WO1994026925A2 - Processes for producing an enzyme - Google Patents
Processes for producing an enzyme Download PDFInfo
- Publication number
- WO1994026925A2 WO1994026925A2 PCT/US1994/004932 US9404932W WO9426925A2 WO 1994026925 A2 WO1994026925 A2 WO 1994026925A2 US 9404932 W US9404932 W US 9404932W WO 9426925 A2 WO9426925 A2 WO 9426925A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- enzyme
- proenzyme
- protease
- proteolytic enzyme
- process according
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/58—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
- C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/06—Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
- C12N2710/24141—Use of virus, viral particle or viral elements as a vector
- C12N2710/24143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- the present invention relates to processes for producing an enzyme, as well as to a cell and a DNA construct suitable for use in the processes. By use of the processes of the invention, it is possible to obtain substantially increased enzyme yields.
- Enzymes which are protein molecules capable of catalyzing specific reactions, have been found useful for a number of applications within a wide range of industries and technical fields, including the detergent industry, the food and feed industry, the paper and pulp industry as well as the textile industry. Enzymes have a number of important advantages over chemical agents which conventionally have been used for same or similar purposes, one advantage being that they are readily degraded and thus, in general, less harmful to the environment than chemical agents. Accordingly, for a number of purposes enzymes are considered to be attractive substituents for chemical agents conventionally used.
- Enzymes are normally produced by fermentation of microbial cells or cells of other organisms, which either inherently or as a consequence of being transformed with a nucleic acid sequence encoding the enzyme in question, are capable of producing the enzyme.
- a number of enzymes are expressed from the producer cell in the form of an inactive proenzyme, which upon expression is converted to an active enzyme, typi- cally by being processed by the action of one or more proteolytic enzymes expressed by the producer cell. Processing by externally supplied activators has also been reported, e.g. the activation of bovine prochymosin by a fungal metalloprotease (Stepanov et al, 1990).
- the present invention relates to a process for producing an active enzyme by fermentation of a cell expressing the enzyme in the form of a proenzyme, which process comprises performing the fermentation in the presence of a proteolytic enzyme capable of converting the proenzyme into an active enzyme, and recovering the active enzyme from the fermentation broth, the proteolytic enzyme being added to the fermentation broth prior to and/or during the fermentation.
- a proteolytic enzyme In contrast to what would be expected from producing a protein in the presence of a proteolytic, i.e. protein-degrading, enzyme, the presence of a proteolytic enzyme has been found to result in a substantial increased enzyme yield, more specifically in an increase of more than 2 times, such as more than 4, and even more than 6 or 8 times of the amount of active enzyme produced by a given fermentation as compared to a process in which no proteolytic enzyme is added and in which the activation of the proenzyme thus typically is performed by a proteolytic enzyme expressed by the host cell in question.
- active enzyme is intended to indicate a form of the enzyme exhibiting enzymatic activity, e.g. a mature enzyme.
- the enzymatic activity may be determined by assays known in the art for the enzyme in question.
- proenzyme is intended to indicate a precursor or proform of the enzyme.
- the proenzyme is constituted by a propeptide part and a polypeptide part comprising the amino acid sequence of the active enzyme.
- the proenzyme may also be termed a zymogen or a precursor.
- the proenzyme may be stable in the fermentation broth or may be less stable than the active enzyme in the fermentation broth, in which it is produced, e.g. by being degraded more rapidly in the fermenta ⁇ tion broth than the active enzyme.
- proteolytic enzyme or “maturase” is used interchangeably in the instant application and is intended to indicate an enzyme capable of cleaving off the prope- ptide from the proenzyme expressed from the cell, whereby the “conversion" of the proenzyme into an active or mature enzyme is accomplished.
- the proteolytic enzyme does not or only to a limited extent cleave peptide sequences of the active enzyme required for enzymatic activity.
- the proteolytic enzyme may be one which in nature cleaves the pro sequence from the proenzyme in question to produce the active enzyme, in which case a further amount is added in accordance with the invention, or may be different from the natural enzyme.
- fermentation is intended to indicate any method of cultivation of the cell resulting in the expression of the enzyme in the form of a proenzyme.
- the fermentation may be understood as comprising shake flask cultivation, small or large scale fermentation (including continuous, batch and fed-batch fermentations) in laboratory or industrial fermenters etc. performed in suitable fermentation media and under conditions allowing the proenzyme to be expressed.
- the present invention relates to a process for producing an active enzyme by fermentation of a cell expressing the enzyme in the form of a proenzyme, which process comprises performing the fermentation in the presence of a proteolytic enzyme capable of converting the proenzyme into an active enzyme, and recovering the active enzyme from the fermentation broth, the proteolytic enzyme being encoded by and expressed from a recombinant DNA sequence present in the cell from which the proenzyme is expressed. It is contemplated that increases in the yield of an active enzyme similar to those obtained by the process explained above, may be obtained in accordance with this aspect of the invention.
- the process according to this second aspect has the important advantage that no proteolytic enzyme need to be added during the process, although it can be as it is further described below.
- the term "recombinant DNA sequence” is intended to indicate a foreign DNA sequence with which the cell expressing the proenzyme has been transformed.
- the term “foreign” is intended to indicate that the cell expressing the proenzyme does not, in nature, comprise said DNA sequence encoding the proteolytic enzyme.
- the term “recombinant DNA sequence” is intended to indicate a DNA sequence which is normally found in the cell expressing the proenzyme, but which has been placed under the control of one or more regulatory elements, e.g. a promoter, different from the one(s) associated with the naturally-occurring DNA sequence and capable of increasing the amount of active proteolytic enzyme expressed from the DNA_sequence.
- the term is intended to indicate a DNA construct in which the copy number of the DNA sequence encoding the proteolytic enzyme has been increased.
- the present invention relates to a recombinant host cell harbouring a nucleic acid sequence encoding a proenzyme and a nucleic acid sequence encoding a proteolytic enzyme capable of converting the proenzyme into an active enzyme, in which recombinant host cell at least one of the nucleic acid sequences is a recombinant nucleic acid sequence.
- recombinant is intended to be understood in the above defined manner.
- the present invention relates to a DNA construct harbouring a nucleic acid sequence encoding a proenzyme and a DNA sequence encoding a proteolytic enzyme capable of converting the proenzyme into an active enzyme, and to an expression vector carrying such DNA construct.
- the recombinant host cell, DNA construct and expression vector are advantageously used in a process of the invention and may be produced in accordance with conventional recombinant DNA techniques.
- the present invention relates to an active enzyme produced by a process of the invention.
- the proenzyme produced during the processes of the invention may be stable in the fermentation broth, i.e. not subjected to any substantial degradation, and thus be capable of being converted into an active enzyme over a considerable period of time while being present in or recovered from the fermentation broth.
- the proenzyme may be unstable and quickly degraded in the fermentation broth, in worst case before having been recovered or converted to an active enzyme.
- the processes of the invention are contemplated to be particularly important in the production of enzymes, in which the proenzyme form of which, in the fermentation broth, is less stable than the active enzyme. In such cases, it is believed that the proteolytic enzyme is capable of converting the unstable proenzyme into an active enzyme prior to the degradation thereof.
- the processes of the invention may be advantageous for the production of active enzymes by fermentation of naturally-occurring cells expressing the corresponding proenzyme, they are envisaged to be of particular importance in the pro ⁇ duction of active recombinant enzymes, i.e. enzymes encoded by nucleic acid sequences which have been transformed into the cell subjected to fermentation.
- the cell expressing the proenzyme has been transformed with a nucleic acid, e.g. DNA or RNA sequence, encoding the proenzyme.
- a nucleic acid e.g. DNA or RNA sequence
- the transformation may be accomplished by conventional methods known in the art chosen so as to comply with the nature of the host cell of choice as well as of the nature of the nucleic acid sequence.
- the nucleic acid sequence may be inserted into the genome of the host cell, e.g. by homologous or heterologous recombination.
- the nucleic acid sequence may be inserted into a recombinant expression vector capable of autonomous replication in the host cell.
- the nucleic acid fragment is operably linked to transcription and translation signals capable of directing expression of the proenzyme.
- the processes of the invention may be generally applicable for the production of any active enzyme which in the cell is expressed as a proenzyme, and in particular an enzyme, the corresponding proenzyme of which, in the fermentation broth, is less stable than the active enzyme.
- the enzyme to be produced by a process of the invention may be a hydrolase, an oxidoreductase, an isomerase, an oxidase or a transferase.
- the enzyme to be produced may be a protease, a lipase, an amylase, a cellulase, a xylanase, a pectinase, a peroxidase, a laccase or a transglutaminase.
- the enzyme to be produced may be a naturally occurring enzyme or a genetically engineered variant thereof, in which one or more amino acid residues has been changed e.g. by conventional or site-directed mutagenesis.
- trypsin-like protease is intended to indicate trypsin or an enzyme having a structure or an activity similar to that of trypsin, e.g. an enzyme capable of cleaving peptide bonds at the C-terminal side of lysine or arginine.
- the trypsin-like protease activity may be determined in an assay based on cleavage of a trypsin substrate such as N-Benzoyl-L-arginine-p-nitroanilide (L-BAPA or L-BAP- NA), e.g. as described in the Materials and Methods section below.
- Trypsin-like proteases have been found to be produced by a number of difference organisms including mammals, insects and microorganisms.
- An example of a microorganism producing a trypsin-like protease is one of the fungal genus Fusarium, cf. U.S. Patent No. 5,288,627, incorporated herein by reference and accordingly, the enzyme to be produced may be obtainable from a strain of the genus Fusarium, such as from a strain of F. oxysporum, F. merismoides, F. redolens, F. sambucinum, F. solani or F. verticilloides.
- the enzyme is one obtainable from a strain of F. oxysporum, e.g. a strain deposited in the Deutsche Sammlung von Mikroorganismen in connection with the invention disclosed in U.S. Patent No. 5,288,627 with the deposit number DSM 2672, or from a derivative or mutant thereof having retained the capability of producing an enzyme having an activity similar to that of trypsin as defined above.
- the nucleic acid sequence coding for and the amino acid sequence of the trypsin-like F. oxysporum protease isolated from this strain is illustrated in the appended SEQ ID Nos. 1 and 2, respectively.
- the proenzyme produced by a process of the invention may be a preproenzyme, and thus carry a signal peptide involved in the transportation of the proenzyme out of the cell in which it is produced.
- the signal peptide may be one normally associated with the proenzyme in question or one, which has been fused to the proenzyme, e.g. in order to suit the excretion procedures of the host cell of choice for the expression of the proenzyme.
- the activation of the proenzyme is normally accomplished by one proteolytic enzyme although, for some purposes, it may be found advantageous to use a combination of two or more proteolytic enzymes having similar or different enzymatic activities.
- the nature of the proteolytic enzyme(s) capable of converting the proenzyme into an active enzyme depends strongly on the nature of the proenzyme to be converted.
- the proteolytic enzyme(s) to be used for the activation of a specific enzyme may be chosen on the basis of an analysis of the peptide sequence to be cleaved.
- the amino acid sequence of the proenzyme or of the active enzyme is known or is deducible from a nucleic acid sequence known or contemplated to encode the enzyme
- one or more proteolytic enzymes known to or contemplated to be capable of cleaving the particular peptide sequence(s) may then be identified, and the use thereof be verified experimentally.
- proteolytic enzyme(s) of choice should not, or only to a limited extend, cleave peptide bonds present in the active enzyme thereby hindering a destruction or substantial re- duction of the activity of the active enzyme produced by the process.
- a proteolytic enzyme to be used in a process of the invention may be any enzyme having a suitable proteolytic activity.
- the proteolytic enzyme may be a metalloprotease, a serine protease, an aspartic protease, a cysteine protease, whether of neutral, alkaline or acidic nature.
- the enzyme may be specific or unspecific. Examples of such proteolytic enzyme may be found among the proteinases belonging to the enzyme nomenclature classes 3.4.21-3.4.24 according to Enzyme Nomenclature, 1984.
- a trypsin-like protease especially one produced by a Fusarium sp. such as F. oxysporum, a neutral metalloprotease, a subtilisin or an aspartic protease is expected to be of particular use.
- the trypsin-like protease is the one produced by the F. oxysporum DSM 2672
- the proteolytic enzymes thermolysin or a proteolytic enzyme from Bacillus Zamost et al., 1990, Journal of Industrial Microbiology, Vol. 5, pp. 303-312
- Bacillus metalloprotease preparation may be used.
- the proteolytic enzyme may also be a metalloprotease obtainable from Aspergillus oryzae or Fusarium oxysporum disclosed in Examples 4 and 6, infra.
- the proteolytic enzyme may be used to increase the yield of the trypsin-like F. oxysporum protease when produced by F. oxysporum.
- the proteolytic enzyme is present in an excessive amount as compared to conventional fermentation.
- the proteolytic enzyme(s) may be added as such to the fermentation broth in which the cell producing the proenzyme to be converted is cultured.
- the proteolytic enzyme may be added batchwise or continuously.
- the proteolytic enzyme(s) to be added may for instance be a commer ⁇ cially available enzyme, e.g. one of those mentioned above, or may be produced by culturing a recombinant host cell inherently carrying or being transformed with a nucleic acid sequence encoding the proteolytic enzyme under suitable conditions to produce the enzyme and recovering the enzyme from the culture.
- the presence of the proteolytic enzyme(s) in the fermentation broth may be accomplished by constructing a cell capable of expressing the proenzyme and the proteolytic enzyme(s), and cultivating the cell under conditions conducive to the pro ⁇ duction of the proenzyme and the proteolytic enzyme(s) and to the subsequent activation of the proenzyme by the proteolytic enzyme(s).
- a suitable cell may be con ⁇ structed by being transformed with nucleic acid sequences encoding the proenzyme and the proteolytic enzyme(s), optionally present on one or more expression vectors.
- the processes of the invention may be carried out by subjecting a cell expressing the proenzyme and a cell expressing a proteolytic enzyme capable of converting the proenzyme into an active form to co-expression under sui ⁇ table conditions allowing the expression of said proenzyme and said proteolytic enzyme and the conversion of the proenzyme into an active enzyme, and recovering the active enzyme in from the culture.
- a cell expressing the proenzyme and a cell expressing a proteolytic enzyme capable of converting the proenzyme into an active form to co-expression under sui ⁇ table conditions allowing the expression of said proenzyme and said proteolytic enzyme and the conversion of the proenzyme into an active enzyme, and recovering the active enzyme in from the culture.
- at least one of said proenzyme and proteolytic enzyme is recombinant
- the proteolytic enzyme should be present in a sufficient amount for the activation of the proenzyme to take place.
- the amount of proteolytic enzyme to be present may be determined by model experiments in accordance with methods known in the art For instance, the determination of a suitable amount may be based on estimations of K ⁇ values and rate constants for respectively the enzyme reactions degrading the proenzyme and the enzyme reaction converting the proenzyme into an active enzyme.
- the amount of proteolytic enzyme necessary may be determined emperically by carrying out fermentations with dosing of proteolytic enzyme.
- the fermentation conditions e.g. pH and temperature, should be optimal for stability of the proenzyme and stability and activity of the proteolytic enzyme.
- the proteolytic enzyme is expected to be easily degraded in the fermentation broth, for instance by the active enzyme produced according to a process of the invention, it may be advantageous to supply the enzyme continuously or in several portions, e.g. by use of a fed batch feeding.
- proteolytic enzyme When the proteolytic enzyme is expressed from the same cell as the proenzyme, it may be advantageous to add a further amount (in addition to that produced from the cell) of said proteolytic enzyme to the fermentation broth during the cultivation of the cell.
- the maturation of the proenzyme may be accomplished intracellularly, provided that the thus mature or activated enzyme is not detrimental to the cell, and may be recovered from the cell in mature or active form.
- an additional positive effect on the yield of an active enzyme produced by a process of the invention may be obtained by stabilizing the proenzyme, especially when the proenzyme is unstable in the fermentation broth. For instance, such stabilization may result in a higher intracellular stability of the proenzyme and thus a higher amount of proenzyme available for the activation by the proteolytic enzyme.
- the stabilization may be performed by suitably modifying the nucleic acid sequence coding for the propeptide part of the proenzyme in accordance with well-known procedures, resulting in the addition of one or more amino acids to either or both the C- and N-terminal end of the propeptide, substitution of one or more amino acids at one or a number of different sites in the amino acid sequence of the propeptide, deletion of one or more amino acids at either or both ends of the propeptide or at one or more sites in the amino acid sequence, or insertion of one or more amino acids at one or more sites in the amino acid sequence of the propeptide, so as to obtain a higher stability of the proenzyme.
- a stabilizing effect may be obtained by constructing a fusion protein comprising the proenzyme or a part thereof capable of being converted into a active or mature protein having enzymatic activity and a stabilizing protein or part thereof.
- the nucleic acid sequences encoding the proenzyme and/or the proteolytic enzyme(s) as well as the DNA construct of the invention may be of genomic or cDNA origin, for instance obtained by preparing a genomic or cDNA library of an appropriate or ⁇ ganism, and screening for DNA sequences coding for all or part of the proenzyme or proteolytic enzyme by hybridization using synthetic oligonucleotide probes, e.g. prepared on the basis of the amino acid sequence of the proenzyme or proteolytic enzyme, in accordance with standard techniques (cf. Sambrook et al., 1989).
- DNA sequences and the DNA construct of the invention may also be prepared synthetically by established standard methods, e.g. the phosphoamidite method described by S.L. Beaucage et al. (1981), Matthes et al. (1984). According to the phosphoamidite method, oligonucleotides are synthesized, e.g. in an automatic DNA synthesizer, purified, ligated, and cloned in an appropriate vector.
- DNA sequences and the DNA construct may be of mixed synthetic and genomic, mixed synthetic and cDNA or mixed genomic and cDNA origin prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate), the fragments corresponding to various parts of the entire DNA construct, in accordance with standard techniques.
- the cell used for the expression of the proenzyme and/or the proteolytic enzyme(s) in processes of the invention is suitably a cell which, on cultivation, produces large amounts of the proenzyme and/or the proteolytic enzyme(s).
- the cell may be one which in nature produces the proenzyme or the proteolytic enzyme(s), but is preferably a cell of the invention which has been transformed with a nucleic acid sequence encoding the proenzyme and/or a nucleic acid sequence encoding the proteolytic enzyme(s).
- the cell may conveniently be one which has previously been used as a host for producing recombinant proteins, either a prokaryotic or eukaryotic cell, including but not limited to mammalian cells, insect cells, plant cells or fungal cells and is preferably a microorganism such as a bacterium or a fungus.
- fungus is intended to comprise filamentous fungi as well as yeasts.
- suitable bacteria are gram positive bacteria of the genus Bacillus such as Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Bacillus stea- rothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus megaterium, Bacillus circulans, Bacillus lautus and of the genus Streptomyces such as Streptomyces lividans.
- suitable gram-negative bacteria comprises bacteria of the genus Escherichia such as E. coli.
- the trans ⁇ formation of the bacterial host cell may for instance be effected by protoplast trans ⁇ formation or by using competent cells in a manner known per se.
- Another suitable bacterial cell is a cell of a Pseudomonas spp. such as Pseudomonas cepacia, Pseudomonas fragi, Pseudomonas gladioli, Pseudomonas fluorescens, Pseudomonas stutzeri, Pseudomonas alcaligenes, Pseudomonas pseudoalcaligenes, Pseudomonas putida, Pseudomonas glumae or Pseudomonas aeruginosa.
- Pseudomonas spp. such as Pseudomonas cepacia, Pseudomonas fragi, Pseudomonas gladioli, Ps
- the cell may be a fungus, i.e. a cell of a yeast or of a filamentous fungus.
- the yeast cell may, for instance, be a cell of the genus Saccharomyces such as S. cerevisiae.
- the filamentous fungus host organism may, for instance, be a strain of Aspergillus sp., such as A. niger, A. nidulans or A. oryzae.
- the techniques used to transform an Aspergillus host cell and obtain expression of the recombinant protein may suitably be as described in EP 238 023.
- the fungal host cell may be a strain of a Fusarium sp. such as F. oxysporum, the transformation of which, e.g., may be carried out as described by Malardier et al., 1989.
- the nucleic acid sequence encoding the proenzyme and/or the nucleic acid sequence encoding the proteolytic enzyme may be carried on an expression vector or alternatively be present in the genome of the host cell.
- the nucleic acid sequence encoding the proenzyme and/or proteolytic enzyme(s) are/is normally preceded by a promoter.
- the promoter may be any nucleic acid sequence exhibiting a strong transcriptional activity in the host cell of choice and may be derived from a gene encoding an extracellular or intracellular protein such as an amylase, a glucoamylase, a protease, a lipase, a cellulase or a glycolytic enzyme.
- suitable promoters especially when using a bacterial host, are the promoter of the lac operon of E.
- the Streptomyces coelicolor agarase gene dag A promoters the promoters of the Bacillus licheniformis ⁇ -amylase gene (amyL), the promoters of the Bacillus stearothermophilus maltogenic amylase gene (amyM), the promoters of the Bacillus Amyloliquefaciens ⁇ -amylase
- ⁇ myQ Bacillus subtilis xylA and xinB genes
- useful promoters are those derived from the gene encoding A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger neutral ⁇ -amylase, A. niger acid stable ⁇ -amylase, A. niger glucoamylase,
- Rhizomucor miehei lipase Rhizomucor miehei lipase, A. oryzae alkaline protease, A. oryzae triose phosphate isomerase or A. nidulans acetamidase.
- sequences involved in expression of the proenzyme include termination and polyadenylation sequences as well as ribosome binding sites and may suitably be derived from the same sources as the promoter.
- the vector may further comprise a nucleic acid sequence enabling the vector to replicate in the host cell in question, e.g. a suitable origin of replication, as well as a selectable marker, e.g. a gene the product of which complements a defect in the host cell, or one which confers antibiotic resistance to the host cell.
- a nucleic acid sequence enabling the vector to replicate in the host cell in question, e.g. a suitable origin of replication, as well as a selectable marker, e.g. a gene the product of which complements a defect in the host cell, or one which confers antibiotic resistance to the host cell.
- the broth or medium used in the processes of the invention for cultivation of the resulting recombinant host cell may be any conventional medium suitable for growing the cell in question.
- Suitable media e.g. minimal or complex media, are available from commercial suppliers or may be prepared according to published recipes (e.g. in catalogues of the American Type Culture Collection).
- the enzyme may be recovered from the broth by conventional procedures including separating the cells from the broth by centrifugation or filtration, if necessary after disruption of the cells, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g. ammonium sulphate, followed by purification by a variety of chromatographic procedures, e.g. ion exchange chromatography, affinity chromatography, or the like, the actual recovery method being dependant on the kind of enzyme in question.
- a salt e.g. ammonium sulphate
- FIG. 1 illustrates the construction of the expression plasmid pSX183 used for the expression of a recombinant trypsin-like F. oxysporum protease further described in the accompanying examples.
- Figure 2 shows a comparison of F. oxysporum proteolytic enzyme activity with that of Bacillus maturase used to process pro F. oxysporum protease.
- Figurea 3A, 3B, 3C, and 3D shows the genomic DNA sequence and deduced amino acid sequence of p45 as determined from the sequencing of the cDNA.
- Figure 4 shows a map of plasmid pDM120.
- Figure 5 shows a map of plasmid pSO2.
- Figure 6 shows SDS-PAGE analysis of A . oryzae transformants containing both the pro F. oxysporum trypsin-like protease and the F. oxysporum p45 proteolytic enzyme genes.
- the lanes contain supernatants from: lane 1, molecular weight markers; lane 2, control A. oryzae strain (untransformed); lane 3, A. oryzae transformed with p45 only; lane 4, A. oryzae transformed with pSX183 trypsin-like protease only; lanes 5-10, A. oryzae strains transformed with both p45 and the pro
- Figure 7 shows a comparision of the N-terminal amino acid sequence of purified npl with p45.
- Construction of a recombinant A. oryzae strain capable of expressing the trypsin-like F. oxysporum protease cDNA encoding a proenzyme form of the trypsin-like F. oxysporum protease and having the DNA sequence shown in the appended SEQ ID NO: 1 is inserted into the vector pCDVl-PL described by Noma et al. (1986), Nature 319: 640-646 resulting in the plasmid pSX180.
- the coding region of the cDNA is inserted as a Ncol-Xba ⁇ fragment into the Aspergillus expression plasmid p777 (EP 0489718) which is cut with BamUl and partially with Xba ⁇ .
- a synthetic linker DNA KFN709/710 (illustrated in Fig. 1) is added to the ligation reaction.
- the resulting plasmid pSX183 is co-transformed into A. oryzae (IFO 4177) together with plasmid ⁇ ToC90 carrying the amdS from A. nidulans (WO
- Transformants are selected for growth on acetamide.
- the Bacillus stearothermophilus (BS) protease TEM-8 described by Zamost et al. (1990) has been used.
- BS Bacillus stearothermophilus
- the specific activity of the enzyme is approx. 100 AU(H)/g.
- the trypsin-like protease is assayed using the specific substrate N-Benzoyl-L-arginine p-nitroanilide hydrochloride (L-BAPNA).
- L-BAPA is available from Sigma (B3133) or Merck (Art.10754).
- a 0.2 M stock solution in dimethyl sulfoxide is prepared (87 mg/ml) (store frozen) and diluted to 0.004 M with the buffer described above.
- the trypsin-like protease is diluted to approx. 15 ⁇ g/ml for the assay. 20 ⁇ l of the diluted trypsin-like protease are mixed with 200 ⁇ l of 0.004 M L-BAPA in a 96 well microtiter plate. A blank with 20 ⁇ l buffer and 200 ⁇ l 0.004 M L-BAPA is used for correction.
- the absorption change (delta OD/min) is monitored at 405 nm in an Elisa reader for 10 minutes with readings every 5 minutes at 25°C or room temperature. The result is calculated relative to the trypsin content of a reference Fusarium trypsin-like protease.
- the activity of the BS-protease is determined with N,N-dimethyl casein (DMC) as a substrate.
- DMC N,N-dimethyl casein
- the primary amino groups formed in this process react with trinitrobenzene sulphonic acid forming a coloured complex. The reaction takes place for 9 minutes at
- the reaction is followed in situ in order that the change in absorbance (at 420 nm) per time unit can be calculated.
- the measuring time is 3 minutes.
- the change in absorbance is a measure of the reaction rate and the enzyme activity.
- the activity is determined relatively to an enzyme standard (Alcalase®), and in the same units as for the standard.
- the unit is termed AU(H).
- the N,N-dimethyl casein solution (0.4%) is prepared by dissolving 4.0 g of N,N- dimethyl casein in approx. 200 ml of boiling demineralized water during constant agitation for 20 minutes, mixing the resulting solution with a solution prepared from 11.92 g of Hepes buffer (Sigma H-3375) and 3.69 g of NaCl further comprising 9.0 ml of 4.0 N NaOH and 1 mmole CaCl 2 and adding 1.5 ml of a Brij 35 solution (150.0 g of Brij 35 (Atlas Chemie) in 1000 ml of water).
- An enzyme sample is made by mixing 0.5-1.0 g of the enzyme to be analysed with a 2% Na 2 SO 3 solution (200 g Na 2 SO 3 , 15 ml of Brij 35 solution, and 1 mmole CaCl 2 , add up to 10 1 of demineralized water) with an amount of the Na 2 SO 3 solution resulting in a suitable enzyme concentration.
- the 2,4,6-trinitrobenzene sulphonic acid solution (0.1%) reacting with the primary amino groups formed during the reaction is prepared by dissolving 200 mg of 2,4,6- trinitro-benzene sulphonic acid in 200 ml of demineralized water.
- the BS-protease activity is determined from the reaction rates of standards and samples, which are determined as the increase in OD (slope) from 6 to 9 min. with measurements each 5 sec.
- Enzymatically active trypsin-like Fusarium protease and the proform thereof are analyzed by RIE.
- Horizontal rocket immunoelectrophoresis is carried out in 1% agarose (Litex HSA/HSB, 1:1) with 20 ⁇ l antibody/ml.
- the vessel and gel buffer con- sists of 41 mM Tris (hydroxy methyl) aminomethane and 13 mM glycine buffer, pH
- Electrophoresis is carried out for approx. 18 hours at 15°C, and 2 V/cm.
- the antibody to be used in the process is raised against purified trypsin-like Fusarium protease in rabbits by standard procedures. Rabbits are immunized with purified protease, 250 ⁇ g/dose once a week for 10 weeks. Crude serum is used in the assays.
- the active enzyme is found to migrate towards the positive pole, the proform towards the negative.
- the proform of the trypsin-like Fusarium protease (termed “Trypsin” in the table) has been estimated by RIE.
- the mature form has been estimated by RIE and the B APNA- enzyme assay.
- the increase obtained by use of a process of the invention is significantly higher in minimal medium than in complex medium. It is contemplated that the A. oryzae recombinant host cell used for the production of the Fusarium trypsin-like protease itself produced a proteolytic enzyme capable of activating said trypsin-like protease.
- the apparent lower effect obtained in complex medium is probably due to the fact that a higher level of naturally-occurring maturating protease produced by A. oryzae is synthesized in complex medium. It should be emphasized that although the A. oryzae host cell presumably inherently produces an activated trypsin-like protease a substantial additional effect of adding the BS-protease during the fermentation is seen for the yield of active trypsin-like protease obtained.
- Dilutions of trypsin-like Fusarium protease proform as well as proteolytic enzyme solutions either comprising BS-protease or the naturally occurring F. oxysporum activating protease, p45, (the isolation of which is described in Example 4 below) is prepared in the BAPA-assay buffer (pH 6.5). 20 ⁇ l of a trypsin-like proenzyme dilution containing approx. 15 mg/l are mixed with 100 ⁇ l of proteolytic enzyme solution in 96 well microtiter plates and incubated at 25°C. After 5 and 40 minutes of incubation, the amount of active or mature trypsin-like protease is assayed by using
- Fermentation supernatant from a shake flask fermentation of A. oryzae IFO 4177 transformed with the plasmid pSX183 in minimal medium without addition of BS- protease is used.
- the supernatant contained 90 mg/l of the trypsin-like protease proform.
- the stability of the active trypsin-like Fusarium protease is evaluated by incubation at 30°C of a supernatant of broth from a fermentation in complex medium of A. oryzae transformed with the plasmid pSX183 and sampling at relevant intervals.
- the transformant and the medium are described in the Materials and Methods section of Example 1.
- Crude proenzyme is prepared from fermentation of A. oryzae (IFO 4177) transformed with the plasmid pSX183 described in the Materials and Methods section of Example 1 under conditions where proform is obtained: 500 ml shake flasks without baffles containing 100 ml YDP (10 g ⁇ Bacto yeast extract, 20 g 1 Bacto peptone, 30 g/1 dextrose) are inoculated with approximately 10 6 spores of the A. oryzae culture and incubated at 125 rpm at 26°C for 2 days. Cell material is removed by filtration and crude proform is prepared from the medium by ultrafiltation and subsequent freeze-drying. Evaluation of Stability and Activation of Trypsin-like Fusarium Protease Proenzyme
- proenzyme stability/maturation of proenzyme is evaluated by addition of crude proenzyme (approx. 100 mg l) to the fermentation supernatant mentioned above, incubation at 30°C and sampling at relvant intervals.
- A. oryzae (IFO 4177) is capable of activating the proform. Besides it is obvious, that the proform is unstable in the fermentation broth. Half of the added proform is converted to an active enzyme, the other half is degraded.
- EXAMPLE 4 ISOLATION AND CHARACTERIZATION OF THE p45 PROTEOLYTIC ENZYME FROM Fusarium oxysporum
- F. oxysporum broth is centrifuged at 9000 rpm for 10 min. and the supernatant is filtered through a 0.45 ⁇ m filter. 200 ml of filtrate is concentrated down to 0 ml on an Amicon cell (PM 10 membrane) and Centriprep-0 (Amicon). 5 ml of concentrate is diluted to 100 ml and pH adjusted to 5 with acetic acid and run on a 1 ml MonoS column in the following buffe ⁇ .1 M borate, 10 mM DMG, 2 mM calcium chloride, pH 5.2 in a gradient of 0->0.5 M sodium chloride over 70 min., after 10 min. of wash in the above-identified bufer at a flow rate of 1 ml/min; 1.5 ml fractions are collected and concentrated on Centricon-10 (Amicon).
- Proteolytic enzyme activity is measured as released trypsin activity from recombinant pro-rrypsin-like Fusarium osysporum protease disclosed in EXAMPLE 1, supra after a 30-60 min pre-incubation at 37 °C in 0.1 M Tris, 2 mM CaCl 2 , pH 7 (at lower pH, 100 mM borate, 10 mM DMG, 2mM CaCl 2 is used).
- the tryptic activity is measured in microtiter plates; 100 ⁇ l samples are mixed with 100 ⁇ l of substrate (Stock: 87 mg/ml L-BAPNA (Sigma) in DMSO, diluted 50-fold in buffer) and the absorption at
- SDS-PAGE (10-27%, Novex) is run according to the manufacturer's instructions; samples to be run are preincubated with PMSF before adding sample buffer. Electroblotting onto pro-blot membranes (Applied Biosystems) is done in 3mM Na 2 CO 3 , lOmM NaHCO 3 , 20% MeOH, pH 9.9 at 30 V for 2 hours using the blotting module from Novex. The pro-blot is stained as described by Applied Biosystems.
- IEF Ampholine PAG-plate: pH 3.5-9.5, Pharmacia
- the gel to be overlaid is first equilibrated for 15 min in 0.1 M Tris, 2mM CaCl 2 , pH 8.1 and then overlaid with 10ml 1% agarose, 0.1 M Tris, 2mM CaCl 2 , pH 8.1 added 300 ⁇ l L-BAPNA stock and 500 ⁇ l recombinant pro-trypsin-likeFMs ⁇ ' Mm oxysporum protease disclosed in EXAMPLE 1, supra (-0.25 mg/ml).
- Amino acid analysis and amino acid sequencing Microwave facilitated vapor phase hydrolysis of lyophilized samples is done using the MDS-2000 hydrolysis-station (CEM). 6 N HC1 containing 1% phenol (scavenger) is used for creating the vapor phase. Hydrolysis time is 20 min at 70 psi ( ⁇ 148°C). Hydrolyzed samples are lyophilized and redissolved in 20 ⁇ l of 500 pmol/ ⁇ l sarcosine and norvaline as internal standard. The analysis is done using the AminoQuant from Hewlett-Packard according to manufacturer's instructions; 1 ⁇ l of sample is injected. Amino acid sequencing is done using the 476A Protein Sequencer from Applied Biosystems according to manufacturer's instructions; premixed buffers are used for the online-HPLC.
- the p45 proteolytic enzyme is purified from concentrated and filtered fermentation broth, by using cation-exchange chromatography (MonoS) followed by gel filtration on Superose 12. Fractions from MonoS are selected by assaying for proteolytic enzyme activity as release trypsin-like actvity from pro-trypsin-likeFttfariwm oxysporum protease disclosed in EXAMPLE 1, supra. Proteolytic enzyme containing fractions form the Superose 12 column are identified by using the same assay procedure as for the MonoS -fractions. The purified proteolytic enzyme appears as a single band on SDS-PAGE at 45 kDa. Two isoforms of the maturase are observed in IEF (pH 3.5-9.5) at respectively pi 8.4 and 8.17.
- Purified F. oxysporum p45 (maturase) demonstrates a high specific activity.
- the desired proteolytic enzyme (maturase) fractions from the gel filtration column are pooled and loaded onto a preparative IEF apparatus. Samples are run at 1000V for 1 hour after the amperage had stabilized and then at 500V for another 30 minutes before 30 fractions of 3 ml each are collected. Only one fraction contained the proteolytic enzyme as seen on SDS-PAGE. A comparison of the activity of p45 with Bacillus maturase is shown in Figure 2.
- the p45 maturase is a metalloprotein.
- Metalloproteases contain a catalytic zinc metal center which participates in the hydrolysis of the peptide backbone.
- the active zinc center differentiates these proteases from calpains whose activities are dependent upon the presence of calcium.
- Consfirmation of a protease as a metallo-protease is loss of proteolytic activity accomplished by removal of the zinc center with 1,10-phenanthroline (ImM) followed by titration with Zn 2+ (0.1-100 ⁇ M) to restore full activity.
- ImM 1,10-phenanthroline
- Zn 2+ 0.1-100 ⁇ M
- Table 5 demonstrates that the trypsin-like Fusarium oxysporum protease disclosed in Example 1, supra is not inhibited by 1,10-phenanthroline since similar tryptic activities result with or without inhibitor addition, 33.8 x 10- and 34.0 x 10- 4 ⁇ Abs/min respectively.
- Pro-trypsin-like Fusarium oxysporum protease disclosed in the Materials and Methods section of Example 1 , supra or Fusarium oxysporum maturase samples alone do not contain any tryptic activity (Table 1), however, when combined the maturase cleaves recombinant pro-trypsin-like Fusarium oxysporum protease disclosed in the Materials and Methods section of Example 1, supra to yield the active tryptic protease. Maturase activity is halted upon the addition of 1 mM 1,10- phenanthroline (Table 5). However, full reactivation of the Fusarium maturase occurs upon addition of 1 mM Zn 2 +. Analogous results occur when EDTA (1 mM) is substituted for 1,10-phenanthroline.
- EXAMPLE 5 CLONING OF THE Fusarium oxysporum p45 GENE
- F. oxysporum p45 gene is first cloned by PCR.
- One primer is designed using the N-terminal protein sequence (SEQ ID NO:4) and a reverse primer is designed from an internal maturase peptide sequence (SEQ ID NO:5).
- PCR is performed using the DNA primers and genomic DNA isolated from Fusarium oxysporum. Genomic DNA is isolated as follows. Approximately 15 g wet weight F.
- the samples are alternately vortexed and iced for 30 second intervals until a noticeable viscosity breakdown occurs.
- the samples are vortexed two additional 30 second intervals.
- 2.5 ml 20% SDS is added to each sample.
- the samples are mixed by inversion, incubated 10 minutes at room temperature, and mixed again. Samples are spun 8 minutes at 3.5K, room temperature. Supernatants are combined in a 50 ml polypropylene tube.
- the sample is extracted with an equal volume of TE equilibrated with phenol:chloroform:isoamyl alcohol (25:24: 1) then centrif uged 10 minutes at 10,000 rpm, 4°C.
- the supernatant is treated with 300 ⁇ l 10 mg/ml proteinase K for 30 minutes at 37oQ
- the DNA is phenol/chloroform /isoamyl alcohol (P/C I) extracted as described above, ethanol precipitated and dissolved in 5 ml TE.
- the sample is treated with 150 ⁇ l 10 mg/l RNAase A for 15 minutes at 65°C, then 15 minutes at 37°C.
- the sample is treated again with proteinase K (100 ⁇ l 10 mg/ml for
- PCR is used to clone a portion of the F. oxysporum p45 maturase gene as follows: 50-100 ng F. oxysporum genomic DNA is mixed with ca. 100 pmoles each of the synthetic PCR primer DNAs in IX Taq buffer (Boehringer Mannheim) and a concentration of 100 ⁇ M each of dGTP, dATP, dTTP, and dCTP, in a volume of 50 ⁇ l. Taq DNA polymerase (Boehringer Mannheim), 1-5 units, is added and the
- PCR incubations are, 95 C 5 min then 35 cycles of [95°C 30 seconds : 50°C 1 minute : 72°C 1 min].
- the PCR reaction produces two DNA fragments of ca. 1.0 and 1.3 kb in length. These fragments are isolated by gel electrophoresis, purified, cloned into an E. coli replicating plasmid, and sequenced using standard methods known in the art of molecular biology. The 1.0 kb DNA fragment is found to contain
- F. oxysporum p45 gene sequences by a comparison of the translations of the DNA with the amino acid sequences obtained from the direct protein sequencing. Therefore, this 1.0 kb PCR generated DNA fragment is used as a probe to clone the entire maturase gene from a F. oxysporum genomic DNA library.
- a genomic DNA library in lambda phage is prepared from the F. oxysporum genomic DNA using methods such as those described found in Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY.
- Partially digested DNA of molecular size 10-20 kb is isolated by agarose gel electrophoresis, followed by electroelution into dialysis membrane and concentration using an Elutip-D column (Schleicher and Schuell).
- Hybridizing phage are detected with an alkaline phosphatase-conjugated anti-digoxigenin antibody visualized with Lumiphos 530 as described by the manufacturer (Boehringer Mannheim).
- DNA preparations are made from the positive lambda clones using the Qiagen Lambda Midi Kit (QIAGEN,Inc). DNA from one preparation is digested with restriction enzyme EcoRI and a 6.3 kb fragment is subcloned into plasmid pUCl 18. DNA sequence analysis of portions of this subclone identified the entire coding region of the p45 gene (see Figure 3 and SEQ ID
- Cell debris is removed by low speed (5000 rpm for 30 minutes) centrifugation.
- the poly-A RNA fraction is isolated using oligo(dT) cellulose obtained from Boehringer Mannheim.
- the polyA RNA is used to generate cDNA using the hairpin/RNaseH method (Sambrook etal., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY).
- polyA RNA in 5 ⁇ l water is heated at 70°C then placed on ice.
- Second strand DNA synthesis is performed in this solution at 16°C for 3 hours.
- the reaction is stopped by addition of EDTA to 20 mM followed by phenol extraction and ethanol precipitation.
- the result of this procedure is double stranded cDNA with blunt ends suitable for attachment of DNA linkers and cloning into any vector.
- the cDNA with Ec ⁇ Rl linkers is size fractionated on an agarose gel to obtain cDNAs of molecular size 0.7 kb or greater.
- the cDNA is recovered from the gel by electroelution and purified by phenol extraction and ethanol precipitation.
- the size fractionated cDNA is used to construct a lambda cDNA library.
- the cDNA is cloned into lambda ZIPLOX arms (Gibco BRL).
- Full length cDNA lambda clones are identified using a 467 bp digoxigenin labeled fragment as probe (bp 336-803 of the genomic clone) with the techniques of plaque lifts and DNA hybridizations as previously described.
- Full length cDNA is recovered in plasmid pZLlas described by the manufacturer (strains and plasmid from Gibco BRL). The full length cDNA is sequenced and compared with the sequence of the genomic DNA.
- the genomic DNA is 2049 bp in length and contains three introns.
- the predicted coding region of prepro-p45 protease consists of a putative 18 amino acid signal sequence, a 226 amino acid pro-region, and a 388 amino acid mature region is shown in S ⁇ Q ID NO:6 and in Figure 3.
- a 2102 bp BamHl/Nru ⁇ genomic prepro-p45 protease fragment is inserted between a TAKA amylase promoter and amyloglucosidase (AMG) terminator.
- AMG amyloglucosidase
- the 5 '-end of the gene is modified using PCR techniques to introduce a BamHl site directly upstream of the ATG initiation codon.
- the endogenous Nral site 44bp downstream from the termination codon is used.
- the p45 expression plasmid is called pDM120 ( Figure 4).
- a pyrG- A. oryzae host strain is co-transformed with plasmids pDM120 and pSO2. Plasmid pSO2 contains the A. oryzae pyrG marker (see Figure 5).
- A. oryzae The transformation of A. oryzae is performed by the protoplast method (Christensen et al. Biotechnology 6:1419-1422 (1988), Yelton et al. Proceedings of the National Academy of Sciences (USA) 81:1470-1474 (1984)).
- A. oryzae mycelia are grown in a rich nutrient broth. The mycelia are separated from the broth by a technique such as filtration, centrifugation, etc.
- the transformed protoplasts are diluted with 8 ml STC buffer and plated to selective plates. Acetamide (as sole nitrogen source for growth) plates can be used to select for transformants containing an exogenously supplied amdS marker.
- Minimal plates can be used for transformants containing an exogenously supplied pyrG gene.
- a major band migrating at ca. 45 kD is seen in at least one transformant, strain DLM7, and no p45 is seen in control cultures.
- the recombinant p45 produced in DLM7 is analyzed by protein sequence analysis and the N-terminal residues match the mature
- N-terminus of p45 produced from F .oxysporum. Therefore, the p45 is processed correctly when made in A. oryzae.
- strain DLM7 is co-transformed with plasmids pSX233 containing the trypsin-like protease and pToC90 containing the A. nidulans amdS gene as a selectable marker.
- Plasmid pSX233 is a derivative of plasmid pSX183 in which the DNA linker at the beginning of the precursor trypsin-like protease gene has been changed from GGATCCTCGAATTCTCTTCAGATCTCTTCACCATGG (SEQ ID NO:7) to GGATCCACCATGG (SEQ ID NO:8) using standard techniques of molecular biology.
- the underlined ATG indicates the position of the initiator methionine codon.
- Co-transformants are grown in FG4P medium and analyzed for F. oxysporum trypsin-like protease activity using the L-BAPNA assay. Six of the transformants made significantly more trypsin-like protease than a control strain that did not contain the p45. Supernatants from these transformant cultures (and controls) are analyzed by SDS/PAGE ( Figure 6). All transformants showed the production of both trypsin-like protease and p45 maturase from the same host organisms. The results show that co-expression of the (precursor) trypsin-like protease and the F. oxysporum p45 maturase in the same host cells (A. oryzae) results in significantly enhanced expression of active trypsin-like protease.
- EXAMPLE 7 PUR CA ⁇ ON AND INITIAL CHARACTERIZATION OF A NEUTRAL METALLOPROTEASE (npl) FROM Aspergillus oryzae
- a 10 1 A. oryzae 1560 (7C1-58) fermentation is harvested. 9 1 of broth is obtained and filtered through a 0.1 ⁇ m hollow fibre (Amicon) and concentrated to 700 ml on a 3 kDa cut off spiral ultrafiltration cartridge (Amicon).
- 300 ml is diluted to 1000 ml ( ⁇ 1.5 mS, pH 7.1) and loaded onto a 150 ml (2.6 cm i.d.) Q-Sepharose column equilibrated in 0.1 M borate, 10 mM DMG, 2 mM CaCl 2 , pH 6.2 at a flow rate on 5 ml/min.
- the column is washed with buffer and eluted with a 0->lM NaCl gradient in 1050 ml at 6 ml min. 12 ml fractions are collected and assayed for maturase activity for pro-trypsin-like Fusarium oxysporum protease disclosed in Example 1, supra, maturing activity.
- Maturase containing fractions are pooled and concentrated on a YM3 membrane.
- the pool is then diluted to 80 ml ( ⁇ 1.5 mS, pH 7.5), loaded onto a 20 ml MonoQ- column (1.6) cm i.d.) equilibrated in 20 mM Tris, 2 mM CaCl ) pH 7.5 and eluted in a 0->0.5M NaCl gradient in 300 ml at a flow rate on 6 ml/min). 4.5ml fractions are collected and tested for maturase activity. Fractions having activity are pooled and concentrated on Centriprep-10.
- 3ml of MQ1 is subjected to gel filtration using a HiLoad Superdex 200 16/60 column equilibrated in 100 mM borate, 10 mM DMG, 2 mM CaCl 2 , pH 6.2 at a flow rate of lml/min. 1 ml fractions are collected. Fractions having maturase activity are pooled.
- a further purification step is established by doing pilot runs on either phenyl-superose 5/5 (flow rate 0.5 ml/min, 1.7->OM (NH 4 ) 2 S0 gradient in 60min in 25mM Tris pH 7, 1ml fractions collected) or bacitracin coupled to CH Sepharose 4B (15ml column 1.6 cm i.d., flow rate: 2 ml/min, 0->100% B in 80 min (A: 25mM acetate, pH 5, B: 0.1M Tris, 1M NaCl, 25% isopropanol, pH 7.5), 3 mL fractions collected).
- Coupling of bacitracin Coupling of bacitracin to activated CH Sepharose 4B (Pharmacia) is performed according to manufacturer's descriptions. 6.6g CH Sepharose (swell in ImM HC1 and ished in coupling buffer) is used and coupled with 0,25g (18250 units) of bacitracin (Sigma) in 0.1M NaHCO 3 , 0.5M NaCl, pH 8 for 2 hours at room temperature. Excess active groups are blocked with 0.1M Tris, pH 8 followed by washing with 0.1 M acetate, 0.5 M NaCl, pH 4.
- Maturase activity is measured as released trypsin activity from pro-trypsin-like Fusarium oxysporum protease disclosed in Example 1, supra ( ⁇ 25 ⁇ g/ml) after a 30 min pre-incubation at 37»C in 0.1 M Tris, 2mM CaCl 2 pH 7.5 (at lower pH either borate/DMG or acetate buffer containing CaCl 2 is used).
- the tryptic activity is measured in microtiter plates: 100 ⁇ l of substrate (Stock: 87 mg/ml L-BAPNA (Sigma) in DMSO, diluted 50 fold in buffer) and the absorption at 405 nm is measured using Thermomax microplate reader from Molecular Devices.
- SDS-PAGE and Electroblotting onto PVDF SDS-PAGE (10-27%, Novex) are run according to the manufacturer's instructions (125 V, 2 hours); samples to be run is preincubated with PMSF (0.2%) before adding sample buffer. Electroblotting onto pro-blot membranes (Applied biosystems) is performed in 3 mM Na 2 CO 3 , 10 mM NaHCO 3 , 20% MeOH, pH 9.9 at 25V for 2.5 hours using the blotting module from Novex. The pro-blot is stained as described by Applied Biosystems.
- IEF Ampholine PAG-plate: pH 3.5-9.5, Pharmacia
- the gel to be overlaid is first equilibrated for 15 min in 0.1 M Tris, 2mM CaCl 2 , pH 7 and then overlaid with 1% agarose, 0.1 M Tris, 2mM CaCl 2 , pH 7 added L-BAPNA stock (50-fold diluted) and pro-trypsin-like Fusarium oxysporum protease disclosed in Example 1, supra (crude concentrated broth lmg/ml, 50 fold diluted). Casein overlay is done by having 1 % skimmed milk in the overlay buffer.
- Amino acid sequencing is done using the 476A Protein Sequencer from Applied Biosystems according to manufacturer's instructions; premixed buffers are used for the online-HPLC.
- the purification procedure described supra resqlts in a more than 3300 fold purification (purity > 95% (SDS-PAGE).
- the purified npl has a molecular weight around 46 kDa from SDS-PAGE and a pi around 4.5 from IEF.
- protease pH-optimum is found to be around 5.5-6.0.
- Incubations with pro-trypsin-like Fusarium oxysporum protease disclosed in Example 1, supra are done in dilute buffers at various pHs.
- E.coli containing pSO2 (pyrG) NRRL B-21240 4/21/94 E.coli containing pSO2 (pyrG) NRRL B-21240 4/21/94 (EMCC 0100)
- E. coli containing pSX233 NRRL B-21241 4/21/94 E. coli containing pSX233 NRRL B-21241 4/21/94 (EMCC 0101)
- the strains have been deposited under conditions that assure that access to the culture will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 C.F.R. ⁇ 1.14 and 35 U.S.C. ⁇ 122 and under conditions of the Budapest Treaty.
- the deposit represents a biologically pure culture of each deposited strain.
- the deposit is available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Gastroenterology & Hepatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Analytical Chemistry (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1019950704898A KR960702008A (ko) | 1993-05-05 | 1994-05-04 | 효소생성방법(processes for producing an enzyme) |
| EP94916656A EP0698116A1 (en) | 1993-05-05 | 1994-05-04 | Processes for producing an enzyme |
| JP6525523A JPH08509868A (ja) | 1993-05-05 | 1994-05-04 | 酵素を製造するための方法 |
| AU68251/94A AU678019B2 (en) | 1993-05-05 | 1994-05-04 | Processes for producing an enzyme |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DK93522A DK52293D0 (enExample) | 1993-05-05 | 1993-05-05 | |
| DK0522/93 | 1993-05-05 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO1994026925A2 true WO1994026925A2 (en) | 1994-11-24 |
| WO1994026925A3 WO1994026925A3 (en) | 1995-02-02 |
Family
ID=8094506
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1994/004932 Ceased WO1994026925A2 (en) | 1993-05-05 | 1994-05-04 | Processes for producing an enzyme |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US5702934A (enExample) |
| EP (1) | EP0698116A1 (enExample) |
| JP (1) | JPH08509868A (enExample) |
| KR (1) | KR960702008A (enExample) |
| CN (1) | CN1090238C (enExample) |
| AU (1) | AU678019B2 (enExample) |
| CA (1) | CA2162022A1 (enExample) |
| DK (1) | DK52293D0 (enExample) |
| WO (1) | WO1994026925A2 (enExample) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995030757A3 (en) * | 1994-05-04 | 1996-03-21 | Novo Nordisk Biotech Inc | Metalloproteases from fusarium and aspergillus having thermolysin-like activity |
| US5700686A (en) * | 1995-06-06 | 1997-12-23 | Iogen Corporation | Protease-treated and purified cellulase compositions and methods for reducing backstaining during enzymatic stonewashing |
| WO2005040372A1 (en) | 2003-10-23 | 2005-05-06 | Novozymes A/S | Protease with improved stability in detergents |
| WO2005103245A1 (en) * | 2004-04-23 | 2005-11-03 | Novozymes A/S | Method for obtaining mature protease by enzymatic digestion |
| EP1546318A4 (en) * | 2002-09-24 | 2007-02-14 | Novozymes Inc | MICROBIAL TRYPSIN VARIANTS WITH CHYMOTRYPE INACTIVITY AND THESE CODING NUCLEIC ACIDS |
| WO2014015256A2 (en) | 2012-07-20 | 2014-01-23 | Novozymes A/S | Enzymatic oxidation of 5-hydroxymethylfurfural and derivatives thereof |
| WO2024133495A1 (en) | 2022-12-21 | 2024-06-27 | Novozymes A/S | Microbial proteases for cell detachment |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0797671B1 (en) * | 1994-12-09 | 2004-03-03 | Novo Nordisk A/S | A process of producing extracellular proteins in bacteria |
| EP0981630B1 (en) | 1997-05-16 | 2008-11-19 | Novozymes, Inc. | Polypeptides having prolyl pipeptidyl aminopeptidase activity and nucleic acids encoding same |
| CN1197965C (zh) | 1998-10-26 | 2005-04-20 | 诺维信公司 | 在丝状真菌细胞内构建和筛选目的dna文库 |
| ATE469223T1 (de) | 2000-03-14 | 2010-06-15 | Novozymes As | Pilz transkriptionsaktivator zur verwendung in verfahren zur herstellung von polypeptiden |
| US7279564B2 (en) * | 2003-11-06 | 2007-10-09 | Genencor International, Inc. | Expression in filamentous fungi of protease inhibitors and variants thereof |
| US20070010416A1 (en) * | 2004-10-22 | 2007-01-11 | Novozymes A/S | Protease with improved stability in detergents |
| RU2433182C2 (ru) * | 2005-10-12 | 2011-11-10 | Джененкор Интернэшнл, Инк. | Применение и получение стабильной при хранении нейтральной металлопротеиназы |
| US8222372B2 (en) * | 2007-04-16 | 2012-07-17 | Novozymes A/S | Whey protein hydrolysate |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3652399A (en) * | 1969-04-30 | 1972-03-28 | Takeda Chemical Industries Ltd | Alkali protease |
| US5077204A (en) * | 1984-06-21 | 1991-12-31 | Chiron Corporation | Yeast endopeptidase for basic amino-acid site cleavage, preparation and use |
| CA1340740C (en) * | 1987-12-08 | 1999-09-14 | Eileen R. Mulvihill | Co-expression in eukaryotic cells |
| DE68924654T2 (de) * | 1988-01-07 | 1996-04-04 | Novonordisk As | Spezifische Protease. |
| US5288627A (en) * | 1988-01-07 | 1994-02-22 | Novo Nordisk A/S | Endoprotease from Fusarium oxysporumDSM 2672 for use in detergents |
| NL9000917A (nl) * | 1989-10-25 | 1991-05-16 | Holland Biotechnology | Farmaceutisch preparaat met endoproteolytische activiteit; werkwijze voor endoproteolytische processing van (precursor) eiwitten en voor de (micro) biologische bereiding van eiwitten. |
| DK52393D0 (enExample) * | 1993-05-05 | 1993-05-05 | Novo Nordisk As |
-
1993
- 1993-05-05 DK DK93522A patent/DK52293D0/da not_active Application Discontinuation
-
1994
- 1994-05-04 CN CN94192473A patent/CN1090238C/zh not_active Expired - Fee Related
- 1994-05-04 CA CA002162022A patent/CA2162022A1/en not_active Abandoned
- 1994-05-04 US US08/238,130 patent/US5702934A/en not_active Expired - Fee Related
- 1994-05-04 WO PCT/US1994/004932 patent/WO1994026925A2/en not_active Ceased
- 1994-05-04 KR KR1019950704898A patent/KR960702008A/ko not_active Withdrawn
- 1994-05-04 EP EP94916656A patent/EP0698116A1/en not_active Withdrawn
- 1994-05-04 AU AU68251/94A patent/AU678019B2/en not_active Ceased
- 1994-05-04 JP JP6525523A patent/JPH08509868A/ja not_active Ceased
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995030757A3 (en) * | 1994-05-04 | 1996-03-21 | Novo Nordisk Biotech Inc | Metalloproteases from fusarium and aspergillus having thermolysin-like activity |
| US5843753A (en) * | 1994-05-04 | 1998-12-01 | Novo Nordisk A/S | Metalloprotease having increased activity |
| US5700686A (en) * | 1995-06-06 | 1997-12-23 | Iogen Corporation | Protease-treated and purified cellulase compositions and methods for reducing backstaining during enzymatic stonewashing |
| US5916799A (en) * | 1995-06-06 | 1999-06-29 | Iogen Corporation | Protease-Treated and purified cellulase compositions and methods for reducing backstaining during enzymatic stonewashing |
| EP1546318A4 (en) * | 2002-09-24 | 2007-02-14 | Novozymes Inc | MICROBIAL TRYPSIN VARIANTS WITH CHYMOTRYPE INACTIVITY AND THESE CODING NUCLEIC ACIDS |
| US8114635B2 (en) | 2002-09-24 | 2012-02-14 | Novozymes, Inc. | Methods for obtaining microbial trypsin mutants having chymotrypsin activity |
| WO2005040372A1 (en) | 2003-10-23 | 2005-05-06 | Novozymes A/S | Protease with improved stability in detergents |
| WO2005103245A1 (en) * | 2004-04-23 | 2005-11-03 | Novozymes A/S | Method for obtaining mature protease by enzymatic digestion |
| WO2014015256A2 (en) | 2012-07-20 | 2014-01-23 | Novozymes A/S | Enzymatic oxidation of 5-hydroxymethylfurfural and derivatives thereof |
| WO2024133495A1 (en) | 2022-12-21 | 2024-06-27 | Novozymes A/S | Microbial proteases for cell detachment |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1090238C (zh) | 2002-09-04 |
| CA2162022A1 (en) | 1994-11-24 |
| WO1994026925A3 (en) | 1995-02-02 |
| EP0698116A1 (en) | 1996-02-28 |
| AU678019B2 (en) | 1997-05-15 |
| CN1125466A (zh) | 1996-06-26 |
| US5702934A (en) | 1997-12-30 |
| DK52293D0 (enExample) | 1993-05-05 |
| AU6825194A (en) | 1994-12-12 |
| KR960702008A (ko) | 1996-03-28 |
| JPH08509868A (ja) | 1996-10-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5264825B2 (ja) | 菌類細胞中で遺伝子を発現させるためのプロモーター | |
| DK175460B1 (da) | Fremgangsmåde til fremstilling af et pattedyrpolypeptid | |
| EP0956338B1 (en) | Host cells and methods of producing proteins | |
| EP1266011B1 (en) | Fungal transcriptional activator useful in methods for producing polypeptides | |
| US5702934A (en) | Processes for producing an enzyme | |
| US8647856B2 (en) | Methods for producing polypeptides in enzyme-deficient mutants of Fusarium venenatum | |
| US5861280A (en) | Host cell expressing reduced levels of a metalloprotease and methods using the host cell in protein production | |
| JP2001514529A (ja) | プロテアーゼ活性を有するポリペプチドをコードする核酸 | |
| JPH04507346A (ja) | アルカリ性タンパク質分解酵素およびその製造方法 | |
| CA2204257C (en) | Tripeptidyl aminopeptidase | |
| CA2205411A1 (en) | Lysophospholipase produced from aspergillus by recombinant methods | |
| JP2011101651A (ja) | オキサロ酢酸ヒドロラーゼ欠陥真菌宿主細胞 | |
| HU219809B (hu) | Új gomba proteáz és eljárás ennek előállítására | |
| JP2002515252A (ja) | 糸状菌変異体細胞においてポリペプチドを生産するための方法 | |
| JPH07213286A (ja) | 真菌プロテアーゼ | |
| US5807729A (en) | Metalloprotease having increased activity | |
| KR20000068489A (ko) | 국균에서 단백분해 효소의 증강된 발현 | |
| JPH0538289A (ja) | 蛋白質の製造法 | |
| WO2002040652A2 (en) | Novel soluble endoproteases for the in vitro processing of recombinant proteins |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 94192473.4 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AU BB BG BR BY CA CN CZ FI HU JP KR LK LU LV MG MW NO NZ PL RO RU SD SK UA VN |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): AU BB BG BR BY CA CN CZ FI HU JP KR LK LU LV MG MW NO NZ PL RO RU SD SK UA VN |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2162022 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1994916656 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1994916656 Country of ref document: EP |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 1994916656 Country of ref document: EP |