phosphoglycerate kinase (PGK) promoter (Adra et al. , Gene 60: 65-74 (1987) and are both bordered by polylinker sequences that include restriction sites for EcoRV and Clal.
  • PGK murine phosphoglycerate kinase
  • neo R gene is directed by an altered polyoma virus promoter (PMC1; Thomas and Cappechi, cell 51: 503-12 (1987)).
  • PMC1 polyoma virus promoter
  • the FLP/FRT recombinase system of yeast has been used to eliminate the neo R gene from the sequence that interrupts the ⁇ -l,3-GalT gene.
  • the neo R gene is bordered at both the 5' and 3' ends by FRT DNA elements.
  • stop codons for each of three reading frames have been inserted 3' to the neo R gene, and these stop codons, together with a single FRT sequence, will remain within the ⁇ -l,3-GalT gene after the neo R gene has been excised by FLP.
  • Targeted cells carrying a genomic copy of the neo gene flanked by direct repeats of the FRT could be supplied with FLP recombinase in two ways:
  • FLP protein (0.1 - 10 ⁇ g) is introduced (“transfected") into approximately 10 7 cells using standard electroporation conditions. The cells are plated out into gelatinized tissue culture dishes in appropriate medium, at a sufficient dilution to result in individual colonies. Approximately 200 of these colonies are then picked for further analysis.
  • a plasmid containing the FLP gene under control of a promoter able to drive FLP expression e.g., the human interferon-inducible 6-16 promoter
  • a promoter able to drive FLP expression e.g., the human interferon-inducible 6-16 promoter
  • Approximately 10 ⁇ g of FLP expression plasmid is transfected into approximately 10 7 cells using standard electroporation conditions.
  • interferon is added at approximately 500 units/ml, in order to induce expression of FLP.
  • the cells are then treated as in (1) , above.
  • the procedure to knock out the ⁇ -l,3-GalT gene in ES cells using an FRT-containing construct is: a) electroporate the complete construct into ES cells b) select neo R cells, and identify those ES cells having an interrupted ⁇ -l,3-GalT gene c) delete the neo R gene using FLP recombinase, as described above; cells are tested for the excision event as follows:
  • samples of each selected cell line are tested for the absence of the neo R gene by treatment with the chemical G418.
  • the cells will die in the presence of approximately 200 / g/ml G418 unless the neo R gene is still present in the genome.
  • Cell lines that are G418 sensitive are then tested further to confirm that excision of neo R has occurred. This is done by Southern analysis or PCR analysis, both described in Sambrook et al. (1989) .
  • genomic DNA is isolated from the cells, digested with an appropriate restriction enzyme, subjected to agarose gel electrophoresis, and the digested DNA transferred to a membrane.
  • the DNA is hybridized with a labeled probe, the label is detected (e.g., with X-ray film or color development) , and the pattern of bands indicates whether or not an excision event had occurred in the cell line.
  • genomic DNA is isolated from the cells and subjected to PCR reaction with suitable oligonucleotide primers. d) following confirmation of neo R excision, the manipulated ES cells or PGC s are used to generate chimeric animals.
  • Gene targeting is more efficient if the cloned cDNA fragments used for targeting are isolated from the cell line which is used for the gene knockout (i.e., the DNA is " isogeneic" ) . Accordingly, DNA was isolated from the E14 ES cell line (Hooper et al., Nature 326: 292-95 (1987)) and used to construct a mouse genomic library. The DNA was digested partially with the restriction enzyme Sau 3A, and fragments 12 kb - 20 kb in size were isolated by glycerol gradient fractionation. The size-fractionated DNA was ligated into the Bam HI site of ⁇ EMBL3 (Sambrook et al.
  • the lambda library was plated by infection of E. coli strain PMC103 host cells (Doherty et al. , Gene 124: 29-35 (1993)) at a density of 4xl0 4 phage per plate.
  • a bovine cDNA clone about 900 bp in length and containing a portion of the ⁇ -l,3-GalT gene corresponding to exons 7 - 9, was used to probe a total of 5.6xl0 5 independent recombinant phage.
  • Four overlapping clones containing ⁇ -l,3-GalT gene sequences were isolated and purified.
  • a knockout strategy was conceived. Basically the strategy is to insert a resistance gene (either neo R or hyg R ) into the Sail site which lies within Exon 9.
  • the knockout construct carries the 4.0 and 5.5kb Sail fragments from p ⁇ GT-S4.0 and p ⁇ GT-S5.5 which flank the Exon 9 Sail site ( Figure 13). Screening for homologous recombination events then can be carried out using a DNA fragment representing the genomic region but lying outside the DNA included in the knockout construct, i.e., outside the 9.5kb covered by p ⁇ GT-S4.0 and p ⁇ GT-S5.5.
  • a 0.7kb EcoRl/Xmnl fragment from p ⁇ GT-Sll is used to screen Southern blots of Bglll digested ES cell DNA for homologous recombinant events. An 8.3kb band should appear on these Southerns when the uninterrupted ⁇ l,3-GalT gene is probed with this
  • the present inventors prepared a series of knockout constructs.
  • the generation of one such construct is outlined in detail in Figure 15.
  • the vector p ⁇ GT-S5.5 which carries the 5.5kb fragment immediately 3' to the Exon 9 Sail site, was chosen as the starting vector.
  • p ⁇ GT-S5.5 was digested with EcoRV and Clal, generating a vector with a blunt end and a Clal compatible end.
  • a 1.3kb fragment carrying the PMC1 promoter-driven neo R gene flanked by FRT sites was excised from plasmid pNeo2FRT (previously constructed by the present inventors) by digesting with BamHl, filling in the restriction site and then digesting with Clal to generate a fragment with one blunt end and one Clal compatible end.
  • the nucleotide sequence of this 1.3kb fragment is provided in Figure 16 (SEQ ID NO: 13) . This fragment was then ligated into the Clal/EcoRV digested p ⁇ GT-S5.5, the ligation mix transformed and colonies screened for recombinants.
  • Neo R fragment inserted into the EcoRV/Clal of p ⁇ GT-S5.5, based on the restriction pattern after digestion with diagnostic restriction enzymes Clal, EcoRV, Xbal and EcoRl.
  • This construct was designated PNeo ⁇ GT6.8.
  • pNeo ⁇ GT6.8 was digested with Smal, generating a vector with blunt ends.
  • the 4.0kb Sail fragment was excised from p ⁇ GT-S4.0 and the ends filled. This fragment was then ligated into the Smal digested p ⁇ GT- S5.5, the ligation mix transformed and colonies screened for recombinants.
  • Two complementary oligomers were synthesized that, when annealed, generated a linker containing translation termination codons in all three reading frames and a Bglll site.
  • the linker has Clal compatible ends.
  • the linker was ligated into the Clal digested pNeo ⁇ GTlO.8, the ligation mix transformed and colonies screened for recombinants. Many colonies were recovered that contained the linker inserted into the Clal sites within pNeo ⁇ GTlO.8 based on the restriction pattern after digestion with diagnostic restriction enzymes Bglll, Cla and Bglll/Notl. This construct has been sequenced to confirm the identity, copy number and orientation of the insert. This construct is called pNeo ⁇ GT10.8B ( Figure 17).
  • Water for media preparation and cleaning of glassware is of high quality (e.g., Milli-Q water, prepared by passage through a Milli-Q ultrapure water system (Millipore) .
  • Glassware is either dry-heat sterilized or autoclaved following extensive cleaning in Milli-Q water before use.
  • All tissue culture work is carried out under laminar flow conditions (Hepa filtered horizontal laminar flow workstation) .
  • Antibiotics are used to minimize the risk of bacterial contamination (Penicillin, Streptomycin and
  • DMEM powder- Gibco the low-glucose or high-glucose formulation, with or without pyruvate, may be used; L-glutamine is included
  • FBS fetal bovine serum
  • Penicillin G - 5000 U/ml Streptomycin Sulphate - 5000 ⁇ .g/ml.
  • EGTA Ethylene-glycol-bis()9-amino-ethyl ether)N,N,N',N ⁇ -tetra-acetic acid [Ethylene-bis(oxy- ethylenenitrilo) ]tetraacetic acid
  • EDTA Ethylenediaminetetraacetic Acid
  • EDTA is preferred as it is less damaging to the ES/PGC cells.
  • Thymidine (Sigma) 24 mg 1. Dissolve by warming to 37°C.
  • the solution is adjusted to a final milliosmolarity of 250-280 by addition of H 2 0 or NaCl.
  • Batches of FBS vary in the ability to support growth of ES cells, and in the ability to maintain the undifferentiated state of such cells. The following procedure is used to identify suitable batches of FBS. Use ES cells from between 2 & 20 passages:
  • This procedure is used to assay the potency of Leukae ic Inhibitory Factor (LIF) .
  • LIF Leukae ic Inhibitory Factor
  • CM conditioned medium
  • Embryonic pluripotential cells are cultured in vitro on a layer of fetal fibroblast cells.
  • the fibroblast cells provide a wide range of factors necessary for the growth of pluripotential embryonic cells (e.g. growth factors, cytokines, factors that are essential for maintenance of ES cell pluripotency) .
  • growth factors, cytokines, factors that are essential for maintenance of ES cell pluripotency e.g. growth factors, cytokines, factors that are essential for maintenance of ES cell pluripotency
  • Passage of cells may be continued to increase cell numbers, or cells may be frozen or inactivated for further use.
  • mice feeder STO cells
  • porcine and bovine fetal fibroblasts can be used to form feeder layers. These include: (1) Bradley/Baylor mouse STO feeder cells that have been modified to express human LIF (gift from Allan
  • the procedure for producing feeder layers is as follows:
  • This procedure is used to expand the number of cells from a single confluent plate/dish; cells are detached from the confluent plate and transferred to fresh plates at sub-confluent densities. 1. Gelatinize five 10 cm tissue culture dishes.
  • STO Cell medium i.e., a ratio of 1:1 STO Cell medium:Trypsin/Versene Working Solution
  • STO Cell medium i.e., a ratio of 1:1 STO Cell medium:Trypsin/Versene Working Solution
  • Ten 4-well plates (Nunc tissue culture plates) , or Eight 3.5 cm tissue culture dishes, or Three 6 cm tissue culture dishes, or Two 20 cm tissue culture dishes.
  • Embryos at the morula stage of development are surgically collected from superovulated animals.
  • porcine embryos for example, the zona pellucida is then disrupted using Acid Tyrodes solution and ES cells/PGC s are cultured in the presence of the zona pellucida- disrupted morulae.
  • ES/PGC cells adhere to the exposed morula cells and, following overnight culture in Whitten' s medium, the embryos are transferred to synchronized recipients.
  • the zona pellucida- disrupted morula is completely free of the zona pellucida. However, this need not be the case as long as the ES cells/PGC s can gain direct access to at least some of the morula cells.
  • ES cells and PGC s can be injected into a morula embryo prior to formation of the blastocyst cavity.
  • the technique is similar to blastocyst injection.
  • ES cells or PGC s are drawn into an injection pipette, which is inserted beneath the zona pellucida. Then, the cells are expelled so that they are in contact with the cells of the morula embryo.
  • the injected morula is then cultured overnight in Whitten' s medium (porcine) or other appropriate medium to allow blastocyst formation.
  • Whitten' s medium porcine
  • ES cells and PGC s can be fused to enucleated zygotes that have been derived by in vitro maturation, in vitro culture, in vitro fertilization or collected surgically. Following successful fusion the embryos can be transferred to synchronized recipients.
  • porcine oocytes for example, are manipulated in Whitten' s medium supplemented with 1.5% BSA Fraction V and 7 ⁇ g/ l cytochalasin B (Sigma) .
  • a bevelled micropipette is used to remove the metaphase plate from the oocyte.
  • a single ES cell or PGC (after trypsin treatment to form a single-cell suspension) is inserted through the zona using a bevelled micropipette, such that the cell comes in contact with the oocyte plasma membrane. Fusion is achieved in a 28 V/cm AC field for 5 sec. followed by an 80 V/cm DC pulse of 100 ⁇ sec. duration. Subsequent to observed fusion, embryos are incubated at 39° C in 5% C0 2 , 5% 0 2 , 90% N 2 in microdrops of Whitten' s medium supplemented with 1.5% BSA, until transfer to a synchronized recipient.
  • EXAMPLE 11 Murine ES Cell Culture ES cells are able to differentiate spontaneously into many different cell types, and culture conditions which prevent this differentiation are critical for the continuous passage of these cells in an undifferentiated form, capable of contribution to chimeric mice.
  • ES cells are grown in polystyrene cell culture dishes treated with 0.1% gelatin (made up in PBS or Milli-Q water) for 10 minutes.
  • a feeder layer of mitotically inactivated fibroblasts provides a source of cytokines.
  • the fibroblasts are either primary mouse embryo fibroblasts (PMEFs) , or STO fibroblasts, an immortal line.
  • the medium used is DMEM supplemented with glucose, amino acids and nucleosides.
  • Robertson Embryo- Derived Stem Cell Lines. In: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach (E.J. Robertson, ed.), IRL Press, Oxford (1987).
  • LIF final concentration of 10 3 U/ml Esgro, AMRAD
  • FBS is added to 15%.
  • the batch of FBS is chosen on the basis of its ability to support ES cell growth with low levels of differentiation (i.e, only rare individual cells undergo differentiation.
  • the ES cells are grown in an atmosphere of 5-10% C0 2 , at 37°C II.
  • ES cells must be passaged frequently to prevent the colonies from growing too large and differentiating. This is achieved by splitting the cells at a ratio of 1:10 to 1:40, every two to four days.
  • EXAMPLE 12 Genetic Manipulation of Cells
  • the general procedures set out in this Example provide guidelines that are readily adaptable to individual experimental situations that might employ, for example, different cell lines or equipment supplied by different manufacturers.
  • This Example also provides specific procedures used and results obtained in generating a set of mouse ES cell lines in which the ⁇ 1- 3 galactosyltransferase gene was disrupted by homologous recombination.
  • the general procedures provided in this Example are adapted for mouse ES cells. However, the procedures are substantially similar for porcine ES cells.
  • I. INTRODUCTION OF DNA INTO ES CELLS BY ELECTROPORATION A. Coat required number of plates with 0.1% gelatin (in PBS or Milli-Q water) . (Usually 2 X 6 well plates and 8 well plate)
  • B. Thaw 10 7 embryonic fibroblasts into DMEES
  • F. Remove PBS, add 5 ml trypsin (CSL) and leave at room temperature for 2 - 4 min. Wash down cells, add 10 ml DMEES and count. Approximately 5 X 10 6 to 2 X l ⁇ 7 ES cells are needed for experiments.
  • G. Centrifuge cells and resuspend in 10 ml PBS. Centrifuge again and resuspend in 540 ⁇ .1 PBS. Dilute 50 ⁇ l into 10 ml DMEES and culture to determine plating efficiency.
  • K Centrifuge cells and resuspend in 5ml DMEES.
  • L Take 50 ⁇ l , add 50 ⁇ l trypan blue solution and count for viability.
  • ES cells that do not express a neomycin resistance gene are selectively killed by treatment with G418 at 200-500 ⁇ g per ml of medium. Antibiotic- containing medium is changed daily. A population of cells that has not been electroporated also is treated in order to see how genuinely sensitive cells respond to the G418 treatment. After 6 to 10 days, cells resistant to the antibiotic will be evident as healthy colonies. These cells will have been transformed by the targeting construct and can be screened for homologous recombination (i.e., screened for gene targeting versus random integration) .
  • Resistant colonies are picked from the selection dish with a mouth pipette and dispersed into a single cell suspension. Half of these cells are frozen away while the other half is expanded and used to determine whether or not homologous recombination has occurred. If the colonies are small, it is sometimes preferable to expand the whole colony in a 24 well dish, and then to freeze half while further expanding the other half for genetic analysis.
  • A. Method l Freezing Half Colonies 1. The day before colony picking: a) Coat required number of plates with 0.1% gelatin (in PBS). Two plates per 24 colonies to be picked: one plate is for freezing and one plate is for clone expansion. Start with 20 X 24 well plates. b) Count irradiated fibroblasts, spin down and resuspend in DMEES. c) Aspirate gelatin from 10 plates and plate -lO 5 ⁇ (can use as few as 5 X 10 4 ) cells/well in 1ml DMEES. Incubate at 37°C, 10% C0 2 overnight (or a minimum of 1 h) . d) Aspirate the gelatin from the other
  • Method 2 Freezing after expansion to 24 wells.
  • the day before colony picking a) Coat required number of plates with 0.1% gelatin (in PBS). Start with 10 X 24 well plates. b) Count irradiated fibroblasts, spin down and resuspend in DMEES. c) Aspirate gelatin from the plates and plate -10 s cells/well in 1ml DMEES. Incubate at 37°C, 10% C0 2 overnight (or a minimum of 1 h) . 2. On the day of colony picking: a) Pick colonies as described for half colonies (method 1, above) but instead of dividing the cell suspension between freezing and expansion plates, the entire cell suspension goes into the expansion plate. b) After 3-4 days (with daily medium changes) the cells will have grown sufficiently to be frozen.
  • a total of lxlO 7 E14 ES cells was electroporated with 5 ⁇ l of l ⁇ g/ ⁇ l pNeo ⁇ GT10.8B DNA (linearized by Xhol digestion) (see Example 9 and Figure 17) . Electroporation was carried out in 600 ⁇ l in a wide cuvette at 25 ⁇ F, 350V for 0.5msec. Cells were recovered in 6ml ES complete medium and plated into 6 x 100mm petri dishes, each containing a feeder layer of Neo R STO cells.
  • ES complete medium for 3 days and then medium containing 200-350 ⁇ g/ml G418 was substituted. This medium was changed every second day. After 9 days, individual Neo R colonies were sufficiently large to be identified and recovered. Colonies were picked in 20 ⁇ l PBS and 20 ⁇ l of trypsin solution were added. Forty ⁇ l of 60% BRL conditioned medium in ES complete medium were then added. Aliquots of 40 ⁇ l were transferred to single wells of each of two 24-well plates. One plate contained a feeder layer of STO cells in lOO ⁇ l ES complete medium. 140 ⁇ l of 2x DMSO freezing mix was added to this plate, which was stored at -80°C. Each of the wells of the second 24-well plate contained lml of 60% BRL conditioned medium in ES complete medium. This plate was incubated at 37°C until the colonies were confluent.
  • the membrane was prehybridised in a Hybaid hybridization bottle in 10ml of the following hybridization mix for 3 hours at 65°C: 0.25M Na 2 HP0 4 pH 7.2 7% SDS lmM EDTA
  • Radioactively labeled probe DNA was prepared using a BRESATEC gigaprime oligo labeling kit (Cat. No. GPK-1) according to the manufacturer' s recommendations. Approximately 50ng of a 0.7kb EcoRI/Xmnl DNA fragment from beyond the 3' terminus of the construct pNeo ⁇ GT10.8B (see Example 9 and Figure 17) were labeled with 32 P-dATP to a specific activity of 5xl0 8 cpm/ ⁇ g. The denatured probe was added to the prehybridising membrane in the Hybaid bottle and incubated overnight at 65°C.
  • the membrane was removed from the Hybaid bottle, rinsed with 0.5xSSC, 0.1% SDS prewarmed to 65°C, and then washed 2-3 times with O.lxSSC, 0.1% SDS at 65°C for 30 min each wash. Excess moisture was then blotted from the membrane, the membrane wrapped in plastic wrap and exposed to a phospho-imager screen for 16 hours up to 3 days. The image was visualized on an I agequant phospho- imager.
  • Results are shown in Figure 18, which is a Southern blot of DNA from 15 ES cell lines probed with the diagnostic 0.7kb EcoRI/Xmnl DNA fragment described above and in Example 9.
  • the 6.4kb band diagnostic for a homologous recombination event in the ⁇ 1-3 galactosyltransferase gene ( ⁇ 1-3 Gal T) (see Example 9) , is seen in 6 of the 15 ES cell lines examined. All of the 6 knockout cell lines appeared to be heterozygous for the inactivated allele since the 8.3kb band, diagnostic for the uninterrupted ⁇ -l,3-Gal T gene (see Example 9), was also present in all six lanes.
  • MGT-KOex8F and MGT-KORl span the intron between exons 8 & 9, and amplify a 5.5 kb fragment from the wild- type ⁇ -l,3-GalT gene ( Figure 19) SEQUENCES:
  • MGT-KOex8F and MGT-KONeoR span exon 8 to the Neo R gene cassette in the "knock-out” allele and amplify a 5.5 kb fragment from the knocked out allele ( Figure 19) SEQUENCE: MGT-KONeoR
  • Each reaction contained -100 ng genomic DNA as template in a reaction volume of 50 ⁇ l and contained 25mM Tris HCI (pH9.1), 16mM (NH 4 ) 2 S0 4 , 250 ⁇ M dNTPs, 3.5 mM MgCl 2 , 100 ng each primer, 2 units Taq polymerase and 0.025 units Pfu polymerase.
  • the reactions were heated at 94°C for 1 min, then 45 cycles of 94°C for 15 sec, 68°C for 6 min, followed by a single step of 72°C for 10 min.
  • Genomic DNAs from putative "knock-out" ES cell lines from CBA/C mice were amplified in separate reactions using each set of primers. A lO ⁇ l aliquot of each PCR was analyzed by Southern blotting (Sambrook et al., 1989).
  • ES CELLS FOR INJECTION ES cells are split into wells of a 24-well dish at cell densities of 1:2, 1:4, 1:8 and 1:16, relative to the initial density, two and three days before injection. The most vigorous and least differentiated cultures are chosen on the basis of morphology.
  • Mouse embryos are collected from either superovulated or naturally mated female mice, approximately 3.5 days after mating. After overnight culture in M16 medium (Bradley, Production and Analysis of Chimaeras. In Teratocarcinomas and Embryonic Stem Cells a Practical Approach (E.J. Robertson, ed.) IRL Press, Oxford, pp. 113- 52 (1987)), those that have cavitated to form blastocysts are microinjected with about 12 to 20 ES cells. This microsurgical procedure is performed with instruments drawn from capillary glass, and injection is controlled with micrometer syringe-based hydraulic devices. A differential interference contrast-equipped inverted microscope is used to view the procedure.
  • Chimeric mice are identified by coat color contribution by the ES cells. Chimaeric mice show agouti coat colour derived from the host blastocyst, and chinchilla contributed by the ES cells.
  • Chimeric mice were generated from ES cells carrying the interrupted a-l,3-Gal T allele (including 8D1, 7C2 cells) by injection into C57B1/6J x CBA F2 blastocysts.
  • the ability of individual chimaeric mice to transmit the ES cell characteristics through the germ-line was estimated by glucose phosphate isomerase (Gpi) analysis of sperm (Bradley, supra. (1987)); Mann et al., J. Reprod & Fert. 9_9_, 505-512 (1993) .
  • Glucose phosphate isomerase catalyses the interconversion of glucose-6-phosphate to fructose-6- phosphate.
  • mice have a single structural Gpi locus with two main alleles Gpi 1A and Gpi IB.
  • Gpi 1A codes for protein which appears as a slow cathodically migrating band during electrophoresis and occurs in strains such as BALB/c and C129. (The ES cells used here were derived from strain 129 mice) .
  • Gpi IB determines an enzyme that moves faster than Gpi 1A and occurs in the wild and in strains such as C57 and CBA (used here to derive host blastocysts) .
  • Heterozygotes have the two parental bands plus an intermediate band which indicates the di eric structure of the enzyme. Multiple electrophoretic forms occasionally observed are due to oxidation of sulfyhdryl groups and not due to tissue-specific expression.
  • the ratio of Gpi 1A (strain 129-derived) to Gpi IB (derived from the host blastocyst) indicates the proportion of cells with the ES cell genotype within different tissues.
  • the appearance of Gpi 1A (derived from the ES cells) in the sperm suggests that the mouse is able to transmit the ES cell genotype through the germ-line.
  • Chimaeric mice with sperm derived from ES cells were mated to BALB/c mice.
  • Offspring with the 129/Ola X BALB/c genotype i.e. heterozygous for the ES cell genotype
  • Half of these grey mice were expected to carry the interrupted allele.
  • Mice heterozygous for the interrupted allele were identified by PCR analysis of genomic DNA obtained from blood.
  • mice homozygous for the inactivated ⁇ -1,3- Gal T gene were mated to each other. One quarter of the offspring were expected to be homozygous for the interrupted gene. Homozygotes were identified by PCR analysis of genomic DNA obtained from blood. The PCR strategy was based on the insertion of a Neo R gene in the Sal I site of exon 9 of the ⁇ -l,3-Gal T gene ( Figure 13). Wild-type primers:- E9F: 5'TCAGCATGATGCGCATGAAGAC 3' (SEQ ID NO: 17)
  • E9R2 5'TGGCCGCGTGGTAGTAAAAA 3' (SEQ ID NO: 18)
  • the expected fragment size generated from the wild- type allele is 255 bp ( Figure 21) .
  • These primers also can potentially generate a 1596 bp PCR fragment from the interrupted allele. In practice this fragment was not generated when both the wild-type and interrupted alleles were present, probably because the smaller 255 bp product is amplified preferentially.
  • NeoFl 5' TCTTGACGAGTTCTTCTGAG 3' (SEQ ID NO: 19)
  • E9R2 (corresponding to nucleotides 1170-1189; Figure 16)
  • the expected fragment size is 364 bp ( Figure 21) .
  • Mice were grown to weaning age and bled from the tail. Sodium Heparin was added to about 10 U/ml.
  • PCR amplification was conducted on 1 ⁇ l of heparinised blood (-10 4 nucleated cells) in a 50 ⁇ l reaction volume containing 100 mM Tris-Acetate pH 8.8, 3.5 mM MgCl 2 , 0.2mM dNTPs, and 2 units Tth DNA polymerase.
  • Each reaction contained both the wild-type and knock-out primers at a concentration of 2ng/ ⁇ l for each primer. To ensure that Tth polymerase was not inhibited by heparinized blood, each reaction was performed in duplicate.
  • the other reaction was not spiked. Thus, two separate PCR reactions were set up for each blood sample. In addition, control PCR reactions with no genomic DNA template and with or without spikes were conducted. Each reaction mix was heated at 94°C for 3 min., then incubated for 40 cycles at 94°C for 40 sec, 53°C for 40 sec, and 72°C for 40 sec. Aliquots of 5 ⁇ l of each reaction mix were electrophoresed on a 3% agarose gel, and DNA fragments were visualized on a UV light box after staining with ethidium bromide. Hpall-digested pUC19 plasmid DNA was used for markers.
  • mice #43 results of the PCR analysis for three mice, and a "no DNA" control, are shown in Figure 22.
  • the KO primers generated a 364 bp band in the + spike reaction only.
  • the wild-type primers generated a 255 bp band in the + spike and - spike reactions.
  • mouse #42 is homozygous for the wild-type allele.
  • mouse #43 the wild-type primers generated a 255 bp band in the + spike reaction only.
  • the KO primers generated a 364 bp band in the + spike and - spike reactions.
  • mice #44 For mouse #44, the KO primers generated a 364 bp band in the + spike and - spike reactions. The wild-type primers generated a 255 bp band in the + spike and - spike reactions. These results demonstrate that mouse #44 is heterozygous for the interrupted allele. In the control PCR reactions, no product was evident when template was not included. PCR products of 364 bp and 255 bp were evident when pNeo ⁇ GT10.8B and Exon 9 RT-PCR DNA were the only templates included in the control reactions.
  • Primers 7F and 9R2 were expected to generate a fragment of -619 bp ( Figure 23) from the cDNA template. These primers will not generate a fragment from genomic DNA possibly present in the cDNA preparation, since the primers span two large introns.
  • mGT-3UR 5'- GGGTTTTGGTTTTGATTGTT 3' (SEQ ID NO: 22) (corresponding to nucleotides 1866-1888 within the 3 ' untranslated region; Figure 4) .
  • This primer was used with primer 7F to generate the DNA fragment used in the control spike PCRs.
  • FC-F 5'- CTGAATTCATGTTAAACATGGGAGGCCCC 3' (SEQ ID NO: 23) (corresponding to nucleotides 215-235,
  • gFC-R 5'- CTGAATTCTGCCCACTCCCTGCCGATG 3' (SEQ ID NO: 24) (corresponding to nucleotides 888-908,
  • Reaction volumes were 50 ⁇ l, consisting of 4 ⁇ l of the first strand cDNA synthesis reaction, 100 ng of each primer, 2 mM MgCl 2 , 0.3 mM dNTPS, 2U of Taq-Polymerase (Bresatec) and Taq reaction buffer (Bresatec) at IX concentration. Reactions were heated at 94°C for 2 min, then 29 cycles of 94°C for 15 sec, 58°C for 30 sec and 72°C for 1 min followed by single steps of 72°C for 4 min and 4°C for 5 min. A 10 ⁇ l aliquot of each PCR was electrophoresed on a 2% agarose gel and DNA fragments were visualized on a UV light box after staining the gel with ethidium bromide.
  • Figure 24 shows the PCR fragments generated from RNA isolated from kidney (K) , heart (H) and liver (L) of a wild-type mouse, and mice heterozygous or homozygous for the interrupted ⁇ -l,3-Gal T allele.
  • Figure 24(i) shows that the 709 bp ferrochelatase fragment was generated from each of the cDNA preparations, indicating that cDNA template was produced from the reverse transcription reaction, and was available for the ⁇ -l,3-Gal T gene primers.
  • Potassium phosphate buffer pH 7.2 a) 1.68M KH 2 P0 4 (229 g/L) b) 1.12M K 2 HP0 4 (226 g/L K 2 HP0 4 3H 2 0 or 195 g/1 K 2 HP0 4 )
  • Potassium phosphate buffer is prepared by mixing together equal volumes of solutions a) and b) . To pH the buffer, remove a small sample, dilute 1:50 and read on pH meter.
  • KDS BSS Add stock solutions in the following order to double-distilled water (DDW) :
  • FITC dilution Dilute 7.5ul FITC-IgG to 600ul with KDS/BSS
  • HBBS Hanks Balanced Salt Solution
  • mice Eye bleed mice, collect 300-400ul into pre- chilled Ependorf tube, store on ice, add EDTA 20mg/ml to give final concentration of 2mg/ml. 2. Transfer blood (including appropriate human controls) to 10ml plain tube and add 10ml red cell lysis buffer (0.168M NH 4 C1) pre-warmed to 42°C; incubate for several minutes or until cells have lysed.
  • IB 4 Lectin has an exclusive affinity for terminal ⁇ - D-galactosyl residues, and is demonstrated below to be useful for characterizing the knockout mice.
  • KDS/BSS Mae Tonicity, Hepes Buffered Balanced Salt Solution pH 7.2
  • TBS Tris Buffered Saline NaCl 8g
  • Blocking buffer 800ml distilled water. Adjust pH to 8.0 with 1 M HCI. Adjust volume to 1L. Sterilise by autoclaving. Store at RT. 2. Blocking buffer:
  • Conjugates were both separately pre-absorbed on 10% mouse liver powder at 4°C overnight, then centrifuged at 18,000xg for 10 minutes in a Biofuge and then at 30 psi for 30 min in a Beckman airfuge. Conjugated antisera were diluted 1/50 in 2% blocking buffer (TBS + 2% BSA + 2% rabbit serum) with 16% normal mouse serum. 4.
  • MT-PBS mouse tonicity phosphate buffered saline
  • a) Prepare a fine suspension of mouse liver in mouse tonicity phosphate buffered saline (MT-PBS) .
  • Mash liver through a sieve with a 5 ml plunger. Discard any fibrous tissue.
  • One gram of tissue should be resuspended in approximately 1 ml MT-PBS.
  • b) Transfer the tissue/saline suspension to ice for 5 min.
  • c) Add 8 ml of acetone (-20°C) (Univar 6, Ajax Chemicals) for 10 minutes. Mix vigorously. Incubate on ice for 30 minutes with occasional vigorous mixing.
  • d) Collect the precipitate by centrifugation at 10,000g (9,000 rpm in Sorvall RC-5B refrigerated superspeed centrifuge) . Spin for 10 minutes.
  • e) Resuspend the pellet with fresh acetone (-
  • Peroxidase substrate 3,3'-Diaminobenzidine tetrahydrochloride (DAB) (Sigma, Missouri)
  • Tris HCL 1.211g Tris in 200ml double distilled water pH 7.6
  • Sheep serum was obtained from the University of Melbourne Veterinary Clinic and Hospital, Werribee, Australia.
  • Blocking buffer TBS + 2% BSA + 10% sheep serum 2.
  • FITC IB 4 (Sigma, Missouri, USA #L-2895)
  • TBS + 2% BSA + 2% sheep serum Incubate for 30 minutes in humidified chamber.
  • Lysis of spleen cells by human serum was tested through use of a 51 chromium release assay. See in general Example 4, above.
  • HI-FCS Store cells on ice.
  • Fetal calf serum - purchased from Gibco BRL, and stored at -20°C.
  • Freshly prepared cells ⁇ 2 hours -150-300 ⁇ Ci (eg. , splenocytes or lymphocytes)
  • -Assay should be set up in quadruplicate. -Assay is performed in a total volume of 180 ⁇ l. Assay:
  • EXAMPLE 16 Generation of Knockout Animals Through Microinjection of Eggs
  • Transgenic animals are generated routinely by microinjection of DNA into the pronuclei of fertilised eggs. Generally this technology results in the random integration of the transgene in the genome.
  • conventional transgenic technology has resulted in homologous recombination between the injected transgene and the endogenous gene. See, for example, Brinster et al., Proc. Nat. Acad. Sci. USA 86: 1087-91 (1989). Described below are procedures for inactivating the ⁇ - 1,3-Gal T gene in pigs through microinjection of eggs with gene targeting constructs. I. GENE TARGETING CONSTRUCTS
  • the frequency of homologous recombination in embryos is improved if the gene targeting constructs are prepared with isogenic DNA. Therefore the "knock out" constructs are prepared from DNA isolated from the boar used to fertilize the oocytes used for microinjection. DNA is isolated from the tail or ear tissue, and genomic fragments from both ⁇ -l,3-Gal T alleles of the boar, encompassing exons 8 & 9 are cloned using long range PCR or conventional genomic library technologies. Clones for each of the ⁇ -l,3-Gal T alleles are identified using restriction fragment length polymorphism identification and DNA sequencing. Constructs to target both alleles are made by interrupting the coding sequence of exon 9, either by deletion or by inserting a heterologous DNA fragment.
  • the constructs contain at least 8 kb of homologous DNA to promote efficient homologous recombination.
  • PCR of Genomic DNA Homologous DNA on one side of the interrupting DNA fragment is constructed to be less than 1 kb, allowing PCR amplification of a short diagnostic fragment. (Amplification of small fragments generally is relatively efficient) .
  • Reverse Transcription/PCR A deletion of about 100 bp within exon 9 is made, allowing synthesis of a shortened ⁇ -l,3-Gal T mRNA in correctly targeted cells.
  • GFP Green Fluorescent Protein
  • the ⁇ -l,3-Gal T gene is interrupted within exon 9 by in-frame insertion of the GFP coding region. Expression of the GFP gene (with resulting fluorescence at 509 nm) is driven by the ⁇ -1,3- Gal T gene promoter in correctly targeted cells.
  • Fertilized embryos are generated as described by Nottle et al., (1993). Proc Aust Soc for Reproductive Biol 26, 33.
  • the protocol involves: a)sperm from the boar providing DNA for the targeting construct is collected and stored frozen in liquid N 2 . b) Superovulation of donor gilts:
  • Gilts are mated at the second oestrus, and aborted between days 25-40 days of gestation to synchronise the subsequent oestrus cycles. Abortion is achieved by intramuscular injection of 1 mg cloprostenol (a prostaglandin F2 ⁇ analogue), followed by a second 0.5 mg injection 24 hours later. Gilts are superovulated by injection of 1000 i.u. equine chorionic gonadotrophin (eCG) or pregnant mare serum gonadotrophin at the time of the second cloprostenol injection, and a subsequent injection 72 hours later of 500 i.u. human chorionic gonadotrophin (hCG) .
  • Fertilization 1000 i.u. equine chorionic gonadotrophin (eCG) or pregnant mare serum gonadotrophin at the time of the second cloprostenol injection, and a subsequent injection 72 hours later of 500 i.u. human chorionic gonadotrophin (hCG) .
  • Embryos are collected surgically 50-56 hours after hCG injection prior to fusion of the pronuclei. Oviducts are flushed with 15-20 ml phosphate saline buffer containing 1% fetal calf serum. One-cell embryos are recovered by searching oviductal flushings using low magnification microscopy. III. MICROINJECTION OF EMBRYOS
  • Embryos are centrifuged at 12000 x g for 8 min to stratify the cytoplasm and allow the pronuclei to be visualised, and held in Dulbecco's Minimal Essential Medium with 25 mM Hepes and 5 mg/ml bovine serum albumin. Pronuclei are injected, using differential interference contrast optics, with 4-10 picolitres of DNA (10 ng/ ⁇ l) in PBS. Gene targeting with isogenic DNA is maximized by coinjecting both allelic constructs derived from the boar into the male pronucleus.
  • GILTS The oestrus cycles of recipient gilts are synchronized with those of donors.
  • the recipients are mated and aborted using the protocol described above, and injected with 500 i.u. eCG.
  • Injected embryos are transferred surgically (20-40 per oviduct) to recipients on the same day that they are collected from donor gilts.
  • V. SCREENING FOR HOMOLOGOUS RECOMBINATION Homologous recombinants can be detected by analysis of tissue from the born piglets. Screening procedures involve PCR technology, the precise strategy depending on the design of the gene targeting construct. Because many ⁇ -l,3-Gal T mRNA molecules are synthesized from a single ⁇ -l,3-Gal T gene in expressing cells, the RT/PCR approach can be more sensitive than PCR amplification of genomic DNA. The RT/PCR screening strategy relies on successful transcription of the interrupted gene and relative stability of the shortened mRNA.
  • constructs that promote expression of heterologous genes allow embryos to be screened at the blastocyst stage for marker gene expression (i.e.: GFP expression can be detected by measuring fluorescence within blastocysts at 509 nm) .
  • the microinjected embryos are cultured in vitro until blastocyst development, screened for fluorescence, and fluores ⁇ ing embryos transferred into recipients.
  • LIF Leukemia Inhibitory Factor
  • T-LIF third transcript of LIF
  • the T-LIF protein is found intracellularly in contrast to the other two forms of LIF which are both extracellular.
  • the transcript was cloned using the RACE PCR technique (see below) from murine ES cells and human GCT 27 teratocarcinoma-derived cell lines, and sequenced using standard methods. The presence of the T-LIF transcript was confirmed by PCR analysis of ES cell mRNA and RNA' ase protection on GCT 27 RNA.
  • the transcript comprises a novel first exon, located in the first intron of the LIF gene, spliced to the known exon 2 and exon 3 sequences.
  • the mouse nucleotide sequence (SEQ ID NO: 25) and deduced amino acid sequence (SEQ ID NO: 26) are set out in Figure 26.
  • the human nucleotide sequence (SEQ ID NO: 31) and deduced amino acid sequence (SEQ ID NO: 32) are set out in Figure 27.
  • the murine T-LIF transcript When expressed in a COS cell expression system, the murine T-LIF transcript produces a 17 kD protein that is unglycosylated (D-LIF is glycosylated in the Golgi during the secretion process) ( Figure 28) .
  • Translation of T-LIF initiates at the first in-frame initiation codon (ATG) in exon 2 to produce a protein of 158 amino acids.
  • the protein is 45 amino acids shorter than the unprocessed D-LIF protein and 22 amino acids shorter than the mature D-LIF product generated by cleavage of the signal sequence. Because the T-LIF protein does not contain a signal sequence, it does not leave the cell and is unglycosylated.
  • the T form of LIF is efficacious in preventing the differentiation of ES cells in culture.
  • RNA was added to 20 pmol of primer and 2 ⁇ l of lOx annealing buffer (500mM Tris-HCl (pH 8.0), 60mM MgCl 2 , 400mM KC1) in a total volume of 16 ⁇ l, heated to 85'C for 5 min, and cooled slowly to room temperature.
  • the elongation reaction was carried out as described by Frohman et al. (Proc. Natl. Acad. Sci. USA 85: 8998-9002 (1988)).
  • TE lOmM Tris-HCl pH 7.6, l.OmM EDTA.
  • Fractions of 50 ⁇ l corresponding to the cDNA radioactive peak were pooled, concentrated by vacuum centrifugation, and resuspended in 23 ⁇ l of H 2 0.
  • 3 ⁇ l of lOmM dGTP and 6 ⁇ l of 5 x tailing buffer (Bethesda Research Laboratories) were added and the mixture was incubated at 37'C for 60 min. and then at 70'C for 15 min. After ethanol precipitation, the cDNA template was resuspended in 500 ⁇ l H 2 0.
  • PCR was carried out using a mouse LIF specific oligonucleotide, 5'-TTCTGGTCCCGGGTGATATTGGTCA-3' (residues 389-365) (SEQ ID NO: 28) , and an anchor oligonucleotide, 5'-CCATGGCCTCGAGGGCCCCCCCCCCCC-3' (SEQ ID NO: 29) .
  • PCR was carried out in a final volume of 50 ⁇ l containing 7 ⁇ l of the cDNA template and 34pmol of each oligonucleotide. Reaction conditions were as recommended by Perkin-Elmer Cetus, with a final concentration of 1.5mM MgCl 2 .
  • DNA was denatured prior to the addition of Taq polymerase (Perkin-Elmer Cetus) by heating the reaction mixture to 94'C for 5 min.
  • Each PCR cycle (35 in total) consisted of denaturation for 2 min at 94'C, annealing for 2 min at 55'C, and elongation for 3 min at 72'C. After the final elongation (30 min at 72 * C), samples were ethanol precipitated, digested with Smal and Xhol and analyzed by agarose gel electrophoresis.
  • DNA was purified from agarose gels using Geneclean and cloned into Sail- and Smal- digested TST7 19U (Stratagene) . Suitable recombinant plasmids were purified by the rapid boiling method.
  • Double-stranded sequencing was performed with Sequenase version 2.0 (USB) according to the manufacturers recommendations.
  • the complete T-LIF open reading frame was reconstructed from the PCR product and inserted into the COS cell expression vector pXMT2 as described by Rathjen et al., Cell 62: 1105-14 (1990).
  • the plasmid used for transfection of COS cells is shown in Figure 29.
  • the COS cells were transfected by electroporation.
  • Supernatants from COS cells expressing T-LIF were added to the above ES cells in various dilutions (1/5, 1/10,
  • T-LIF is produced intracellularly, sufficient numbers of cells lyse to give significant amounts of LIF activity in the culture supernatants. If the COS cells expressing T-LIF are lysed, more LIF activity is released.
  • PCR was carried out on ES cell cDNA (prepared as described above except that the cDNA was not tailed with dG) .
  • PCR conditions were as described above except that 2mM MgCl 2 was used in the reactions.
  • the oligonucleotides 5'-CACCTTTCGCTTTCCT-3' (SEQ. ID NO. 30) and 5'-TTCTGGTCCCGGGTGATATTGGTCA-3' (SEQ. ID. NO 28) were used at 80 picograms/reaction. Products of the PCR reaction were ethanol precipitated as described above, separated electrophoretically on a 2% agarose gel and transferred to a nylon membrane for detection using Southern hybridization ( Figure 30) .
  • the probe was the full length D-LIF transcript isolated from pDRl (Rathjen et al., Cell 62: 1105-14 (1990).
  • the control experiment is designed to detect all LIF transcripts using internal primers 5'-TTCTGGTCCCGGGTGATATTGGTCA-3' (SEQ. ID. NO 28) and 5' -CTGTTGGTTCTGCACTGGA-3' (SEQ. ID. NO. 33).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Environmental Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Des hétéro-anticorps humains préformés jouent un rôle important dans les réactions de rejet hyperaigu suite à une hétérogreffe chez l'homme. Des substances et des procédés permettant de supprimer ou de neutraliser ces anticorps sont décrits, ainsi que des substances et des procédés permettant de réduire ou de supprimer les épitopes dans les organes donneurs qui sont reconnus par de tels anticorps. Ces épitopes résultent de l'activité de l'enzyme α-1,3 galactosyltransférase. Le gène de porc codant l'α-1,3 galactosyltransférase est également décrit, ainsi que des substances et des procédés permettant d'inactiver (d'éliminer) le gène α-1,3 galactosyltransférase dans des cellules et des embryons de mammifères. Sont également compris, des produits de recombinaison d'acide nucléique aptes à inactiver le gène α-1,3 galactosyltransférase dans une cellule cible, ainsi qu'un nouveau facteur d'inhibition de leucémie (T-LIF) permettant de maintenir en culture les cellules souches embryonnaires et les cellules germinales primordiales.
PCT/IB1995/000088 1994-01-27 1995-01-27 Procedes et substances destines a la prise en charge du rejet hyperaigu suite a une heterogreffe chez l'homme WO1995020661A1 (fr)

Priority Applications (8)

Application Number Priority Date Filing Date Title
MX9603037A MX9603037A (es) 1995-01-26 1995-01-27 Materiales y metodos para manejar rechazo hiperagudo en xenotrasplante humano.
AU15445/95A AU695373B2 (en) 1994-01-27 1995-01-27 Materials and methods for management of hyperacute rejection in human xenotransplantation
EP95907116A EP0755451B1 (fr) 1994-01-27 1995-01-27 Procedes et substances destines a la prise en charge du rejet hyperaigu suite a une heterogreffe chez l'homme
JP7519965A JPH09508277A (ja) 1994-01-27 1995-01-27 ヒト異種移植における超急性拒絶の管理のための物質及び方法
BR9506652A BR9506652A (pt) 1994-01-27 1995-01-27 Materiais e métodos para gerenciamento de rejeição hiperaguda em xenotransplante em ser humano
AT95907116T ATE296349T1 (de) 1994-01-27 1995-01-27 Stoffe und verfahren zur beherrschung der hyperakuten abstossung von menschlichen transplantaten
DE69534227T DE69534227T2 (de) 1994-01-27 1995-01-27 Stoffe und verfahren zur beherrschung der hyperakuten abstossung von menschlichen transplantaten
CA2181433A CA2181433C (fr) 1994-01-27 1995-01-27 Procedes et substances destines a la prise en charge du rejet hyperaigu suite a une heterogreffe chez l'homme

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US18860794A 1994-01-27 1994-01-27
US08/188,607 1994-01-27
US08/378,617 1995-01-26

Publications (1)

Publication Number Publication Date
WO1995020661A1 true WO1995020661A1 (fr) 1995-08-03

Family

ID=22693845

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB1995/000088 WO1995020661A1 (fr) 1994-01-27 1995-01-27 Procedes et substances destines a la prise en charge du rejet hyperaigu suite a une heterogreffe chez l'homme

Country Status (2)

Country Link
JP (1) JPH09508277A (fr)
WO (1) WO1995020661A1 (fr)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0689597A1 (fr) * 1993-03-16 1996-01-03 Austin Research Institute UTILISATION DE GAL$g(a) (1,3) GALACTOSYL-TRANSFERASE PORCINE DANS LE TRAITEMENT DE XENOGREFFES
US5560911A (en) * 1993-10-12 1996-10-01 Oklahoma Medical Research Foundation Method of inhibiting acute complement mediated cytotoxicity with anti-idiotypic antibodies
WO1996036341A1 (fr) * 1995-05-18 1996-11-21 Pierre Fabre Medicament Utilisation d'un compose comportant une structure glycanique pour le blocage d'anticorps et procede d'obtention d'un tel produit
EP0773993A1 (fr) * 1994-08-19 1997-05-21 The General Hospital Corporation Cellules porcines traitees par genie genetique
FR2751346A1 (fr) * 1996-07-19 1998-01-23 Inst Nat Sante Rech Med Procede de preparation d'organes de mammiferes non humains transgeniques en vue de leur transplantation chez l'homme, et sequences nucleotidiques pour la mise en oeuvre de ce procede
WO1998033528A2 (fr) * 1997-02-05 1998-08-06 Biotransplant, Inc. Induction d'une tolerance aux cellules b
WO2001088096A2 (fr) * 2000-05-15 2001-11-22 Geron Corporation Tissu animal pour xenotransplantation
US6399578B1 (en) 1998-12-09 2002-06-04 La Jolla Pharmaceutical Company Conjugates comprising galactose α1,3 galactosyl epitopes and methods of using same
WO2003066855A1 (fr) * 2002-02-04 2003-08-14 National Institute Of Agrobiological Sciences Gene rag-1 de porc et utilisation de celui-ci
US6894153B1 (en) * 1999-05-31 2005-05-17 National Institute Of Agrobiological Sciences Gene Any-RF; dormancy regulatory substance, process for producing the same and cell regulator for vital cells
EP1534066A2 (fr) * 2002-08-14 2005-06-01 Immerge Biotherapeutics, Inc. Cellules depourvues d'alpha(1,3)-galactosyltransferase, procedes de selection et porc depourvu d'alpha(1,3)-galactosyltransferase ainsi obtenu
EP1534819A2 (fr) * 2002-08-21 2005-06-01 Revivicor, Inc. Porcins ne presentant aucune expression de l'alpha 1,3-galactosyltransferase fonctionnelle
US7504096B1 (en) 1998-07-06 2009-03-17 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods for in vitro fertilization
US7560538B2 (en) 2003-11-05 2009-07-14 University Of Pittsburgh Porcine isogloboside 3 synthase protein, cDNA, genomic organization, and regulatory region
US8034330B2 (en) 2001-04-30 2011-10-11 Rbc Biotechnology, Inc. Modified organs and cells for xenotransplantation
US8106251B2 (en) 2002-08-21 2012-01-31 Revivicor, Inc. Tissue products derived from porcine animals lacking any expression of functional alpha 1,3 galactosyltransferase
WO2012112586A1 (fr) 2011-02-14 2012-08-23 Revivicor, Inc. Cochons génétiquement modifiés destinés à la xénotransplantation de xénogreffes vascularisées et de dérivés de celles-ci
US8324449B2 (en) 2003-07-21 2012-12-04 Lifecell Corporation Acellular tissue matrices made from alpha-1,3-galactose-deficient tissue
US9339519B2 (en) 2009-08-14 2016-05-17 Revivicor, Inc. Multi-transgenic pigs for diabetes treatment
US9883939B2 (en) 2012-05-08 2018-02-06 The General Hospital Corporation Reducing immunogenicity of xenogeneic transplant tissues
US10307510B2 (en) 2013-11-04 2019-06-04 Lifecell Corporation Methods of removing alpha-galactose
WO2022109316A1 (fr) 2020-11-20 2022-05-27 Revivicor, Inc. Porcs multitransgéniques présentant une inactivation du récepteur de l'hormone de croissance pour une xénogreffe

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0235805A2 (fr) * 1986-03-04 1987-09-09 The Royal Free Hospital School Of Medicine Immunosuppression
WO1988007548A1 (fr) * 1987-04-02 1988-10-06 Amrad Corporation Limited Facteur inhibiteur de la leucemie
WO1990008188A1 (fr) * 1989-01-10 1990-07-26 Amrad Corporation Limited Facteur inhibiteur de la leucemie provenant d'especes de betail et son emploi pour augmenter l'implantation et le developpement de cellules embryonnaires
WO1991013985A1 (fr) * 1990-03-05 1991-09-19 John Kaye Heath Facteur inhibiteur de la leucemie
WO1992007581A1 (fr) * 1990-10-31 1992-05-14 Autoimmune, Inc. Procede et compositions servant a supprimer le rejet d'une allogreffe chez les mammiferes
WO1993016729A1 (fr) * 1992-02-28 1993-09-02 Biotransplant, Inc. Anticorps pour la prevention ou l'attenulation de la gravite du rejet d'une xenogreffe
WO1994002616A1 (fr) * 1992-07-20 1994-02-03 The Regents Of The University Of Michigan CLONAGE ET EXPRESSION D'UNE α(1,3)FUCOSYLTRANSFERASE (FucT-VI) HUMAINE
WO1994021799A1 (fr) * 1993-03-16 1994-09-29 Austin Research Institute UTILISATION DE GALα (1,3) GALACTOSYL-TRANSFERASE PORCINE DANS LE TRAITEMENT DE XENOGREFFES

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0235805A2 (fr) * 1986-03-04 1987-09-09 The Royal Free Hospital School Of Medicine Immunosuppression
WO1988007548A1 (fr) * 1987-04-02 1988-10-06 Amrad Corporation Limited Facteur inhibiteur de la leucemie
WO1990008188A1 (fr) * 1989-01-10 1990-07-26 Amrad Corporation Limited Facteur inhibiteur de la leucemie provenant d'especes de betail et son emploi pour augmenter l'implantation et le developpement de cellules embryonnaires
WO1991013985A1 (fr) * 1990-03-05 1991-09-19 John Kaye Heath Facteur inhibiteur de la leucemie
WO1992007581A1 (fr) * 1990-10-31 1992-05-14 Autoimmune, Inc. Procede et compositions servant a supprimer le rejet d'une allogreffe chez les mammiferes
WO1993016729A1 (fr) * 1992-02-28 1993-09-02 Biotransplant, Inc. Anticorps pour la prevention ou l'attenulation de la gravite du rejet d'une xenogreffe
WO1994002616A1 (fr) * 1992-07-20 1994-02-03 The Regents Of The University Of Michigan CLONAGE ET EXPRESSION D'UNE α(1,3)FUCOSYLTRANSFERASE (FucT-VI) HUMAINE
WO1994021799A1 (fr) * 1993-03-16 1994-09-29 Austin Research Institute UTILISATION DE GALα (1,3) GALACTOSYL-TRANSFERASE PORCINE DANS LE TRAITEMENT DE XENOGREFFES

Non-Patent Citations (23)

* Cited by examiner, † Cited by third party
Title
BIO/TECHNOLOGY, 7, November 1989, D.P. GEARING et al., "Production of Leukemia Inhibitory Factor in Escherichia Coli by a Novel Procedure and Its Use in Maintaining Embryonic Stem Cells in Culture", pp 1157-1161. *
BIOCHIMICA ET BIOPHYSICA ACTA, 1260, 1995, B.B. SAMAL et al., "High Level Expression of Human Leukemia Inhibitory Factor (LIF) from a Synthetic Gene in Escherichia Coli and the Physical and Biological Characterization of the Protein", pp 27-34. *
BLOOD, 62, 4, 1983, G. HALE et al., "Removal of T Cells from Bone Marrow for Transplantation: A Monoclonal Antilymphocyte Antibody that Fixes Human Complement", pp 873-882. *
DNA, 8, 5, 1989, D.G. LOWE et al., "Genomic Cloning and Heterologous Expression of Human Differentation-Stimulating Factor", pp 351-359. *
EUROPEAN JOURNAL OF BIOCHEMISTRY, 204, 1, 1992, T.A. WILLSON et al., "Cross-species Comparison of the Sequence of the Leukaemia Inhibitory Factor Gene and its Protein", pp 21-30. *
IMMUNOLOGICAL REVIEWS, 141, 1, 1994, D. LATINNE et al., "Depletion of IgM Xenoreactive Natural Antibodies by Injection of Anti-mu Monoclonal Antibodies", pp 94-125. *
IMMUNOLOGICAL REVIEWS, 141, 1, 1994, K. GUSTAFSSON et al., "Alpha1,3Galactosyltransferase: A Target for In Vivo Genetic Manipulation in Xenotransplantation", pp 59-70. *
IMMUNOLOGICAL REVIEWS, 141, 1, 1994, M.S. SANDRIN & I.F.C. McKENZIE, "Galalpha(1,3)Gal, the Major Xenoantigen(s) Recognised in Pigs by Human Natural Antibodies", pp 169-190. *
IMMUNOLOGY TODAY, 14, 10, 1993, U. GALILI, "Interaction of the Natural Anti-Gal Antibody with alpha-Galactosyl Epitopes: a Major Obstacle for Xenotransplantation in Humans", pp 480-482. *
JOURNAL BIOL. CHEM., 265, 15, 1990, J. STAHL et al., "Structural Organization of the Genes for Murine and Human Leukemia Inhibitory Factor", pp 8833-41. *
NATURE, 336, 15 December 1988, J.F. MOREAU et al., "Leukaemia Inhibitory Factor is Identical to the Myeloid Growth Factor Human Interleukin for DA Cells", pp 690-692. *
NUCLEIC ACIDS RESEARCH, 16, 20, 1988, D.P. GEARING et al., "Complete Sequence of Murine Myeloid Leukaemia Inhibitory Factor (LIF)", p 9857. *
PROC. NATL. ACAD. SCI. U.S.A., 85, April 1988, N.M. GOUGH et al., "Molecular Cloning and Expression of the Human Homologue of the Murine Gene Encoding Myeloid Leukemia-Inhibitory Factor", pp 2623-2627. *
PROC. NATL. ACAD. SCI. U.S.A., 86, November 1989, R.D. LARSEN et al., "Isolation of a cDNA Encoding a Murine UDPgalactose: beta-D-Galactosyl-1,4-N-Acetyl-D-Glucosamin ide alpha-1,3-Galactosyltransferase: Expressin Cloning by Gene Transfer", pp 8227-8231. *
PROC. NATL. ACAD. SCI. U.S.A., Vol. 90, December 1993, M.S. SANDRIN et al., "Anti-pig IgM Antibodies in Human Serum React Predominantly with Gal (alpha1-3) Gal Epitopes", pp 11391-11395. *
SCIENCE, 246, 15 December 1989, T. YAMAMORI et al., "The Cholinergic Neuronal Differentiation Factor from Heart Cells is Identical to Leukemia Inhibitory Factor", pp 1412-1416. *
See also references of EP0755451A4 *
THE JOURNAL OF EXPERIMENTAL MEDICINE, 174, 4, 1991, F.A. FLETCHER et al., "Leukemia Inhibitory Factory Improves Survival of Retroviral Vector-infected Hematopoietic Stem Cells In Vitro, Allowing Efficient Long-term Expression of Vector-encoded Human Adenosine Deaminase In Vivo", pp 837-45. *
TRANSPLANT INTERNATIONAL, 7, 6, 1994, R. ORIOL et al., "Monomorphic and Polymorphic Carbohydrate Antigens on Pig Tissues: Implications for Organ Xenotransplantation in the Pig-to-Human Model", pp 405-413. *
TRANSPLANTATION, 54, 4, 1992, L. GAMBIEZ et al., "The Role of Natural IgM in the Hyperacute Rejection of Discordant Heart Xenografts", pp 577-583. *
TRANSPLANTATION, 56, 6, 1993, M. SOARES et al., "In Vivo Depletion of Xenoreactive Antibodies with an Anti-mu Monoclonal Antibody", pp 1427-1433. *
TRANSPLANTATION, 57, 7, 1994, M. SOARES et al., "In Vivo IgM Depletion by Anti-mu Monoclonal Antibody Therapy", pp 1003-1009. *
TRANSPLANTATION, 58, 8, 1994, H.A. VAUGHAN et al., "Galalpha(1,3)Gal is the Major Xenoepitope Expressed on Pig Endothelial Cells Recognized by Naturally Occurring Cytoxic Human Antibodies", pp 879-882. *

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0689597A4 (fr) * 1993-03-16 1998-10-21 Austin Research Inst UTILISATION DE GAL-g(a) (1,3) GALACTOSYL-TRANSFERASE PORCINE DANS LE TRAITEMENT DE XENOGREFFES
EP0689597A1 (fr) * 1993-03-16 1996-01-03 Austin Research Institute UTILISATION DE GAL$g(a) (1,3) GALACTOSYL-TRANSFERASE PORCINE DANS LE TRAITEMENT DE XENOGREFFES
EP1621627A3 (fr) * 1993-03-16 2006-06-07 The Austin Research Institute Utilisation de gal$g(a) (1,3) galactosyl-transferase porcine dans le traitement de xenogreffes
US5560911A (en) * 1993-10-12 1996-10-01 Oklahoma Medical Research Foundation Method of inhibiting acute complement mediated cytotoxicity with anti-idiotypic antibodies
EP0773993A1 (fr) * 1994-08-19 1997-05-21 The General Hospital Corporation Cellules porcines traitees par genie genetique
EP0773993A4 (fr) * 1994-08-19 2000-07-05 Gen Hospital Corp Cellules porcines traitees par genie genetique
FR2734160A1 (fr) * 1995-05-18 1996-11-22 Pf Medicament Utilisation d'un compose comportant une structure glycanique pour le blocage d'anticorps et procede d'obtention d'un tel produit
WO1996036341A1 (fr) * 1995-05-18 1996-11-21 Pierre Fabre Medicament Utilisation d'un compose comportant une structure glycanique pour le blocage d'anticorps et procede d'obtention d'un tel produit
WO1998003653A3 (fr) * 1996-07-19 1998-03-26 Inst Nat Sante Rech Med Procede de preparation d'organes de mammiferes non humains transgeniques en vue de leur transplantation chez l'homme, et sequences nucleotidiques pour la mise en oeuvre de ce procede
WO1998003653A2 (fr) * 1996-07-19 1998-01-29 Inserm (Institut National De La Sante Et De La Recherche Medicale) Procede de preparation d'organes de mammiferes non humains transgeniques en vue de leur transplantation chez l'homme, et sequences nucleotidiques pour la mise en oeuvre de ce procede
FR2751346A1 (fr) * 1996-07-19 1998-01-23 Inst Nat Sante Rech Med Procede de preparation d'organes de mammiferes non humains transgeniques en vue de leur transplantation chez l'homme, et sequences nucleotidiques pour la mise en oeuvre de ce procede
WO1998033528A2 (fr) * 1997-02-05 1998-08-06 Biotransplant, Inc. Induction d'une tolerance aux cellules b
WO1998033528A3 (fr) * 1997-02-05 1999-02-11 Biotransplant Inc Induction d'une tolerance aux cellules b
US7504096B1 (en) 1998-07-06 2009-03-17 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods for in vitro fertilization
US6399578B1 (en) 1998-12-09 2002-06-04 La Jolla Pharmaceutical Company Conjugates comprising galactose α1,3 galactosyl epitopes and methods of using same
US6894153B1 (en) * 1999-05-31 2005-05-17 National Institute Of Agrobiological Sciences Gene Any-RF; dormancy regulatory substance, process for producing the same and cell regulator for vital cells
WO2001088096A3 (fr) * 2000-05-15 2003-07-10 Geron Corp Tissu animal pour xenotransplantation
WO2001088096A2 (fr) * 2000-05-15 2001-11-22 Geron Corporation Tissu animal pour xenotransplantation
US8034330B2 (en) 2001-04-30 2011-10-11 Rbc Biotechnology, Inc. Modified organs and cells for xenotransplantation
WO2003066855A1 (fr) * 2002-02-04 2003-08-14 National Institute Of Agrobiological Sciences Gene rag-1 de porc et utilisation de celui-ci
US7547522B2 (en) 2002-08-14 2009-06-16 Immerge Biotherapeutics, Inc. Method to enrich for α(1,3)-galactosyltransferase null pig cells
EP1534066A2 (fr) * 2002-08-14 2005-06-01 Immerge Biotherapeutics, Inc. Cellules depourvues d'alpha(1,3)-galactosyltransferase, procedes de selection et porc depourvu d'alpha(1,3)-galactosyltransferase ainsi obtenu
EP1534066A4 (fr) * 2002-08-14 2008-01-02 Immerge Biotherapeutics Inc Cellules depourvues d'alpha(1,3)-galactosyltransferase, procedes de selection et porc depourvu d'alpha(1,3)-galactosyltransferase ainsi obtenu
AU2009202105B2 (en) * 2002-08-21 2011-07-14 Revivicor Inc Porcine animals lacking any expression of functional alpha 1,3 galactosyltransferase
AU2003295322B2 (en) * 2002-08-21 2009-06-18 Revivicor, Inc. Porcine animals lacking any expression of functional alpha 1,3 galactosyltransferase
US11172658B2 (en) 2002-08-21 2021-11-16 Revivicor, Inc. Porcine animals lacking expression of functional alpha 1, 3 galactosyltransferase
EP2163614A1 (fr) 2002-08-21 2010-03-17 Revivicor, Inc. Porcs déficient pour l'expression de l'alpha 1,3 galactosyl transférase
US7795493B2 (en) 2002-08-21 2010-09-14 Revivicor, Inc. Porcine animals lacking any expression of functional alpha 1, 3 galactosyltransferase
EP1534819A4 (fr) * 2002-08-21 2005-09-21 Revivicor Inc Porcins ne presentant aucune expression de l'alpha 1,3-galactosyltransferase fonctionnelle
EP1534819A2 (fr) * 2002-08-21 2005-06-01 Revivicor, Inc. Porcins ne presentant aucune expression de l'alpha 1,3-galactosyltransferase fonctionnelle
US8106251B2 (en) 2002-08-21 2012-01-31 Revivicor, Inc. Tissue products derived from porcine animals lacking any expression of functional alpha 1,3 galactosyltransferase
US10912863B2 (en) 2002-08-21 2021-02-09 Revivicor, Inc. Tissue products derived from animals lacking any expression of functional alpha 1, 3 galactosyltransferase
US10130737B2 (en) 2002-08-21 2018-11-20 Revivicor, Inc. Tissue products derived from animals lacking any expression of functional alpha 1, 3 galactosyltransferase
EP3170890A1 (fr) 2002-08-21 2017-05-24 Revivicor, Inc. Animaux porcins manquant d'expression d'alpha 1,3, galactosyltransferase fonctionnel
US8802920B2 (en) 2003-07-21 2014-08-12 Lifecell Corporation Acellular tissue matrices made from α-1,3-galactose-deficient tissue
US8324449B2 (en) 2003-07-21 2012-12-04 Lifecell Corporation Acellular tissue matrices made from alpha-1,3-galactose-deficient tissue
US7560538B2 (en) 2003-11-05 2009-07-14 University Of Pittsburgh Porcine isogloboside 3 synthase protein, cDNA, genomic organization, and regulatory region
EP2433492A1 (fr) 2004-03-17 2012-03-28 Revivicor Inc. Produits tissulaires dérivés d'animaux dépourvus d'une expression quelconque de l'alpha 1,3 galactosyltransférase fonctionnelle
US9339519B2 (en) 2009-08-14 2016-05-17 Revivicor, Inc. Multi-transgenic pigs for diabetes treatment
US10383317B2 (en) 2009-08-14 2019-08-20 Revivicor, Inc. Multi-transgenic pigs for diabetes treatment
WO2012112586A1 (fr) 2011-02-14 2012-08-23 Revivicor, Inc. Cochons génétiquement modifiés destinés à la xénotransplantation de xénogreffes vascularisées et de dérivés de celles-ci
US11179496B2 (en) 2011-02-14 2021-11-23 Revivicor, Inc. Genetically modified pigs for xenotransplantation of vascularized xenografts and derivatives thereof
US9883939B2 (en) 2012-05-08 2018-02-06 The General Hospital Corporation Reducing immunogenicity of xenogeneic transplant tissues
US10307510B2 (en) 2013-11-04 2019-06-04 Lifecell Corporation Methods of removing alpha-galactose
WO2022109316A1 (fr) 2020-11-20 2022-05-27 Revivicor, Inc. Porcs multitransgéniques présentant une inactivation du récepteur de l'hormone de croissance pour une xénogreffe

Also Published As

Publication number Publication date
JPH09508277A (ja) 1997-08-26

Similar Documents

Publication Publication Date Title
EP0755451B1 (fr) Procedes et substances destines a la prise en charge du rejet hyperaigu suite a une heterogreffe chez l'homme
WO1995020661A1 (fr) Procedes et substances destines a la prise en charge du rejet hyperaigu suite a une heterogreffe chez l'homme
AU727546B2 (en) Transgenic animals for xenotransplantation with reduced antibody-mediated rejection
US6413769B1 (en) α(1,3) galactosyltransferase negative porcine cells
US11160260B2 (en) Methods for protecting porcine fetuses from infection with porcine reproductive and respiratory syndrome virus (PRRSV)
US6528699B1 (en) Transgenically produced non-secreted proteins
US20050287581A1 (en) Gene sequence of alpha(1,3)galactosyltransferase
JP2005525817A (ja) ヒト抗体産生が可能なトランスジェニック有蹄動物
WO2000039294A1 (fr) Cellules porcines incapables d'exprimer l'antigene cd40, et destinees a des xenogreffes
AU711144B2 (en) Materials and methods for management of hyperacute rejection in human xenotransplantation
KR102680060B1 (ko) 바이러스에 의한 감염으로부터 돼지 태아를 보호하는 방법
JP2002512021A (ja) トランスジェニックヒツジから得られるヒト胆汁酸塩−刺激リパーゼ（ｂｓｓｌ）
US10717991B2 (en) Transgenic pig which simultaneously expresses HO-1 gene and TNFR1-Fc gene, and comprises knocked-out GGTA1 gene, and use thereof
KR101588474B1 (ko) 영장류 동물의 초기 배아에의 외래 유전자 도입법 및 상기 도입법을 포함하는 트랜스제닉 영장류 동물을 작출하는 방법
Sandrin et al. Overcoming the anti-galα (1–3) gal reaction to avoid hyperacute rejection: Molecular genetic approaches
AU766519B2 (en) alpha(1,3)-galactosyltransferase negative swine
EP1793000A1 (fr) Protéines non sécrétées produites de manière transgénique

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AM AT AU BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU JP KE KG KP KR KZ LK LR LT LU LV MD MG MN MW MX NL NO NZ PL PT RO RU SD SE SI SK TJ TT UA UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2181433

Country of ref document: CA

WWE Wipo information: entry into national phase

Country of ref document: MX

Ref document number: PA/a/1996/003037

WWE Wipo information: entry into national phase

Ref document number: 1995907116

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1995907116

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1995907116

Country of ref document: EP