WO1994025606A2 - Rekombinante alanin racemase und gapdh aus tolypocladium niveum - Google Patents

Rekombinante alanin racemase und gapdh aus tolypocladium niveum Download PDF

Info

Publication number
WO1994025606A2
WO1994025606A2 PCT/EP1994/001272 EP9401272W WO9425606A2 WO 1994025606 A2 WO1994025606 A2 WO 1994025606A2 EP 9401272 W EP9401272 W EP 9401272W WO 9425606 A2 WO9425606 A2 WO 9425606A2
Authority
WO
WIPO (PCT)
Prior art keywords
dna
alanine racemase
gene
cyclosporin
alanine
Prior art date
Application number
PCT/EP1994/001272
Other languages
English (en)
French (fr)
Other versions
WO1994025606A3 (de
Inventor
Hans Peter Kocher
Elisabeth Schneider-Scherzer
Kurt Schoergendorfer
Gerhard Weber
Original Assignee
Sandoz Ltd.
Sandoz-Patent-Gmbh
Sandoz-Erfindungen Verwaltungsgesellschaft Mbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sandoz Ltd., Sandoz-Patent-Gmbh, Sandoz-Erfindungen Verwaltungsgesellschaft Mbh filed Critical Sandoz Ltd.
Priority to JP6523853A priority Critical patent/JPH08509368A/ja
Priority to EP94915107A priority patent/EP0696323A1/de
Publication of WO1994025606A2 publication Critical patent/WO1994025606A2/de
Publication of WO1994025606A3 publication Critical patent/WO1994025606A3/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/64—Cyclic peptides containing only normal peptide links
    • C07K7/645—Cyclosporins; Related peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01009—Glyceraldehyde-3-phosphate dehydrogenase (NADP+) (1.2.1.9)

Definitions

  • the invention relates to nucleotide sequences which code for enzymes which have an alanine racemase activity and methods for producing alanine racemase which use these sequences.
  • the invention also relates to methods for the production of cyclosporin and cyclosporin derivatives.
  • the present invention relates to new DNA fragments with part or all of the gene for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from Tolypocladium niveum, its promoter and termination region, and the use thereof.
  • GPDH glyceraldehyde-3-phosphate dehydrogenase
  • the invention also relates to new vectors and cells that have been transformed with these vectors.
  • the fungus Tolypocladium niveum can be classified microbiologically in the class of imperfect fungi and is of particular biotechnological interest because of its ability to form cyclosporins (Dreyfuss et al., 1976).
  • cyclosporins A class of cyclic undecapeptides, which are composed of hydrophobic, aliphatic amino acids, is referred to as cyclosporins.
  • These substances have a variety of biological effects: the main metabolite cyclosporin A is used because of its immunosuppressive effect as the most important medication to prevent organ rejection after transplantation. Accordingly, the development of suitable techniques for genetically manipulating this and related organisms that produce cyclosporins or that have an impact on cyclosporin production is of great importance.
  • Such a technique can not only contribute to increasing the production of known cyclosporins, but also to the production of new active ingredients or other substances.
  • the regulatory areas of the GAPDH gene such as the promoter area, can be used for the effective transcription of various genes and are therefore important for their strong expression.
  • cyclosporin synthetase The biosynthesis of the cyclosporins takes place, as for other peptide antibiotics described, according to the non-ribosomal thiotemplate mechanism (Kleinkauf and von Dschreiben, 1990). It is noteworthy that the entire biosynthesis is controlled by a multienzyme, which consists of a single polypeptide chain and is called cyclosporin synthetase. This enzyme has been biochemically purified and characterized (Schmidt et al., 1992).
  • Cyclosporin A contains three non-proteinogenic amino acids: D-alanine in position 8, ⁇ -aminobutyric acid in position 3 and the unusual amino acid (4R) -4 - [(E) -2-butenyl] -4- methyl-L-threonine (Bmt ) at position 1.
  • Such non-proteinogenic amino acids are characteristic components of peptide antibiotics.
  • D-amino acids it has been found in the peptide synthetases investigated to date that the L-amino acid is activated by the enzyme, that is, bound as a thioester, and then epimerized directly on the enzyme.
  • cyclosporin synthetase does not have an integral epimerase function (Kleinkauf and von Dschreiben, 1990): it must be supplied with d-alanine as a building block for biosynthesis. Tolypocladium niveum must therefore have an alanine racemase. Since the cyclosporin biosynthesis starts at position 8 with the activation of D-alanine (Lawen et al., 1992), this racemase has a key function in the biosynthesis process.
  • the invention relates to an isolated nucleotide sequence encoding a eukaryotic enzyme, or a fragment thereof, that has alanine racemase activity.
  • an enzyme that has alanine racemase activity is an enzyme that converts D-alanine or L-alanine into a mixture of both enantiomers.
  • the nucleotide sequence preferably codes for alanine racemase from Tolypocladium niveum ATCC 34921 or for an enzyme which has alanine racemase activity and is at least 70% (for example at least 80, 90 or 95%) homologous thereto. This is to mean that the invention includes, in addition to the nucleotide sequence shown in FIG. 5, one which codes for protein which has essentially similar activity and / or function, the amino acid sequence being at least 70% (at
  • Example at least 80, 90 or 95%) contains such amino acids as those
  • Amino acid sequence encoded by the nucleotide sequence shown in Figure 5 and wherein in one position or the other amino acids can be conservatively exchanged.
  • the following codons are synonymous, that is to say they each code for the same or conservatively interchangeable amino acid: i) UUU, UUC, UAU and UCG; ii) UUA, UUG, CUU, CUC, CUA, CUG, AUU, AUC, AUA, GUU, GUC, GUA andOLQ iii) UCU, UCC, UCA, UCG, AGU, AGC, ACU, ACC, ACA, ACG, GCU, GCC, CGA and
  • GCG GCG; iv) CCU, CCC, CCA and CCG; v) UAA, UAG, and UGA; vi) CAU and CAC; vii) CAA, CAG, AAU and AAC viii) AAA, AAG, CGU, CGC, CGA, CGG, AGA and AGG; ix) GAU, GAC, GAA and GAG; x) UGU and UGC; xi) AGU and AGC; xii) GGU, GGC, GGA and GGG.
  • triplets that are specified in the individual points above are also synonymous. Nucleotide sequences that code for the structural gene shown in Figure 5 and in which such synonymous triplets are included are also encompassed by the invention.
  • the present description therefore relates in one aspect to new DNA fragments with some or all of the gene for the alanine racemase from Tolypocladium niveum, its promoter and termination region, and their use for strain improvement.
  • the invention also relates to new nucleotide molecules, vectors and cells that have been transformed with these vectors.
  • strains which are particularly suitable for processes for the preparation of modified cyclosporins which contain amino acids other than D-alanine at position 8 is also described.
  • the invention relates to part or all of the GAPDH gene from Tolypocladium niveum, with "a part” meaning at least 70% (for example at least 80, 90 or 95%) homologous DNA sequence which may contain synonymous triplets, as described above for the case of alanine racemase, furthermore its promoter and its termination region, to which the above statements regarding " homologous DNA sequences also apply, and their use.
  • the invention further encompasses including those genes whose gene product is bound or immunoprecipitated with antibodies to all or part of the protein encoded by the genes according to the invention, provided that these gene products have an essentially similar function or activity.
  • the invention also encompasses nucleotide sequences which are similar to the nucleotide sequences according to the invention nt, which can hybridize against one of the sequences according to the invention.
  • the test sequence and the sequence according to the invention can have a TM difference of up to approximately 15 ° C.
  • the hybridization is carried out under stringent conditions, with either the test sequence or one of the sequences according to the invention being applied to a support. Either a denatured test sequence or one of the sequences according to the invention is thus first bound to a support, whereupon the hybridization against the other sequence in a suitable time and at temperatures of about 35 to 70 ° C. in 2xSSC buffer containing 0.1% SDS , carried out becomes.
  • the carrier is then washed at the same temperature with a buffer of reduced SSC concentration.
  • buffers are generally SSC buffers with single strength, with half strength or with 1/10 strength (lxSSC, 0.5xSSC or 0, lxSSC), each containing 0 , 1% SDS.
  • Sequences with the highest degree of similarity are those whose hybridization is least affected by washing with buffer of reduced concentration.
  • the test sequence and the sequence according to the invention are preferably so similar that the hybridization by washing with or incubating in 0.1 ⁇ SSC buffer (0.1% SDS) remains essentially unaffected.
  • the invention also encompasses recombinant nucleotide sequences which are modified with respect to the sequences according to the invention with respect to one or more codons.
  • the modification is carried out in such a way that the modified codons of the corresponding amino acid in the organism into which the recombinant nucleotide sequence is to be introduced are favorably used for translation.
  • Expression of the modified DNA in said organism provides essentially similar protein to the unmodified, recombinant nucleotide sequence in the organism in which the protein coding components of the recombinant nucleotide sequence are endogenous.
  • the expression of the genes according to the invention can be improved, for example, by (i) mutating the non-coding region 5 'of the heterologous gene to increase the RNA polymerase binding, (ii) using constructions which have several promoter regions, either from the same source or from another, for example from a GAPDH gene, (iii) introducing strong promoters into the genome (preferably not accidentally) to induce the expression of autologous or heterologous genes.
  • Examples of Tolypocladium niveum include Tolypocladium niveum ATCC 34921 and strains derived therefrom.
  • the alanine racemase from Tolypocladium niveum has not previously been described in the literature. In order to find access to this enzyme, it was first necessary to develop a proof of activity.
  • the NADH method described in the literature for prokaryotic racemases was used as a starting point (Badet et al., 1984): the D-alanine formed is detected by oxidizing it to pyruvate with D-amino acid oxidase; Pyruvate is again reduced to lactate while consuming NADH. The consumption an NADH is equimolar to the D-alanine formed and is determined by the decrease in UV absorption at 340 nm.
  • This assay is described in its "coupled” form in the literature, that is to say all the reactions mentioned (epimerization of alanine, oxidation to pyruvate and reduction to lactate) are carried out simultaneously.
  • This method has only provided unreliable measured values in only roughly enriched enzyme extracts from Tolypocladium niveum. For this reason, the reactions were decoupled: in the first sub-step, the epimerization of L-alanine to D-alanine was carried out, and after heat inactivation of the enzymes, the D-alanine formed was converted into pyruvate and lactate in a second sub-step.
  • This decoupling also has the advantage that the optimal conditions for the epimerization reaction can be determined without being influenced by the subsequent reactions.
  • the enzyme is purified by customary methods.
  • The. Cell disruption can be carried out from moist or lyophilized cells. If the cells are moist, pressure digestion, e.g. with a Manton Gaulin apparatus or with a French press, or digestion with a glass ball mill. Lyophilized cells, on the other hand, are expediently disrupted by mortaring under liquid nitrogen. In the case of alanine racemase, the mycelium was in a moist state and in large quantities, so that pressure digestion with a Manton Gaulin apparatus was most expedient.
  • the digestion is followed by a rough clarification of the crude extract by medium-speed centrifugation (around 10,000 g) and a further clarification step by precipitation of nucleic acids. All reagents customary for this can be used to precipitate the nucleic acids, such as polyethyleneimine or protamine sulfate. The appropriate concentration should be worked out for each problem. A final concentration of 0.1% of polyethyleneimine was used for the alanine racemase.
  • the alanine racemase can be extracted from such a clarified crude extract by the usual Methods of protein purification can be enriched. Salting out with ammonium sulfate is advantageous as the first stage, since the volume of the protein solution, which is usually very large after mycelium extraction, can be concentrated at the same time.
  • chromatographic methods for purifying the alanine racemase can be used, such as, for example, ion exchange chromatography, gel permeation chromatography, hydrophobic interaction chromatography, pseudoaffinity chromatography on dye-Sepharosen, chromatography on inorganic support materials, such as, for example, hydroxylapatite, and others .
  • ion exchange chromatography gel permeation chromatography
  • hydrophobic interaction chromatography pseudoaffinity chromatography on dye-Sepharosen
  • chromatography on inorganic support materials such as, for example, hydroxylapatite, and others .
  • the first step after ammonium sulfate precipitation was to use an ion exchange step on a column combination of S-Sepharose and phosphocellulose.
  • alanine racemase No further purification of the alanine racemase could be achieved on dye-Sepharosen or on hydrophobic materials without high losses.
  • the enzyme preparation is already clean enough to assign the corresponding protein band to the enzyme activity.
  • a first assignment is made by correlating the course of the enzyme activity in the successively eluting fractions from Mono-Q with the occurrence of the individual protein bands in an SDS-PAGE. Although such an assignment can be made in many cases, as with the example of alanine racemase, it is advantageous if one tries to identify the protein band directly on the basis of its activity.
  • a radioactive, enzyme-specific labeling technique was used. It is known that amino acid racemases require pyridoxyl phosphate as an essential cofactor. In the absence of an adequate enzyme substrate, this pyridoxal phosphate is bound via a Schiff base to the epsilon amino group of a lysine in the active center of the enzyme. By reduction with NaBH 4 can this ship sees base to a secondary amine and thus to a covalent bond between enzyme and cofactor. If tritiated NaBH 4 is used for this reaction, a radioactive label is simultaneously introduced on the enzyme, which can be visualized by autoradiography after SDS-PAGE and drying of the gel.
  • the relative molar mass of the native enzyme was determined for further characterization of alanine racemase.
  • An M ⁇ around 100,000 was determined by gel permeation chromatography.
  • the values obtained from such analyzes can only be regarded as guidelines, since the behavior of a protein on a molecular sieve depends not only on its size, but also on its (unknown) shape, its hydrophobicity and on non-specific interactions with the gel matrix.
  • the M, denatured protein of 39,000 it is very likely that the alanine racemase is present as a homodimer, as has been described for a number of other racemases (Inagaki et al., 1986, Inagaki et al., 1987, Wang and Walsh, 1978).
  • the amino acid sequencing can be carried out according to customary methods. If, as in the case of alanine racemase, the enzyme is not homogeneous, the proteins are advantageously first separated by SDS-PAGE and blotted onto a protein-binding membrane. The first step is to try N-terminal sequencing. If the N-terminus is blocked, as in the case of alanine racemase, or in order to obtain internal sequence information, the protein can be cleaved directly on the membrane: the fragments are eluted from the membrane, separated by HPLC and the Gas phase sequencing fed.
  • GAPDH gene a DNA was cloned from the chromosomal DNA of Tolypocladium niveum which contains the gene for glyceraldehyde-3-phosphate dehydrogenase, an enzyme of the central metabolic pathway of glycolysis.
  • the structure of the gene and its regulatory region was analyzed and it was found that the promoter region can be used as a host strain for the construction of potent expression vectors, for example for Tolypocladium niveum.
  • the GAPDH structural gene, the initiation site of the translation, the promoter-active part and the transcription termination region of the GAPDH gene can be isolated from cells of Tolypocadium niveum.
  • Examples of Tolypocladium niveum include Tolypocladium niveum ATCC 34921 and strains derived therefrom.
  • the DNA for the alanine racemase gene and also for the .GAPDH gene can be obtained from chromosomal DNA from Tolypocladium niveum.
  • the chromosomal DNA in turn can be isolated by various methods according to the prior art, such as, for example, directly from digested cells according to Kück et al. (1989) or a similar method.
  • Another method is based on protoplasts.
  • the fungal cells are protoplastized according to a known method, e.g. summarized by Peberdy (1991) or after a corresponding modification; the optimized variant for Tolypocladium niveum described in Example 18 is very suitable.
  • the DNA is isolated and purified by the method of Cryer et al. (1975) or a corresponding modification (example 6).
  • any method can be used which determines the existence of the alanine racemase gene or the GAPDH gene approved.
  • a method could be used which is based on a corresponding defect in the host strain alanine racemase gene or Complement the GAPDH gene.
  • Another method would be to detect the gene from another organism by hybridization with part or all of the known alanine racemase gene or GAPDH gene.
  • Possible other microorganisms relating to the alanine racemase gene would be, for example, Salmonella typhimu ⁇ um (Wasserman et al., 1984 (dadB), Galakatos et al., 1986 (alr)), Bacillus stearothermophilus (Inagaki et al., 1986, Tanizawa et al., 1988 ) or Bacillus subtilis (Ferrari et al., 1985).
  • Suitable other microorganisms relating to the GAPDH gene are, for example, Saccharomyces cerevisiae or Aspergillus nidulans.
  • part of the GAPDH gene from Penicillium chrysogenum can be a useful sample.
  • Escherichia coli is usually used as the host strain for cloning, although other organisms could of course also be used.
  • a preferred strain is, for example, the commercially available Escherichia coli SRB (Stratagene).
  • any vector that can be transferred into Escherichia coli can be used as the cloning vector.
  • plasmid vectors such as pBR322, pUC18, pUC19, pUCBM20, pBluescriptII SK + and the like, or vectors based on the bacteriophage lambda, such as lambda EMBL3, or lambda DASH II, are used.
  • cosmids can be used, for example the vector Supercos 1 (Stratagene).
  • the chromosomal DNA can be cut either partially or completely with a suitable restriction enzyme.
  • the selected vector can be cut with the same restriction enzyme or one that creates the same ends.
  • the two edge fragments can be produced using a known method in order to increase the cloning efficiency. Then DNA fragments and vector can be ligated together using a DNA ligase in order to obtain the corresponding recombinant DNA molecules.
  • the recombined DNA is then introduced into Escherichia coli.
  • Escherichia coli In the case of a plasmid vector, this can be done using "competent cells” (Sambrook et al., 1989) or by Electrotransformation can be performed.
  • Lambda and cosmid molecules are introduced into Escherichia coli by in vitro packaging in bacteriophage lambda phage shells and subsequent infection of the corresponding host strain.
  • Commercially available lysates can be used for the in vitro packaging (eg Gigapack II, Stratagene).
  • plaque hybridizations for lambda clones or colony hybridizations for plasmid and cosmid clones are carried out according to standard techniques (Sambrook et al., 1989), an oligonucleotide mixture which was derived from amino acid partial sequences of the alanine racemase protein as described above being used as a probe for the alanine racemase gene.
  • a suitable mixture must first be selected in preliminary experiments, and the stringency of the corresponding hybridization must be very well optimized in Southern experiments.
  • a corresponding DNA containing the alanine racemase gene from Tolypocladium niveum can be isolated.
  • Part of the GAPDH gene from Penicillium chrysogenum can be used as a probe for the GAPDH gene, the stringency having to be modified accordingly.
  • nucleotide sequence of the alanine racemase gene or the GAPDH gene can be determined by a sequencing method (eg according to Maxam-Gilbert (Maxam and Gilbert 1980) or the didesoxy method (Sanger et al., 1977) or a suitable modification). Gene can be determined. After analyzing the sequence and comparing the translated sequence with the partial amino acid sequences of the identified alanine racemase, it can be verified that the alanine racemase gene is involved, and also the orientation of the gene and its promoter and termination region on the DNA can be determined become.
  • the expression of the hybridized gene can be confirmed by Northern hybridizations of corresponding partial fragments of the alanine racemase gene or of the GAPDH gene. After analysis of the corresponding sequences, both in the case of the alanine racemase gene and of the GAPDH gene, the position of the structural gene, of the promoter and of the Termination region can be determined. This can be substantiated significantly if, in addition to the genomic DNA fragment, the corresponding RNA in the form of cDNA is also used for the investigations. In addition, the determination of the position of intron areas and the starting point of the transcription is facilitated. For this purpose, the entire RNA is first isolated from the fungal cells by the method described by Cathala et al. (1983) or a similar method.
  • the polyA-RNA is purified from it using one of the numerous standard processes.
  • the overwriting in c-DNA can be realized, for example, by PCR amplification technology.
  • RACE rapid amplification of cDNA ends
  • RACE gene-specific oligonucleotide primers both the beginning of the transcripts (5'-RACE) and also the end (3'-RACE), or thereby the internal gene area (testing for introns) isolated and accessible for direct sequencing or for sequencing after appropriate clone construction.
  • This procedure was demonstrated for the characterization of the alanine racemase gene in Example 27, the exact transcription start, the transcription determination and the location of intron regions being localized.
  • Another possibility is to incorporate the cDNA obtained after overwriting the poly-RNA into plasmid or lambda vectors using suitable linkers or adapters.
  • the search and purification of the positive clones is carried out analogously to the above by means of plaque or colony hybridizations, it now being possible to use part of the GAPDH gene from Tolypocladium niveum.
  • the proportion of positive clones compared to the total number of clones examined also gives an indication of the strength of the expression of the gene sought under the corresponding conditions. In the case of the GAPDH gene according to Example 13, the proportion of positive clones was very high at approximately 2.5 to 3%.
  • Figure 15 shows the nucleotide sequence of the GAPDH gene isolated from Tolypocladium niveum according to Examples 12, 13 and 14.
  • the ATG codon at item 673 in Figure 15 is the start codon of translation, the beginning of the actual structural gene.
  • structural elements can be found, like those in a similar form in others Mushroom promoters have been found.
  • This is followed by an approx. 60 bp CT region above the presumed transcription start, which ends in a potential TATA box.
  • a so-called CAAT box could be located another approximately 60 bp upwards (Gurr et al., 1987).
  • Corresponding DNA fragments which contain this promoter region can now be used for the construction of individual fusions with genes which are to be placed under the control of the GAPDH gene promoter.
  • certain parts of the sequenced region were used according to Examples 20 and 26. However, these are only individual possibilities for such constructions.
  • part of the DNA can also be deleted, both at the 5 'end of the region and at the 3' end. Only parts of the promoter area can also be used (as in Example 25), for example only the part up to the starting point of the transcription.
  • larger parts of the structural gene can also be used for such mergers.
  • genes whose expression one wishes to achieve can be combined to form fusion constructions. Examples of these genes can be, for example, those which serve as selection labels in the corresponding organism, as described in Examples 20 and 25, or any other genes which code for specific enzymes. In very general terms, this gene can be chemically synthesized or semisynthetically produced both from genomic DNA, from cDNA which has been formed from mRNAs.
  • strains By transforming Tolypocladium niveum with plasmid vectors which carry part of the alanine racemase gene (which is insufficient to produce the active enzyme), strains can be generated which have integrated the plasmid vector into the genomic alanine racemase gene by homologous recombination, as a result of which. Gene has been destroyed. It can be shown in test fermentations that these strains no longer form cyclosporin A. This is further proof that the cloned gene is actually the gene for the alanine racemase enzyme, which is essential for cyclosporin biosynthesis.
  • restriction maps shown in Figures 1, 2, 3, 4, 6, 7, 10, 12, 17, 18 and 19 are only approximate representations of restriction sites in the DNA molecules.
  • the distances shown are proportional to the actual distances, but the latter may differ. Not all restriction interfaces are shown, there may be other interfaces.
  • Figure 1 Restriction map of the approximately 15.2 kb portion of genomic DNA from Tolypocladium niveum in Lambda RAC4 (white bar).
  • the shaded bar represents the approx. 1100 bp tl restriction fragment, which delivers a positive signal with the hybridization probe (oligonucleotide mixture R14) and was cloned into pRPl.
  • the two hatched bars represent the neighboring fragments that were subcloned into pRP6 and pRP9, respectively.
  • FIG. 2 Restriction map of plasmid pRPl.
  • the shaded bar represents the approx. 1100 bp Pstl restriction fragment, which gave a positive signal with the hybridization probe (oligonucleotide mixture R14).
  • the thinner portion represents the area of the plasmid vector pUCBM20 used.
  • FIG. 3 Restriction map of plasmid pRP6.
  • the shaded bar represents the approx. 1.9 kb EcoRI-SaE restriction fragment from Lambda RAC4.
  • the thinner portion represents the area of the plasmid vector pUCBM20 used.
  • FIG. 4 Restriction map of plasmid pRP9.
  • the shaded bar represents the approx. 650 bp HindSl-Pst restriction fragment from Lambda RAC4.
  • the thinner portion represents the area of the plasmid vector pBluescriptII SK + used.
  • Figure 5 Nucleotide sequence of the approximately 1.1 kb PstI insert in pRPl, the approximately 1.9 kb-sized EcoRI-Sall fragment from pRP6, the approx. 650 bp PstI-Hindül fragment from pRP9, and an additional 511 bp subsequent to the HindlH site comprising 3973 nucleotides (see also Figure 19). Individual recognition sites for restriction endonucleases are indicated.
  • Figure 6 Restriction map of a sequenced section from Figure 5. The location of the amino acid partial sequences found (Example 12) is given.
  • FIG. 7 Restriction map of plasmid pRP12.
  • the shaded bar represents the approximately 835 bp EcoRI- -stl restriction fragment from pRPl.
  • the thinner portion represents the area of the plasmid vector pUCBM20 used.
  • FIG. 8 Restriction map of plasmid pGT24.
  • the plasmid is derived from pGT14 and contains a - ⁇ mHI fragment (white bar) with the hygromycin resistance gene, the orientation of which is indicated by the dotted arrow.
  • FIG. 9 Restriction map of plasmid pGTl.
  • the shaded bar represents the S ⁇ cl fragment isolated in Example 12 with the GAPDH gene from Tolypocladium niveum.
  • the thinner portion represents the area of the plasmid vector pUC18 used.
  • FIG. 11 Restriction map of plasmid pGT4.
  • the shaded area represents the cloned cDNA of the GAPDH gene (gpdA) (example 13).
  • the thinner area represents the proportion of the plasmid vector pUCBM20.
  • Figure 12 Nucleotide sequence of the 1347 bp cDNA insert in pGT4. Items 1-14 and 1334-1347 (underlined) correspond to the adapter molecules used for the cloning and contain the recognition sites for the restriction endonucleases EcoRI (GAATTC) and NotI (GCGGCCGC).
  • Figure 13 Nucleotide sequence of the 1278 bp Xhol-Sall fragment from gpdcosl, which contains the promoter of the GAPDH gene (Example 14).
  • the S ⁇ cl identification point corresponds to that at pos. 1-6 in Figure 11.
  • Figure 14 Comparison of the genomic nucleotide sequence (top) with that of the cDNA (bottom) (example 14). Individual restriction interfaces are marked. The two intron areas are represented by the dash. The translation start codon ATG, as well as the translation stop codon TAA, is underlined. They mark the location of the actual GAPDH structural gene from Tolypocladium niveum.
  • Figure 15 Amino acid sequence of the derived GAPDH
  • Figure 16 Restriction map of plasmid pGT12 (example 20).
  • the gray arrow marks the area and the orientation of the selected promoter fragment of the GAPDH gene from Tolypocladium niveum.
  • the thin area corresponds to the part of the plasmid vector pBluescript II SK + used.
  • FIG. 17 Restriction map of plasmid pGT14 (example 20).
  • the gray areas indicate the promoter fragment used (arrow) and the fragment from the terminator area of the GAPDH gene from Tolypocladium niveum.
  • FIG 18 Restriction map of plasmid pGT30 (example 26).
  • the gray arrow marks the area and the orientation of the selected promoter fragment of the GAPDH gene from Tolypocladium niveum.
  • the fragment marked by the white bar contains the hygromycin resistance gene, the orientation of which is indicated by the dotted arrow.
  • the rest of the plasmid corresponds to pCSN44 (Stäben et al., 1989)
  • Figure 19 The amino acid sequence of the alanine racemase from Tolypocladium niveum derived from the nucleotide sequence
  • Figure 20 Nucleotide sequence of the 3973 bp alanine racemase gene region.
  • the coding region of the structural gene is characterized by the representation of the amino acid sequence.
  • the position of the intron is marked.
  • Figure 21 Result of the sequencing of 32 5'-RACE clones of the alanine racemase gene.
  • the starting nucleotide is always the large A.
  • the identical sequence areas are marked with dashes.
  • the position numbers refer to the A of the translation start codon.
  • Figure 22 Result of the sequencing of 12 3'-RACE clones of the alanine racemase gene. Above the ends of the individual DNAs, the genomic sequence is shown in italics as a reference point. The position numbers refer to the A of the translation start codon. The number after the "/" stands for the length of the 3 'area after the stop codon.
  • Example 1 Analytical determination of alanine racemase activity:
  • racemase About 1 mU of racemase are incubated in a total volume of 120 ⁇ l in the presence of 30 mM L-alanine, 50 ⁇ M pyridoxal phosphate (Boehringer Mannheim), 20 mM DTT and 100 raM tricine pH 8.5 at 48 ° C. for 1 hour.
  • the protein solution is then inactivated by heating at 80 ° C. for 5 minutes; the denatured proteins are centrifuged off in the Eppendorf centrifuge.
  • DAO D-amino acid oxidase
  • LDH lactate dehydrogenase
  • the procedure is carried out in 500 ⁇ l quartz cuvettes (quartz glass Suprasil micro cuvettes), and the decrease in extinction caused by the NADH consumption is measured at 340 nm for 20 minutes.
  • Racemase unit defined as 1 ⁇ mol D-alanine, which is formed per minute. The formation of D-alanine is equimolar to the consumption of NADH.
  • alanine racemase has a share of about 10% (about 0.4 mg).
  • These 0.4 mg alanine racemase have an activity of 2.5 enzyme units, which corresponds to a 1000-fold enrichment of the enzyme activity, based on the crude extract. All steps were carried out between 0 ° C and 4 ° C. All column chromatography Separations were carried out on an FPLC system (from Pharmacia).
  • the nucleic acids were precipitated by adding a polyethyleneimine solution (12% in water; dialyzed to remove the low molecular weight constituents) to a final concentration of 0.1%.
  • the precipitate was removed by centrifugation at 17,000 g for 10 minutes. This clarified crude extract was called the polyethyleneimine supernatant.
  • the polyethyleneimine supernatant was added dropwise to 40% saturation of ammonium sulfate by dropwise addition of a 100% saturated ammonium sulfate solution in buffer B (0.1 M HEPES pH 7.5; 4 mM EDTA; 15 gv% glycerol; 4 mM DTT). After the addition had ended, stirring was continued for 30 minutes. The protein pellet was centrifuged at 32,000 g for 30 minutes, then dissolved in 500 ml of buffer B and dialyzed against 5 l of buffer B for 12 hours. Before the 4th step, the dialysate was diluted to twice the volume with buffer B and filtered through an 8 ⁇ glass fiber filter. The sample thus obtained was called the ammonium sulfate fraction. 4th step: Combination chromatography on the cation exchangers S-Sepharose and phosphocellulose Pl l:
  • the Pll pool was across a membrane with a separation limit at an M ,. concentrated from 30,000 (YM30 from Amicon) to 10 ml. Conditions: Ultrafiltration cell from Amicon, under N 2 gassing, maximum 5 bar, at 4 ° C.
  • Step 6 Gel permeation chromatography on Sephacryl S300-HR:
  • Sephacryl S300-HR was from Pharmacia: 2.6 x 95 cm.
  • the column was equilibrated in buffer D (50 mM Tris / HCl pH 8.2; 1 mM EDTA; 10 gv% glycerol; 4 mM OTT) with the addition of 0.2 M NaCl.
  • the calibration was carried out under the same buffer conditions using a BioRad GPC standard. Chromatography: flow rate 1 ml / min. The activity eluted at a volume of 268-302 ml. The sample thus obtained was referred to as the S300 pool.
  • Step 7 anion exchange chromatography on Mono-Q:
  • the MonoQ column HR5 / 5 was equilibrated by Pharmacia and in buffer D.
  • the S300 pool was cleaned in two portions using Mono-Q.
  • the sample was applied after dialysis against buffer D at a flow rate of 0.5 ml / min.
  • the main peak of racemase activity was 0.32 to 0.36 M NaCl.
  • a radioactive enzyme-specific labeling technique was used to correctly identify the protein band correlating with racemase activity.
  • the racemase-containing protein solutions after the last purification step on Mono-Q (0.2 mg total protein in 200 ⁇ l) were dialyzed against 20 mM KH 2 PO 4 buffer pH 7 for about 10 hours before labeling. The reduction was carried out in a total volume of 300 ⁇ l with 2 ⁇ l of a 10 mg / ml NaBH 4 solution in 0.2% NaOH and 3.7 MBq [ 3 H] -NaBH 4 (specific activity: 331 GBq / mmol; from NEN), also carried out in 0.2% NaOH at room temperature for three hours.
  • the batches were then dialyzed against 100 mM NH 4 HCO 3 for 12 hours with repeated buffer changes and evaporated to dryness in vacuo.
  • the pellets were taken up in 50 ⁇ l sample buffer for SDS-PAGE and boiled for 5 minutes.
  • the electrophoresis was carried out according to Lämmli (Lämmli 1970) in a 10% gel with subsequent Coomassie Blue staining.
  • the gel was then fixed for 30 minutes (in 25% isopropanol, 10% acetic acid, 2% glycerol) and then swirled in Amplify solution (from Amersham; with the addition of 2% glycerol) for 15 minutes.
  • the gel was dried and exposed to a Hyperfilm TM MP (Amersham) at -70 ° C for two to four weeks. This method clearly assigned the racemase activity to a protein band with an M. of 39,000.
  • the M r analysis was carried out on a TSK-3000-SWG 21.5 x 600 mm, with a TSK-SWG 21.5 x 75 mm guard column, on an HPLC system. Buffer: 0.2 M Tris / HCl pH 7.5; Flow rate: 5 ml / min.
  • the gel column was calibrated using the calibration proteins aldolase (M, 160,000), IgG (150,000), alkaline phosphatase (140,000), BSA (68,000), ovalbumin (45,000), carbonic anhydrase (30,000) and myoglobulin (18,800). An M was determined around 100,000.
  • Example 5 Amino acid sequences of alanine racemase:
  • the protein sample was subjected to SDS-PAGE (10%) in a Mini Protean II electrophoresis system (Bio Rad). After electrophoresis, the gel was equilibrated for 5 minutes in transfer buffer (10 mM CAPS (3- (cyclohexylamino) -l-propane sulfonic acid, Fluka), 10% methanol, pH 11.0 with sodium hydroxide solution).
  • transfer buffer 10 mM CAPS (3- (cyclohexylamino) -l-propane sulfonic acid, Fluka
  • 10% methanol pH 11.0 with sodium hydroxide solution
  • Eirie PVDF polyvinylidene difluoride membrane
  • the proteins were then transferred from the gel to the membrane in the Mini Trans-Blot cell (Bio Rad) within one hour at 200 mA.
  • the membrane was washed in water for 5 minutes, then stained in a 0.1% solution of Coomassie Blue R-250 (Serva) in 50% methanol for 2 minutes and decolorized in 50% methanol, 10% acetic acid until the protein bands became clear be identified.
  • the membrane was then washed with water, the bands containing alanine racemase (estimated amount of alanine racemase due to the color: 25 ⁇ g) were cut out and crushed into squares of approximately 1 mm in side length, which were dissolved in 1 ml of 0.2% PVP-40 (polyvinylpyrrolidone ( Sigma) solution was added in 100% methanol After incubation for one hour at 37 ° C.
  • PVP-40 polyvinylpyrrolidone
  • the membrane pieces were placed in 100 mM Tris-HCl buffer, pH 8.1 After adding 2 ⁇ g of the protease Lys-C (Boehringer Mannheim) was incubated at 37 ° C. After 20 hours of incubation, solid guanidine.HCl was added to a final concentration of 6 M. The protein was reduced by adding 300 ⁇ g DTT and 90 minutes incubation at 37 ° C.
  • the peptide mixture was applied to a 2.1 x 30 mm reversed phase column (Aquapore RP-300, 7 ⁇ m, Brownlee) and separated in a Model 130A HPLC system from Applied Biosystems.
  • the peptides were separated by eluting the column with a gradient of 0.1% trifluoroacetic acid in water against 70% acetonitrile (containing 0.075% trifluoroacetic acid), the gradient increasing from 0% to 60% in 20 minutes and from 60% in a further 10 minutes Was driven 100%.
  • the eluting peptides were collected and their amino acid sequence was determined on a 470A gas phase sequencer (Applied Biosystems) in accordance with the device manufacturer's instructions: as 1750: AWADEQEIAIHIDGARIW
  • Example 6 Isolation of high molecular genomic DNA from Totvoocladium niveum
  • Protoplasts were produced as described in Example 18. About 10 9 protoplasts were carefully lysed in 2 ml TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) 0.1 mg / ml RNase A was added and incubated at 37 ° C for 20 min. After adding 0.5% SDS and 0.1 mg / ml Proteinase K, the mixture was incubated at 55 ° C. for a further 40 min. The mixture was extracted very gently twice with TE-saturated phenol, phenol / chloroform (1: 1) and chloroform / isoamyl alcohol (24: 1) (Maniatis et al., 1982).
  • the aqueous, slightly viscous supernatant was mixed with a tenth volume of 3 M sodium acetate (pH 5.2), covered with 2.5 times the volume of absolute, -20 ° C cold ethanol and the DNA in the form of fine threads was wound on the phase boundary using glass rods.
  • the DNA was dissolved in 3 ml of TE for at least 20 h. Depending on the quality of the protoplasts, approx. 500 ⁇ g / ml DNA was obtained.
  • FIGE (0.8% agarose, 0.5 x TBE (Maniatis et al. 1982), 6 V / cm, forward pulse 0.2 to 3 sec, pulse ratio 3.0, running time 5 h) showed a size of more than 150 kb.
  • Example 7 Construction of a genomic lambda library from Tolypocladium niveum
  • Lambda DASH II (Stratagene) was used as the cloning vector. After restriction of the vector with -B ⁇ mHI and HindIII, the two vector arms were prepared as indicated by Sambrook et al. (1989). 1 ⁇ g of this was mixed with approx. 500 ng of the DNA fragments in 20 ⁇ l ligation mix (Tris-HCl 66 mM, MgCl 2 5 mM, DTE 1 mM, ATP 1 mM, pH 7.5) with 16 units of T4 DNA ligase (Fa. Boehringer Mannheim) ligated at 12 ° C for 16 h.
  • each of the batch were packed with packaging extracts (Gigapak II, Stratagene) in lambda phage casings.
  • E.coli SRB (Stratagene) was used as the host strain for the infection; the bacteriophage lambda-competent cells were produced according to Sambrook et al. (1989). After infection, the batches were plated in aliquots on LB medium (Maniatis et al., 1982) with 10 mM MgSO 4 , and E.coli SRB was again used as the indicator strain. Recombinant clones were identified as plaques in the bacterial lawn.
  • Example 8 Construction of a genomic cosmid library from Tolypocladium niveum
  • SCos 1 (Stratagene) was used as the cloning vector.
  • the BamTR and Xbäl cut vector arms were made and modified as indicated by Evans et al (1989). 1 ⁇ g of this was ligated with approx. 500 ng of the DNA fragments and packed in lambda phage casings.
  • E.coli SRB (Stratagene) was used as the host strain for the infection. After infection, the batches were plated in aliquots on LB medium with 75 ⁇ g / ml ampicillin. Recombinant clones were recognizable as colonies after 20 h at 37 ° C.
  • the following DNA sequence could be derived from the partial amino acid sequence asl750 of alanine racemase (Example 5) by reverse translation using the universal genetic code:
  • Oligo R14 Length: 23mer 64-fold degenerate GC GAT TTC TTG TTC ATC AGC CCA - 3 'CCCGC
  • each of these oligonucleotide mixtures were gamma-coated in 20 ⁇ l buffer (50 mM Tris-Cl pH 7.6, 10 mM MgCl 2 , 5 M dithiothreitol, 0.1 mM spermidine HC1, 0.1 mM EDTA (pH 8)) with 50 ⁇ Ci 32 P-ATP (6000 Ci / mmol) and 8 units of T4 polynucleotide kinase (from Boehringer Mannheim) radioactively labeled for 45 min at 37 ° C. More than 80% of the radioactivity was incorporated into the oligonucleotides.
  • the membranes were washed for 5 min and 30 min in 6 x SSC (Maniatis et al., 1982) at 4 ° C. The membranes were then washed for 5 min at room temperature in a tetramethylammonium chloride (TMAC) washing solution (3.00 M TMAC, 50 mM Tris (pH 8.0), 2 mM EDTA, 0.1% SDS) (Wood et al., 1985). Finally, it was washed twice in TMAC washing solution at the stringent temperature of 56 ° C. for 40 minutes. The membranes were sealed in foil and exposed to Kodak intensifying foil on X-ray film (XOmatik AR, Kodak) for 14 days at -70 ° C.
  • XO Kodak intensifying foil on X-ray film
  • Example 10 Isolation of lambda clones using an alanine racemase-specific
  • SM buffer 5.8 g / 1 NaCl, 2 g / 1 MgSO 4 x7H 2 0, 50 mM Tris-Cl pH 7.5.
  • a suitable dilution was plated again with E. coli SRB on LB medium with 10 mM MgSO 4 and the plaques were transferred again to membranes.
  • the positive clones were purified by renewed hybridization and subsequently by a third round of hybridization carried out analogously.
  • Example 12 Isolation of the GAPD ⁇ gene from Tolypocladium niveum
  • the approximately 4 kb S ⁇ / I fragment was eluted from a 0.8% agarose gel (Geneclean II, BiolOl) and radioactively labeled with alpha- 32 P-dATP using nick translation (Sambrook et al. 1989).
  • the screening of the cosmid bank was carried out under the same hybridization and washing conditions. One positive colony was found for every 600 colonies tested. A colony was purified and the cosmid DNA isolated from it. The cosmid obtained was called gpdcosl.
  • the inserted genomic Tolypocladium niveum DNA was determined to be approximately 36 kb by restriction digestion. Restriction fragments containing parts of the GAPDH structural gene were identified by hybridizing Southern blots with the screening probe. An approximately 2.2 kb S ⁇ cl restriction fragment gave a clear signal; this corresponded to the fragment size in the Southern hybridizations with genomic DNA. The fragment was cloned into the plasmid vector pUC18 (from Boehringer Mannheim).
  • gpdcosl DNA were completely cut with Sacl and the 2.2 kb Sacl fragment was eluted from a 0.7% agarose gel.
  • the plasmid vector pUC18 was also restricted with Sacl and treated with alkaline phosphatase from calf intestine (from Boehringer Mannheim) according to the manufacturer's instructions. Approx. 200 ng of purified S ⁇ cl fragment from gpdcosl and pUC18 were ligated with 1 unit of T4 DNA ligase. After transformation into E. coli HB101, the corresponding plasmid was isolated. It was called pGTl and characterized by restriction analysis; a restriction map is shown in Figure 9.
  • nucleotide sequence of the entire S ⁇ cl fragment was also determined using the Sanger method (Sanger et al., 1977) using Sequenase (USB). The sequence is shown in Figure 10 and comprises 2271 nucleotides).
  • Example 13 Isolation of cDNA clones of the GAPDH gene from Tolypocladium niveum
  • RNA was first isolated as described in Example 17.
  • the poly (A + ) RNA was enriched by an oligo (dT) cell cellulose affinity chromatography as described in Maniatis et al. (1982).
  • the crude RNA was dissolved in water after centrifugation and drying.
  • fractions containing poly (A + ) RNA were again precipitated with ethanol and stored at -70 ° C.
  • the integrity of the RNA was checked by gel electrophoresis in the presence of formaldehyde, the concentration was determined by UV absorption.
  • RNA 5 ⁇ g of the poly (A + ) RNA were converted into a complementary single-stranded DNA using reverse transcriptase and an oligo (dT) primer in the presence of the four deoxynucleoside triphosphates.
  • a double-stranded molecule was synthesized from it by the enzymes RNaseH and DNA polymerase (Sambrook et al., 1989). After the enzymatic addition of suitable EcoRI adapters, for which polynucleotide kinase and T4-DNA ligase were used, a linear double-stranded cDNA was obtained which could be incorporated into cloning vectors.
  • a cDNA synthesis kit (from Pharmacia) which contained the necessary enzymes and the adapter oligonucleotide was used for these reactions. The reactions were carried out according to the manufacturer's instructions.
  • the synthesized cDNA was cloned into the vector ⁇ gtlO (Sambrook et al., 1989). 80 ⁇ l of the cDNA preparation were mixed with 16 ⁇ l ⁇ gtlO-DNA (8 ⁇ g), which had previously been cleaved with EcoRI and treated with alkaline phosphatase. After adding 3 ⁇ l of 3M sodium acetate (pH 5.2), the DNA was precipitated with ethanol.
  • the DNA was then ligated in 30 mM Tris-Cl pH 7.5, 10 mM MgCl 2 , 10 mM DT ⁇ , 2.5 mM ATP after addition of 0.5 U T4 DNA ligase for 16 h at 16 ° C. (DNA Concentration 500 ⁇ g / ml).
  • the ligation mixture was packaged in vitro using protein extracts.
  • the resulting ⁇ -lysates were titled with E. coli C ⁇ OOhfl (Promega Inc.). About 4.5xl0 5 pfu were obtained.
  • the 665 bp HindIII-HindIII restriction fragment from the plasmid pGTl was used as the probe for the screning.
  • the filters were washed 2 x 10 min in 2 x SSC / 0.1% SDS at 25 ° C and 2 x 45 min in 1 x SSC / 0.1% SDS at 60 ° C.
  • the membrane was exposed for 14 hours on X-ray film (Xomatic AR, Kodak). kidney. 2.5 to 3.5% of all plaques showed a strong signal.
  • Single-stranded DNA was produced using the M13 clones and sequenced from both ends using the Sanger dideoxynucleotide method (Sanger et al., 1977). It was found that the insert from clone M13GT4 has a 33 bp polyA region, with clone M13GT5 2 bp at the 5 'end and 20 bp at the 3' end were missing, as well as the polyA region.
  • a restriction map of the apparently complete cDNA clone pGT4 is shown in Figure 11. The entire nucleotide sequence of the cDNA was determined; it comprised 1333 nucleotides without adapter molecules and is shown in Figure 12.
  • Example 14 Isolation of the promoter region of the GAPDH gene from Tolypocladium niveum
  • the complete nucleotide sequence of the insert was determined using the Sanger method (Sanger et al., 1977). It is shown in Figure 13 and corresponds to the sequence region from bp 1 to 1278 in Figure 14.
  • the comparison of the genomic sequence of the entire present promoter and structural gene region with the cDNA- Sequence showed the location of two introns ( Figure 14). The first lies in the 5 'untranslated region from pos. 550 to 664 (115 bp), the second much longer intron lies in the actual structural gene and was located at pos. 802 to 1218 (417 bp).
  • the translation of the cDNA sequence resulted in a 338 amino acid primary sequence of GAPDH from Tolypocladium niveum with a derived molecular weight of 36121.
  • Example 15 Determination of partial sequences of the alanine racemase gene
  • the assembled nucleotide sequence of the approximately 1.1 kb Pstl insert in pRPl, the approximately 1.9 kb EcoRI-SalI fragment from pRP6, the approximately 650 bp Pstl HindIII fragment from pRP9, and additionally 511 bp following the Hindlü site is shown in Figure 5 and comprises 3973 nucleotides.
  • the sequencing was carried out according to the modified dideoxynucleotide method using Sequenase (United States Biochemical) according to the manufacturer's instructions.
  • the region of the amino acid partial sequence as 1750 which also served to derive the screening probe, can be found from item 2557 to item 2610 of FIG. 5:
  • GCT TGG GCT GAC GAG CAG GAG ATC GCC ATT CAC ATC GAC GGT GCG CGG ATA TGG
  • Example 17 Isolation of RNA from the mycelium of Tolypocladium niveum
  • RNA was isolated from about 6 g of mycelium moist mass; For this purpose, the mycelium was centrifuged off, washed with 40 ml of TE (10 mM Tris-Cl, 1 mM EDTA, pH 7.5) and ground into a fine powder in a friction bowl under liquid nitrogen. RNA isolation was carried out using the slightly modified method of Chomczynski and Sacchi (1987). For this purpose, 1 g of wet mycelium was worked up with 20 ml of RNAzol (from Biomedica) according to the manufacturer's instructions. About 0.7 mg of RNA were obtained per 1 g of moist mycelium, which were stored at -20 ° C.
  • RNA 10 ⁇ g were made up a 1% agarose gel containing 0.6 M formaldehyde, according to the Sambrook et al. (1989) method described. The samples were heated to 95 ° C. for 2 min and separated at constant 70 V for 2.5 h. The gel was shaken three times for 20 min in 2 x SSC, blotted on Duralon UV membranes (from Stratagene) by means of a vacuum and fixed by UV treatment.
  • the 1078 bp Pstl restriction fragment from the plasmid pRPL was used as the hybridization probe, and the 665 bp Hindlll-Hindll restriction fragment from the plasmid pGTl (Example 12) was used as the hybridization probe for the GAPDH gene.
  • DNA For this purpose, about 10 ⁇ g of DNA were cut from the plasmids with the corresponding restriction enzymes (Boehringer Mannheim) according to the manufacturer's instructions and the corresponding restriction fragment from a 0.8% agarose gel by means of adsorption on glass beads (Geneclean II, BiolOl ) isolated. After labeling with alpha- 32 P-dATP via random primer polymerization (from Stratagene), the fragment was used for hybridization.
  • the corresponding restriction enzymes Boehringer Mannheim
  • the pre-hybridization was 20 h, the hybridization 18 h at 42 ° C in 6 x SSC, 50% formamide, 5 x Denhardt's (Maniatis et al., 1982), 0.1% SDS, 0.25 mg / ml denatured herring sperm DNA, 25 mM NaH 2 P ⁇ 4 pH 6.5 carried out in a volume of 10 ml per 100 cm 2 membrane.
  • the blot was washed twice for 10 min with 2 x SSC / 0.1% SDS at 25 ° C and twice for 30 min with 0.5 x SSC / 0.1% SDS at 60 ° C.
  • Example 18 Protoplasting of Tolypocladium niveum
  • the mycelium was harvested by centrifugation (Beckman centrifuge J2-21, rotor JA 14, 8000 rpm, 20 ° C, 5 min), in 40 ml TPS (NaCl 0.6 M, KH 2 PO 4 / Na ⁇ O, 66 mM pH 6.2) washed and the pellet volume measured by centrifugation in calibrated tubes at 2000 g (in Beckman centrifuge GPR, rotor GH3.7, 3000 rpm, 5 min).
  • the mycelium was suspended in TPS (3 ml TPS was used for each 1 ml pellet volume) and the same volume of protoplasting solution was added (Novozym 234 10 mg / ml (Novo Industri, Batch PPM-2415), cytohelicase 5 mg / ml (Fa. IBF), Zymolyase 20T 1 mg / ml (Seikagaku Kogyo, C.No. 120491) in TPS). It was incubated at 27 ° C. and 80 rpm for approx. 60 min. The protoplasts were filtered through milk filters, centrifuged (700 g, 10 min) and taken up in a total of 4 ml TPS.
  • the protoplast suspension from Example 18 was centrifuged off (700 g, 10 min) and suspended in 1 M sorbitol, 50 mM CaCl 2 at a density of 1 ⁇ 10 8 .
  • 90 ⁇ l of this suspension were mixed with 10 ⁇ l of the vector DNA to be transformed (1-10 ⁇ g, dissolved in Tris-HCl 10 mM, EDTA 1 mM, pH 8.0) and 25 ⁇ l PEG 6000 solution (25% PEG 6000 , 50 mM CaCl 2 , 10 mM Tris-HCl, pH 7.5, freshly prepared from the stock solutions: 60% PEG 6000 (Fa.BDH), 250 mM Tris-HCl pH 7.5, 250 mM CaCl 2 ).
  • the transformation mixture was placed on ice for 20 min and then a further 500 ⁇ l of the mixed PEG 6000 solution were added and mixed thoroughly. After 5 minutes at room temperature, 1 ml of 0.9 M NaCl, 50 mM CaCl 2 was added, the whole batch was added to 7 ml of melted soft agar of the corresponding selection medium and heated to 45 ° C. and poured onto appropriate, preheated plates.
  • the vector DNA to be transformed contains the amdS gene from Aspergillus nidulans, for example plasmid p3SR2 (Hynes et al., 1983), the entire batch was converted into 7 ml of soft agar TMMAAC + which was heated to 45 ° C.
  • TMMAAC + N contains glucose 6 g / 1, KH 2 PO 4 3 g 1, KC1 0.5 g / 1, MgSO 4 * 7 H 2 O 0.4 g / 1, CaCl 2 * 2 H 2 O 0.2 g / 1, acrylamide 8 mM, CsCl 2.1 g / 1, trace element solution 1 ml / 1, 0.6 M NaCl; for plates 15 g / 1 for white chagar 7 g / 1 agar agar (Merck) added
  • the trace element solution contains 1 mg / ml FeSO 4 * 7 H 2 O, 9 mg / ml ZnSO 4 * 7 H 2 O, 0.4 mg / ml CuSO 4 * 5 H 2 O, 0.1 mg / ml MnSO 4 * H 2 O, 0.1 mg / ml H 3 BO 3 and 0.1 mg / ml Na 2 MoO 4 * H 2 O.
  • TM88-NaCl soft agar (20 g / 1 malt extract, 4 g / 1 yeast extract, 10 g / 1 Bacto agar, 0.6 M NaCl, pH 5.7) (45 ° C) and placed on TM88-NaCl plates (approx. 20 ml TM88-NaCl agar: 20 g / 1 malt extract, 4 g / 1 yeast extract, 30 g / 1 Bacto agar, 0.6 M NaCl, pH 5.7) poured out.
  • oligonucleotides were derived and synthesized based on the determined nucleotide sequence of the GAPDH gene (see Example 14):
  • P3 corresponds from its position 5 to 29 to the region from position 1 to 25 of the nucleotide sequence of Figure 14 of the GAPDH gene, ie it contains the natural Xh ⁇ interface (CTCGAG);
  • P4 corresponds to the range from pos. 670 to 650 (complementary to the sequence of the GAPDH gene).
  • the first 12 nucleotides of P4 contain the recognition sites for the restriction enzymes Ncol (CCATGG) and BamYR (GGATCC). With the aid of these primers, the region lying between the primers was amplified from the genomic DNA of Tolypocladium niveum (35 cycles: 2 min 95 ° C., 1 min 20 sec 56 ° C., 1 min 20 sec 72 ° C.).
  • the DNA fragment of approximately 680 bp in size was cut after the chloroform extraction and ethanol precipitation with the restriction endonucleases Bam ⁇ T and Xh ⁇ l (after Information from the manufacturer, Boehringer Mannheim) and incorporated into the likewise prepared plasmid vector DNA pBluescriptII SK + (from Stratagene) according to standard methods.
  • the resulting plasmid was called pGT12 and is shown in FIG. 16.
  • the following oligonucleotides were derived and synthesized analogously from the nucleotide sequence of the GAPDH gene:
  • Items 10 to 28 of primer P8 correspond to items 2301 to 2319 in Figure 14, items 4 to 11 contain a recognition site for the restriction enzyme Notl (GCGGCCGC). Items 9 to 28 of primer P9 correspond to the complementary strand of items 2855 to 2838 in Figure 14, items 3 to 8 represent the recognition site for the enzyme Kspl (CCGCGG).
  • the primers close the range of the suspected Termination area of the GAPDH gene. With their help, as described above, the corresponding DNA fragment was amplified from the genomic DNA from Tolypocladium niveum * The corresponding DNA fragment was amplified from the genomic DNA from Tolypocladium niveum.
  • DNA of the plasmid pMAT5 (Mohr, 1988) was completely cut with the enzyme -B ⁇ mHI (according to the manufacturer, Boehringer Mannheim) and the approximately 1.1 kb DNA fragment was prepared from the agarose gel after electrophoresis.
  • the plasmid pGT14 was also cut with BamHl and treated with calf intestine using alkaline phosphatase (according to the manufacturer, Boehringer Mannheim).
  • the approximately 1.1 kb large jB ⁇ «HI fragment from pMAT5 was ligated in according to standard methods, transformed into E. coli XLl-Blue (Stratagene) and the plasmid DNA of some resulting clones was isolated.
  • the resulting vector plasmid was named pGT24.
  • pGT24 contains the hygromycin resistance gene in the correct orientation to the GAPDH promoter and is in Figure 8 shown.
  • Plasmid pGT24 used, which contains the hygromycin resistance gene under the control of the Tolypocladium niveum GAPDH gene. Together with this DNA, equimolar amounts of pRP12 DNA were also used in the same transformation approach. These cotransformations were carried out according to the method described in Example 19, using Tolypocladium niveum ATCC 34921 as the starting strain.
  • Genomic DNA from hygromycin-resistant transformants was isolated using a rapid method. For this purpose, the mycelium was removed from an area of approximately 1 cm 2 in the corresponding colony and transferred to ⁇ ppendorf homogenizers. 1 ml of lysis buffer (50 M EDTA, 0.2% SDS) and 100 mg of aluminum oxide (type A%, from Sigma) were added and homogenized well for about 5 minutes. After centrifugation (5 min, 11,000 rpm), the supernatant was extracted once with tris-saturated phenol, phenol / chloroform (1: 1) and chloroform / isoamyl alcohol (24: 1) and the DNA was precipitated with isopropanol according to the standard procedure ( Sambrook et al., 1989).
  • the DNA was completely restricted with the restriction enzyme SaR, separated by gel electrophoresis and examined in Southern hybridizations.
  • the 0.8% agarose gel was transferred to a nylon membrane (Duralon-UV, from Stratagene) by means of vacuum blotting (Vacublot, from Pharmacia) and fixed by UV.
  • the pre-hybridization was carried out for approx. 8-16 h at 42 ° C in 6 x SSC, 50% formamide, 5 x Denhardt's (Maniatis et al., 1982), 0.1% SDS, 0.25 mg / ml denatured herring sperm DNA, 25 mM NaH 2 PO 4 pH 6.5 carried out in a volume of 10 ml per 100 cm 2 membrane.
  • the mixture was incubated at 42 ° C. for a further 16-20 h.
  • the blot was washed twice for 10 min with 2 x SSC / 0.1% SDS at 25 ° C and twice for 30 min with 0.5 x SSC / 0.1% SDS at 60 ° C.
  • the transformation vector pGT24 was used. Together with this DNA, equimolar amounts of lambda RAC4 (example 10) were also used in the same transformation approach. Tolypocladium niveum ATCC 34921 was used as the starting strain for these cotransformations.
  • Genomic DNA from hygromycin resistant transformants was isolated and examined by Southern hybridizations as described in Example 21.
  • restriction fragments of the Lambda DASH II gene bank vector were labeled with alpha 32 P dATP by "random primer” labeling (from Stratagene).
  • Some of the examined DNAs showed hybridization signals which are due to integration of Lambda RAC4.
  • Transformant strains verified in this way were examined in a test fermentation in a shake flask for cyclosporin A formation, as described by Dreyfuss et al. (1976). While in the experiment carried out in parallel with the non-transformed starting strain Tolypocladium niveum ATCC 34921 approx.
  • Example 23 Preparation of 8-D-serine cyclosporin A by strains with a destroyed gene for the alanine racemase
  • CyA cyclosporin A
  • DSA 8-D-serine cyclosporin A.
  • DNA of the plasmid pGT24 was used for the transformation as described in Example 19. As a result, obtained hygromycin-resistant Tolypocladium m 'vewm colonies numerous. This confirmed that the gene incorporated into the expression vector pGT14 (hygromycin resistance gene from E. coli) was expressed efficiently. By isolating the DNA of such transformants, restricting the DNA, for example using ⁇ mHI, electrophoresis and blotting on nylon membranes (according to standard techniques, Sambrook et al., 1989), hybridization with the approximately 1.1 kb - ⁇ mHI fragment was able to confirm that the Plasmid pGT24 is present one or more times in the genome.
  • Example 25 Construction of the vector pGT30
  • Positions 9 to 29 of this oligonucleotide are complementary to the sequence shown in Figure 13 (positions 652 to 672); it therefore covers the area immediately before the start codon.
  • the first eight positions correspond to a C / ⁇ l recognition region (ATCGAT).
  • a second oligonucleotide has the sequence:
  • the first eight nucleotides contain a Spel recognition region.
  • 20 ng of DNA from Tolypocladium niveum was amplified with the oligonucleotides described above (Sambrook et al., 1989): 30 cycles: 1 min 30 sec 94 ° C.; 2 min 30 sec 55 ° C; 6 min 72 ° C.
  • a DNA of approximately 620 bp was produced. After chloroform extraction, this DNA was purified by ultrafiltration (Ultrafree MC 100,000; Millipore) and cleaved in the appropriate buffer with the Spei and Clal enzymes.
  • the plasmid pGT30 can be used to transform Tolypocladium niveum, as described in Example 19. DNA from such transformants was cleaved with -B ⁇ mHI and blotted onto a nylon membrane after gel electrophoresis. The 0.6 kb Spe / -C / ⁇ / fragment from pGT30 was used as the radioactive probe. In this way, transformants can be identified in which the plasmid pGT30 is integrated one or more times in the genome.
  • Example 27 Sequencing of cDNA and localization of the structural gene
  • RNA was therefore isolated and checked for the presence of the alanine racemase transcript by Northern hybridization (see example 17).
  • the first strand synthesis was carried out using an adapter primer (5'-GGCCACGCGTCGACT (T) 17 ) (from GIBCO BRL) and then with the primers S 11 (5'-ATTGGGGAGATCCCACTCTC, items 1990 - 2009, ( Figure 20)) and PRP8 / 6 (5'-ACCGCAAAGGACTTTGACTTGCCT, pos.
  • Isolated RNA was used to carry out 5'-RACE experiments using a kit (from GIBCO BRL).
  • the oligonucleotide 5 '-CUACUACUACÜAGGCCACGCGTCGACTAGTACGGGIIGGG ⁇ GG-GIIG was used as the "anchor primer”.
  • S7 (5'-CTCGTCAGCCCAAGCCTT, items 2571 - 2554 ( Figure 20)) and S10 (5'-ACAACAAACAGAGCTGCTTC, items 2261 - 2243 ( Figure 20)) were used as gene-specific primers.
  • the fragments obtained were cloned into the plasmid vector pGEM-T (from PROMEGA) and sequenced. A total of 32 independent clones were characterized.
  • Figure 20 shows the sequence of the alanine racemase gene region.
  • the first ORF methionine codon is at item 1953. However, this is also the only Met codon that can be used on the sequenced transcript, since the partial sequence was found 9 codons later than 1753. After splicing the intron, there is a continuous open reading frame that ends at item 3178. It contains 383 codons (amino acid sequence see Figure 20).
  • the molecular weight of the derived protein is 41002 Da.
  • Cannon P.F . International Commission on the taxonomy of fungi (ICTF): name changes in fungi of microbiological, industrial and medical importance. Part 2. Microbiological Sciences 3 No. 9 (1986) 285-287.
  • Esaki N. and Walsh C Biosynthetic alanine racemase of Salmonella typhimurium: Purification and characterization of the enzyme encoded by the alr gene. Biochemistry 25 (1986) 3261-3267.
  • Hynes M.J., Corrick CM. and King J.A . Isolation of genomic clones containing the amdS gene of Aspergillus nidulans and their use in the analysis of structural and regulatory mutations. Molec.Cell.Biol. 3 (1983) 1430-1439.
  • Kück U., Walz M., Mohr G. and Mracek M . The 5 '-sequence of the isopenicillin N- synthetase gene (pcbC) from Cephalosporium acremonium directs the expression of the prokaryotic hygromycin B phosphotransferase gene (hph) in Aspergillus niger Appl.Microbio Biotechnol. 31: 358-365 (1989).
  • Pfitzner A Cloning of two glycolysis genes from Penicillium chrysogenum. Dissertation Technical University Vienna (1989).
  • Cyclosporin synthetase is a 1.4 MDa multienzyme polypeptide. FEBS Letters 307 (1992) 355-360.
  • Ciclosporin (Borel JF, ed., series Progress in Allergy, Ishizaka K., Lachmann PJ, Kall ⁇ s P. and Waksman BH, eds.), Karger Verlag 1986, 28- 45.
  • Wood W.I., Gitschier J., Lasky L.A. and Lawn R.M . Base composition-independent hybridization in tetramethylammonium Chloride: A method for oligonucleotide screening of highly complex libraries. Proc.Natl.Acad.Sci. USA 82 (1985) 1585.
  • FIGE Feldin version gel electrophoresis

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Die Erfindung betrifft Nukleotid-Sequenzen die für Enzyme kodieren, die eine Alanin Racemase Aktivität besitzen und Methoden zur Herstellung von Alanin Racemase, die diese Sequenzen benützen. Die Erfindung betrifft auch Methoden zur Herstellung von Cyclosporin und Cyclosporin-Derivate. Ferner ist die Erfindung auf neue DNA-Fragmente mit einem Teil oder dem ganzen Gen für die Glycerinaldehyd-3-phosphatdehydrogenase (GAPDH) aus Tolypocladium niveum, dessen Promotor- und Terminations-Region, sowie deren Verwendung gerichtet. In einem anderen Aspekt bezieht sich die Erfindung auch auf neue Vektoren und Zellen, die mit diesen Vektoren transformiert wurden.

Description

REKOMBINANTE ALANIN RACEMASE UND GAPDH AUS TOLYPOCLADIUM NIVEUM
Die Erfindung betrifft Nukleotid-Sequenzen, die für Enzyme kodieren, die eine Alanin Racemase Aktivität besitzen und Methoden zur Herstellung von Alanin Racemase, die diese Sequenzen benützen. Die Erfindung betrifft auch Methoden zur Herstellung von Cyclosporin und Cyclosporin-Derivaten. Weiterhin betrifft die vorliegende Erfindung neue DNA- Fragmente mit einem Teil oder dem ganzen Gen für die Glycerinaldehyd-3-phosphat- dehydrogenase (GAPDH) aus Tolypocladium niveum, dessen Promotor- und Terminations-Re- gion, sowie deren Verwendung. In einem anderen Aspekt bezieht sich die Erfindung auch auf neue Vektoren und Zellen, die mit diesen Vektoren transformiert wurden. Der Pilz Tolypocladium niveum ist mikrobiologisch in die Klasse der imperfekten Pilze ein- zuorden und ist besonders wegen seiner Fähigkeit, Cyclosporine zu bilden von biotechnologi¬ schem Interesse (Dreyfuss et al., 1976). Als Cyclosporine wird eine Klasse von zyklischen Undekapeptiden, die aus hydrophoben, aliphatischen Aminosäuren aufgebaut sind, bezeichnet. Diese Substanzen zeigen vielfältige biologische Effekte: der Hauptmetabolit Cyclosporin A wird aufgrund seiner immunsuppressiven Wirkung als wichtigstes Medikament zur Verhinderung von Organabstoßungen nach Transplantation eingesetzt. Dementsprechend ist die Entwicklung geeigneter Techniken zur genetischen Manipulation dieses und verwandter Organismen, die Cyclosporine produzieren, oder die einen Einfluss auf die Cyclosporinproduktion besitzen, von großer Bedeutung. Dabei kann eine solche Technik nicht nur zur Steigerung der Produktion bekannter Cyclosporine, sondern auch zur Produktion neuer Wirkstoffe oder anderer Substanzen beitragen. Speziell die regulatorischen Bereiche des GAPDH-Gens, wie der Promoterbereich, können bekanntlich zur effektiven Transkription verschiedener Gene verwendet werden und sind daher bedeutend für deren starke Expression.
Mit der Entwicklung der Gentechnologie wurde in den letzten Jahren die biotechnologische Produktion zahlreicher Polypeptide mittels rekombinanter DNA möglich. Zwei der Voraussetzungen dafür sind einerseits das entsprechende Gen, dessen Produkt hergestellt werden soll, und andererseits geeignete DNA-Konstruktionen durch deren Hilfe das Gen möglichst effizient in der entsprechenden Wirtszelle exprimiert wird.
Die Biosynthese der Cyclosporine erfolgt, wie auch für andere Peptid-Antibiotika beschrieben, nach dem nicht-ribosomalen Thiotemplate-Mechanismus (Kleinkauf und von Döhren, 1990). Bemerkenswert ist, daß die gesamte Biosynthese von einem Multienzym gesteuert wird, welches aus einer einzigen Polypeptidkette besteht und Cyclosporin Synthetase genannt wird. Dieses Enzym wurde biochemisch gereinigt und charakterisiert (Schmidt et al., 1992).
Cyclosporin A enthält drei nicht proteinogene Aminosäuren: D-Alanin in Position 8, α- Aminobuttersäure in Position 3 und die ungewöhnliche Aminosäure (4R)-4-[(E)-2-Butenyl]-4- Methyl-L-Threonin (Bmt) an Position 1. Solche nicht proteinogenen Aminosäuren sind charakteristische Bestandteile von Peptid-Antibiotika. In Bezug auf den Einbau von D- Aminosäuren wurde in den bisher untersuchten Peptidsynthetasen festgestellt, daß die L- Ami¬ nosäure vom Enzym aktiviert, das heißt, als Thioester gebunden, und dann direkt am Enzym epimerisiert wird.
Die Cyclosporin Synthetase besitzt im Gegensatz dazu keine integrale Epimerase-Funktion (Kleinkauf und von Döhren, 1990): sie muß D-Alanin als Baustein für die Biosynthese zugeführt bekommen. Tolypocladium niveum muß daher über eine Alanin Racemase verfügen. Da die Cyclosporin Biosynthese an der Position 8 mit der Aktivierung von D- Alanin startet (Lawen et al., 1992), kommt dieser Racemase eine Schlüsselfunktion im Biosynthese-Ablauf zu. Nachdem die Cyclosporin Synthetase in vitro durchaus in der Lage ist, an Position 8 auch andere Aminosäuren zu akzeptieren (Lawen et al., 1989), könnte die Inhibition der Racemase-Aktivität oder eine Veränderung der Spezifität in vivo einen neuen fermentativen Zugang zu Cyclosporinen mit Variation in der Position 8 eröffnen. Bemerkenswert ist auch, daß alle bisher beschriebenen Alanin Racemasen prokaryontischen Ursprungs sind. Die Hauptfunktion der prokaryontischen Alanin Racemasen besteht in der Bereitstellung von D-Alanin für die Zellwandsynthese. Die Hemmung dieser Enzyme als antibiotisches Prinzip wurde daher sehr intensiv untersucht (Thornberry et al., 1987). Alanin Racemase aus Tolypocladium niveum ist das erste Enzym dieser Klasse, welches aus einem eukaryontischen Organismus isoliert wurde.
In einem Aspekt bezieht sich die Erfindung auf eine isolierte Nukleotid-Sequenz die für ein eukaryontisches Enzym, oder ein Fragment davon, kodiert, das Alanin-Racemase Aktivität besitzt. In der vorliegenden Beschreibung ist ein Enzym, das Alanin Racemase Aktivität besitzt, ein Enzym, das D-Alanin oder L-Alanin in ein Gemisch beider Enantiomere überführt. Vorzugsweise, codiert die Nukleotid- Sequenz für Alanin Racemase aus Tolypocladium niveum ATCC 34921 oder für ein Enzym, das Alanin-Racemase Aktivität besitzt und zu mindestens 70% (zum Beispiel zu mindestens 80, 90 oder 95%) hierzu homolog ist. Dies soll bedeuten, dass die Erfindung neben der in Abbildung 5 angegebenen Nukleotid- Sequenz auch eine solche beinhaltet, die für Protein codiert, das im wesentlichen ähnliche Aktivität und/oder Funktion aufweist, wobei die Aminosäuresequenz zύmindestens zu 70% (zum
Beispiel zu mindestens 80, 90 oder 95%) solche Aminosäuren enthält, wie jene
Aminosäuresequenz, für die die in Abbildung 5 angegebene Nucleotid-Sequenz codiert, und wobei in der einen oder anderen Position Aminosäuren konservativ ausgetauscht sein können.
Folgender konservativer Austausch ist beispielsweise möglich:
(i) Alanin, Serin und Threonin;
(ii) Glutaminsäure und Asparaginsäure;
(iii) Arginin und Lysin;
(iv) Asparagin und Glutamin;
(v) Isoleucin, Leucin, Valin und Methionin;
(vi) Phenylalanin, Tyrosin und Tryptophan.
Betreffend mRNA sind die folgenden Codons synonym, das heisst sie codieren jeweils für die gleiche oder konservativ austauschbare Aminosäure: i) UUU, UUC, UAU und UCG; ii) UUA, UUG, CUU, CUC, CUA, CUG, AUU, AUC, AUA, GUU, GUC, GUA undOLQ iii) UCU, UCC, UCA, UCG, AGU, AGC, ACU, ACC, ACA, ACG, GCU, GCC, CGA und
GCG; iv) CCU, CCC, CCA und CCG; v) UAA, UAG,und UGA; vi) CAU und CAC; vii) CAA, CAG, AAU und AAC viii) AAA, AAG, CGU, CGC, CGA, CGG, AGA und AGG; ix) GAU, GAC, GAA und GAG; x) UGU und UGC; xi) AGU und AGC; xii) GGU, GGC, GGA und GGG. Betreffend die korrespondierende DNA Sequenz sind Triplets, die in den einzelnen, obigen Punkten angegeben sind, ebenfalls synonym. Nucleotidsequenzen, die für jenes Strukturgen codieren, das in der Abbildung 5 angegeben ist und in denen solche synonymen Triplets äquivalent enthalten sind, sind ebenfalls von der Erfindung umfasst.
Die vorliegende Beschreibung betrifft daher unter einem Aspekt neue DNA-Fragmente mit einem Teil oder dem ganzen Gen für die Alanin Racemase aus Tolypocladium niveum, dessen Promotor- und Terminationsregion, sowie deren Verwendung für die Stammverbesserung. In einem anderen Aspekt bezieht sich die Erfindung auch auf neue Nukleotid-Moleküle, Vektoren und Zellen, die mit diesen Vektoren transformiert wurden. Ebenso wird die Konstruktion von Stämmen beschrieben, die sich besonders gut für Verfahren zur Herstellung von modifizierten Cyclosporinen, welche an der Position 8 andere Aminosäuren als D- Alanin enthalten, eignen. In einem weiteren Aspekt betrifft die Erfindung einen Teil oder das ganze GAPDH-Gen aus Tolypocladium niveum, wobei mit "einem Teil" eine mindestens 70% (zum Beispiel zu mindestens 80, 90 oder 95%) hierzu homologe DNA Sequenz zu verstehen ist, die synonyme Triplets enthalten kann, wie oben für den Fall der Alanin Racemase beschrieben ist, gemeint ist, ferner dessen Promotor- und dessen Terminations-Region, für die die obigen Ausführungen betreffend" homologe DNA Sequenzen ebenfalls gelten, und deren Verwendung. Die Erfindung umfasst ferner auch solche Gene, deren Genprodukt mit Antikörpern gegen das ganze oder gegen Teile des, von den erfindungsgemässen Genen jeweils codierten, Proteins, gebunden oder immunoprezipitiert wird, sofern diese Genprodukte eine im wesentlichen ähnliche Funktion oder Wirksamkeit aufweisen. Ferner umfasst die Erfindung auch Nucleotidsequenzen, die den erfindungsgemässen Nucleotidsequenzen ähnlich sind. Mit "ähnlich" ist jeweils eine Testsequenz gemeint, die jeweils gegen eine der erfindungsgemässen Sequenzen hybridisieren kann. Bei doppelsträngigen Sequenzen können die Testsequenz und die erfindungsgemässe Sequenz einen TM-Unterschied von bis zu etwa 15°C besitzen. Die Hybridisierung wird unter stringenten Bedingungen ausgeführt, wobei entweder die Testsequenz oder eine der erfindungsgemässen Sequenzen auf einen Träger aufgebracht wird. Entweder eine denaturierte Test- oder eine der erfindungsgemässen Sequenzen wird somit erst an einen Träger gebunden, worauf die Hybridisierung gegen die jeweils andere Sequenz in angemessener Zeit und bei Temperaturen von etwa 35 bis 70"C in 2xSSC Puffer, der 0,1% SDS enthält, durchgeführt wird. Nachfolgend wird der Träger bei gleicher Temperatur mit einem Puffer reduzierter SSC Konzentration gewaschen. Abhängig von der erwünschten Stringenz und damit dem Grad der Ähnlichkeit der Sequenzen, sind solche Puffer im allgemeinen SSC Puffer mit einfacher Stärke, mit halber Stärke oder mit 1/10 Stärke (lxSSC, 0,5xSSC bzw. 0,lxSSC), enthaltend jeweils 0,1% SDS. Sequenzen mit höchsten Grad an Ähnlichkeit sind solche, deren Hybridisierung am wenigsten durch Waschen mit Puffer reduzierter Konzentration beeinflusst wird. Bevorzugt sind die Test- und die erfindungsgemässe Sequenz so ähnlich, dass die Hybridisierung durch Waschen mit oder Inkubieren in 0,lxSSC Puffer (0,1% SDS) im wesentlichen unbeeinflusst bleibt.
Von der Erfindung umfasst sind auch recombinante Nucleotidsequenzen, die gegenüber den erfindungsgemässen Sequenzen bezüglich eines oder mehrerer Codons modifiziert sind. Die Modifizierung erfolgt in einer Weise, dass die veränderten Codons der entsprechenden Aminosäure in jenem Organismus, in den die rekombinante Nucleotidsequenz eingebracht werden soll, begünstig zur Translation benutzt werden. Die Expression der modifizierten DNA im besagten Organismus liefert im wesentlichen ähnliches Protein, wie die unmodifizierte, rekombinante Nucleotidsequenz in jenem Organismus, in welchem die proteincodierenden Komponenten der rekombinanten Nucleotidsequenz endogen sind. Die Expression der erfindungsgemässen Gene kann beispielsweise verbessert werden durch (i) Mutation der nicht-codierenden Region 5' des heterologen Gens zur Erhöhung der RNA Polymerase-Bindung, (ii) Benützung von Konstruktionen, die mehrere Promotor Regionen aufweisen, die entweder aus derselben Quelle oder aus einer anderen, beispielsweise aus einem GAPDH-Gen, stammen, (iii) Einbringen starker Promotor in das Genom (vorzugsweise nicht-zufällig) zur Veranlassung der Expression autologer oder heterologer Gene. Beispiele für Tolypocladium niveum schließen Tolypocladium niveum ATCC 34921 und davon abgeleitete Stämme ein.
Die Alanin Racemase aus Tolypocladium niveum ist in der Literatur bisher nicht beschrieben worden. Um einen Zugang zu diesem Enzym zu finden, war es daher zunächst erforderlich, einen Aktivitätsnachweis zu entwickeln. Als Ausgangsbasis wurde die für prokaryontische Racemasen in der Literatur beschriebene NADH-Methode verwendet (Badet et al., 1984): das gebildete D-Alanin wird nachgewiesen, indem man es mit D-Aminosäureoxidase zu Pyruvat oxidiert; Pyruvat wird wiederum unter NADH- Verbrauch zu Lactat reduziert. Der Verbrauch an NADH ist equimolar zum gebildeten D-Alanin und wird durch die Abnahme der UV- Absorption bei 340 nm bestimmt. In der Literatur ist dieser Assay in seiner "gekoppelten" Form beschrieben, das heißt, alle genannten Reaktionen (Epimerisierung des Alanins, Oxidation zu Pyruvat und Reduktion zu Lactat) werden simultan durchgeführt. Diese Methode hat in nur grob angereicherten Enzymextrakten aus Tolypocladium niveum nur unzuverlässige Meßwerte geliefert. Aus diesem Grund wurden die Reaktionen entkoppelt: im ersten Teilschritt wurde die Epimerisierung des L-Alanins zum D-Alanin durchgeführt, und nach Hitzeinaktivierung der Enzyme wurde das gebildete D-Alanin in einem zweiten Teil¬ schritt zu Pyruvat und Lactat umgesetzt. Diese Entkopplung hat auch den Vorteil, daß die optimalen Bedingungen für die Epimerisierungsreaktion ohne Beeinflussung durch die nachfolgenden Reaktionen ermittelt werden können. Durch sorgfältige Optimierung der Reaktionsparameter (pH-Optimum, T-Optimum, Cofaktor-Bedarf, Oxidationsschutz) im ersten Teilschritt konnte damit eine hochempfindliche Nachweismethode für die Alanin Racemase aus Tolypocladium niveum etabliert werden, deren Prinzip (Entkopplung der Teilreaktionen) auch auf Alanin-Racemasen aus anderen Organismen angewendet werden kann. Als Enzymeinheit ist nach IUPAC-Nomenklatur jene Menge Protein definiert, die pro Minute 1 μmol L-Alanin zu D-Alanin epimerisiert.
Die Reinigung des Enzyms erfolgt nach üblichen Verfahren. Der. Zellaufschluß kann aus feuchten oder lyophilisierten Zellen durchgeführt werden. Liegen die Zellen feucht vor, kann ein Druckaufschluß, z.B. mit einer Manton Gaulin Apparatur oder mit einer French Press, oder ein Aufschluß mit einer Glaskugelmühle durchgeführt werden. Lyophilisierte Zellen werden dagegen zweckmäßigerweise durch Zermörsern unter flüssigem Stickstoff auf¬ geschlossen. Im Fall der Alanin Racemase lag das Mycel in feuchtem Zustand und in großen Mengen vor, so daß ein Druckaufschluß mit einer Manton Gaulin Apparatur am zweckmäßigsten war.
Dem Aufschluß folgen eine grobe Klärung des Rohextrakts durch mitteltourige Zentrifugation (um 10.000 g) und ein weiterer Klärungs schritt durch Präzipitation von Nukleinsäuren. Zur Präzipitation der Nukleinsäuren können alle dafür üblichen Reagentien eingesetzt werden, wie z.B. Polyethylenimin oder Protaminsulfat. Die geeignete Konzentration sollte für jede Pro¬ blemstellung neu erarbeitet werden. Für die Alanin Racemase wurde eine Endkonzentration von 0,1 % an Polyethylenimin eingesetzt. Die Alanin Racemase kann aus einem derart geklärten Rohextrakt durch die üblichen Methoden der Proteinreinigung angereichert werden. Als erste Stufe ist Aussalzen mit Ammoniumsulfat günstig, da dabei gleichzeitig das nach Mycel-Extraktion üblicherweise sehr große Volumen der Proteinlösung eingeengt werden kann. Im Anschluß daran können alle üblichen chromatografischen Verfahren zur Reinigung der Alanin Racemase herangezogen werden, wie z.B. Ionenaustausch-Chromatografie, Gelpermeations-Chromatografie, hydrophobe Interaktions-Chromatografie, Pseudoaffinitäts-Chromatografie an Farbstoff- Sepharosen, Chromatografie an anorganischen Trägermaterialien, wie z.B. Hydroxylapatit, und andere. Bei der Alanin Racemase kam nach der Ammoniumsulfatfällung als erstes ein Ionenaustauscherschritt an einer Säulenkombination aus S-Sepharose und Phosphozellulose zum Einsatz. Diese Kombination war deshalb günstig, da das Enzym unter gleichen Pufferbedingungen an S-Sepharose im Durchlauf war und an Phosphozellulose gebunden hat, obwohl beide Materialien vom Kationenaustauscher-Typ sind. Durch dieses Verhalten konnte ein sehr selektiver Reinigungseffekt erzielt werden. Im nächsten Schritt erfolgte eine Gelpermeations-Chromatografie an Sephacryl S300-HR. Als letzter Schritt erwies sich eine Anionenaustausch-Chromatografie an Mono-Q als besonders günstig, da an dieser Säule eine hohe Auflösung der Proteine erzielt werden kann, und die nach Gelpermeations- Chromatografie sehr verdünnte Probe hoch aufkonzentriert wird. Nach dieser Stufe war die spezifische Racemase- Aktivität gegenüber dem Rohextrakt etwa lOOOfach angereichert. An Farbstoff-Sepharosen oder an Hydrophob-Materialien konnte ohne hohe Verluste keine weitere Aufreinigung der Alanin Racemase mehr erzielt werden. Nach Mono-Q ist die Enzympräparation jedoch bereits sauber genug, um der Enzymaktivität die entsprechende Pro¬ teinbande zuzuordnen. Man trifft eine erste Zuordnung, in dem man den Verlauf der Enzymaktivität in den nacheinander von Mono-Q eluierenden Fraktionen mit dem Auftreten der einzelnen Proteinbanden in einem SDS-PAGE korreliert. Obwohl eine solche Zuordnung in vielen Fällen, wie auch am Beispiel der Alanin Racemase, getroffen werden kann, ist es von Vorteil, wenn man versucht, die Proteinbande anhand ihrer Aktivität direkt zu identifi¬ zieren.
Im Fall der Alanin Racemase wurde dazu eine radioaktive, enzymspezifische Markierungstechnik angewendet. Es ist bekannt, daß Aminosäure Racemasen als essentiellen Cofaktor Pyridoxylphosphat benötigen. Dieses Pyridoxalphosphat ist in Abwesenheit eines adäquaten Enzymsubstrats über eine Schiff sehe Base an die epsilon-Aminogruppe eines Lysins im aktiven Zentrum des Enzyms gebunden. Durch Reduktion mit NaBH4 läßt sich diese Schiff sehe Base zu einem sekundären Amin und damit zu einer kovalenten Bindung zwischen Enzym und Cofaktor reduzieren. Verwendet man für diese Reaktion tritiiertes NaBH4, so führt man gleichzeitig eine radioaktive Markierung am Enyzm ein, die nach SDS- PAGE und Trocknen des Gels durch Autoradiografie sichtbar gemacht werden kann. Mit dieser Methode lassen sich alle Pyridoxal-haltigen Enzyme nach entsprechender Anreicherung aus dem Rohextrakt eindeutig identifizieren, wie bereits für einige Racemasen publiziert wurde (Roise et al., 1984, Badet et al., 1984, Esaki und Walsh, 1986). Wie im Beispiel 3 beschrieben, ließ sich diese Methode auch auf die Alanin Racemase aus Tolypocladium niveum anwenden, was zur Identifizierung einer Proteinbande mit einer M→ von 39.000 führte. Das in der Erfindung entwickelte Reinigungsverfahren liefert eine etwa 10%ige Enzympräparation, in der die Racemase eindeutig identifiziert werden kann. Mit diesem Verfahren kann man aus ca. 5 kg Fermentationsbrei 4 mg Gesamtprotein gewinnen; der Anteil der Racemase beträgt demnach ca. 400 μg (2,5 Enzymeinheiten). Die Qualität dieser Präparation ist ausreichend, um alle wichtigen proteinchemischen Arbeiten, wie die Amino¬ säure-Sequenzierung, durchführen zu können.
Zur weiteren Charakterisierung der Alanin Racemase wurde die relative Molmasse des nativen Enzyms ermittelt. Durch Gelpermeations-Chromatografie wurde eine M→ um 100.000 ermittelt. Die durch solche Analysen erhaltenen Werte dürfen bekannterweise nur als Richtwerte betrachtet werden, da das Verhalten eines Proteins auf einem Molekularsieb nicht nur von seiner Größe, sondern auch von seiner (nicht bekannten) Gestalt, von seiner Hydrophobizität und von unspezifischen Wechselwirkungen mit der Gelmarrix abhängt. In Kombination mit der M, des denaturierten Proteins von 39.000 ist es sehr wahrscheinlich, daß die Alanin Racemase als Homodimeres vorliegt, wie auch für eine Reihe anderer Racemasen beschrieben wurde (Inagaki et al., 1986, Inagaki et al., 1987, Wang und Walsh, 1978). Die Aminosäure- Sequenzierung kann nach üblichen Methoden durchgeführt werden. Wenn das Enzym, wie im Fall der Alanin Racemase, nicht homogen vorliegt, werden die Proteine zweckmäßigerweise zuerst durch SDS-PAGE getrennt und an eine proteinbindende Membran geblottet. Als erstes versucht man, eine N-terminale Sequenzierung durchzuführen. Wenn der N-Terminus, wie im Fall der Alanin Racemase, blockiert ist, oder auch, um interne Se¬ quenzinformationen zu erhalten, kann man das Protein direkt an der Membran spalten: die Fragmente werden von der Membran eluiert, über HPLC aufgetrennt und der Gasphasen- Sequenzierung zugeführt. Betreffend das GAPDH Gen wurde aus der chromosomalen DNA von Tolypocladium niveum eine DNA kloniert, die das Gen für die Glycerinaldehyd-3-phosphatdehydrogenase, ein Enzym des zentralen Stoffwechselweges der Glykolyse, enthält. Das Gen samt seiner regu¬ latorischen Region wurde in seiner Struktur analysiert und es zeigte sich, daß der Promotorbereich für die Konstruktion potenter Expressionsvektoren zum Beispiel für Tolypocladium niveum als Wirtsstamm verwendet werden kann.
Bislang wurden schon einige Gene für die GAPDH einzelner niederer Eukaryonten kloniert und analysiert, wie etwa jene aus Saccharomyces cerevisiae (Holland and Holland, 1980), Asper gillus nidulans (Punt et al., 1988) oder Cephalosporium acremonium (Kimura et al.,1991). Das GAPDH-Gen aus Tolypocladium niveum und seine Verwendung für Techniken der genetischen Manipulation in diesem oder anderen Organismen wurde bis jetzt noch nicht beschrieben.
Das GAPDH-Strukturgen, die Initiationsstelle der Translation, der Promotor-aktive Teil, sowie der Transkriptions-Terminationsberich des GAPDH-Gens kann aus Zellen von Tolypo¬ cladium niveum isoliert werden. Beispiele für Tolypocladium niveum schließen Tolypocladium niveum ATCC 34921 und davon abgeleitete Stämme ein.
Die DNA für das Alanin Racemase Gen, sowie auch für das .GAPDH-Gen kann aus chromosomaler DNA von Tolypocladium niveum gewonnen werden. Die chromosomale DNA wiederum kann nach verschiedenen Methoden nach Stand der Technik isoliert werden, wie beispielsweise direkt aus aufgeschlossenen Zellen nach Kück et al.(1989) oder einem ähnlichen Verfahren. Eine andere Methode geht von Protoplasten aus. Dazu werden die Pilz¬ zellen nach einer bekannten Methode protoplastiert, wie z.B. von Peberdy (1991) zusammengefaßt, bzw. nach einer entsprechenden Modifikation; sehr gut eignet sich die in Beispiel 18 beschriebene, optimierte Variante für Tolypocladium niveum. Nach Lyse der Protoplasten wird die DNA nach der Methode von Cryer et al.(1975) oder einer entsprechen¬ der Modifikation isoliert und gereinigt (Beispiel 6).
Um die DNA, welche die Alanin Racemase Genregion der chromosomalen DNA bzw. jene DNA, die die GAPDH-Genregion enthält, zu detektieren und letztlich zu klonieren, kann irgendeine Methode verwendet werden, die die Existenz des Alanin Racemase Gens bzw. des GAPDH-Gens bestätigt. Zum Beispiel könnte prinzipiell eine Methode verwendet werden, die darauf beruht, einen entsprechenden Defekt im Wirtsstamm Alanin Racemase Gen bzw. GAPDH-Gen zu komplementieren. Eine andere Methode wäre, das Gen mittels Hy- bridisierung mit einem Teil oder einem ganzen bekannten Alanin Racemase Gen bzw. GAPDH-Gen aus einem anderen Organismus nachzuweisen. Mögliche andere Mikroorganismen betreffend das Alanin Racemase Gen wären beispielweise Salmonella typhimuήum (Wasserman et al., 1984 (dadB), Galakatos et al., 1986 (alr)), Bacillus stearothermophilus (Inagaki et al., 1986, Tanizawa et al., 1988) oder Bacillus subtilis (Ferrari et al., 1985). Da es sich dabei jedoch um prokaryontische Gene handelt, und in diesem Fall keine ausgeprägte Homologie erwartet werden kann, ist es essentiell, zunächst Aminosäure- Teilsequenzen des Alanin Racemase Proteins aus Tolypocladium niveum zu bestimmen, und sich dann daraus geeignete spezifische Oligonukleotidsonden abzuleiten und herzustellen. Geeignete andere Mikroorganismen betreffend das GAPDH-Gen sind beispielweise Saccharomyces cerevisiae oder Aspergillus nidulans. Im speziellen Fall kann ein Teil des GAPDH-Gens aus Penicillium chrysogenum eine brauchbare Probe sein. Als Wirtsstamm für eine Klonierung wird üblicherweise Escherichia coli genutzt, obwohl natürlich auch andere Organismen verwendet werden könnten. Ein bevorzugter Stamm ist etwa der kommerziell erhältliche Escherichia coli SRB (Fa.Stratagene). Als Kloniervektor kann prinzipiell jeder Vektor verwendet werden, der in Escherichia coli transferiert werden kann. Meist werden Plasmidvektoren wie zum Beispiel pBR322, pUC18, pUC19, pUCBM20, pBluescriptll SK+ und dergleichen, oder Vektoren auf der Basis des Bakteriophagen Lambda, wie etwa Lambda EMBL3, oder Lambda DASH II, verwendet. Um noch größere DNA- Fragmente zu klonieren, können Cosmide verwendet werden, beispielsweise der Vektor Supercos 1 (Fa.Stratagene).
Um Fragmente der isolierten chromosomalen DNA in einen Vektor zu inserieren, kann die chromosomale DNA mit einem geeigneten Restriktionsenzym entweder partiell oder vollständig geschnitten werden. Ebenso kann der ausgewählte Vektor mit dem selben Restriktionsenzym oder einem, das gleiche Enden erzeugt, geschnitten werden. Im Falle von Lambda- oder Cosmid- Vektoren können dazu die beiden Randfragmente nach einer bekannten Methode hergestellt werden, um die Kloniereffizienz zu erhöhen. Dann können DNA-Fragmente und Vektor mittels einer DNA-Ligase miteinander ligiert werden, um die entsprechenden rekombinanten DNA-Moleküle zu erhalten.
Die rekombinierte DNA wird dann in Escherichia coli eingebracht. Im Fall eines Plasmidvektors kann das mittels "kompetenter Zellen" (Sambrook et al., 1989) oder durch Elektrotransformation durchgeführt werden. Lambda- und Cosmid-Moleküle werden durch in vitro Verpackung in Bakteriophagen Lambda Phagen-Hüllen und anschließende Infektion des entsprechenden Wirtsstammes in Escherichia coli eingebracht. Für die in vitro Verpackung können kommerziell erhältliche Lysate herangezogen werden (z.B. Gigapack II, Fa.Stratagene).
Um unter den rekombinanten Klonen jene mit dem Alanin Racemase-Gen bzw. jene, mit dem GAPDH-Gen zu detektieren, werden Plaque-Hybridisierungen für Lambda-Klone, bzw. Kolonie-Hybridisierungen für Plasmid- und Cosmid-Klone nach Standardtechniken durchge¬ führt (Sambrook et al., 1989), wobei als Sonde für das Alanin Racemase Gen ein Oli- gonukleotidgemisch, das wie oben beschrieben aus Aminosäure-Teilsequenzen des Alanin Racemase Proteins abgeleitet wurde, herangezogen wird. Dabei muß in Vorversuchen zunächst ein geeignetes Gemisch ausgewählt werden, und die Stringenz der entsprechenden Hybridisierung in Southern-Experimenten sehr gut optimiert werden. Durch mehrmaliges Wiederholen der Plaquehybridisierung kann eine entsprechende DNA, die das Alanin Racemase Gen aus Tolypocladium niveum enthält, rein isoliert werden. Als Sonde für das GAPDH-Gen kann ein Teil des GAPDH-Gens aus Penicillium chrysogenum herangezogen werden, wobei die Stringenz entsprechend modifiziert werden muß. Durch mehrmaliges Wiederholen dieser Technik kann "eine entsprechende DNA, die das GAPDH-Gen aus Tolypocladium niveum enthält, rein isoliert werden.
Nach Restriktionsanalysen der entsprechenden DNA können einzelne Fragmente in Plasmid- oder Bakteriophagen Ml 3- Vektoren mittels Standardtechniken subkloniert werden. Durch ein Sequenzierverfahren (z.B. nach Maxam-Gilbert (Maxam und Gilbert 1980) oder die Dides- oxy-Methode (Sanger et al., 1977) bzw. einer geeigneten Modifikation) kann die Nukleotidse- quenz des Alanin Racemase Gens bzw. des GAPDH-Gens bestimmt werden. Nach Analyse der Sequenz und Vergleich der translatieren Sequenz mit den Aminosäureteilsequenzen der identifizierten Alanin Racemase kann verifiziert werden, daß es sich um das Alanin Racemase Gen handelt, und auch die Orientierung des Gens, sowie dessen Promotor- und Terminations-Region auf der DNA kann bestimmt werden. Durch Northernhybridisierungen entsprechender Teilfragmente des Alanin Racemase Gens bzw. des GAPDH-Gens kann die Expression des hybridisierten Gens bestätigt werden. Nach Analyse der entsprechenden Sequenzen, sowohl im Falle des Alanin Racemase Gens, als auch des GAPDH-Gens, können die Lage des Strukturgens, des Promotors, sowie der Terminationsregion bestimmt werden. Dies kann wesentlich untermauert werden, wenn neben dem genomischen DNA-Fragment auch die entsprechende RNA in Form von cDNA für die Untersuchungen herangezogen wird. Darüberhinaus wird auch die Bestimmung der Lage von Intron-Bereichen und des Startpunktes der Transkription erleichtert. Dazu wird zunächst die gesamte RNA aus den Pilzzellen nach der von Cathala et al.(1983) beschriebenen, oder einer ähnlichen Methode isoliert. Nach einem der zahlreichen Standardverfahren wird daraus die polyA-RNA gereinigt. Die Überschreibung in c-DNA kann zum Beispiel durch PCR- Amplifikationstechnik realisiert werden. Anschliessend werden durch RACE ("rapid amplification of cDNA ends") unter Verwendung kommerziell erhältlicher Systeme ( z. B. Fa. GIBCO BRL, Fa. Clonetech) und unter Eisatz genspezifischer Oligonukleotidprimer sowohl der Anfang der Transkripte (5'-RACE), als auch das Ende (3'-RACE), beziehungsweise dadurch auch der interne Genbereich (Prüfung auf Introns) isoliert und zur direkten Sequenzierung oder zur Sequenzierung nach entsprechender Klonkonstrukrion zugänglich. Dieses Vorgehen wurde zur Charekterisierung des Alanin Racemase Gens im Beispiel 27 dargestellt, wobei der genaue Transskriptionsstart, die Transkriptionsdetermination und die Lage von Intronbereichen lokalisiert wurde. Eine andere Möglichkeit ist, die nach Überschreibung der poly-RNA erhaltene cDNA unter Einsatz geeigneter Linker oder Adaptoren in Plasmid- oder Lambda- Vektoren einzubauen. Die Suche und Reinigung der positiven Klone erfolgt analog zu oben mittels Plaque- bzw. Kolonie- Hybridisierungen, wobei nun zweckmäßigerweise auch ein Teil des GAPDH-Gens aus Tolypocladium niveum verwendet werden kann. Der Anteil an positiven Klonen im Vergleich zur Gesamtzahl an untersuchten Klonen gibt dabei auch einen Anhaltspunkt über die Stärke der Expression des gesuchten Gens unter den entsprechenden Bedingungen. Im Fall des GAPDH-Gens gemäss Beispiel 13 war der Anteil an positiven Klonen mit ca. 2.5 bis 3 % sehr hoch. Nach Sequenzierung geeigneter cDNA-Fragmente des GAPDH-Gens können durch Vergleich mit der genomischen Sequenz exakt die Lage der Introns, sowie der Promotor- und der Terminations-Bereich lokalisiert werden.
In Abbildung 15 ist die Nukleotidsequenz des GAPDH-Gens, das aus Tolypocladium niveum gemäss der Beispiele 12, 13 und 14 isoliert wurde, dargestellt. Das ATG-Codon bei Pos. 673 der Abbildung 15 ist das Startcodon der Translation, der Beginn des eigentlichen Strukturgens. Im nicht translatierten Bereich oberhalb des Transkriptionsstarts können Strukturelemente gefunden werden, wie sie schon in ähnlicher Form in anderen Pilzpromotoren gefunden wurden. So etwa schließt sich eine ca. 60 bp lange CT-Region oberhalb des vermutlichen Transkriptionsstarts an, welche in einer potentiellen TATA-Box endet. Weitere etwa 60 bp aufwärts könnte eine sogenannte CAAT-Box lokalisiert werden (Gurr et al., 1987).
Es können nun entsprechende DNA-Fragmente, die diesen Promotorbereich enthalten, für die Konstruktion einzelner Fusionen mit Genen, die unter die Kontrolle des GAPDH-Gen Promotors gestellt werden sollen, verwendet werden. Zur Konstruktion der Vektoren in denen Fusionen des GAPDH-Gen Promotors zum Hygromycin-Resistenzgen enthalten sind, wurden gemäss der Beispiele 20 und 26 bestimmte Teile des sequenzierten Bereiches verwendet Dies sind jedoch nur einzelne Möglichkeiten für solche Konstruktionen. So kann beispielsweise auch ein Teil der DNA deletiert werden, sowohl am 5 '-Ende des Bereiches, als auch am 3'- Ende. Es können auch nur Teile des Promotorbereiches Verwendung finden (wie in Beispiel 25), etwa nur der Teil bis zum Startpunkt der Transkription. Andererseits können aber auch größere Teile des Strukturgens für solche Fusionen mit herangezogen werden. Analog verhält es sich natürlich auch mit dem verwendeten Fragment aus dem Terminationsbereich des Gens. Darüberhinaus kann auch eventuell ein kleiner Teil der Promotor- und Terminator- Fragmente für spezielle Zwecke modifiziert werden, beispielsweise um die Expression weiter zu steigern. Mit Hilfe solcher DNA-Fragmente können Gene, deren Expression man erreichen will, zu Fusionskonstruktionen kombiniert werden. Beispiele für diese Gene können etwa solche, die als Selektionsmarken im entsprechenden Organismus dienen, wie in den Beispielen 20 und 25 beschrieben, oder irgendwelche andere Gene, die für spezielle Enzyme codieren, sein. Ganz allgemein kann dieses Gen sowohl aus genomischer DNA, aus cDNA, die aus mRNAs gebildet wurde, chemisch synthetisiert oder semisynthetisch hergestellt sein.
Essentielle Voraussetzungen zur gezielten Veränderung von Tolypocladium niveum sind entsprechende Verfahren zur Protoplastierung und Transformation. Als Wirtsstämme für die einzelnen Genkonstruktionen können irgendwelche Stämme der Art Tolypocladium niveum, aber auch andere Pilzarten Verwendung finden. Als Verfahren, um diese Genkonstruktionen in Tolypocladium niveum zu bringen, kann neben der Transformation von Protoplasten (wie etwa im Beispiel 19 beschrieben), aber auch eine andere Methode (z.B. Elektrotransformation von Protoplasten oder sphäroplastiertem Mycel, o.a.) herangezogen werden. Die Transformation kann direkt erfolgen, indem sich die Genkons ruktion auf einer Vektor-DNA zusammen mit einer geeigneten Selektionsmarke befindet, oder aber mittels Cotransformation durchgeführt werden. Hierbei wird neben geeigneter Vektor-DNA jene Genkonstruktion, die sich auf einer anderen DNA befindet, dem Transformationsansatz beigefügt. Entsprechende Transformanten können durch verschiedene Hybridisierungstechniken molekular analysiert werden.
Gemäss der obigen Beschreibung ist es also möglich, Tolypocladium niveum mit DNA, die das Gen für die Alanin Racemase oder die das Gen oder einen Teil davon für das GAPDH- Gen trägt, zu transformieren. In Southernhybridisierungen lassen sich Stämme finden, die mehrere zusätzliche Kopien des Alanin Racemase Gens enthalten. Dabei läßt die Anzahl der Kopien allein keinen zwingenden Schluß auf Mehrleistung der Stämme zu, da die Integrationsorte und veränderte Regulationsmechanismen einen wesentlichen Einfluß besitzen. In Testfermentationen können diese Stämme untersucht werden, und dann dabei solche gefunden werden, die mehr Cyclosporin A bilden.
Durch Transformation von Tolypocladium niveum mit Plasmidvektoren, die einen Teil des Alanin Racemase Gens (der nicht zur Ausbildung des aktiven Enzyms ausreicht) tragen, können Stämme erzeugt werden, die den Plasmidvektor in das genomische Alanin Racemase Gen durch homologe Rekombination integriert haben, wodurch das. Gen zerstört worden ist. In Testfermentationen kann gezeigt werden, daß diese Stämme kein Cyclosporin A mehr bilden. Dies ist auch ein weiterer Beweis, daß es sich beim klonierten Gen tatsächlich um das Gen für das Enzym Alanin Racemase handelt, welches für die Cyclosporinbiosynthese essentiell ist.
Da die Biosynthese des Cyclosporins an der Position 8, also mit Aktivierung des D-Alanins, startet, sind Stämme, in denen das Alanin Racemase Gen zerstört wurde, besonders interessant für den Einbau "fremder" Aminosäuren an der Position 8 im Cyclosporinmolekül. Es wurde insbesonders gefunden, dass eine Nucleotid-Sequenz, die gegenüber der in der Abbildung 5 angegebenen Sequenz in Position 2318 ein A (Adenosin) anstatt des G (Guanosins) besitzt, wodurch das Triplett in den Positionen 2317, 2318, und 2319 für Asparaginsäure anstatt für Glycin codiert, zu einem Einbau von D-Serin anstatt von D- Alanin in Position 8 des Cyclosporins führt. Durch Zugabe größerer Mengen "fremder" Aminosäuren ins Fermentationsmedium können Stämme gefunden werden, die deutliche Mengen an modifizierten Cyclosporinen bilden können. Cyclosporine, die in 8-Stellung eine andere Aminosäure, als D- Alanin tragen und die gemäss vorliegender Erfindung herstellbar sind, sind beispielsweise im US-Patent 5,284,826 geoffenbart und zitiert, deren Inhalt hiermit als Referenz eingefügt wird. Diese modifizierten Cyclosporine finden in den dort geoffenbarten und zitierten Anwendungsgebieten als Pharmazeutika Verwendung und sind auf die dort angegebene und zitierte Art und Weise und in den dort angegebenen und zitierten Dosen anwendbar.
Die folgenden Beispiele und Abbildungen erläutern die Erfindung, ohne sie jedoch zu beschränken.
Die in den Abbildungen 1, 2, 3, 4, 6, 7, 10, 12, 17, 18 und 19 gezeigten Restriktionskarten sind zum Teil nur ungefähre Wiedergaben von Restriktionsschnittstellen in den DNA- Molekülen. Die gezeichneten Abstände sind proportional zu den tatsächlichen Abständen, letztere können sich jedoch davon unterscheiden. Nicht alle Restriktionsschnittstellen sind wiedergegeben, es können durchaus weitere Schnittstellen vorhanden sein.
Abbildung 1: Restriktionskarte des ca. 15.2 kb großen Anteils genomischer DNA von Tolypocladium niveum in Lambda RAC4 (weißer Balken). Der schattierte Balken repräsentiert das ca. 1100 bp große tl Restriktionsfragment, das mit der Hybridisierungs- sonde (Oligonukleotidgemisch R14) ein positives Signal liefert und in pRPl kloniert wurde. Die beiden schraffierten Balken stellen jene benachbarten Fragmente dar, die in pRP6, bzw. pRP9 subkloniert wurden.
Abbildung 2: Restriktionskarte des Plasmids pRPl. Der schattierte Balken repräsentiert das ca. 1100 bp große Pstl Restriktionsfragment, das mit der Hybridisierungssonde (Oligonukleotidgemisch R14) ein positives Signal lieferte. Der dünnere Anteil stellt den Bereich des verwendeten Plasmidvektors pUCBM20 dar.
Abbildung 3: Restriktionskarte des Plasmids pRP6. Der schattierte Balken repräsentiert das ca. 1.9 kb große EcoRl-SaE Restriktionsfragment aus Lambda RAC4. Der dünnere Anteil stellt den Bereich des verwendeten Plasmidvektors pUCBM20 dar.
Abbildung 4: Restriktionskarte des Plasmids pRP9. Der schattierte Balken repräsentiert das ca. 650 bp große HindSl-Pst Restriktionsfragment aus Lambda RAC4. Der dünnere Anteil stellt den Bereich des verwendeten Plasmidvektors pBluescriptll SK+ dar.
Abbildung 5: Nukleotidsequenz des ca. 1,1 kb große Pstl-Insert in pRPl, des ca. 1,9 kb grosse EcoRI-Sall-Fragment aus pRP6, des ca. 650 bp grossen Pstl-Hindül-Fragment aus pRP9, sowie noch zusätzlich 511 bp anschliessend an die HindlH- Stelle umfaßend 3973 Nukleotide (siehe auch Abbildung 19). Einzelne Erkennungsstellen für Restriktions- endonukleasen sind angegeben.
Abbildung 6: Restriktionskarte eines sequenzierten Teilbereiches aus Abbildung 5. Die Lage der aufgefundenen Aminosäureteilsequenzen (Beispiel 12) ist angegeben.
Abbildung 7: Restriktionskarte des Plasmids pRP12. Der schattierte Balken repräsentiert das ca. 835 bp große EcoRI- -stl Restriktionsfragment aus pRPl. Der dünnere Anteil stellt den Bereich des verwendeten Plasmidvektors pUCBM20 dar.
Abbildung 8: Restriktionskarte des Plasmids pGT24. Das Plasmid leitet sich aus pGT14 ab und enthält ein -ßαmHI-Fragment (weißer Balken) mit dem Hygromy- cinresistenzgen, dessen Orientierung durch den punktierten Pfeil gekennzeichnet ist.
Abbildung 9: Restriktionskarte des Plasmids pGTl. Der schattierte Balken repräsentiert das in Beispiel 12 isolierte Sαcl-Fragment mit dem GAPDH-Gen aus Tolypocladium niveum. Der dünnere Anteil stellt den Bereich des verwendeten Plasmidvektors pUC18 dar.
Abbildung 10: Nukleotidsequenz des 2271 bp großen Sαcl-Fragmentes aus pGTl
Abbildung 11: Restriktionskarte des Plasmids pGT4. Der schattierte Bereich stellt die klonierte cDNA des GAPDH-Gens (gpdA) (Beispiel 13) dar. Der d nnere Bereich steht für den Anteil des Plasmidvektors pUCBM20.
Abbildung 12: Nukleotidsequenz des 1347 bp großen cDNA-Inserts in pGT4. Die Pos. 1 - 14 und 1334 - 1347 (unterstrichen) entsprechen den für die Klonierung verwendeten Adaptormolekülen und enthalten die Εrkennungsstellen für die Restriktionsendonukleasen EcoRI (GAATTC) und Notl (GCGGCCGC).
Abbildung 13: Nukleotidsequenz des 1278 bp großen Xhol-Sall Fragmentes aus gpdcosl, das den Promotor des GAPDH-Gens enthält (Beispiel 14). Die Sαcl-Εr- kennungs stelle entspricht jener bei Pos. 1-6 in Abbildung 11.
Abbildung 14: Vergleich der genomischen Nukleotidsequenz (oben), mit jener der cDNA (unten) (Beispiel 14). Einzelne Restriktionsschnittstellen sind gekennzeichnet. Die beiden Intron-Bereiche sind durch den Strich dargestellt. Das Translationsstartcodon ATG, ebenso wie das Translationsstoppcodon TAA, ist unterstrichen. Sie markieren die Lage des eigentlichen GAPDH-Strukturgens aus Tolypocladium niveum.
Abbildung 15: Aminosäuresequenz der abgeleiteten GAPDH Abbildung 16: Restriktionskarte des Plasmids pGT12 (Beispiel 20). Der graue Pfeil markiert den Bereich und die Orientierung des gewählten Promotorfragmentes des GAPDH- Gens aus Tolypocladium niveum. Der dünne Bereich entspricht dem Teil des verwendeten Plasmidvektors pBluescript II SK+.
Abbildung 17: Restriktionskarte des Plasmids pGT14 (Beispiel 20). Die grauen Bereiche kennzeichnen das verwendete Promotorfragment (Pfeil) und das Fragment aus dem Terminatorbereich des GAPDH-Gens aus Tolypocladium niveum.
Abbildung 18: Restriktionskarte des Plasmids pGT30 (Beispiel 26). Der graue Pfeil markiert den Bereich und die Orientierung des gewählten Promotorfragmentes des GAPDH- Gens aus Tolypocladium niveum. Das durch den weißen Balken markierte Fragment enthält das Hygromycinresistenzgen, dessen Orientierung durch den punktierten Pfeil gekennzeichnet ist. Der Rest des Plasmides entspricht pCSN44 (Stäben et al., 1989)
Abbildung 19: Die aus der Nucleotidsequenz abgeleitete Aminosäuresequenz der Alanin Racemase aus Tolypocladium niveum
Abbildung 20: Nucleotid Sequenz des 3973 bp grossen Alanin Racemase Gen - Bereiches. Der kodierende Bereich des Strukturgens ist durch Darstellung der Aminosäuresequenz gekennzeichnet. Die Lage des Introns ist markiert.
Abbildung 21: Ergebnis der Sequenzierung von 32 5'-RACE Klonen des Alanin Racemase Gens. Startnucleotid ist jeweils das gross dargestellte A. Identische Sequenzbereiche sind durch Striche markiert. Die Positionsnummern beziehen sich auf das A des Translationsstartcodons.
Abbildung 22: Ergebnis der Sequenzierung von 12 3'-RACE Klonen des Alanin Racemase Gens. Oberhalb der Enden der einzelnen DNAs ist die genomische Sequenz als Bezugspunkt kursiv dargestellt, Die Positionsnummern beziehen sich auf das A des Translationsstartcodons. Die Zahl hinter dem "/" steht für die Länge des 3 '-Bereiches nach dem Stoppcodon. Beispiel 1: Analytische Bestimmung der Alanin Racemase-Aktivität:
1. Stufe: Racemase-Reaktion:
Etwa 1 mU Racemase werden in einem Gesamtvolumen von 120 μl unter Anwesenheit von 30 mM L-Alanin, 50 μM Pyridoxalphosphat (Boehringer Mannheim), 20 mM DTT und 100 raM Tricin pH 8,5 1 Stunde bei 48°C inkubiert. Danach wird die Proteinlösung durch 5 Minuten Erhitzen auf 80°C inaktiviert; die denaturierten Proteine werden in der Eppendorfzentrifuge abzentrifugiert.
2. Stufe: Nachweis des gebildeten D-Alanins durch Reaktion mit D-Aminosäure-Oxidase (DAO) und Lactat-Dehydrogenase (LDH) (beide Enzyme von Boehringer Mannheim):
100 μl Überstand aus der hitzeinaktivierten Racemase-Reaktion werden in einem
Gesamtvolumen von 500 μl unter Anwesenheit von 200 μM NADH (Boehringer Mannheim),
0,3 units DAO, 1 unit LDH und 100 mM Tricin pH 8,5 bei 30°C gemessen.
Die Durchführung erfolgt in 500 μl Quarz-Küvetten (Quarzglas Suprasil Mikroküvetten), und der durch den NADH-V erbrauch bewirkte Extinktionsabfall wird 20 Minuten bei 340 nm gemessen.
Bestimmung der Enzymeinheiten (enzyme units): Nach IUPAC-Nomenklatur ist ein
Racemase-unit als 1 μmol D-Alanin, welches pro Minute gebildet wird, definiert. Die Bildung von D-Alanin ist equimolar zum Verbrauch an NADH.
Beispiel 2: Anreicherung der Alanin Racemase:
Mit dem folgenden Protokoll lassen sich aus 1 kg feuchtem Mycel (feucht nach Abschleudern, wie unten beschrieben) ca. 4 mg Gesamtprotein gewinnen, woran die Alanin Racemase einen Anteil von etwa 10% (ca. 0,4 mg) hat. Diese 0,4 mg Alanin Racemase besitzen eine Aktivität von 2,5 Enzymeinheiten, was einer 1000-fachen Anreicherung der Enzymaktivität, bezogen auf den Rohextrakt, entspricht. Alle Schritte wurden zwischen 0°C und 4°C durchgeführt. Alle säulenchromatografischen Trennungen wurden an einer FPLC- Anlage (von Pharmacia) durchgeführt.
1. Schritt: Ernte und Aufschluß des Mycels:
4-5 kg Fermentationsbrei wurden bei 16.000 g, 10 Minuten, abzentrifugiert. Der Brei wurde zweimal mit 2,5 1 physiologischer Kochsalzlösung unter Zusatz von 5 mM EDTA gewaschen. 1 kg der so gewonnenen, feuchten Biomasse wurde in 2,5 1 Puffer A (0,25 M HEPES pH 7,5; 0,4 M KC1; 5 mM EDTA; 20 gv% Glycerin; 10 mM OTT) suspendiert und mit Hilfe eines Ultraturrax homogenisiert. Die Suspension wurde im Manton Gaulin Lab 60 unter 3 Durchläufen zu je 600 bar aufgeschlossen (Durchflußgeschwindigkeit 60 1 h). Die Temperatur wurde zwischendurch immer wieder auf 4°C gestellt. Die Zelltrümmer wurden in einer mitteltourigen Standzentrifuge 10 Minuten bei 16.000 g abzentrifugiert. Der Überstand wurde als Rohextrakt bezeichnet.
2. Schritt: Entfernung der Nukleinsäuren aus dem Rohextrakt:
Die Nukleinsäuren wurden durch Zugabe einer Polyethyleniminlösung (12% in Wasser; dialysiert zur Entfernung der niedermolekularen Bestandteile) zu einer Endkonzentration von 0,1% ausgefällt. Der Niederschlag wurde durch 10 Minuten Zentrifugation bei 17.000 g entfernt. Dieser geklärte Rohextrakt wurde als Polyethylenimin-Überstand bezeichnet.
3. Schritt: Proteinfällung mit Ammoniumsulfat:
Der Polyethylenimin-Überstand wurde durch Zutropfen einer 100% gesättigten Ammoniumsulfat-Lösung in Puffer B (0,1 M HEPES pH 7,5; 4 mM EDTA; 15 gv% Glycerin; 4 mM DTT) auf 40% Sättigung an Ammoniumsulfat gestellt. Nach beendeter Zugabe wurde 30 Minuten nachgerührt. Das Proteinpellet wurde 30 Minuten bei 32.000 g abzentrifugiert, danach ad 500 ml in Puffer B gelöst und 12 Stunden gegen 5 1 Puffer B dialysiert. Das Dialysat wurde vor dem 4. Schritt mit Puffer B auf das doppelte Volumen verdünnt und über einen 8 μ Glasfaserfilter filtriert. Die so erhaltene Probe wurde als Ammoniumsulfatfraktion bezeichnet. 4. Schritt: Kombinationschromatografie an den Kationenaustauschern S-Sepharose und Phosphozellulose Pl l:
Zwei Säulen (S-Sepharose fast flow war von Pharmacia: 2,6 x 7,8 cm und Phosphozellulose Pl l war von Whatman: 5 x 7,9 cm) waren in tandem geschalten, und zwar derart, daß die Proteine beim Auftrag zuerst über S-Sepharose filtriert und danach an Phosphozellulose gebunden wurden. Dieser Teil der Chromatografie erfolgte in Puffer B mit einer Flußrate von 10 ml/min. Die gekoppelten Säulen wurden solange mit Puffer B gewaschen, bis die Extinktion auf die Basislinie zurückgefallen war. Danach wurde die S-Sepharose entkoppelt und die Phosphozellulose mit einem Salzgradienten eluiert: Gradient in 700 ml auf Puffer C (= Puffer B mit 1 M NaCl). Flußrate: 5 ml/min. Die aktiven Fraktionen wurden gepoolt und über einen 0,8 μ Membranfilter filtriert. Diese Probe wurde als Pll-Pool bezeichnet.
5. Schritt: Aufkonzentrierung des Pll-Pools durch Ultrafiltration:
Der Pll-Pool wurde über eine Membran mit einer Trenngrenze bei einer M,. von 30.000 (YM30 von Amicon) auf 10 ml eingeengt. Bedingungen: Ultrafiltrationszelle von Amicon, unter N2-Begasung, maximal 5 bar, bei 4°C.
6. Schritt: Gelpermeations-Chromatografie an Sephacryl S300-HR:
Sephacryl S300-HR war von Pharmacia: 2,6 x 95 cm. Die Säule wurde in Puffer D (50 mM Tris/HCl pH 8,2; 1 mM EDTA; 10 gv% Glycerin; 4 mM OTT) unter Zusatz von 0,2 M NaCl equilibriert. Die Kalibrierung erfolgte unter gleichen Pufferbedingungen mit einem BioRad GPC-Standard. Chromatografie: Flußrate 1 ml/min. Die Aktivität eluierte bei einem Volumen von 268-302 ml. Die so erhaltene Probe wurde als S300-Pool bezeichnet.
7. Schritt: Anionenaustauschchromatografie an Mono-Q:
Die MonoQ-Säule HR5/5 war von Pharmacia und in Puffer D equilibriert. Der S300-Pool wurde über Mono-Q in 2 Portionen gereinigt. Die Probe wurde jeweils nach Dialyse gegen Puffer D bei einer Flußrate von 0,5 ml/min aufgetragen. Die Elution der gebundenen Proteine erfolgte mit einem Gradienten: von 0 auf 20% Puffer E (= Puffer D mit 1 M NaCl) in 2 ml; von 20 auf 70% E in 15 ml und von 70 auf 100% E in weiteren 3 ml, bei einer Flußrate von 0,2 ml/min. Der Hauptpeak der Racemase-Aktivität lag bei 0,32 bis 0,36 M NaCl.
Beispiel 3: Identifizierung der Proteinbande im SDS-PAGE:
Zur korrekten Identifizierung der mit der Racemase-Aktivität korrelierenden Proteinbande wurde eine radioaktive enzymspezifische Markierungstechnik angewendet. Die Racemase- haltigen Proteinlösungen nach dem letzten Reinigungsschritt an Mono-Q (0,2 mg Gesamtprotein in 200 μl) wurden vor der Markierung gegen 20 mM KH2PO4-Puffer pH 7 etwa 10 Stunden dialysiert. Die Reduktion wurde in einem Gesamtvolumen von 300 μl mit 2 μl einer 10 mg/ml NaBH4-Lösung in 0,2% NaOH und 3,7 MBq [3H]-NaBH4 (spez. Aktivität: 331 GBq/mmol; von NEN), ebenfalls in 0,2% NaOH bei Raumtemperatur drei Stunden durchgeführt. Danach wurden die Ansätze 12 Stunden gegen 100 mM NH4HCO3 unter mehrmaligem Pufferwechsel dialysiert und im Vakuum zur Trockne eingeengt. Die Pellets wurden in 50 μl Probenpuffer für SDS-PAGE aufgenommen und 5 Minuten gekocht. Die Elektrophorese wurde nach Lämmli (Lämmli 1970) in einem 10% Gel mit anschließender Coomassie Blue-Färbung durchgeführt. Danach wurde das Gel 30 Minuten fixiert (in 25% Isopropanol, 10% Essigsäure, 2% Glycerin) und anschließend 15 Minuten in Amplify-Lösung (von Amersham; mit Zusatz von 2% Glycerin) geschwenkt. Das Gel wurde getrocknet und an einem Hyperfilm™-MP (Amersham) bei -70°C zwei bis vier Wochen exponiert. Durch diese Methode konnte die Racemase-Aktivität eindeutig einer Proteinbande mit einer M. von 39.000 zugeordnet werden.
Beispiel 4: Molekulargewichtsanalyse der Alanin-Racemase:
Die Mr-Analyse wurde an einer TSK-3000-SWG 21,5 x 600 mm, mit einer TSK-SWG 21,5 x 75 mm Vorsäule, an einer HPLC-Anlage durchgeführt. Puffer: 0,2 M Tris/HCl pH 7,5; Flußrate: 5 ml/min. Die Kalibrierung der Gelsäule erfolgte mit den Eichproteinen Aldolase (M, 160.000), IgG (150.000), alkalische Phosphatase (140.000), BSA (68.000), Ovalbumin (45.000), Carboanhydrase (30.000) und Myoglobulin (18.800). Es wurde eine M, um 100.000 ermittelt. Beispiel 5: Aminosäure-Sequenzen der Alanin Racemase:
Die Proteinprobe wurde einer SDS-PAGE (10%) in einem Mini Protean II Elektrophorese System (Bio Rad) unterworfen. Nach der Elektrophorese wurde das Gel 5 Minuten in Transfer Puffer (10 mM CAPS (3-(Cyclohexylamino)-l-propane sulfonic acid, Fluka), 10% Methanol, pH 11.0 mit Natronlauge eingestellt) equilibriert. Eirie PVDF (Polyvinylidene difluoride) Membran (Immobilon, Millipore) wurde 5 Sekunden in Methanol getaucht und anschließend ebenfalls in Transfer Puffer equilibriert. Danach wurden die Proteine in der Mini Trans-Blot Zelle (Bio Rad) innerhalb einer Stunde bei 200 mA vom Gel auf die Membran transferiert. Nach dem Transfer wurde die Membran 5 Minuten in Wasser gewaschen, danach in einer 0.1% Lösung von Coomassie Blue R-250 (Serva) in 50% Methanol 2 Minuten gefärbt und in 50% Methanol, 10% Essigsäure entfärbt, bis sich die Proteinbanden klar identifizieren ließen. Die Membran wurde anschließend mit Wasser gewaschen, die Alanin Racemase enthaltenden Banden (aufgrund der Färbung geschätzte Alanin Racemase Menge: 25 μg) ausgeschnitten und in Quadrate von ca. 1 mm Seitenlänge zerkleinert, die in 1 ml einer 0.2% PVP-40 (Polyvinylpyrrolidone (Sigma) Lösung in 100% Methanol gegeben wurden. Nach Inkubation von einer Stunde bei 37°C und Waschen in Wasser wurden die Membranstücke in 100 mM Tris-HCl Puffer, pH 8.1 gegeben. Nach Zugabe von 2 μg der Protease Lys-C (Boehringer Mannheim) wurde bei 37°C inkubiert. Nach 20 Stunden Inkubation wurde festes Guanidin.HCl bis zu einer Endkonzentration von 6 M zugegeben. Durch Zugabe von 300 μg DTT und 90 Minuten Inkubation bei 37°C unter Argon wurde das Protein reduziert und anschließend durch Zugabe eines 3fachen molaren Überschusses über DTT von Iodacetamid unter Argon während 30 Minuten bei Raumtemperatur im Dunkeln alkyliert. Das durch den Abbau mit Lys-C ent¬ standende, reduzierte und alkylierte Peptidgemisch wurde auf eine 2.1 x 30 mm reversed phase Säule (Aquapore RP-300, 7 μm, Brownlee) aufgetragen und in einem Modell 130A HPLC System von Applied Biosystems aufgetrennt. Die Auftrennung der Peptide erfolgte durch Elution der Säule mit einem Gradienten von 0.1% Trifluoressigsäure in Wasser gegen 70% Acetonitril (enthaltend 0.075% Trifluoressigsäure), wobei der Gradient in 20 Minuten von 0% auf 60% und in weiteren 10 Minuten von 60% auf 100% gefahren wurde. Die eluierenden Peptide wurden gesammelt und deren Aminosäuresequenz auf einem Gasphasen- Sequenator 470A (Applied Biosystems) nach Vorschrift des Geräteherstellers bestimmt: as 1750: AWADEQEIAIHIDGARIW
as 1751: STLDTAAQHR
as 1753: AGHWGDPTLTGS
as 1758: EAALFVVSGTMANQIALGAL
Beispiel 6: Isolierung hochmolekularer genomischer DNA aus Totvoocladium niveum
Es wurden Protoplasten wie im Beispiel 18 beschrieben, hergestellt. Ca.109 Protoplasten wurden vorsichtig in 2 ml TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) lysiert Es wurde 0.1 mg/ml RNase A zugesetzt und 20 min bei 37 °C inkubiert. Nach Zugabe von 0.5 % SDS und 0.1 mg/ml Proteinase K wurde weitere 40 min bei 55 °C inkubiert. Der Ansatz wurde sehr schonend je zweimal mit TE-gesättigtem Phenol, Phenol/Chloroform (1:1) und Chloroform/Isoamylalkohol (24:1) extrahiert (Maniatis et al., 1982). Der wässrige leicht viskose Überstand wurde mit einem Zehntel Volumen 3 M Natriumazetat (pH 5.2) versetzt, mit dem 2.5 fachen Volumen absolutem, -20 °C kaltem Ethanol überschichtet und die DNA in Form feiner Fäden mittels Glasstäben an der Phasengrenze aufgespult. Die DNA wurde in 3 ml TE mindestens 20 h gelöst. Je nach Qualität der Protoplasten wurden ca.500 μg/ml DNA erhalten. Analyse mit FIGE (0.8 % Agarose, 0.5 x TBE (Maniatis et al.1982), 6 V/cm, Vorwärtspuls 0.2 bis 3 sek, Puls- Verhältnis 3.0, Laufzeit 5 h) ergab eine Größe von mehr als 150 kb.
Beispiel 7: Konstruktion einer genomischen Lambda-Genbank von Tolypocladium niveum
Zweimal ca. 100 μg DNA aus Beispiel 6 wurden mit 9 bzw. 18 Einheiten des Re¬ striktionsenzyms Ndell (Fa.Boehringer Mannheim) f ür 1 h bei 37°C in 1 ml Puffer (Tris- Acetat 33 mM, Magnesiumacetat 10 mM, Kaliumacetat 66 mM, DTT 0.5 mM, pH 7.9) ge¬ schnitten. Aliquots der Restriktionen wurden mittels FIGE überprüft und ergaben ein Maxi¬ mum der erhaltenen Fragmente bei etwa 25 bzw.10 kb. Mit einem Gradientenmischer wurden in Ultrazentrifugenröhrchen lineare NaCl- Dichtegradienten von 30 % bis 5 % in 3 mM EDTA pH 8.0 hergestellt und die DNAs aufgetragen. Nach Zentrifugation für 5 h bei 37000 Upm und 25 °C (Beckman Ultrazentrifuge L7-65, Rotor SW 41) wurde der Gradient in 500 μl Fraktionen geerntet. Nur Fraktionen mit DNA von mehr als 12 kb und weniger als 25 kb wurden dreimal 2 h gegen TE (Tris-HCl 10 mM, EDTA 1 mM pH 8.0) dialysiert, mit Ethanol gefällt und in je 50 μl TE gelöst.
Als Kloniervektor wurde Lambda DASH II (Fa.Stratagene) verwendet. Nach Restriktion des Vektors mit -BαmHI und Hindlll wurden die beiden Vektorarme präpariert, wie von Sambrook et al.(1989) angegeben. 1 μg davon wurden mit ca. 500 ng der DNA Fragmente in 20 μl Ligationsmix (Tris-HCl 66 mM, MgCl2 5 mM, DTE 1 mM, ATP 1 mM, pH 7.5) mit 16 Einheiten T4-DNA-Ligase (Fa.Boehringer Mannheim) 16 h bei 12 °C ligiert. Je 4 μl des Ansatzes wurden mit Packaging-Extrakten (Gigapak II, Fa.Stratagene) in Lambda Phagenhüllen verpackt. Als Wirtstamm für die Infektion wurde E.coli SRB (Fa.Stratagene) verwendet, die Bakteriophagen-Lambda kompetenten Zellen wurden nach Sambrook et al.(1989) hergestellt. Nach der Infektion wurden die Ansätze in Aliquots auf LB-Medium (Maniatis et al., 1982) mit 10 mM MgSO4 plattiert, als Indikatorstamm wurde wiederum E.coli SRB verwendet. Rekombinante Klone wurden als Plaques im Bakterienrasen erkennbar. Ca. 50000 Plaques wurden mit SM-Puffer (5,8 g/1 NaCl, 2 g/1 MgSO4 x 7H20 und 50 mM Tris-Cl pH 7.5) abgeschwemmt, und die so erhaltene Genbank wurde in Aliquots bei 4 °C gelagert. Eine Titerbestimmung ergab ca. 1 x 108 pfu/ml.
Eine Analyse von 30 willkürlich ausgewählten Klonen durch Isolierung und Restriktion der enthaltenen Lambda-DNA ergab, daß alle Klone rekombinante Lambda-Phagen enthielten; die durchschnittliche Insertgröße betrug 15 kb.
Beispiel 8: Konstruktion einer genomischen Cosmid-Genbank von Tolypocladium niveum
Zweimal 135 μg DNA aus Beispiel 6 wurden mit 7.5 bzw. 15 Einheiten des Re¬ striktionsenzyms Ndell, wie im Beispiel 7 beschrieben, geschnitten. Aliquots der Re¬ striktionen wurden überprüft und ergaben ein Maximum der erhaltenen Fragmente bei etwa 45 bzw. 30 kb.
Mit einem Gradientenmischer wurden in Ultrazentrifugenröhrchen lineare NaCl- Dichtegradienten von 30 % bis 5 % in 3 mM EDTA pH 8.0 hergestellt und die DNAs aufgetragen. Nach Zentrifugation wurde der Gradient in 500 μl Fraktionen geerntet. Nur Fraktionen mit DNA von mehr als 30 kb und weniger als 50 kb wurden dreimal 2 h gegen TE dialysiert, mit Ethanol gefällt und in je 50 μl TE gelöst.
Als Kloniervektor wurde sCos 1 (Fa.Stratagene) verwendet. Die BamTR und Xbäl geschnittenen Vektorarme wurden hergestellt und modifiziert wie von Evans et al (1989) angegeben. 1 μg davon wurden mit ca. 500 ng der DNA Fragmente ligiert und in Lambda Phagenhüllen verpackt. Als Wirtstamm für die Infektion wurde E.coli SRB (Fa.Stratagene) verwendet. Nach der Infektion wurden die Ansätze in Aliquots auf LB-Medium mit 75 μg/ml Ampicillin plattiert. Rekombinante Klone wurden als Kolonien nach 20 h bei 37 °C er¬ kennbar. Insgesamt wurden ca. 50000 Kolonien erhalten, die dann in 0.9 % NaCl/20 % Glycerin suspendiert und bei -70 °C gelagert wurden. Eine Analyse von 40 willkürlich ausge¬ wählten Klonen durch Isolierung und Restriktion der enthaltenen Cosmide ergab, daß alle Klone rekombinante Cosmide enthielten; die durchschnittliche Insertgröße betrug 36 kb.
Beispiel 9: Auswahl und Prüfung geeigneter Oligonukleotidgemische
Zur Herstellung der Hybridisierungssonde ließ sich aus der Aminosäureteilsequenz asl750 der Alanin Racemase (Beispiel 5) durch reverse Translation unter Verwendung des universellen genetischen Codes die folgende DNA-Sequenz ableiten:
ALA TRP ALA ASP GLU GLN GLU ILE ALA ILE HIS ILE ASP GLY ALA ARG ILE TRP
GCN TGG GCN GAC GAA CAA GAA ATA GCN ATA CAC ATA GAC GGN GCN CGN ATA TGG GAT GAG CAG GAG ATC ATC CAT ATC GAT AGA ATC
ATT ATT ATT AGG ATT
Davon ausgehend wurden drei Oligonukleotidgemische synthetisiert, die einem bestimmten Teil der Sequenz des nicht codierenden Stranges entsprechen (unterstrichener Bereich):
Oligo R13: Länge: 23mer 64fach degeneriert
5'- GC AAT TTC TTG TTC ATC AGC CCA - 3' C C C G C
G T
Oligo R14: Länge: 23mer 64fach degeneriert GC GAT TTC TTG TTC ATC AGC CCA - 3' C C C G C
G T
Oligo R15: Länge: 23mer 64fach degeneriert
5'- GC TAT TTC TTG TTC ATC AGC CCA - 3' C C C G C
G
T
Je ca. 10 pmol dieser Oligonukleotid-Gemische wurden in 20 μl Puffer (50 mM Tris-Cl pH 7.6, 10 mM MgCl2 , 5 M Dithiothreitol, 0.1 mM Spermidin HC1, 0.1 mM EDTA (pH 8)) mit 50 μCi gamma-32P-ATP (6000 Ci/mmol) und 8 Einheiten T4-Polynukleotid-Kinase (Fa. Boehringer Mannheim) für 45 min bei 37 °C radioaktiv markiert. Mehr als 80 % der Radioaktivität wurden in die Oligonukleotide eingebaut.
Zum Testen der Hybridisierung wurden je 10 μg genomische DNA von Tolypocladium niveum (Beispiel 6) mit SaR, EcoRl und mit HindlR geschnitten und in Southern- Hybridisierungen untersucht Das 0.8 % Agarosegel wurde mittels Vakuum-Blotting (Vacublot, Fa. Pharmacia) auf eine Nylon-Membran (Duralon-UV, Fa. Stratagene) übertragen. Die Vorhybridisierung wurde 16 h bei 37 °C in 5 ml / 100 cm2 6 x SSPE (Maniatis et al. 1982), 5 x Denhardt's Lösung (Maniatis et al., 1982), 0.5 % SDS, 100 μg/ml hitzedenatu¬ rierte Heringssperma-DNA, 0.1 mM ATP durchgeführt. Vor der Zugabe des entsprechenden 32P-markierten Oligonukleotid-Gemisches wurde die Temperatur auf 65 °C erhöht, anschließend für je 1.5 h auf 55 °C, 45 °C und schließlich auf 37 °C gestellt. Die Hybridisierung wurde für 16 h bei 37 °C durchgeführt.
Die Membranen wurden 5 min und 30 min in 6 x SSC (Maniatis et al., 1982) bei 4°C gewaschen. Anschließend wurden die Membranen für 5 min bei Raumtemperatur in einer Tetramethylammoniumchlorid (TMAC) Waschlösung (3.00 M TMAC, 50 mM Tris (pH 8.0), 2 mM EDTA, 0.1 % SDS) (Wood et al., 1985) gewaschen. Schließlich wurde zweimal 40 min bei der stringenten Temperatur 56 °C in TMAC-Waschlösung gewaschen. Die Membranen wurden in Folie eingeschweißt und für 14 Tage mit Kodak Verstärkerfolie auf Röntgenfilm (XOmatik AR, Fa.Kodak) bei -70 °C exponiert. Bei den Hybridisierungen mit den Oligonukleotidgemischen R13 und R15 konnten keine Signale detektiert werden, während jene mit R14 positiv waren. Bei den Restriktionen wurde jeweils eine Bande erkennbar, für die Restriktion mit SaR wurde diese bei etwa 2.9 kb lokalisiert, für EcoRI und HindRl lagen die Größen jeweils über 6 kb.
Beispiel 10: Isolierung von Lambda-Klonen, die mit einem Alanin Racemase-spezifischen
Oligonukleotid hybridisieren
Aliquots der Lambdabank aus Beispiel 7 wurden auf LB Medium (Maniatis et al., 1982) mit 10 mM MgSO4 in einer geeigneten Verdünnung aufgebracht, um einen Titer von etwa 2500 Plaques je Platte zu erreichen. Es wurden insgesamt ca. 20000 Plaques untersucht. Der Transfer auf Nylon-Membranen (Duralon-UV, Fa. Stratagene) wurde wie vom Hersteller empfohlen durchgeführt. Das Screening der Genbank wurde unter gleichen Hybridisierungs¬ und Waschbedingungen durchgeführt, wie in Beispiel 8 beschrieben. Es wurden vier positive Signale auf den Röntgenfilmen gefunden. Die entsprechenden Bereiche der Agaroseschicht der Platten wurden ausgestochen und in SM-Puffer (5,8 g/1 NaCl, 2 g/1 MgSO4x7H20, 50 mM Tris-Cl pH 7.5) resuspendiert. Eine geeignete Verdünnung wurde erneut mit E.coli SRB auf LB-Medium mit 10 mM MgSO4 plattiert, und die Plaques wurden wiederum auf Membranen übertragen. Durch neuerliche Hybridisierung und in der Folge durch eine dritte analog durchgeführte Hybridisierungsrunde wurden die positiven Klo¬ ne gereinigt.
Die DNA der vier Lambda-Klone, Lambda RAC1 bis Lambda RAC4, wurde isoliert und durch Restriktionsanalysen und anschließende Hybridisierung mit dem radioaktiv markierten Oligonukleotidgemisch R14 (Beispiel 9) untersucht. Es zeigte sich, daß unter anderem ein ca. 1.1 kb großes Pstl-Restriktionsfragment ein positives Signal liefert. Abbildung 1 zeigt die Restriktionskarte des Tolypocladium m'veu/n-Anteils eines solchen Lambda-Klons (=Lambda RAC4).
Beispiel 11: Klonierung von Subfragmenten aus Lambda RAC4
Um das ca. 1.1 kb große -P-stl-Fragment (Beispiel 10) zu klonieren, wurden ca. 10 μg Lambda RAC4 mit Pstl vollständig geschnitten und das ca. 1.1 kb Pstl Fragment aus einem 1.0 % Agarosegel eluiert (Geneclean II, Fa. BiolOl). Der Plasmidvektor pUCBM20 (Fa. Boehringer Mannheim) wurde ebenfalls mit Pstl restringiert und mit alkalischer Phosphatase aus Kälberdarm (Fa. Boehringer Mannheim) nach den Angaben der Hersteller behandelt. Je ca. 200 ng gereinigtes Pstl-Fragment aus Lambda RAC4 und pUCBM21 wurden mit 1 Einheit T4-DNA-Ligase ligiert. Nach Transformation in E.coli XL1 Blue (Fa. Stratagene) wurde das entsprechende Plasmid isoliert. Es wurde pRPl genannt und. durch Restriktionsanalysen cha¬ rakterisiert; eine Restriktionskarte ist in Abbildung 2 dargestellt.
Analog dazu wurde auch noch das ca. 1.9 kb große EcoRI-Sα/I-Fragment aus Lambda RAC4 (Abbildung 1) in den entsprechend geschnittenen Plasmidvektor pUCBM20 (Fa.Boehringer Mannheim) kloniert. Das entstandene Plasmid wurde pRP6 genannt und ist in Abbildung 3 dargestellt.
Als weiteres Fragment wurde das ca. 650 bp große HindlU-Pstl-Fragment aus Lambda RAC4 (Abbildung 1) in den ebenso geschnittenen Plasmidvektor pBluescript II SK+ (Fa.Stratagene) eingebaut. Das resultierende Plasmid wurde mit pRP9 bezeichnet und ist in Abbildung 4 dargestellt.
Mit diesen beiden letzten Konstruktionen wurde auch der benachbarte Bereich zu dem in der Ηybridisierung mit R14 positiven Pstl-Fragment abgedeckt.
Beispiel 12: Isolierung des GAPDΗ - Gens aus Tolypocladium niveum
Aliquots der Cosmidbank aus Beispiel 8 wurden auf LB-Medium mit 70 μg/ml Ampicillin in einer geeigneten Verdünnung aufgebracht, um einen Titer von etwa 200 Kolonien je Platte zu erreichen. Der Transfer auf Nylon-Membranen und die Lyse der Kolonien wurde wie vom Hersteller empfohlen durchgeführt. Zur Präparation der Hybridisierungssonde wurden ca. 20 μg des Plasmids pAP21, das einen Teil des GAPDH-Gens aus Penicillium chrysogenum enthält (Pfitzner, 1988), vollständig mit dem Restriktionsenzym SaR geschnitten. Das ca. 4 kb große Sα/I-Fragment wurde aus einem 0.8 % Agarosegel eluiert (Geneclean II, Fa. BiolOl) und mittels Nick-Translation radioaktiv mit alpha-32P-dATP markiert (Sambrook et al.1989).
Zum Testen der Hybridisierung wurden 10 μg genomische DNA von Tolypocladium niveum (Beispiel 6) mit Sacl und mit Hindl geschnitten und in Southern-Hybridisierungen untersucht. Das 0.8 % Agarosegel wurde mittels Vakuum-Blotting (Vacublot, Fa. Pharmacia) auf eine Nylon-Membran übertragen. Die Vorhybridisierung wurde 7 h bei 42 °C in 5 x SSC, 40 % Formamid, 5 x Denhardt's (Maniatis et al., 1982), 0.1 % SDS, 0.25 mg/ml denaturierte Heringssperma-DNA, 25 mM NaH2PO4 pH 6.5 in einem Volumen von 10 ml pro 100 cm2 Membran durchgeführt. Nach Zugabe der markierten Sonde wurde weitere 16 h bei 42 °C inkubiert. Der Blot wurde zweimal gewaschen. Nach Autoradiographie mit Kodak Verstärkerfolie auf Röntgenfilm (Xomatic AR, Fa. Kodak) wurde pro Restriktionsverdau je¬ weils nur eine Bande erkennbar (ca. 2.2. kb Fragment bei Sacl, ca. 3.3 kb Fragment bei Hindlll).
Das Screening der Cosmidbank wurde unter gleichen Hybridisierungs- und Wasch¬ bedingungen durchgeführt. Pro etwa 600 getestete Kolonien wurde eine positive Kolonie gefunden. Eine Kolonie wurde gereinigt und die Cosmid-DNA daraus isoliert. Das erhaltene Cosmid wurde gpdcosl genannt. Durch Restriktionsverdaue wurde die inserierte genomische Tolypocladium niveum DNA mit ca. 36 kb bestimmt. Restriktionsfragmente, die Teile des GAPDH-Strukturgens enthielten, wurden durch Hybridisierung von Southern Blots mit der Screening-Sonde identifiziert. Ein ca. 2.2 kb großes Sαcl-Restriktionsfragment ergab ein deut¬ liches Signal; dies entsprach der Fragmentgröße in den Southern-Hybridisierungen mit genomischer DNA. Das Fragment wurde in den Plasmidvektor pUC18 (Fa. Boehringer Mannheim) umkloniert.
Dazu wurden ca. 10 μg gpdcosl DNA mit Sacl vollständig geschnitten und das 2.2 kb Sacl Fragment aus einem 0.7 % Agarosegel eluiert. Der Plasmidvektor pUC18 wurde ebenfalls mit Sacl restringiert und mit alkalischer Phosphatase aus Kälberdarm (Fa. Boehringer Mannheim) nach den Angaben der Hersteller behandelt. Je ca. 200 ng gereinigtes Sαcl-Fragment aus gpdcosl und pUC18 wurden mit 1 Einheit T4-DNA-Ligase ligiert. Nach Transformation in E.coli HB101 wurde das entsprechende Plasmid isoliert. Es wurde pGTl genannt und durch Restriktionsanalysen charakterisiert; eine Restriktionskarte ist in Abbildung 9 dargestellt. Darüberhinaus wurde auch die vollständige Nukleotidsequenz des gesamten Sαcl-Fragmentes nach der Methode von Sanger (Sanger et al., 1977) mittels Sequenase (Fa. USB) bestimmt. Die Sequenz ist in Abbildung 10 dargestellt und umfaßt 2271 Nukleotide).
Beispiel 13: Isolierung von cDNA - Klonen des GAPDH - Gens aus Tolypocladium niveum
Um eine cDNA-Bank zu konstruieren, wurde zunächst die Roh-RNA, wie im Beispiel 17 beschrieben, isoliert. Die Anreicherung der poly(A+)-RNA geschah durch eine Oligo(dT)-Zel- lulose-Affinitätschschromatographie, wie sie in Maniatis et al.(1982) beschrieben ist. Dazu wurde die Roh-RNA nach Zentrifugation und Trocknung in Wasser gelöst. Nach der Chromatographie wurden Fraktionen, die poly(A+) -RNA enthielten, erneut mit Ethanol gefällt und bei -70°C aufbewahrt. Die Integrität der RNA wurde durch Gelelektrophorese in Gegenwart von Formaldehyd überprüft, die Konzentration wurde durch UV-Absorption bestimmt. 5 μg der poly(A+)-RNA wurden mit Reverser Transkriptase und einem oligo(dT)- Primer in Gegenwart der vier Desoxynukleosidtriphosphate in eine komplementäre einzel- strängige DNA umgesetzt. Durch die Enzyme RNaseH und DNA-Polymerase wurde daraus ein doppelsträngiges Molekül synthetisiert (Sambrook et al., 1989). Nach dem enzymatischen Anfügen von geeigneten EcoRI-Adaptoren, wozu Polynukleotidkinase und T4-DNA-Ligase verwendet wurden, erhielt man eine lineare doppelsträngige cDNA, die in Kloniervektoren eingebaut werden konnte. Für diese Umsetzungen wurde ein cDNA-Synthese-Kit verwendet (Fa. Pharmacia), der die nötigen Enzyme und das Adapter-Oligonukleotid enthielt. Die Durchführung der Reaktionen erfolgte nach den Angaben des Herstellers. Die synthetisierte cDNA wurde in den Vektor λgtlO (Sambrook et al., 1989) einkloniert. 80 μl der cDNA- Präparation wurden dazu mit 16 μl λgtlO-DNA (8 μg) vermischt, die vorher mit EcoRI gespalten und mit alkalischer Phosphatase behandelt wurde. Nach Zugabe von 3 μl 3M Natriumazetat (pH 5,2) wurde die DNA mit Εthanol gefällt. Die DNA wurde dann in 30 mM Tris-Cl pH 7,5, 10 mM MgCl2, 10 mM DTΕ, 2,5 mM ATP nach Zugabe von 0,5 U T4- DNA-Ligase 16 h bei 16°C ligiert (DNA-Konzentration 500 μg/ml). Das Ligationsgemisch wurde mit Hilfe von Protein-Extrakten in vitro verpackt. Die entstandenen λ-Lysate wurden mit E. coli CόOOhfl (Fa. Promega Inc.) getitelt. Erhalten wurden etwa 4,5xl05 pfu. Als Sonde für das Screning wurde das 665 bp große Hindlll-Hindll Restriktionsfragment aus dem Plasmid pGTl (siehe Beispiel 12) verwendet. Dazu wurden 10 μg DNA von pGTl mit den Restriktionsenzymen Hindlll und Hindll (Fa. Boehringer Mannheim) nach den Angaben der Hersteller geschnitten und das entsprechende Restriktionsfragment aus einem 0.8 % Agarosegel isoliert. Nach Markierung mit alpha-32P-dATP über Random-Primer Polymerisation (Fa. Stratagene) wurde das Fragment zur Hybridisierung eingesetzt. Die Vorhybridisierung wurde 20 h, die Hybridisierung 18 h bei 42 °C in 6 x SSC, 50 % Formamid, 1 % SDS, 50 μg/ml Heringsperma-DNA durchgeführt. Die Filter wurden 2 x 10 min in 2 x SSC / 0.1 % SDS bei 25 °C und 2 x 45 min in 1 x SSC / 0.1 % SDS bei 60 °C gewaschen. Die Membrane wurden 14 h auf Röntgenfilm (Xomatic AR, Fa. Kodak) expo- niert. 2.5 bis 3.5 % aller Plaques zeigten ein starkes Signal.
Regionen mit einzelnen solcher positiver Plaques wurden aus der Platte ausgestochen und durch zwei weitere Hybridisierungsrunden mit verdünnteren Plattierungen analog zur ersten gereinigt. Lambda-DNA wurde nach Standardmethoden isoliert (Sambrook et al. 1989). Die ca. 1.3 kb großen cDNA-Inserts aus 2 verschiedenen Klonen wurden als EcoRI-Fragmente in das Plasmid pUCBM20 (Fa. Boehringer Mannheim) und den Phagenvektor M13mpl8 (Fa. Boehringer Mannheim) nach Standardmethoden eingebaut Die entstandenen Konstruktionen wurden pGT4 und pGT5 bzw. M13GT4 und M13GT5 benannt. Mit Hilfe der M13-Klone wurde einzelsträngige DNA hergestellt, die mittels der Didesoxynukleotid-Methode nach Sanger (Sanger et al., 1977) von beiden Enden her ansequenziert wurden. Es zeigte sich, daß das Insert von Klon M13GT4 einen 33 bp langen PolyA-Bereich aufweist, bei Klon M13GT5 fehlten 2 bp am 5 '-Ende und 20 bp am 3 '-Ende, sowie der PolyA-Bereich. Eine Restriktionskarte des offensichtlich vollständigen cDNA-Klons pGT4 ist in Abbildung 11 dargestellt. Die gesamte Nukleotidsequenz der cDNA wurde bestimmt; sie umfaßte 1333 Nukleotide ohne Adaptor- Moleküle und ist in Abbildung 12 angeführt. Ein Vergleich der genomischen und der cDNA-Sequenz zeigte die Lage von zwei Introns, wobei eines am Anfang des Sαcl-Fragmentes liegt, wie aus Abbildung 14 hervorgeht. Daraus wurde deutlich, daß der Promotorbereich des GAPDH-Gens nicht auf dem genomischen Sαcl-Fragment aus pGTl (siehe Beispiel 12) enthalten ist.
Beispiel 14: Isolierung des Promotorbereiches des GAPDH-Gens aus Tolypocladium niveum
20 μg DNA des Cosmidklones gpdcosl (siehe Beispiel 12) wurden gemeinsam mit den Restriktionsenzymen Xhol und SaR geschnitten. Durch Southernhybridisierung mit dem 665 bp großen Hiwdlll-Hi'nrfll-Fragment aus pGTl wurde ein ca. 1250 bp großes Fragment identi¬ fiziert. Dieses wurde aus einem 0.8 % Agarosegel präpariert und nach Standardmethoden (Sambrook et al., 1989) in den Sα I-geschnittenen und dephosphorylierten Plasmidvektor pBluescriptll SK+ (Fa. Stratagene) und in den ebenso behandelten Phagenvektor M13mpl8 eingebaut. Die vollständige Nukleotidsequenz des Inserts wurde nach der Methode nach Sanger (Sanger et al., 1977) bestimmt. Sie ist in Abbildung 13 dargestellt und entspricht dem Sequenzbereich von bp 1 bis 1278 in Abbildung 14. Der Vergleich der genomischen Sequenz des gesamten vorliegenden Promotor und Strukturgen-Bereiches mit der cDNA- Sequenz zeigte die Lage zweier Introns (Abbildung 14). Das erste liegt im 5'-nicht translatierten Bereich von Pos. 550 bis 664 (115 bp), das zweite wesentlich längere Intron liegt im eigentlichen Strukturgen und wurde bei Pos. 802 bis 1218 lokalisiert (417 bp). Aus der Translation der cDNA-Sequenz ergab sich eine 338 Aminosäuren lange Primärsequenz der GAPDH aus Tolypocladium niveum mit einer abgeleiteten relativen Molmasse von 36121.
Beispiel 15: Bestimmung von Teilseαuenzen des Alanin Racemase Gens
Die zusammengefügte Nukleotidsequenz des ca. 1,1 kb große Pstl-Insert in pRPl, des ca. 1,9 kb grosse EcoRI-Sall-Fragment aus pRP6, des ca. 650 bp grossen Pstl-Hindlll-Fragment aus pRP9, sowie noch zusätzlich 511 bp anschliessend an die Hindlü-Stelle ist in Abbildung 5 dargestellt und umfaßt 3973 Nukleotide.
Die Sequenzierung erfolgte nach der modifizierten Didesoxynukleotid-Methode unter Ver¬ wendung von Sequenase (Fa. United States Biochemical) nach den Angaben des Herstellers.
Beispiel 16: Vergleich der abgeleiteten Aminosäuresequenzen
Translatiert man die Nukleotidsequenz aus Beispiel 15, so findet man von Pos. 2557 bis Pos. 2610 der Abbildung 5 den Bereich der Aminosäureteilsequenz as 1750 wieder, die ja auch zur Ableitung der Screeningsonde diente:
2557 2610
I I
GCT TGG GCT GAC GAG CAG GAG ATC GCC ATT CAC ATC GAC GGT GCG CGG ATA TGG
ALA TRP ALA ASP GLU GLN GLU ILE ALA ILE HIS ILE ASP GLY ALA ARG ILE TRP
= as 1750
Außerdem finden sich folgende weitere Teilsequenzen:
2992 3021
I I
TCC ACA CTG GAC ACG GCT GCT CAG CAC CGT
SER THR LEU ASP THR ALA ALA GLN HIS ARG = as 1751
1983 2018
I I
GCA CGT CAT TGG GGA GAT CCC ACT CTC ACT GGC TCA
ALA GLY HIS TRP GLY ASP PRO THR LEU THR GLY SER
•= as 1753
2242
I
GAA GCA GCT CTG TTT GTT GTG TCC GGG ACC ATG GCC AAC CAG ATT GCC TTA GGA
GLU ALA ALA LEU PHE VAL VAL SER GLY THR MET ALA ASN GLN ILE ALA LEU GLY
2301
I GCG CTG
ALA LEU
= as 1758
Die Lage der aufgefundenen Aminosäureteilsequenzen in dem bestimmten Sequenzbereich ist in Abbildung 6 dargestellt. Es ergibt sich daraus eine Lage des Gens in Sall -> Hind l Richtung.
Beispiel 17: Isolierung von RNA aus dem Mycel von Tolypocladium niveum und
Northernhybridisierung
Ein 11-Erlenmeyerkolben mit 100 ml Medium 4 (Dreyfuss et al., 1976), wurde mit einer Sporensuspension von Tolypocladium niveum ATCC34921 beimpft (ca.l x 107 Sporen/ml) und 96 h bei 250 Upm und 25°C geschüttelt. Ein 11-Erlenmeyerkolben mit 100 ml Medium 5 (Dreyfuss et al. , 1976 ) wurde mit 10 ml der Vorkultur beimpft und 7 Tage bei 25°C und 250 Upm geschüttelt. Die Konzentration von Cyclosporin A wurde bestimmt (Dreyfuss et al., 1976). Erreicht wurden ca. 100 μg/ml. Aus ca. 6 g Mycelfeuchtmasse wurde RNA isoliert; dazu wurde das Mycel abzentrifugiert, mit 40 ml TE (10 mM Tris-Cl, 1 mM EDTA, pH 7.5) gewaschen und unter flüssigem Stickstoff in einer Reibschale zu einem feinem Pulver zer¬ rieben. Die RNA-Isolierung erfolgte nach der leicht modifizierten Methode von Chomczynski und Sacchi (1987). Dazu wurden je 1 g Feuchtmycel mit 20 ml RNAzol (Fa. Biomedica) nach den Angaben des Herstellers aufgearbeitet. Erhalten wurden ca. 0.7 mg RNA je 1 g Feuchtmycel, die ethanolgefällt bei -20°C aufbewahrt wurden. 10 μg der RNA wurden auf einem 1 %igen Agarose-Gel, das 0.6 M Formaldehyd enthielt, nach der bei Sambrook et al. (1989) beschriebenen Methode aufgetrennt. Die Proben wurden 2 min auf 95 °C erhitzt und bei konstanten 70 V 2.5 h aufgetrennt. Das Gel wurde dreimal 20 min in 2 x SSC geschüt¬ telt, auf Duralon UV Membranen (Fa. Stratagene) mittels Vakuum geblottet und durch UV- Behandlung fixiert.
Als Hybridisierungssonde wurde das 1078 bp große Pstl Restriktionsfragment aus dem Plas¬ mid pRPl (siehe Beispiel 11) verwendet, als Hybridisierungssonde für das GAPDH-Gen diente das 665 bp grosse Hindlll-Hindll Restriktionsfragment aus dem Plasmid pGTl (Beispiel 12).
Dazu wurden ca. 10 μg DNA von den Plasmiden mit den entsprechenden Restriktionsenzymen (Fa.Boehringer Mannheim) nach den Angaben der Hersteller geschnitten und das entsprechende Restriktionsfragment aus einem 0.8 % Agarosegel mittels Adsorption an Glas-"Beads" (Geneclean II, Fa. BiolOl) isoliert. Nach Markierung mit alpha-32P-dATP über Random-Primer Polymerisation (Fa. Stratagene) wurde das Fragment zur Hybridisierung eingesetzt.
Die Vorhybridisierung wurde 20 h, die Hybridisierung 18 h bei 42 °C in 6 x SSC, 50 % Formamid, 5 x Denhardt's (Maniatis et al., 1982), 0.1 % SDS, 0.25 mg/ml denaturierte Heringssperma-DNA, 25 mM NaH2Pθ4 pH 6.5 in einem Volumen von 10 ml pro 100 cm2 Membran durchgeführt. Der Blot wurde zweimal 10 min mit 2 x SSC / 0.1 % SDS bei 25 °C und zweimal 30 min mit 0.5 x SSC / 0.1 % SDS bei 60 °C gewaschen. Nach Autoradio- graphie mit Kodak Verstärkerfolie auf Röntgenfilm (Xomatic AR, Fa. Kodak) für ca. 48 - 96 h bei -70 °C wurde sowohl im Fall des Alanin Racemase Gens, als auch des GAPDH-Gens eine Bande auf dem Röntgenfilm sichtbar.
Beispiel 18: Protoplastierung von Tolypocladium niveum
200 ml Medium 1 (Maltose (Monohydrat) 50 g/1, Caseinpepton, tryptisch verdaut (Fluka 70169) 10 g/1, KH2PO4 5 g/1, KC1 2.5 g/1 pH 5.6) in einem Erlenmeyerkolben wurden mit 109 Sporen von Tolypocladium niveum ATCC34921 beimpft und bei 27 °C, 250 Upm für ca. 70 h inkubiert. Es wurden 200 μl (0.1 %) ß-Mercaptoethanol zugesetzt und weitere 16 h inkubiert. Das Mycel wurde durch Zentrifugation geerntet (Beckman Zentrifuge J2-21, Rotor JA 14, 8000 Upm, 20 °C, 5 min), in 40 ml TPS (NaCl 0.6 M, KH2PO4 / Na^O, 66 mM pH 6.2) gewaschen und das Pelletvolumen durch Zentrifugation in kalibrierten Röhrchen bei 2000 g (in Beckman Zentrifuge GPR, Rotor GH3.7, 3000 Upm, 5 min) abgemessen. Das Mycel wurde in TPS suspendiert (je 1 ml Pelletvolumen wurden 3 ml TPS verwendet) und das gleiche Volumen Protoplastierungslösung zugesetzt (Novozym 234 10 mg/ml (Fa. Novo Industri, Charge PPM-2415), Cytohelicase 5 mg/ml (Fa. IBF), Zymolyase 20T 1 mg/ml (Fa. Seikagaku Kogyo, C.No.120491) in TPS). Es wurde bei 27 °C und 80 Upm für ca. 60 min inkubiert. Die Protoplasten wurden durch Milchfilter filtriert, abzentrifugiert (700 g, 10 min) und in insgesamt 4 ml TPS aufgenommen. Je 1 ml dieser Suspension wurde auf 4 ml 35% Saccharose-Lösung aufgetragen und bei 600 g, 20 °C, für 20 min zentrifugiert. Die Protopla¬ sten-Banden an der Phasengrenzfläche wurden abgezogen, mit TPS auf je 10 ml verdünnt, abzentrifugiert, in je 200 μl TPS vorsichtig resuspendiert und die Suspensionen vereinigt. Pro 1 ml Pelletvolumen Ausgangsmycel (siehe oben) wurden ca. 2 x 108 Protoplasten erhalten.
Beispiel 19: Transformation von Tolypocladium niveum
Die Protoplastensuspension aus Beispiel 18 wurde abzentrifugiert (700 g, 10 min) und in 1 M Sorbit, 50 mM CaCl2 in einer Dichte von lxlO8 suspendiert. Jeweils 90 μl dieser Suspension wurden mit 10 μl der zu transformierenden Vektor-DNA versetzt (1 - 10 μg, gelöst in Tris-HCl 10 mM, EDTA 1 mM, pH 8.0) und 25 μl PEG 6000-Lsg zugegeben (25 % PEG 6000, 50 mM CaCl2, 10 mM Tris-HCl, pH 7.5, frisch hergestellt aus den Stamm¬ lösungen: 60 % PEG 6000 (Fa.BDH), 250 mM Tris-HCl pH 7.5, 250 mM CaCl2). Der Trans¬ formationsansatz wurde 20 min auf Eis gestellt und anschließend wurden weitere 500 μl der gemischten PEG 6000-Lösung zugegeben und vorsichtig durchmischt. Nach 5 min bei Raum¬ temperatur wurde 1 ml 0.9 M NaCl, 50 mM CaCl2 zugesetzt, der ganze Ansatz zu 7 ml aufgeschmolzenem und auf 45 °C temperiertem Weichagar des entsprechenden Selek¬ tionsmediums gegeben und auf entsprechende, vorgewärmte Platten ausgegossen. Im Falle, daß die zu transformierenden Vektor-DNA das amdS-Gen aus Aspergillus nidulans enthält, z.B. Plasmid p3SR2 (Hynes et al., 1983), wurde der ganze Ansatz zu 7 ml aufge¬ schmolzenem und auf 45 °C temperiertem Weichagar TMMAAC+N gegeben und auf vorge¬ wärmte TMMAAC+N Platten ausgegossen. Medium TMMAAC+N enthält Glukose 6 g/1, KH2PO4 3 g 1, KC1 0.5 g/1, MgSO4 * 7 H2O 0.4 g/1, CaCl2 * 2 H2O 0.2 g/1, Acrylamid 8 mM, CsCl 2.1 g/1, Spurenelement-Lösung 1 ml/1, 0.6 M NaCl; für Platten wurden 15 g/1 für Wei- chagar 7 g/1 Agar-Agar (Merck) zugesetzt Die Spurenelement-Lösung enthält 1 mg/ml FeSO4 * 7 H2O, 9 mg/ml ZnSO4 * 7 H2O, 0.4 mg/ml CuSO4 * 5 H2O, 0.1 mg/ml MnSO4 * H2O, 0.1 mg/ml H3BO3 und 0.1 mg/ml Na2MoO4 * H2O. Transformanten waren in der Lage, Acrylamid als Stickstoffquelle im Medium zu nutzen und konnten daher nach etwa drei Wochen bei 25 °C als Kolonien gegenüber schwachem Hintergrundwachstum identifiziert werden.
Für die Transformation mit dem Hygromycin-Resistenzgen wurde der Ansatz in 7 ml TM88- NaCl-Weichagar (20 g/1 Malt extract,4 g/1 Yeast extract, 10 g/1 Bacto Agar, 0.6 M NaCl, pH 5.7) (45°C) gegeben und auf TM88-NaCl-Platten (ca. 20 ml TM88-NaCl-Agar: 20 g/1 Malt extract,4 g/1 Yeast extract, 30 g/1 Bacto Agar, 0.6 M NaCl, pH 5.7) ausgegossen. Nach 15 - 20 h bei 25°C wurde mit 7 ml TM88-NaCl-Weichagar mit 500 μg/ml Hygromycin (Boehrin¬ ger Mannheim) (45°C) überschichtet. Hygromycinresistente Transformanten ließen sich nach 7 Tagen bei 25 °C als Kolonien auf den Platten nachweisen.
Beispiel 20: Konstruktion des Vektors pGT24
Basierend auf der bestimmten Nukleotidsequenz des GAPDH-Gens (siehe Beispiel 14) wurden folgende Oligonukleotide abgeleitet und synthetisiert:
P3 5' CGACCTCGAGAACATTCGTTGTGCACCGT 3'
P4 5' GGGGATCCATGGTGTACGCTGCGGAGTTAGCGG 3'
P3 entspricht von seiner Pos. 5 - 29 dem Bereich von Pos. 1 - 25 der Nukleotidsequenz der Abbildung 14 des GAPDH-Gens, enthält also die natürliche Xhό - Schnittstelle (CTCGAG); P4 entspricht dem Bereich von Pos. 670 bis 650 (komplementär zur Sequenz des GAPDH- Gens) die ersten 12 Nukleotide von P4 enthalten die Erkennungs stellen für die Restriktionsenzyme Ncol (CCATGG) und BamYR (GGATCC). Mit Hilfe dieser Primer wurde aus der genomischen DNA von Tolypocladium niveum der zwischen den Primern liegende Bereich amplifiziert (35 Zyklen: 2 min 95 °C, 1 min 20 sek 56 °C, 1 min 20 sek 72 °C). Das gebildete DNA-Fragment von ca. 680 bp Größe wurde nach Chloroformextraktion und Ethanolfällung mit den Restriktionsendonukleasen Bam→T und Xhόl geschnitten (nach Angaben des Herstellers, Fa. Boehringer Mannheim) und nach Standardmethoden in die ebenso präparierte Plasmid-Vektor-DNA pBluescriptll SK+ (Fa. Stratagene) eingebaut Das resultierende Plasmid wurde pGT12 genannt und ist in Abbildung 16 dargestellt. Analog wurden die folgende Oligonukleotide wurden aus der Nukleotidsequenz des GAPDH- Gens abgeleitet und synthetisiert:
P8: 5' GGGGCGGCCGCCATGGAGAATAGACACG 3'
P9: 5' CCCCGCGGGCTCΓTCΓTTTTCTGTTG 3'
Der Primer P8 entspricht in seinen Pos. 10 bis 28 den Pos. 2301 bis 2319 in der Abbildung 14, in den Pos. 4 bis 11 ist eine Erkennungs stelle für das Restriktionsenzym Notl (GCGGCCGC) enthalten. Der Primer P9 entspricht in seinen Pos. 9 bis 28 dem komplememtären Strang der Pos. 2855 bis 2838 in der Abbildung 14, die Pos. 3 bis 8 stellen die Erkennungsstelle für das Enzym Kspl (CCGCGG) dar. Die Primer schließen den Bereich des vermutlichen Terminationsbereiches des GAPDH-Gens ein. Mit ihrer Hilfe wurde, gleich wie oben beschrieben, das entsprechende DNA-Fragment aus der genomischen DNA von Tolypocladium niveum amplifiziert* Das entsprechende DNA-Fragment wurde aus der genomischen DNA von Tolypocladium niveum amplifiziert. Nach Restriktion dieser amplifizierten DNA mit den Enzymen Notl und Kspl (nach Angaben des Herstellers, Fa. Boehringer Mannheim) wurde das Fragment in den ebenso präparierten Vektor pGT12 nach Standardmethoden eingebaut. Das resultierende Vektor-Plasmid wurde pGT14 genannt und ist in Abbildung 17 dargestellt
DNA des Plasmides pMAT5 (Mohr, 1988) wurde mit dem Enzym -BαmHI (nach Angaben des Herstellers, Fa. Boehringer Mannheim) vollständig geschnitten und das ca. 1.1 kb große DNA Fragment nach Elektrophorese aus dem Agarosegel präpariert. Das Plasmid pGT14 wurde ebenfalls mit BamHl geschnitten und mittels alkalischer Phosphatase aus Kälberdarm be¬ handelt (nach Angaben des Herstellers, Fa. Boehringer Mannheim). Das ca. 1.1 kb große jBα «HI-Fragment aus pMAT5 wurde nach Standardmethoden einligiert, in E.coli XLl-Blue (Fa.Stratagene) eintransformiert und die Plasmid-DNA einiger resultierender Klone isoliert. Das resultierende Vektor-Plasmid wurde pGT24 genannt. pGT24 enthält das Hygromycinresistenzgen in der richtigen Orientierung zum GAPDH-Promotor und ist in Abbildung 8 dargestellt.
Beispiel 21: Zerstörung des Alanin Racemase Gens in Tolypocladium niveum
Das ca. 835 bp große EcoRI-Pstl-Fragment aus pRPl wurde analog zu der in Beispiel 11 dargestellten Vorgangsweise in den Plasmidvektor pUCBM20 (Fa. Boehringer Mannheim) eingebaut, das konstruierte Plasmid wurde pRP12 genannt und ist in Abbildung 7 dargestellt Als Transformationsvektor wurde das Plasmid pGT24 eingesetzt, welches das Hygromycinresistenzgen unter der Kontrolle des Tolypocladium niveum GAPDH-Gens enthält. Gemeinsam mit dieser DNA wurden auch äquimolare Mengen pRP12-DNA im glei¬ chen Transformationsansatz mit eingesetzt. Diese Cotransformationen wurden nach der in Beispiel 19 beschriebenen Methode durchgeführt, als Ausgangsstamm wurde Tolypocladium niveum ATCC 34921 eingesetzt.
Genomische DNA aus hygromycinresistenten Transformanten wurde nach einer Schnellmethode isoliert. Dazu wurde etwa von 1 cm2 Fläche der entsprechenden Kolonie das Mycel abgenommen und in Εppendorf-Homogenisatoren überführt. Es wurden 1 ml Lysepuffer (50 M EDTA, 0.2 % SDS) und 100 mg Aluminiumoxid (Typ A%, Fa. Sigma) zugegeben und ca. 5 min gut homogenisiert. Nach einer Zentrifugation (5 min, 11000 Upm) wurde der Überstand je einmal mit Tris- gesättigtem Phenol, Phenol/Chloroform (1:1) und Chloroform/Isoamylalkohol (24:1) extrahiert und die DNA mit Isopropanol nach Standardvor¬ schrift gefällt (Sambrook et al., 1989).
Die DNA wurde vollständig mit dem Restriktionsenzym SaR restringiert, durch Gelelektrophorese aufgetrennt und in Southem-Hybridisierungen untersucht. Das 0.8 % Agarosegel wurde mittels Vakuum-Blotting (Vacublot, Fa. Pharmacia) auf eine Nylon- Membran (Duralon-UV, Fa. Stratagene) übertragen und durch UV fixiert. Die Vorhybridisierung wurde ca. 8 - 16 h bei 42 °C in 6 x SSC, 50 % Formamid, 5 x Denhardt's (Maniatis et al., 1982), 0.1 % SDS, 0.25 mg/ml denaturierte Herings sperma-DNA, 25 mM NaH2PO4 pH 6.5 in einem Volumen von 10 ml pro 100 cm2 Membran durchgeführt. Nach Zugabe der markierten Sonde wurde weitere 16 - 20 h bei 42 °C inkubiert. Der Blot wurde zweimal 10 min mit 2 x SSC / 0.1 % SDS bei 25 °C und zweimal 30 min mit 0.5 x SSC / 0.1 % SDS bei 60 °C gewaschen. Nach Autoradiographie mit Kodak Verstärkerfolie auf Röntgenfilm (Xomatic AR, Fa. Kodak) für ca. 48 - 96 h bei -70 °C wurden Banden auf dem Röntgenfilm sichtbar.
Die meisten der untersuchten DNAs zeigten das Signal des nativen ca. 2.9 kb großen SaR- Fragmentes, welches das ca. 835 bp EcoRI-Pstl-Fragment enthält (Abbildung 1). Etwa 60 - 70 % der DNAs zeigten darüberhinaus auch noch zusätzliche Banden, die auf nicht homologe Integrationen des Plasmids pRP12 zurückzuführen sind. Neben diesen Typen von Transformanten-DNAs gab es jedoch auch vereinzelt DNAs, welche das Signal des nativen Sα/I-Fragmentes nicht mehr aufwiesen. In solchen Stämmen ist das Alanin Racemase Gen durch Integration des Plasmids pRP12 zerstört worden.
Auf diese Weise verifizierte Stämme wurden in Testfermentationen im Schüttelkolben auf Cyclosporin A Bildung untersucht, wie von Dreyfuss et al. (1976) beschrieben. Während in den parallel durchgeführten Versuchen mit dem nicht transformierten und intakten Ausgangsstamm Tolypocladium niveum ATCC 34921 noch Cyclosporin A gebildet wurde, konnte in Versuchen mit jenen Stämmen, in denen das Alanin Racemase Gen zerstört wurde, praktisch kein Cyclosporin A mehr nachgewiesen werden (<5 mg/1).
Beispiel 22: Cotransformation mit Lambda RAC4
Analog zu Beispiel 21 wurde der Transformationsvektor pGT24 verwendet. Gemeinsam mit dieser DNA wurden auch äquimolare Mengen Lambda RAC4 (Beispiel 10) im jeweils glei¬ chen Transformationsansatz mit eingesetzt. Als Ausgangsstamm für diese Cotransformationen wurde Tolypocladium niveum ATCC 34921 eingesetzt.
Genomische DNA aus hygromycinresistenten Transformanten wurde isoliert, und durch Southernhybridisierungen untersucht, wie in Beispiel 21 beschrieben. Als Sonde für die Hybridisierungen wurden Restriktionsfragmente des Genbankvektors Lambda DASH II durch "Random Primer" Markierung (Fa. Stratagene) mit alpha 32P dATP radioaktiv markiert. Einzelne der untersuchten DNAs zeigten Hybridisierungssignale, die auf Integration von Lambda RAC4 zurückzuführen sind. Auf diese Weise verifizierte Transformantenstämme wurden in einer Testfermentation im Schüttelkolben auf Cyclosporin A Bildung untersucht, wie von Dreyfuss et al. (1976) beschrieben wurde. Während in dem parallel durchgeführten Versuch mit dem nicht transformierten Ausgangsstamm Tolypocladium niveum ATCC 34921 ca. 90 - 100 μg/ml Cyclosporin A gebildet wurde, konnte im Versuch mit jenem Stamm, in dem zusätzliche Kopien des Alanin Racemase Gens durch Integration von Lambda RAC4 vorhanden sind, ca. 150 μg/ml Cyclosporin A nachgewiesen werden.
Beispiel 23: Herstellung von 8-D-Serin Cyclosporin A durch Stämme mit zerstörtem Gen für die Alanin Racemase
Transformantenstämme, in denen das Alanin Racemase Gen nach dem in Beispiel 21 beschriebenen Verfahren durch Integration des Plasmids pRP12 zerstört worden war, sowie der Ausgangsstamm Tolypocladium niveum ATCC 34921, wurden in Schüttelkolbenfermenta- tionen untersucht, bei denen im Medium D-Serin angeboten wurde. Dazu wurden 100 ml Vorkulturmedium (75 g/1 Glukose, 10 g/1 Pepton, 250 mg/1 KH2PO4, 1.5 g/1 KCl, pH 7.4) in 500 ml Erlenmeyerkolben mit ca. 107 Sporen des entsprechenden zu untersuchenden Stammes beimpft und für 4 bis 7 Tage bei 27 °C und 200 Upm inkubiert. Davon ausgehend wurden 20 ml Hauptkulturmedium (40 g/1 Glukose, 40 g/1 Fruktose, 10 g/1 Pepton, 5 g/1 KH2PO4, 2 g/1 KCl, 5 g/1 DL-2-Aminobuttersäure, 4 g/1 D-Serin, pH 5.5) mit 2 ml Vorkultur inokuliert und unter gleichen Bedingungen weitere 7 - 20 Tage fermentiert. Das gebildete Cyclosporin A (CyA) und 8-D-Serin-Cyclosporin A .(DSA) wurde bestimmt. Es zeigte sich, daß der Ausgangsstamm Tolypocladium niveum ATCC 34921 unter diesen Bedingungen ca. 50 mg/1 CyA und weniger als 5 mg/1 DSA bildet. Ein untersuchter "gene- disruption" Stamm aus Beispiel 21 bildete hingegen <5 mg/1 CyA und ca. 60 mg/1 DSA.
Beispiel 24: Transformation von Tolypocladium niveum mit pGT24
DNA des Plasmids pGT24 wurde zur Transformation herangezogen, wie in Beispiel 19 beschrieben wurde. Als Ergebnis wurden zahlreiche, Hygromycin-resistente Tolypocladium m'vewm-Kolonien erhalten. Dies bestätigte, daß das in den Expressionsvektor pGT14 ein¬ gebaute Gen (Hygromycin-Resistenzgen aus E.coli) effizient exprimiert wurde. Durch Isolierung der DNA solcher Transformanten, Restriktion der DNA, z.B. mit ßαmHI, Elektrophorese und Blotten auf Nylonmembranen (nach Standardtechniken, Sambrook et al., 1989) konnte mittels Hybridisierung mit dem ca. 1.1 kb großen -ßαmHI-Fragment bestätigt werden, daß das Plasmid pGT24 ein- oder mehrmals im Genom vorliegt. Beispiel 25: Konstruktion des Vektors pGT30
Auf Grund der, in Abbildung 13 wiedergegebenen DNA-Sequenz wurde ein Oligonukleotid synthetisiert, das folgende Sequenz aufweist:
5'GG ATC GAT TTT GTA CGC TGC GGA GTT AGC 3'
Die Positionen 9 bis 29 dieses Oligonukleotides sind komplementär zu der in Abbildung 13 gezeigten Sequenz (Pos. 652 bis 672); es umfaßt also den Bereich unmittelbar vor dem Startcodon. Die ersten acht Positionen entsprechen einer C/αl-Erkennungsregion (ATCGAT). Ein zweites Oligonukleotid hat die Sequenz:
5' GG ACTAGTACCTTGTTGGAGTGGTGAGAT3'
Dies entspricht den Positionen 62 bis 82 der Nukleotidsequenz in Abbildung 13. Die ersten acht Nukleotide enthalten eine Spel-Erkennungsregion. 20 ng DNA aus Tolypocladium niveum wurde mit den oben beschriebenen Oligonukleotiden amplifiziert (Sambrook et al., 1989): 30 Zyklen: 1 min 30 sek 94όC; 2 min 30 sek 55°C; 6 min 72°C. Es entstand eine DNA von ca. 620 bp. Diese DNA wurde nach Chloroform-Extraktion durch Ultrafiltration (Ultrafree MC 100 000; Millipore) gereinigt und im entsprechenden Puffer mit den Enzymen Spei und Clal gespalten. 50 ng dieser DNA wurden mit 50 ng Spei und C/αl-gespaltener DNA des Plasmides pCSN44 (Stäben et al., 1989) ligiert. Eine Restriktionskarte dieses Plasmides (pGT30) ist in Abbildung 18 wiedergegeben.
Beispiel 26: Transformation von Tolypocladium niveum mit pGT30
Das Plasmid pGT30 kann zur Transformation von Tolypocladium niveum verwendet werden, wie im Beispiel 19 beschrieben ist DNA aus solchen Transformanten wurde mit -BαmHI gespalten und nach Gelelektrophorese auf eine Nylon-Membran geblottet. Als radioaktive Sonde wurde das 0,6 kb Spe/-C/α/-Fragment aus pGT30 verwendet. Dadurch lassen sich solche Transformanten identifizieren, bei denen das Plasmid pGT30 ein- oder mehrmals im Genom integriert vorliegt. Beispiel 27: Sequenzierung von cDNA und Lokalisierung des Strukturgens
Wie aus dem Vergleich der Aminosäureteilsequenzen zu erkennen ist (siehe Beispiel 16), wechselt der Leserahmen zwischen den für asl758 codierenden Sequenzen, was auf ein Intron schliessen lässt.Es wurde daher RNA isoliert und durch Northernhybridisierung auf Anwesenheit des Alanin Racemase Transkriptes überprüft (siehe Beispiel 17). Unter Verwendung eines Adapterprimers (5'-GGCCACGCGTCGACT(T)17) (Fa. GIBCO BRL) wurde die Erststrangsynthese durchgeführt und anschliessend mit den Primern S 11 (5'- ATTGGGGAGATCCCACTCTC, Pos. 1990 - 2009, (Abbildung 20)) und PRP8/6 (5'- ACCGCAAAGGACTTTGACTTGCCT, Pos. 3145 - 3122, (Abbildung 20)) der entsprechende Bereich amplifiziert, die DNA Fragmente gereinigt, in den Plasmidvektor pGEM-T (Fa. PROMEGA) einkloniert und die DNA verifizierter Klone ebenfalls sequenziert. Auf diese Weise wurde die komplette Sequenz zwischen asl753 und asl751 aus cDNA fertiggestellt. Ein Vergleich gegen die genomische Sequenz zeigte, dass dort bei Pos. 2035 - 2110 ein Intron von 76 bp vorhanden ist.
Isolierte RNA (siehe Beispiel 17) wurde zur Durchführung von 5'-RACE Experimenten unter Verwendung eines Kits (Fa. GIBCO BRL) herangezogen. Als "Ankerprimer" wurde das Oligonukleotid 5 '-CUACUACUACÜAGGCCACGCGTCGACTAGTACGGGIIGGGπGG- GIIG verwendet. Als genspezifische Primer wurden S7(5'-CTCGTCAGCCCAAGCCTT, Pos. 2571 - 2554 (Abbildung 20)) und S10 (5'-ACAACAAACAGAGCTGCTTC, Pos. 2261 - 2243 (Abbildung 20)) eingesetzt. Die erhaltenen Fragmente wurden in den Plasmidvektor pGEM-T (Fa. PROMEGA) einkloniert und sequenziert. Es wurden insgesamt 32 unabhängige Klone charakterisiert. Wie das Ergebnis in Abbildung 21 zeigt, wurden 3 verschiedene Starts gefunden. Wenn man die gesamte Anzahl von 32 Einzelklonen zu einer statistischen Auswertung heranziehen will, so beginnen 75% bei Pos.-8, 16% bei Pos-14 und 9% bei Pos. 26. Die Positionen beziehen sich auf das postulierte ATG Translationsstartcodon (siehe unten).
Analog dazu wurde auch das Ende des Transkriptes durch 3'-RACE Experimente (Fa. GIBCO BRL) untersucht. Als genspezifischer Primer wurden PRP8/2( (5'- AGGCAAGTCAAAGTCCTTTGCGGT, Pos. 3122 - 3145 (Abbildung 21)) und S13 (5'- CTCAGCACCGTGACATACGC, Pos. 3011 - 3030 (Abbildung 21)) verwendet. Es wurden insgesamt 12 Klone sequenziert, deren 3'-Enden in Abbildung 23 gezeigt sind. Alle sequenzierten Messenger tragen eine polyA-Tail. Dessen Länge liegt zwischen 16 und 43 Nucleotiden.
In Abbildung 20 ist die Sequenz des Alanin Racemase Gen Bereiches dargestellt. Das erste Methionin Codon des ORF liegt bei Pos. 1953. Es ist dies aber auch zugleich das einzige Met-Codon, das auf dem sequenzierten Transkript in Frage kommt, da bereits 9 Codons später die Teilsequenz als 1753 gefunden wurde. Nach dem Splicing des Introns ergibt sich ein durchgehender offener Leserahmen, der bei Pos. 3178 endet. Er umfasst 383 Codons (Aminosäuresequenz siehe Abbildung 20). Das Molekulargewicht des abgeleiteten Proteins errechnet sich zu 41002 Da.
Die Analyse der Sequenzregion oberhalb des Strukturgens nach Promotorelementen ergab zwei Möglichkeiten. Entweder eine sehr ausgeprägte TATA Region bei ca. -146. deren Abstand von den experimentell gefundenen Transskriptionsstartpunkten etwas gross, aber durchaus noch im üblichen Rahmen ist. Die CAAT-Box bei ca. -200 würde von der Entfernung her auch sehr gut passen. Bei der TATA-Box bei ca. -60 mit dazupassender CAAT-Box bei -121 stimmen auch die Distanzen zu den Transskriptionsstartpunkten (-8, -14, -26) sehr gut mit den Erwartungen überein.
Literaturliste:
Badet B., Roise D. and Walsh C: Inactivation of the dadB Salmonella typhimuήum alanine racemase by D and L isomers of ß-substituted alanines: Kinetics, stoichiometry, active site peptide sequencing, and reaction mechanism. Biochemistry 23 (1984) 5188-5194.
Badet B. and Walsh C: Purification of an alanine racemase from Streptococcus faecalis and analysis of its inactivation by (l-Aminoethyl)phosphonic acid enantiomers. Biochemistry 24 (1985) 1333-1341.
Cannon P.F.: International Commission on the taxonomy of fungi (ICTF): name chan- ges in fungi of microbiological, industrial and medical importance. Part 2. Microbiological Sciences 3 Nr.9 (1986) 285-287.
Cathala G., Savouret J.F., Mendez B., West B.L., Kavin M., Martial J. and Baxter J.D.: A method for isolation of intact translationally active ribonucleic acid. DNA 2 (1983) 329- 335.
Chomczynski P. and Sacchi N.: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal.Bioche . 162 (1987) 156-159.
Cryer D.R., Eccleshall R. and Marmur J.: Isolation of yeast DNA. Method in Cell Biology XII (1975) 39-44.
Dreyfuss M., Harri E., Hofmann H., Kobel H., Pache W. and Tscherter H.: Cyclosporin A and C. European J. Appl. Microbiology 3 (1976), S. 125-133.
Evans G.A., Lewis K. and Rothenberg B.E.: High efficiency vectors for cosmid microcloning and genomic analysis. Gene 79 (1989) 9 - 20.
Gurr S.J., Unkles S.E. and Kinghorn J.: The structure and organization of nuclear genes of filamentous fungi. In: Kinghorn J.R. (Ed.): Gene structure in eukaryotic microbes. IRL Press, Oxford 1987.
Esaki N. and Walsh C: Biosynthetic alanine racemase of Salmonella typhimurium: Purification and characterization of the enzyme encoded by the alr gene. Biochemistry 25 (1986) 3261-3267.
Ferrari E., Henner DJ. and Yang M.Y.: Isolation of an alanine racemase gene from Bacillus subtilis and its use for plasmid maintenance in B.subtilis. Biotechnology 3 (1985) 1003-1007. Galakatos N.G., Daub E., Botstein D. and Walsh C: Biosynthetic alr alanine racemase from Salmonella typhimurium: DNA and protein sequence determination. Biochemistry 25 (1986) 3255-3260.
Holland J.P. and Holland M.J.: Structural comparison of two nontandemly repeated yeast glyceraldehyde-3-phosphate dehydrogenase genes. J.Biol.Chem. 255 (1980) 2596-2605.
Hynes M.J., Corrick CM. and King J.A.: Isolation of genomic clones containing the amdS gene of Aspergillus nidulans and their use in the analysis of structural and regulatory mutations. Molec.Cell.Biol. 3 (1983) 1430-1439.
Inagaki K., Tanizawa K., Badet B., Walsh C, Tanaka H. and Soda K.: Thermostable alanine racemase from Bacillus stearothermophilus: Molecular cloning of the gene, enzyme purification, and characterization. Biochemistry 25 (1986) 3268-3274.
Inagaki K., Tanizawa K., Tanaka H. and Soda K.: Purification and characterization of amino acid racemase with very broad Substrate specificity from Aeromonas caviae. Agric. Biol. Chem. 51 (1987) 173-180.
Kimura H., Sumino Y. and Suzuki M.: Cloning and sequencing of the putative glyceraldehyde-3-phosphate dehydrogenase gene from Cephalosporium acremonium and its application to heterologous gene expression. J.FermentBioeng. 71 (1991) 145-150.
Kleinkauf H. and v. Döhren H.: Nonribosomal biosynthesis of. peptide antibiotics. Eur. J. Biochem. 192 (1990) 1-15.
Kück U., Walz M., Mohr G. and Mracek M.: The 5 '-sequence of the isopenicillin N- synthetase gene (pcbC) from Cephalosporium acremonium directs the expression of the prokaryotic hygromycin B phosphotransferase gene (hph) in Aspergillus niger. Appl.Microbio Biotechnol. 31 (1989) 358-365.
Lämmli U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 (1970) 680-685.
Lawen A., Traber R., Geyl D., Zocher R. and Kleinkauf H.: Cell-free biosynthesis of new cyclosporins. J. Antibiotics 42 (1989) 1283-1289.
Lawen A., Dittmann J., Schmidt B., Riesner, D. and Kleinkauf H.: Enzymatic biosynthesis of cyclosporin A and analogues. Biochimie 74 (1992) 511-516.
Lawen A. and Zocher R.: Cyclosporin Synthetase. The most complex peptide synthesizing multienzyme polypeptide so far described. J. Biol. Chem. 265 (1990) 11355- 11360. Maniatis T., Fritsch E.F. and Sambrook J.: Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor 1982.
Maxam A.M., and Gilbert W.: Sequencing end-labelled DNA with base-specific chemical cleavages. Methods in Enzymology 65 (1980) 499-560.
Mohr, G.: Grundlagen, Anwendungen und Möglichkeiten der Stammverbesserung biotechnologisch relevanter Hyphenpilze durch die Gentechnik: Integrative Transformation von Aspergillus niger. Dissertation Ruhr-Universität Bochum (1988).
Peberdy J.F.: Fungal Protoplasts. In: Bennett J.W. and Lasure L.L. (Eds):More gene manipulations in fungi. Acad.Press Inc., San Diego, 1991.
Pfitzner A.: Klonierung zweier Glykolysegene aus Penicillium chrysogenum. Dissertation Technische Universität Wien (1989).
Punt P.J., Dingemanse M.A., Jacobs-Meijsing B.J.M., Pouwels P.H. and van den Hondel C.A.M.J.J.: Isolation and characterization of the glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. Gene 69 (1988) 49-57.
Roise D., Soda K., Yagi T. and Walsh C: Inactivation of the Pseudomonas striata broad specificity amino acid racemase by D and L isomers of ß-substituted alanines: Kinetics, stoichiometry, active site peptide, and mechanistic studies. Biochemistry 23 (1984) 5195- 5201.
Sambrook J., Fritsch E.F. and Maniatis T.: Molecular Cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989.
Sanger F., Nickier S. and Coulson A.R.: DNA sequencing with chain-terminating inhibitors. Proc.Natl.Acad.Sci.USA 74 (1977) 5463-5467.
Schmidt B., Riesner D., Lawen A. and Kleinkauf H.: Cyclosporin synthetase is a 1.4 MDa multienzyme polypeptide. FEBS Letters 307 (1992) 355-360.
Stäben C, Jensen B., Singer M., Pollock J., Schechtman M., Kinsey J. and Selker E.: Use of a bacterial Hygromycin B resistance gene as a dominant selectable marker in Neurospora crassa transformation. Fungal Genetics Newsletter 36 (1989) 79.
Tanizawa K., Ohshima A., Scheidegger A„ Inagaki K., Tanaka H. ans Soda K.: Thermostable alanine racemase from Bacillus stearothermophilus: DNA and protein sequence determination and secondary structure prediction. Biochemistry 27 (1988) 1311-1316.
Thornberry N.A., Bull H.G., Taub D., Greenlee W.J., Patchett A.A. and Cordes E.H.: 3-Halovinylglycines. Efficient irreversible inhibitors of E. coli alanine racemase. J. Am. Chem. Soc. 109 (1987) 7543-7544.
Walsh C, Badet R., Daub E., Esaki N. and Galakatos N.: Bacterial alanine racemases: Targets for antibacterial agents. Spec. Publ. - R. Soc. Chem. 55 (1985) 193-209.
Wang E. and Walsh C: Suicide Substrates for the alanine racemase of Escherichia coli B. Biochemistry 17 (1978) 1313-1321.
Wartburg A. v. and Traber R. Chemistry of the natural cyclosporin metabolites, in: Ciclosporin (Borel J.F., ed., series Progress in Allergy, Ishizaka K., Lachmann P.J., Kallόs P. and Waksman B.H., eds.), Karger Verlag 1986, 28-45.
Wasserman S.A., Daub E., Grisafi P., Botstein D. and Walsh C: Catabolic alanine racemase from Salmonella typhimurium: DNA sequence, enzyme purification, and characterization. Biochemistry 23 (1984) 5182-5187.
Wood W.I., Gitschier J., Lasky L.A. and Lawn R.M.: Base composition-independent hybridization in tetramethylammonium Chloride: A method for oligonucleotide screening of highly complex libraries. Proc.Natl.Acad.Sci. USA 82 (1985) 1585.
Der Inhalt der zitierten Literaturstellen wird der Anmeldung hiermit als Referenz eingefügt.
Verwendete Abkürzungen:
μCi Mikrocurie μg Mikrogramm μl Mikroliter μm Mikrometer μM Mikromolar amdS Acetamidasegen
ACV Aminoadipyl-Cysteinyl-Valin
ATCC American Type Culture Collection
ATP Adenosintriphosphat as Aminosäuren, Aminosäuresequenz bp Basenpaare cDNA komplementäre Desoxyribonukleinsäure
DAO D-Aminosäure Oxidase
DNA Desoxyribonukleinsäure
DTE Dithioerythrit
DTT Dithiothreitol
E. coli Escherichia coli
EDTA Aethylendiamintetraessigsäure
FIGE Feldin versionsgelelektrophorese
FPLC Fast Performance Liquid Chromatography g Gramm
(g/v)% Gewicht/Volumen in % gv% Gewicht/Volumen in %
GAPDH Glycerinaldehyd-3-phosphatdehydrogenase
GBq Giga-Bequerel gpdA Gen für die GAPDH h Stunden
HEPES N-2-Hydroxyethyl-piperazine-N-2-propansulfonsäure
HP-RPC High Pressure - Reversed Phase Chromatography kb Kilobase; 1000 Nukleotide kDa Kilodalton
1 Liter
LDH Lactat-Dehydrogenase
MBq Mega-Bequerel mg Milligramm min Minuten ml Milliliter mM Millimolar
MOPS 3-Morpholinopropansulfonsäure
M, relative Molmasse mRNA Boten-Ribonukleinsäure mU milli-units
NADH Nicotinamid-adenin-dinukleotid, reduziert ng Nanogramm nm Nanometer
PEG Polyethylenglykol pfu plaquebildende Einheiten pH pH-Wert
Pos Position
RNA Ribonukleinsäure
SDS Natriumdodecylsulfat
SDS-PAGE SDS-Polyacrylamid Gelelektrophorese sek Sekunden
SSC 150 mM NaCl, 15 mM Natriumzitrat, pH 7,0
SSPE 180 mM NaCl, 10 mM Natriumphosphat, 1 mM EDTA, pH 7,7
TE 10 mM Tris-Cl pH 7.5, 1 mM EDTA
TM mittlerer Schmelzbereich
Tricin N-tris(hydroxymethyl)methylglycine
Tris Tri s (hydroxymethyl)aminomethane
Upm Umdrehungen pro Minute
V Volumen
(v/v)% Volumen Prozent
°C Grad Celsius
Außerdem wurden die für Restriktionsendonukleasen üblichen Abkürzungen verwendet (Sau3A, Hindlll, EcoRI, Hindlll, Clal,..; Maniatis et al., 1982). Für DNA-Sequenzen wurden die Nukleotid-Abkürzungen A, T, C, G und für Polypeptide die Aminosäure- Abkürzungen (Arg, Asn, Asp, Cys,..; b.z.w. R, N, D, C, ...) benutzt (Sambrook et al., 1989).

Claims

Ansprüche:
1. Isolierte oder rekombinante Nukleotid-Sequenz die für ein eukaryontisches Enzym, oder ein Fragment davon kodiert, das Alanin-Racemase Aktivität besitzt.
2. Isolierte oder rekombinante Nukleotid-Sequenz gemäss Anspruch 1, die für Alanin Racemase aus Tolypocladium niveum ATCC 34921 kodiert öder für ein Enzym kodiert, das Alanin Racemase Aktivität besitzt und zu mindestens 70% hierzu homolog ist.
3. Isolierte oder rekombinante Nukleotid-Sequenz gemäss Anspruch 1 oder Anspruch 2, die eine Restriktionskarte besitzt, wie in Abbildung 6 dargestellt wird.
4. Isolierte oder rekombinante Nukleotid-Sequenz gemäss Anspruch 3, die entweder die komplette Nukleotid-Sequenz, wie in Abbildung 5 dargestellt, oder ein Fragment hiervon, das Alanin Racemase Aktivität besitzt, umfasst.
5. Isolierte Nukleotid-Sequenz, die zu einer Nukleotid-Sequenz gemäss Anspruch 4 hybridisiert.
6. Nukleotid-Molekül enthaltend eine isolierte Nukleotid Sequenz gemäss einem der Ansprüche 1 bis 5.
7. Vektor enthaltend eine isolierte Nukleotid Sequenz gemäss einem der Anspruch 1 bis 6.
8. Vektor gemäss Anspruch 7 in Form eines Plasmids, eines Cosmids, eines Pl-Vektors oder eines YAC- Vektors.
9. Wirtszelle die einen Vektor gemäss einem der Ansprüche 7 oder 8 trägt.
10. Verfahren zur Herstellung von Alanin Racemase, durch Züchtung einer Wirtszelle gemäss Anspruch 9 und Veranlassung der Wirtszelle, Alanin Racemase zu exprimieren.
11. Alanin Racemase hergestellt mittels eines Verfahrens gemäss Anspruch 10.
12. Verfahren zur Herstellung eines Cyclosporin Derivats, das in Stellung 8 eine ausgewählte Aminosäure enthält, die anders ist, als D-Alanin, durch -Entaktivierung jenes Teils der genomischen DNA eines Cyclosporin-produzierenden Wirtes, der für Alanin Racemase kodiert
-Züchtung des Cyclosporin-produzierenden Wirtes in einer Fermentationsbrühe, die die ausgewählte Aminosäure enthält und -gegebenenfalls Veranlassung des Cyclosporin-produzierenden Wirtes, das Cyclosporin Derivat herzustellen.
13. Verfahren zur Herstellung eines Cyclosporin Derivats, das in Stellung 8 eine ausgewählte Aminosäure enthält, die anders ist, als D-Alanin, durch -Transformierung eines Cyclosporin-produzierenden Wirtes mit einem Vektor, der die Biosynthese der angewählten Aminosäure bewirkt
-gegebenenfalls Entaktiviering jenes Teils der genomischen DNA eines Cyclosporin- produzierenden Wirtes, der für Alanin Racemase kodiert
-Züchtung des Cyclosporin-produzierenden Wirtes unter Veranlassung, die ausgewählte Aminosäure und das Cyclosporinderivat herzustellen.
14. Verfahren zur Verbesserung der Herstellung eines Cyclosporins durch -Transformierung eines Cyclosporin-produzierenden Wirtes mit einem Vektor gemäss Anspruch 7 oder 8 und
-Veranlassung der Wirtszelle, Alanin Racemase zu exprimieren.
15. Isolierte DNA aus Tolypocladium niveum, die für das Enzym Glycerinaldehyd-3- phosphatdehydrogenase kodiert und gegebenenfalls den Promotorbereich und/oder den Terminationsbereich des Gens enthält.
16. Isolierte DNA nach Anspruch 15, welche die gesamte oder auch nur Teile folgender Sequenz (kodierender Strang) aufweist:
1 CTCGAGAACATΓCGTTGTGCACCGTGCTGGAGCTACCGATGGGGTTGTCGTTAGCGGGAC
61 AACCTTGTTGGAGTGGTGAGATCACCCGCTGTGGCTTCAACCACTGGGAGCTGCGGGCAG
121 CGGCGTGCCGCGAGAGGGTTGGACAGCGTCGCACAGGTGCCACCGGCGTGGTCAAGGAAG
181 GCC AGGTCGCCCTTCTGCTGCTGGTCCC AAAA AT AGTCC A ATGC AATATGTGCCTC ATCC
241 GATGCCGCCTTGGTGTTTTAGGTGCTGACGTGCCGTCCATGTTCGTAGCAGGTCTACGGA '
301 GTACTCCAGCAAGTCCAGGTAGGCAAAGGTAATTATGTAACCTAGGTGCTACGTAAGGGA
361 GTCGCAATATCCATCCGTCGCGCCTCCCCTCCTCGGAGCTGCCACCCACGCCTCCATGCT
421 AGTTAGGAGGTACCTACATATTATTTTTCCCTGTCCCTCCCCTCCCTCCGTCCTTTCTCT
481 TCCTTTTCCTCCTCCCC ATACC ACCCCCTC ACG AG AACCTC ATCCTCGCTATCC AGTCCC
541 A ACCTTCCGGTACGTACGCGACGCAGCTTTCGCCCTGG ACGGGCG AGAGCTCCTCTTGCC
601 CCGCCTGCGAAGCTTGCTTGCCCTCTGCCGCTCCGGCGTCGAAGCTCCCCCGCTAACTCC
661 GCAGCGTACAAAATGGCTCCCATCAAGGTCGGCATCAACGGCTTCGGTCGCATTGGCCGT
721 ATCGTCTTCCGCAACGCCGTCGAGCACCCCGATATCCAGGTCGTCGCCGTCAATGACCCC
781 TTC ATCG AG ACC AAATACGCTGTGAGTTTTTGCCGGTTGCTGCTGCCCCTCCCCCTCCCC
841 CTCCTTG ACC ATCCTTGCCCCTCCTTTTGGCCGCAATCGCCCCCAAC ACGCCTCAACAAC
901 ACCACCGTCACCCCGCCGTCATGGAATTTTCTGGCCACGCTATGCTGCCCCTCCATGATA
961 TCATCAATGAGCGACGCACCACCAGCTTCACAATTGCTCGTGGTGCGCTCTATTCAATTC 1021 GTGAGAGATGCAACGGCATTGCAGCATTGCCAGCAGTTCCTCCCCGCTCCATTGATGCGG 1081 CCAAGGCGCCTGGCCC AGTCTTGCTTTCTCATGTCAAGCAG ACGGGG AACCGCCATAAAT 1141 CACAATCTCATCAGCCAATTCACCACATCTATGCTTTCCGCGCAGTATGCTGACCTCCGT 1201 CTCTTCTCCACGCCATAGGAGTACATGCTCAAGTATGACTCCTCCCACGGTAACTTCAAG 1261 GGCGACATCGCCGTCGACGGCAACGACCTGGTTGTCAACGGCAGCAAGGTCAAGTTCTAC 1321 TCCGAGCGCGACCCCGCCGCCATCCCCTGGAAGGACACTGGCGCCGACTACATCGTCGAG 1381 TCCACTGGTGTCTTCACCACCACCGACAAGGCCAAGGCTCACTTGGTTGGCGGTGCCAAG 1441 AAGGTCATCATCTCGGCTCCCTCTGCCGATGCCCCCATGTACGTAATGGGCGTCAACGAG 1501 AAGACCTACGACGGCAAGGCCGATGTCATCTCCAACGCCTCGTGCACCACCAACTGCCTG 1561 GCTCCCCTCGCCAAGGTCATCCACGACAAGTTCACCATTGTTGAGGGTCTTATGACCACC 1621 GTCCACTCCTACACCGCCACCCAGAAGACCGTTGACGGCCCCTCCGGCAAGGACTGGCGC 1681 GGTGGCCGTGGTGCTGCCCAGAACATCATCCCCAGCAGCACTGGCGCCGCCAAGGCCGTC 1741 GGC AAGGTCATCCCCG ACCTCAACGGCAAGCTC ACCGGCATGTCCATGCGTGTGCCCACT 1801 GCCAACGTCTCCGTCGTTGACCTGACTGTCCGCACCGAGAAGCCCGCCAGCTACGAGGCC 1861 ATC AAGGCGGCCATC AAGG AAGCCGCC AACGGTCCCCTCAAGGGCATCCTCGCCTAC ACC 1921 GAGGACGACATCGTCTCCAGCGACATGAACGGCAACACCAACTCCTCCATCTTCGATGCC 1981 AAGGCCGGCATCTCCCTCAACGACCACTTCGCCAAGCTGGTCTCCTGGTACGACAACGAG 2041 TGGGGCTACTCCCGCCGTGTCCTCGACCTCCTGGCCTACATTGCCAAGGTTGATGCTGGC 2101 AAGTAAATGCTGCCTATTGCAGGAAAGCCAGTAGGGCGAAAACTGGTTGGTGGCTAGTGG 2161 CCGAGAGACTGAATCAATATGAAATGCTCGCACCTATTTTCGGTCGAGAAATTATCAGTA 2221 CTCGGAAGAACACACATTCAAGTACATCCTCCGGGGGTGGAGCAGTGGAAATATGTTCCC 2281 CGGAGCAATGGTTTAGTGTAGCCATGGAGAATAGACACGCCCGTCCATCCACATGTACTG 2341 TGTCCCGTCGCATG A AAGCGCTCTGTGACATGAGTCAAGC ACGTATTC ATTGCATCGTTT 2401 CATGTTCATGTTTTGCCATTTCATCTGAGCTAGGTATCTAACCTGTGAACTCCTGCGTGA 2461 ATGCCCGCCGTCCTGGCCATTTCGACCTTTGACGCCAGAACACCAGCTCAGGCTCTGACT 2521 GTGCATGTATAAGCAAGTAGCGGCCGTGCCTCCGCTTTTCTGTAGATCTGGTCATTATAG 2581 ACGATCCATTACCGCGTCTCGCGATTATGATCCATCCTGCTCGTGCTGTTGATCGATGCG 2641 TCGGG AACA ATA AA AG AGGCG ATTTGTC AAAA ATAG AGTCG ATA ATAAGCCGGCG A AG AG 2701 AAGAAGACCCAAAATCCTCTAGGTAGGAGAAAAAAGAAAACGGAAAAAAGAGAAAGTATT 2761 TGTCCTGCTCGGCCGGCAGTGCGTCGTGGGCCGAGGGGGTGGGATATCATCACGTACATG 2821 TACAACAAAAACGGGAACAACAGAAAAAGAAGAGCTC
17. Rekombinantes DNA-Molekül, das DNA nach den Ansprüchen 15 oder 16 enthält.
18. Pilz, der mit einem rekombinanten DNA-Molekül nach Anspruch 16 oder eines Fragments hiervon transformiert wurden.
PCT/EP1994/001272 1993-04-23 1994-04-23 Rekombinante alanin racemase und gapdh aus tolypocladium niveum WO1994025606A2 (de)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP6523853A JPH08509368A (ja) 1993-04-23 1994-04-23 組換えアラニンラセマーゼおよびトリポクラジウム・ニベウムからのｇａｐｄｈ
EP94915107A EP0696323A1 (de) 1993-04-23 1994-04-23 Rekombinante alanin racemase und gadph aus tolypocladium niveum

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
DEP4312856.4 1993-04-23
DE4312856 1993-04-23
DEP4314610.4 1993-05-04
DE4314610 1993-05-04
DE4316419 1993-05-17
DEP4316419.6 1993-05-17

Publications (2)

Publication Number Publication Date
WO1994025606A2 true WO1994025606A2 (de) 1994-11-10
WO1994025606A3 WO1994025606A3 (de) 1994-12-22

Family

ID=27204983

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1994/001272 WO1994025606A2 (de) 1993-04-23 1994-04-23 Rekombinante alanin racemase und gapdh aus tolypocladium niveum

Country Status (3)

Country Link
EP (1) EP0696323A1 (de)
JP (1) JPH08509368A (de)
WO (1) WO1994025606A2 (de)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001040449A3 (en) * 1999-12-03 2002-01-10 Pasteur Institut Cloning of a gene encoding an amino acid racemase from trypanosoma cruzi, and uses thereof
WO2003038067A1 (en) * 2001-10-29 2003-05-08 Valtion Teknillinen Tutkimuskeskus Fungal micro-organism having an increased ability to carry out biotechnological process(es)
WO2008095889A1 (en) * 2007-02-06 2008-08-14 Basf Plant Science Gmbh Use of alanine racemase genes to confer nematode resistance to plants
EP2471930A1 (de) 2002-12-20 2012-07-04 Metanomics GmbH & Co. KGaA Verfahren zur Herstellung von Aminosäuren
EP2706122A3 (de) * 2008-01-03 2014-06-18 Verenium Corporation Isomerasen, Nukleinsäuren zur Codierung davon und Verfahren zur Herstellung und Verwendung davon
US9765119B2 (en) 2001-10-19 2017-09-19 Aurinia Pharmaceuticals Inc. Cyclosporine analogue mixtures and their use as immunomodulating agents
CN113106082A (zh) * 2021-05-27 2021-07-13 云南师范大学 动物粪便宏基因组来源的丙氨酸消旋酶及其制备和应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS63304985A (ja) * 1987-06-04 1988-12-13 Daicel Chem Ind Ltd 新規なプラスミド
GB2206119A (en) * 1987-06-22 1988-12-29 Merck & Co Inc A new cyclosporin derivative with modified "8-amino acid"
EP0578616A2 (de) * 1992-07-09 1994-01-12 Sandoz Ltd. Zyclosporine Synthetase

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS63304985A (ja) * 1987-06-04 1988-12-13 Daicel Chem Ind Ltd 新規なプラスミド
GB2206119A (en) * 1987-06-22 1988-12-29 Merck & Co Inc A new cyclosporin derivative with modified "8-amino acid"
EP0578616A2 (de) * 1992-07-09 1994-01-12 Sandoz Ltd. Zyclosporine Synthetase

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CURRENT GENETICS, Bd.26, Nr.2, Februar 1994 Seiten 120 - 125 WEBER ET AL. 'The peptide synthetase catalysing cyclosporine production in Tolypocladium niveum is encoded by a giant 45.8 Kilobase open reading frame' *
GENE, Bd.69, Nr.1, 1988 Seiten 49 - 57 PUNT ET AL. 'Isolation and characterization of the Glyceraldehyde-3-phospate dehydrogenase gene of Aspergillus nidulans' *
J. BIOL. CHEM., Bd.255, Nr.6, 1980 Seiten 2596 - 2605 HOLLAND ET AL. 'Structural comparison of two nontandemly repeated yeast Glyceraldehyde-3-phosphate dehydrogenase genes' *
PATENT ABSTRACTS OF JAPAN vol. 13, no. 145 (C-583) (3493) 10. April 1989 & JP,A,63 304 985 (DAICEL CHEM. IND. LTD) 13. Dezember 1988 *
PROCESS BIOCHEM., Bd.26, Nr.3, 1991 Seiten 157 - 166 REHACEK ET AL. 'The biochemistry of cyclosporin formation : a review' *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7851603B2 (en) 1999-12-03 2010-12-14 Centre National De La Recherche Scientifique Cloning, sequencing and expression of a gene encoding an eukaryotic amino acid racemase, and diagnostic, therapeutic, and vaccination applications of parasite and viral mitogens
WO2001040449A3 (en) * 1999-12-03 2002-01-10 Pasteur Institut Cloning of a gene encoding an amino acid racemase from trypanosoma cruzi, and uses thereof
US8168770B2 (en) 1999-12-03 2012-05-01 Centre National De La Recherche Scientifique Cloning, sequencing and expression of a gene encoding an eukaryotic amino acid racemase, and diagnostic, therapeutic, and vaccination applications of parasite and viral mitogens
US7732563B2 (en) 1999-12-03 2010-06-08 Institut Pasteur Cloning, sequencing and expression of a gene encoding an eukaryotic amino acid racemase, and diagnostic, therapeutic, and vaccination applications of parasite and viral mitogens
US9765119B2 (en) 2001-10-19 2017-09-19 Aurinia Pharmaceuticals Inc. Cyclosporine analogue mixtures and their use as immunomodulating agents
US10472394B2 (en) 2001-10-19 2019-11-12 Aurinia Pharmaceuticals Inc. Cyclosporine analogue mixtures and their use as immunomodulating agents
USRE48226E1 (en) 2001-10-19 2020-09-29 Aurinia Pharmaceuticals Inc. Cyclosporine analogue mixtures and their use as immunomodulating agents
WO2003038067A1 (en) * 2001-10-29 2003-05-08 Valtion Teknillinen Tutkimuskeskus Fungal micro-organism having an increased ability to carry out biotechnological process(es)
EP2471930A1 (de) 2002-12-20 2012-07-04 Metanomics GmbH & Co. KGaA Verfahren zur Herstellung von Aminosäuren
WO2008095889A1 (en) * 2007-02-06 2008-08-14 Basf Plant Science Gmbh Use of alanine racemase genes to confer nematode resistance to plants
EP2706122A3 (de) * 2008-01-03 2014-06-18 Verenium Corporation Isomerasen, Nukleinsäuren zur Codierung davon und Verfahren zur Herstellung und Verwendung davon
US9169478B2 (en) 2008-01-03 2015-10-27 Basf Enzymes Llc Isomerases, nucleic acids encoding them and methods for making and using them
CN113106082A (zh) * 2021-05-27 2021-07-13 云南师范大学 动物粪便宏基因组来源的丙氨酸消旋酶及其制备和应用
CN113106082B (zh) * 2021-05-27 2022-11-04 云南师范大学 动物粪便宏基因组来源的丙氨酸消旋酶及其制备和应用

Also Published As

Publication number Publication date
EP0696323A1 (de) 1996-02-14
WO1994025606A3 (de) 1994-12-22
JPH08509368A (ja) 1996-10-08

Similar Documents

Publication Publication Date Title
Bolliger et al. A mitochondrial homolog of bacterial GrpE interacts with mitochondrial hsp70 and is essential for viability.
Inokoshi et al. Cerulenin-resistant mutants of Saccharomyces cerevisiae with an altered fatty acid synthase gene
Proctor et al. Tri6 encodes an unusual zinc finger protein involved in regulation of trichothecene biosynthesis in Fusarium sporotrichioides
Mei et al. sid1, a gene initiating siderophore biosynthesis in Ustilago maydis: molecular characterization, regulation by iron, and role in phytopathogenicity.
Dekker et al. Identification of MIM23, a putative component of the protein import machinery of the mitochondrial inner membrane
AU725340B2 (en) Improved methods for transforming Phaffia strains, transformed Phaffia strains so obtained and recombinant DNA in said methods
JP2000506017A (ja) α―ガラクトシダーゼ
DE69728878T2 (de) Verfahren zur vermehrung der hemoproteinherstellung in filamentösen fungi
DE3942129C2 (de) Glucose-6-phosphat-dehydrogenase-Gen
US5827706A (en) Cyclosporin synthetase
WO1994025606A2 (de) Rekombinante alanin racemase und gapdh aus tolypocladium niveum
DE69734828T2 (de) 5-aminolevulinsaure synthase aus aspergillus oryzae und dafuer kodierende nukleinsaeure
DE69634815T2 (de) D-pantolactonhydrolase und dafür kodierendes gen
US6326477B1 (en) Process for modifying glucose repression
US5487990A (en) Glucose-regulated promoter of yeast acetyl-CoA hydrolase
DE69432699T2 (de) Pilze Widerstandsfähig gegenüber Soraphen A
DE69920470T2 (de) Neuartiges gen und transformant, welcher dieses beinhaltet
WO1999013094A2 (en) Fungal pathogenicity genes
WO1989009821A1 (en) GENE AND GENE PRODUCT FOR PREPARING beta-LACTAM COMPOUNDS
US6498239B1 (en) Sterol glycosyl transferases
DE69627856T2 (de) PHENYLACETYL-CoA-LIGASE AUS PENICILLIUM CHRYSOGENUM
Gerhold et al. The topoisomerase I gene from Ustilago maydis: sequence, disruption and mutant phenotype
AT398578B (de) Isolierung eines synthetase-gens und seine verwendung
KR100808307B1 (ko) 신규한(알)-2-히드록시-3-페닐프로피온산(디-페닐유산)탈수소효소 및 이 것을 코드하는 유전자
AT398434B (de) Dna aus tolypocladium niveum

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): JP SI US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

AK Designated states

Kind code of ref document: A3

Designated state(s): JP SI US

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1994915107

Country of ref document: EP

ENP Entry into the national phase

Ref country code: US

Ref document number: 1995 537756

Date of ref document: 19951023

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1994915107

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1994915107

Country of ref document: EP