Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
  • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
  • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
  • C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
  • C12N2760/00011—Details
  • C12N2760/12011—Bunyaviridae
  • C12N2760/12022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

• Viruses in the Tospovirus genus infect a wide variety of plant species, particularly tobacco, peanut, vegetables and ornamental plants. Two virus species, tomato spotted wilt virus (TSWV) and impatiens necrotic spot virus (INSV) are recognized within the Tospovirus genus.
• TSWV tomato spotted wilt virus
• INSV impatiens necrotic spot virus
• TSWV Tomato Spotted Wilt Virus
• NP 29K nucleocapsid protein
• 58K and 78K membrane-associated glycoproteins
• large 200K protein presumably for the viral transcriptase [see J. Gen. Virol. 71 :2207 (1991 ); Virol. 56:12 (1973); and J. Gen. Virol. 36:267 (1977)].
• the virus genome consists of three negative-strand (-) RNAs designated
• L RNA (8900 nucleotides), M RNA (5400 nucleotides) and S RNA (2900 nucleotides) [see J. Gen. Virol. 36:81 (1977); J. Gen. Virol. 53:12 (1981 ); and J. Gen. Virol. 70:3469 (1989)], each of which is encapsulated by the NP.
• the partial or full-length sequences of S RNAs from three TSWV isolates reveals the presence of two open reading frames (ORF) with an ambisense gene arrangement [see J. Gen Virol. 71 :1 (1990) and J. Gen. Virol. 72:461 (1991)].
• the larger open reading frame is located on the viral RNA strand and has the capacity to encode a 52K nonstructural protein.
• the smaller ORF is located on the viral complementary RNA strand and is translated through a subgenomic RNA into the 29K NP.
• the ambisense coding strategy is also characteristic of the TSWV M RNA, with the open reading frames encoding the 58K and 78K membrane-associated glycoproteins.
• the TSWV L RNA has been sequenced to encode a large 200K protein presumably for the viral transcriptase.
• TSWV has a wide host range, infecting more than 360 plant species of 50 families and causes significant economic losses to vegetables and ornamental plants worldwide.
• the "L” serogroup has been found extensively in field crops such as vegetables and weeds, while the “I” serogroup has been largely confined to ornamental crops.
• a cucurbit isolate has recently been identified [see Plant Disease
• CPMP coat protein-mediated protection
• transgenic plants according to the present invention showed resistance to two heterologous isolates of the "L” serogroup and an isolate of the "I” serogroup.
• resistance to the two heterologous isolates of the "L” serogroup was mainly found in plants accumulating very low, if any, levels of NP, while transgenic plants that accumulated high levels of NP were resistant to the isolate of the "I" serogroup.
• TSWV-B has the N protein that was serologically distinct from the "L” and "I” serogroups and biologically differs from a curcurbit isolate in that the TSWV-B does not systemically infect melons or squash . Therefore, one aspect of the present invention is to
• TSWV-B characterizes the TSWV-B by cloning and sequencing of its S RNA and comparisons with the published sequences of other TSWV isolates.
• Fig. 1 depicts the strategy for cloning the NP gene from viral RNA according to the present invention
• Fig. 2 depicts the in vivo transient expression of the nucleocapsid protein (NP) gene of tomato spotted wilt virus according to the present invention in tobacco protoplasts;
• NP nucleocapsid protein
• Fig. 3 depicts the location of the sequenced cDNA clones in the TSWV-B S RNA according to the present invention
• Fig. 4 depicts a dendogram showing relationships among TSWV isolates according to the present invention
• Fig. 5 depicts the serological relationship of TSWV isolates described herein;
• Fig. 6 depicts the correlation of the level of nucleocapsid protein (NP) accumulation in transgenic plants with the degree of resistance to TSWV isolates;
• Fig. 7 depicts the TSWV-BL N coding sequences introduced into transgenic plants in accordance with one aspect of the present invention.
• Fig. 8 depicts the TSWV-BL half N gene fragments introduced into plants in accordance with one aspect of the present invention. More specifically, figure 2 depicts transient expression of the NP gene in which the constructs were transferred into tobacco mesophyll protoplasts using polyethylene glycol (PEG). The transformed
• NP- and NP + represent the protoplasts transformed with plasmids pBI525-NP- and pBI525-NP + , respectively.
• N. benthamiana Domin. were infected with TSWV isolates [TSWV-BL (a lettuce isolate), Arkansas, 10W pakchoy (TSWV-10W), Begonia, and Brazil (TSWV-B)).
• An infected leaf disc (0.05 gram) was ground in 12 ml of the enzyme conjugate buffer and analyzed by DAS-ELISA using antibodies raised against TSWV-BL viron (BL viron), or the NP of TSWV-BL (BL-NP), or TSWV-I (I-
• Concentration of antibodies for coating were 1 ⁇ g/ml; dilution of conjugates were 1 :2000 for BL viron, 1 :250 for BL-NP, and 1 :1000 for I- NP. The results were taken after 10 minutes (BL), 50 minutes (BL-NP), or 30 minutes after adding substrate.
• ELISA for NP accumulation with antibodies raised against the NP of TSWV-BL Plants were read 150 min. after adding substrate and the transgenic plants were grouped into four categories: OD4Q5nm smaller than 0.050, OD 405n m between 0.050 to 0.200, OD 405n m between 0.200 to 0.400, and OD 405n m greater than 0.400.
• the OD 405n m readings of control NP (-) plants were from zero to 0.05.
• the same plants were challenged with either the Arkansas (Ark) and 10W pakchoy (10W) isolates or the Begonia isolate and the susceptibility of each plant was recorded about 12 days after inoculation.
• the TSWV-BL isolate was purified from Datura stramonium L. as follows: the infected tissues were ground in a Waring Blender for 45 sec with three volumes of a buffer (0.033 M KH 2 PO 4 , 0.067 MK 2 HPO 4 , 0.01 M Na 2 SO 3 ). The homogenate was filtered through 4 layers of cheesecloth moistened with the above buffer and centrifuged at 7,000 rpm for 15 min. The pellet was resuspended in an amount of 0.01 M Na 2 SO 3 equal to the original weight of tissue and centrifuged again at 8,000 rpm for 15 min. After the supernatant was resuspended in an amount of 0.01 M Na 2 SO 3 equal to 1/10 of the original tissue weight.
• the virus extract was centrifuged at 9,000 rpm for 15 min. and the supernatant was carefully loaded on a 10-40% sucrose step gradient made up in 0.01 M Na 2 SO 3 . After centrifugation at 23,000 rpm for 35 min., the virus zone (about 3 cm below meniscus) was collected and diluted with two volumes of 0.01 M Na 2 SO 3 . The semi-purified virus was pelleted at 27,000 rpm for 55 min.
• the TSWV-BL isolate [see Plant Disease 74:154 (1990)] was purified from Datura stramonium L, as described in Example I.
• the purified virus was resuspended in a solution of 0.04% of bentonite, 10 ⁇ g/ml of proteinase K, 0.1 M ammonium carbonate, 0.1% (w/v) of sodium diethyldithiocarbanate, 1 mM EDTA, and 1 % (w/v) of sodium dodecyl sulfate (SDS), incubated at 65°C for 5 min., and immediately extracted from H 2 O-saturated phenol, followed by another extraccion with chloroform/isoamyl alcohol (24:1).
• Viral RNAs were precipitated in 2.5 volumes of ethanol and dissolved in distilled H 2 O.
• the first strand cDNA was synthesized from purified TSWV-BL
• the second strand was produced by treatment of the sample with RNase H/DNA polymerase.
• the resulting double- stranded cDNA sample was size-fractionated by sucrose gradient centrifugation, methylated by EcoRI methylase, and EcoRI linkers were added. After digestion with EcoRI, the cDNA sample was ligated into the EcoRI site of pUC18, whose 5'-terminal phosphate groups were removed by treatment with calf intestinal alkaline phosphotase.
• E. coli DH5 ⁇ competent cells (Bethesda Research Laboratories) were
• transformed and clones containing TSWV cDNA inserts were first selected by plating on agar plates containing 50 ⁇ g/ml of ampicillin, IPTG, and X-gal. Plasmid DNAs from selected clones were isolated using an alkaline lysis procedure [see BRL Focus 11 :7 (1989)], and the insert sizes were determined by EcoRI restriction enzyme digestion followed by DNA transfer onto GeneScreen Plus nylon filters (DuPont).
• Plasmid clones that contained a TSWV-BL S RNA cDNA insert were identified as described below by hybridizing against a 32 P-labelled oligomer (AGCAGGCAAAACTCGCAGAACTTGC) complementary to the nucleotide sequence (GCAAGTTCTGCGAGTTTTGCCTGCT) of the TSWV- CPNH1 S RNA [see J. Gen. Virol. 71 :001 (1990)].
• Several clones were identified and analyzed on agarose gels to determine the insert sizes.
• the clones pTSWVS-23 was found to contain the largest cDNA insert, about 1.7 kb in length.
• the full-length NP gene was obtained by the use of polymerase chain reaction (PCR). First-strand cDNA synthesis was carried out at
• the reaction mixture contained 1.5 ⁇ g of viral RNAs,1 ⁇ g of the oligomer primer, 0.2 mM of each dNTP, 1 X PCR buffer (the GeneAmp kit, Perkin-Elmer-Cetus), 20U of RNAs in Ribonuclease inhibitor (Promega), 2.5 mM of MgCl 2 , and 25U of AMV reverse transcriptase (Promega Corporation).
• the reaction was terminated by heating at 95°C for 5 min. and cooled on ice.
• AGCATTCCATGGTTAACACACTAAGCAAGCAC also used to synthesize the nucleotide gene of TSWV-10W
• the latter oligomer being identical to the S RNA in the 3' noncoding region of the gene (nucleotide positions 1919 to 1938 of the TSWV-CPNH1).
• a typical PCR cycle was 1 min. at 92°C (denaturing), 1 min. at 50°C (annealing), and 2 min. at 72°C
• the sample was directly loaded and separated on a 1.2% agarose gel.
• the separated NP gene fragment was extracted from the agarose gel, ethanol-precipitated and dissolved in 20 ⁇ l of distilled H 2 O.
• the gel-isolated NP gene fragment from Example III was digested with the restriction enzyme Ncol in 50 ⁇ l of a reaction buffer [50 mM Tris-HCI (pH 8.0), 10 mM MgCl2, 0.1 M NaCl] at 37°C for 3 hours, and directly cloned into Ncol-digested plant expression vector pB1525.
• the resulting plasmids were identified and designated as pB1525-NP + in the sense orientation relative to the cauliflower mosaic virus (CaMV)
• transformation vector pBIN19 (Clontech Laboratories, Inc.) that had been cut with the same enzymes.
• the resulting vector, pBIN19-NP + and the control plasmid pBIN19 were transferred to A. tumefaciens strain LBA4404, using the procedure described by Holsters et al [see Mol. Gen. Genet. 163:181 (1978)].
• Nucleotide sequence analyses of the inserts in clones pTSWV-23 and Pb1525-NP + were determined using the dideoxyribonucleotide method, T7 polymerase (U.S. Biochemicals, Sequenase TM ), and the double-stranded sequencing procedure described by Siemieniak et al [see Analyt. Biochem. 192:441 (1991)]. Nucleotide sequences were determined from both DNA strands and this information was compared with the published sequences of TSWV isolates CPNH1 using computer programs available from the Genetics Computer Group (GCG, Madison, Wl).
• Transient expression of the NP gene in tobacco protoplasts were also prepared. Plasmid DNAs for clones pTSWVS-23 and pUC18cpphas TSWV-NP (containing the PCR-engineered NP gene insert) were isolated using the large scale alkaline method. The PCR-engineered NP gene insert was excised from clone pBIS25-NP + by Ncol digestion to take advantage of the available flanking oligomer primers for sequencing.
• the expression cassette pUC18cpphas is similar to pUC18cpexp except that it utilizes the poly(A) addition signal derived from the Phaseolus vulgaris seed storage gene phaseolin.
• plasmid DNAs were subjected to two CsCI-ethidium bromide gradient bandings, using a Beckman Ti 70.1 fixed angle rotor. DNA sequences were obtained using dideoxyribonucleotides and the double-stranded plasmid DNA sequencing procedure described above. Nucleotide sequence reactions were electrophoresed on one-meter long thermostated (55°C) sequencing gels and nucleotide sequence readings averaging about 750 bp were obtained. Nucleotide sequences were determined from both DNA strands of both cloned inserts to ensure accuracy. Nucleotide sequence information from the TSWV-BL S RNA isolate was compared as discussed below, with TSWV isolates CPNH1 and L3 using computer programs (GCG,
• TSWV-BL S RNA clones pTSWVS-23 (TSWV-23) and pBI525-NP + (TSWV-PCR) were obtained using the double-stranded dideoxynucleotide sequencing procedure of Siemieniak, and their sequences are compared with the relevant regions of the nucleotide sequence of the TSWV-CPNH1 S RNA reported in GeneBank Accession No. D00645.
• the nucleotide sequence of TSWV-CPNH1 S RNA has been reported by De Haan (1990) and is represented by the following sequence:
• AAAGGAAATA TTTCCTTTCA AAAACACTTG AATGTCTTCC ATCTAACACA 600 CAAACTATGT CTTACTTAGA CAGCATCCAA ATCCCTTCAT GGAAGATAGA 650
• the nucleotide sequence for TSWV-23 depicted below compares closely with the TWSV sequence given above, and contains one-half of the nonstructural gene and one half of the nucleocapsid protein gene.
• the nucleic acid sequence for TSWV-PCR according to the present invention as depicted below also compares closely with the TSWV sequence given above and covers the whole nucleocapsid protein gene.
• TSWV-23 insert overlaps the TSWV-PCR insert, and together they represent the 2028 nucleotides of the TSWV- BL S RNA according to the present invention.
• This 2028 nucleotide sequence according to the present invention contains a part of the nonstructural gene and whole nucleocapsid protein gene. The combined sequence is:
• TTAAAATTTC TCCACAATCT ATTTCAGTTG CAAAATCTTT GTTAAATCTT 700
• cDNA insert of clone pTSWVS-23 included about 760 bp of the 52 K protein viral component gene, the complete intergenic region (492 bp), and 450 bp of the NP gene (about half of the NP gene).
• This cloned insert had its 3'-end located exactly at an EcoRI recognition site, which suggested incomplete EcoRI methylation during the cDNA cloning procedure.
• this clone did not contain the complete TSWV-BL NP gene, its sequence was of considerable importance since it had a 450 bp overlap with the sequence of the PCR-engineered NP gene (a total of 2028 bp of the TSWV-BL S RNA is presented in the nucleotide sequence for TSWV).
• nucleotide sequences of these two cloned NP gene regions contribute greatly, if at all, to the difference between the nucleotide sequences of these two cloned NP gene regions.
• the nucleotide difference at position 1702 resulted in the amino acid replacement of lie with Ser, and even this difference could be due to the lack of homogeneity within the TSWV-BL isolate.
• Leaf discs of Nicotiana tabacum var Havana cv 423 were inoculated with the Agrobacterium strain LBA4404 (ClonTech)
• MS medium contains full strength MS salt (Sigma), 30 g/l sucrose, 1 mg/l BA and 1 ml of B5 vitamins [1 mg/ml Nicotinic acid, 10 mg/ml Thiamine
• HCI 1 mg/ml Pyridoxine
• HCI 1 mg/ml Myo-lnositol
• Double antibody sandwich enzyme-linked immunosorbent assay was used to detect the expression of NP gene in transgenic plants with polyclonal antibodies against the TSWV-BL NP.
• Each sample was prepared by grinding a leaf disc (about 0.05 g) from the top second leaf of the plant in 3 ml of an enzyme conjugate buffer [phosphate- buffered saline, 0.05% Tween 20, 2% polyvinylpyrrolidone 40, and 0.2% ovalbumin].
• an enzyme conjugate buffer phosphate- buffered saline, 0.05% Tween 20, 2% polyvinylpyrrolidone 40, and 0.2% ovalbumin.
• TSWV-BL Serological reactions of TSWV isolates (TSWV-BL, Arkansas, 10W pakchoy, Begonia or Brazil) were assayed in DAS-ELISA using antibodies raised against TSWV-BL virion, or the NP of TSWV-BL or TSWV-I.
• Inocula were prepared by infecting Nicotiana benthamiana Domin. with different TSWV isolates and grinding infected leaves (0.5 g) of N. benthamiana plants (1 to 2 weeks after inoculation) in 15 ml. of a buffer (0.033 M KH 2 PO 4 , 0.067 M K 2 HPO 4 and 0.01 M Na 2 SO 3 ). The inoculum extracts were immediately rubbed on corundum-dusted leaves of transgenic plants and the inoculated leaves were subsequently rinsed with H 2 O.
• each batch of inoculum was used to first inoculate NP(+) plants containing the NP gene; the last inoculated plants of each inoculum were always control NP(-) plants containing the vector sequence alone to assure that a particular virus inoculum was still infective at the end of inoculation.
• TSWV-BL NP gene which resides in the S RNA component of TSWV
• the cDNA cloning strategy yielded several clones containing cDNA inserts derived from TSWV-BL S RNA, as identified by
• Oligomer primers JLS90-46 and -47 were synthesized, with JLS90-46 being complementary to the S RNA in the 5'-coding region of the NP gene (positions 2051-2073 of the TSWV-CPNH1 ) while JLS90-47 being of the 3'-noncoding region of the NP gene (positions 1218 to 1237 of the TSWV-CPNH1) . Both of the primers contain the recognition site for the restriction enzyme Ncol for subsequent cloning, and the primer JLS90- 46 has a plant consensus translation initiation codon sequence
• This specifically-amplified DNA fragment was digested with Ncol and cloned into the plant expression vector pB1525.
• the orientation of the TSWV-BL NP gene with respect to the CaMV 35S promoter was determined by restriction enzyme site mapping (EcoRI, Hindlll, Aval and AiwNI).
• Several clones were isolated that contain the insert in the proper orientation (pB1525-NP + ) and others that contain the insert in the opposite orientation (pB1525-NP-).
• This restriction enzyme site mapping data also showed that the inserts of clones pB1525-NP + contained restriction enzyme sites that were identical to those found in the TSWV-CPNH1 NP gene.
• TSWV-BL NP gene was thus controlled by a double CaMV 35S promoter fused to the 5'-untranslated leader sequence of alfalfa mosaic virus (ALMV) of the expression vector pB1525.
• ALMV alfalfa mosaic virus
• pB1525-NP + clones were transiently expressed in tobacco protoplasts to confirm that the amplified DNA fragment encoded the NP. To achieve this, the clones were transferred into tobacco protoplasts by the PEG method, and after two days of incubation the expressed NP was detected by DAS-ELISA using antibodies against the whole TSWV-
• BL virion High levels of NP were produced in tobacco protoplasts harboring the NP gene in plasmid pB1525-NP + ; while no NP was detected in tobacco protoplasts transformed with the antisense NP sequence (pB1525-NP-).
• cDNA insert of clone pTSWV-23 includes about 760 bp of the 52 K protein viral component gene, the complete intergenic region (492 bp), and 450 bp of the NP gene (about one-half of the gene).
• This cloned insert has its 3'-end located exactly at an EcoRI recognition site suggesting incomplete EcoRI methylation during the cDNA cloning procedure.
• this clone does not contain the complete TSWV-BL NP gene, its sequence is of considerable importance since it has a 450 bp overlap with the sequence of the PCR-engineered NP gene.
• the sequence comparison between this TSWV-BL PCR-engineered and TSWV- CPNH1 NP genes reveals a total of 21 nucleotide differences (2.7%), eight of which encode amino acid replacements (3.1%). Since this PCR- engineered NP gene was obtained using Taq polymerase, which is known to incorporate mutations, it is possible that some of these differences were introduced during PCR amplification.
• nucleotide sequences of these two NP genes are identical to the nucleotide sequences of these two NP genes.
• the nucleotide difference at position 1702 results in the amino acid replacement of Ile with Ser, and even this difference could be due to the lack of homogeneity within the TSWV-BL isolate.
• TSWV-BL NP gene includes the combined sequence information from the cDNA clone, pTSWVS-23 and PCR-engineered insert.
• Comparison numbers are total differences (nucleotides or amino acids) divided by total number of positions (nucleotides or amino acids) compared. For both nucleotide and amino acid calculation gaps, regardless of length, were counted as one mismatch.
• the nucleotide sequence of the NP genes from the CPNH1 and L3 isolates differ from each other by 3.1% and from the BL isolate by nearly a similar degree (2.5%).
• the NP amino acid sequences between CPNH1 and BL isolates differ by a considerably larger amount than they differ between the L3 and BL or CPNH1 and L3 isolates.
• TSWV isolates is subject to a higher degree of selective pressure than the 52 K protein as the differences among the amino acid sequences of the 52 K protein range between 7.9 to 10.6%, more than twice that found for the amino acid sequence of the NPs. Nucleotide sequence divergence is highest among the intergenic regions, indicating that this region is subject to less selective pressure than either genetic region.
• NP gene sequences in transgenic plants was first confirmed by PCR analysis. A NP DNA fragment of about 800 bp was specifically amplified from the total DNAs of transgenic NP(+) plants using the primers homologous to sequences flanking the NP gene, whereas no corresponding fragment was detected in control NP(-) plants. Expression of the NP gene was assayed in each R 0 transgenic plant by DAS-ELISA, and the results are presented in the following table: Reactions of R0 transgenic plants expressing the nucleocapsid protein (NP) gene of tomato spotted wilt virus (TSWV) to inoculation with TSWV-BL isolate
• DAS-ELISA sandwich enzyme-linked immunosorbent assay
• polypeptides from tobacco plants transformed with the NP gene This polypeptide was estimated to be around 29 kDa, which is near the expected size of the native NP. No antibody reactive-protein band of similar size was found in extracts from transgenic plants containing the vector pBIN19.
• TSWV-BL isolate Inoculation of tobacco leaves with TSWV-BL isolate could result in either systemic infection or necrotic local lesions, depending upon weather conditions and physiological stages of plants.
• TSWV-BL induced typical necrotic lesions on the inoculated leaves of control NP(-) plants 6-8 days after inoculation.
• transgenic NP(+) plants showed a spectrum of resistance to the virus when compared to control NP(-) plants. Eleven of the 23 NP(+) plants did not develop any local lesion or the number of lesions that developed was at least 20-fold less than that on the corresponding inoculated NP(-) plants. Three NP(+) plants had intermediate reactions (5- to 19-fold less lesions than controls) while the remaining 9 plants had low or no resistance. None of the inoculated NP(+) or NP(-) plants showed systemic infection,
• symptomless R 0 plants were monitored until the end of their life cycle, and no symptom was observed throughout their life cycles.
• the inoculated leaves of the symptomless NP(+) plants were checked for the presence of the virus on the leaves of C. quinoa plants. No virus was recovered from TSWV-BL-challenged leaves of highly resistant NP(+) plants, suggesting that the virus cold not replicate or spread in these NP(+) plants.
• Leaf discs from selected R 0 plants were subcloned, and the regenerated plantlets were challenged by the virus. All subcloned R 0 plants displayed levels of resistance similar to their corresponding original R 0 plants.
• TSWV transgenic plant
• Five TSWV isolates were chosen in this study to challenge R1 plants germinated on kanamycin- containing medium: TSWV-BL, Arkansas, 10W pakchoy, Begonia and Brazil.
• the first three isolates were reactive to the antibodies against the whole virion and the NP of TSWV-BL (the common TSWV "L” serogroup) (see figure 5).
• Begonia isolate reacted strongly to the antibodies against the NP of TSWV-I (the "I" serogroup) but not to those raised against the TSWV-BL NP, and therefore belonged to the "I" serogroup.
• Seedlings derived from seven R 0 lines were germinated on kanamycin medium and inoculated with the above TSWV isolates.
• NP(+) R 1 plants were highly resistant to the homologous isolate TSWV-BL, while much lower percentages of NP(+) R 1 plants were resistant to heterologous isolates Arkansas, 10W pakchoy and Begonia. On the other hand, all NP(+) R 1 plants from the seven
• transgenic lines were susceptible to the Brazil isolate, even though a slight delay (1 to 2 days) in symptom expression was observed in some of the high NP-expressing NP(+) R 1 plants from line NP(+)4.
• Resistant R 1 plants remained symptomless throughout their life cycles.
• the inoculated leaves of seventeen symptom less NP(+) plants were checked for the presence of the virus by back inoculation on leaves of Chenopodium quinoa plants. No virus was recovered from the inoculated leaves of symptomless NP(+) plants, suggesting that the virus could not replicate or spread in these NP(+) plants.
• the transgenic R 1 plants expressing low levels of the NP gene were highly resistant to infection with the isolate 10W pakchoy (the "L” serogroup), but not to Begonia isolate (the “I” serogroup).
• the highly NP-expressing R 1 plants were very resistant to infection by Begonia isolate but not to infection by the isolate from 10W pakchoy.
• Figures 5 and 6 show the relation between NP levels in transgenic R 1 plants (irrespective of the R 0 lines they came from) and their resistance to the Arkansas and 10W pakchoy isolates or to the Begonia isolate.
• almost all R 1 plants that gave high ELISA reactions (0.4-1.0 OD 405nm ) were resistant to the Begonia isolate but susceptible to the Arkansas and 10W pakchoy isolates.
• the double-stranded (ds) RNA was isolated from the N.
• benthamiana plants infected with TSWV-B using a combination of methods [See Acta Horticulturae 186:51 (1986), and Can. Plant Dis Surv 68:93(1988)] which have been successfully used for isolation of dsRNA from tissue infected with grapevine leafroll virus.
• the dsRNA was chosen for the cDNA synthesis since isolation of the virus particle from this isolate has not been possible [see Plant Disease 74:154 (1990)].
• the double stranded S RNA was gel-purified, denatured by methyl-mercury treatment, and subjected to cDNA synthesis procedure provided by
• nucleotide sequences of the inserts in clones L1 , L22 and L30 were determined from both DNA strands, first by the universal and reverse primers and then by the intemal primers designed for
• TTCTGGTCTTCTTCAAACTCA identical to a sequence 62 nucleotides from the initiation codon of the N gene, was end-labeled with
• polynucleotide kinase to screen the cDNA library described above. Five putative clones were obtained. Sequence analysis of the five clones showed that only clones S6 and S7 contain these 39 missing nucleotides of the N gene. The latter clone also included the extreme 3' end of the S RNA.
• the 5' extreme end of the S RNA was obtained using the 5' RACE System (GIBCO). Both ssRNA of TSWV-B and total RNAs isolated from tobacco plants infected with TSWV-B were used to synthesize first strand cDNA with an oligonucleotide (5'-CTGTAGCCATGAGCAAAG) complementary to the nucleotide positons 746-763 of te TSWV-B S RNA. The 3'-end of the first strand cDNA was tailed with dCTP using terminal deoxynucleotidyl transferase.
• Tailed cDNA was then amplified by PCR using an anshor primer that anneals to the homopolymeric tail, and an oligonucleotide (5'-TTATATCTTCTTCTTGGA) that anneals to the nucleotide positions 512-529 of the TSWV-B S RNA.
• the PCR- ampllified fragement was gel-purified and directly cloned into the T- vector pT7Blue (Novagen) for sequence analysis.
• Eight independent clones were sequenced with an oligomer primer (5'- GTTCTGAGATTTGCTAGT) close to the 5' region of the S RNA (nucleotide positions 40-57 of the TSWV-B S RNA).
• TSWV-B S RNA is identical to the extreme 3' end of the TSWV-I S RNA and is only one out of fifteen nucleotides different from the extreme 3' end of TSWV-CPNH1.
• the conservation of the terminal sequence among TSWV isolates is consistent with observations of the other members of Bunyaviridae genera, and supports the hypothesis that the terminal sequences might form stable base- paired structure, which could be involved in its replication and encapsulation.
• the complete nucleotide sequence of the S RNA genome of TSWV- B (the Brazilian isolate discussed above) according to the present invention is:
• CTCATGGCTA CAGAAAACAA CATTATGCCT AACTCTCAAG CTTTT GTTAA 800
• TGCTTCGAAG AAGAACTATT TTCTTTCAAA AACACTCGAA TGCTTGCCAG 1300 TAAATGTGCA GACTATGTCT TATTTGGATA GCATCCAGAT TCCTTCATGG 1350
• Lys Lys Met Ser Ile Thr Ser Cys Leu Thr Phe Leu Lys Asn Arg
• nucleocapsid protein gene depicted above is on the viral complementary strand
• nucleocapsid protein gene of TSWV-B is:
• the compete S RNA of TSWV-B should be 3049 nucleotides in length, 134 nucleotides longer than S RNA of TSWV-CPNH1. This difference was mainly attributed to the elongated intergenic region of the TSWV-B S RNA.
• Analysis of the sequenced region of TSWV-B S RNA revealed two open reading frames as depicted above, which is similar to other TSWV isolates. The larger one was localized on the viral RNA strand originating at nucleotide 88 and terminating at nucleotide 1491. The smaller one on the vial complementary strand was defined by an initiation codon at nucleotide 2898 and a termination codon at nucleotide 2122.
• the open reading frame of 777 nucleotides encodes the N protein of 258 amino acids with a predicted molecular weight of 28700 Da.
• sequence comparisons of the N open reading frame from TSWV isolates revealed that nucleotide sequences of the N genes from the isolates CPNH1 , L3 and BL differs from TSWV-B by a considerably larger amount (22%-22.5%) than they differ from each other (2.7%-3.2%). Consistent to the results of the immunological analysis, the N amino acid
• sequences among CPNH1 , L3 and BL isolates are more closely related to each other (98.8%-99.6% similarities or 96.9%-98.5% identities) than to the TSWV-B (90.3%-91.5% similarities or 79.1 %-79.9% identities). Much lower homology was observed to TSWV-I at both nucleotide (63.1%) and amino acid (69.7% similarity or 55.3% identity) levels.
• N open reading frame of TSWV-I that encodes 262 amino acids
• the N open reading frames of the other isolates code for the 258 amino acids.
• Computer analysis suggested that the extra residues of TSWV-l N open reading frame resulted from the amino acid sequence insertions (residues 82 through 84 and residue 116).
• One potential N- glycosylation site is found at residue 68.
• the second open reading frame of 1404 nucleotides encodes the nonstructural protein of 467 amino acids with a predicted molecular weight of 52566 Da. Comparisons with homologous open reading frames of TSWV-CPNH1 and TSWV-L3 showed 80% and 79% similarities at the nucleotide level, and 86.1% (or 78.3% identity) and 89% (or 82.0% identity) similarities at the amino acid level.
• This open reading frame contains four potential glycosylation sites, which are located in the exactly same positions as those of TSWV-CPNH1 and TSWV-L3.
• the intergenic region of the TSWV-B S RNA was, due to several insertions, 126 and 41 nucleotide longer than the counterparts of TSWV-CPNH1 and TSWV-L3, respectively.
• the sequence analysis by the program FOLD indicated the intergenic region can form very complex and stable hairpin structure by internally base-pairing U-rich stretches with A-rich stretches of the intergenic region, which had similar stability to those produced from TSWV-CPNH1 and TSWV-L3 as indicated by minimum free energy values.
• This internal base-paired structure may act as a transcription termination signal.
• N protein of TSWV-B is subject to a higher degree of selective pressure than the 52 K protein; the similarities among the amino acid sequences of the 52 K protein are lower than that found for the amino acid sequence of the
• NPs Nucleotide sequence divergence is highest among the intergenic regions, which indicates that this region is subject to less selective pressure than either genetic region.
• the TSWV-B is more closely related to the L- type isolates than to the l-type isolate TSWV-I, but is much less similar to the L-type isolates than the L-type isolates are to each other.
• Transgenic plants according to the present invention that gave low or undetectable ELISA reactions (0-0.05 OD 405n m ) were resistant to infection by the heterologous isolates (Arkansas and 10W pakchoy) of the "L" serogroup, whereas no protection against these isolates was found in plants accumulating high levels of the NP. Compared to the ELISA readings of control NP(-) plants (0.05 OD 405n m ).
• transgenic plants may produce little, if any, TSWV-BL NP. Similar results have been observed in transgenic plants, in which the CP accumulation was not detected; these were highly resistant to virus infection. The mechanism underlying this phenomenon is presently unknown. It is likely that this type of resistance might be attributed to interference of CP RNA molecules produced in transgenic plants with viral replication, presumably by hybridizing to minus-sense replicating RNA of the attacking virus, binding to essential host factors (e.g., replicase) or interfering with virion assembly.
• essential host factors e.g., replicase
• NP gene expression levels of the NP gene Although the relative NP levels of the individual R 1 plants inoculated with TSWV-BL were not measured, it is reasonable to assume that the NP produced in these inoculated R 1 plants (a total of 145 plants tested) ranged from undetectable to high. In contrast to the case for protection against the heterologous isolates of the "L" serogroup, protection against the Begonia isolate of the TSWV-I serogroup was found in the high NP-expressing R 1 plants. Comparison of NP nucleotide sequence of the "L” serogroup with that of the "I” serogroup revealed 62% and 67% identity at the nucleotide and amino acid levels, respectively.
• NP genes of the two serogroups might be so great that the NP (the "L” serogroup) produced in transgenic plants acted as a dysfunctional protein on the attacking Begonia isolate of the "I” serogroup. Incorporation of this "defective" coat protein into virions may generated defective virus which inhibit virus movement or its further replication. This type of interaction is expected to require high levels of the NP for the protection.
• resistance to the Begonia isolate may also involve interference of NP transcripts produced in R 1 plants with viral replication. If this is true, more NP transcripts (due to the
• heterologous nature of two NP gene may be required to inhibit replication of heterologous virus.
• transgenic tomatoes (L. esculentum) were produced by A. tumefaciens-mediated gene transfer of the nucleocapsid protein (N) gene of the lettuce isolate of tomato spotted wilt virus BL into germinated cotyledons using modifications of published procedures [see Plant Cell Reports 5:81 (1986)].
• the tomato line "Geneva 80" was selected for transformation because it contains the Tm-22 gene which imparts resistance to TMV, thus creating the possibility of producing a multiple virus-resistant line.
• Transformants were selected on kanamycin media and rooted transgenic tomatoes were potted and transferred into the greenhouse.
• R 1 and R 2 tomato seedlings expressed the NPT II gene, suggesting multiple insertions of this gene in the plant genome. In contrast, only 18% of the seedlings produced detectable levels of the N protein.
• TSWV-T91 or TSWV-B TSWV-B.
• R 1 and R 2 transgenic plants were infected with TSWV-BL, 7% with TSWV-T91 , and 45% with TSWV-B.
• a plants were inoculated at the one- to two-leaf stage with 5-, 10-, or 20- fold diluted leaf extract of N. benthamiana, H423 tobacco or tomato; the same plants were re-inoculated 7 days later and symptoms were recorded after another 14 days; the reaction is expressed as number of plants with symptoms/number of plants tested
• the description above supports the finding that transgenic tomato plants that express the N gene of TSWV-BL show resistance to infection to TSWV-BL, to other TSWV isolates that are closely related to TSWV-BL, and to the more distantly related TSWV-B.
• benthamiana expressing the TSWV-BL N gene did not correlate with the observed protection in transgenic tomatoes; 55% of the transgenic tomatoes were also resistant to a distantly related isolate of TSWV-B, which was not observed in transgenic tobacco and N. benthamiana plants. These discrepancies may reflect that tomato is inherently less susceptible to Tospoviruses.
• transgenic plants expressing the NP gene of the TSWV-BL isolate are highly resistant to infections of both the homologous TSWV-BL isolate and heterologous isolates of the same serogroup (Arkansas and 10W pakchoy). More significantly, the resistance is effective to Begonia isolate from other serogroups.
• transgenic tobacco plants expressing the nucleoprotein gene of TSWV-BL display resistance to both TSWV and INSV, and the protection appears to be mediated by the nucleoprotein against distantly related INSV and by the nucleoprotein gene ribonucleotide sequence against the homologous and closely related TSWV isolates. This is the first time broad spectrum resistance of the engineered plants to different isolates of TSWV has been shown.
• coat protein protection generally displays delay and/or reduction in infection and symptom expression, but no immunity, the present invention provided a significantly high percentage of transgenic plants which were symptom-free and free of the infective virus.
• transgenic plants producing little, if any, TWSV-BL NP were highly resistant to infection by the homologous isolate and other closely-related isolates within the same serogroup of TSWV, whereas no protection was found in those expressing high levels of the NP gene.
• TSWV The biological diversity of TSWV is well documented and has been reported to overcome the genetic resistance in cultivated plants such as tomato. Thus, it is extremely important to develop transgenic plants that show resistant to many strains of TSWV.
• the present invention indicates that one method to do so would be to utilize the viral NP gene to confer this resistance, and that this resistance would be to diverse TSWV isolates.
• the finding of the present invention that the expression of TSWV NP gene is capable of conferring high levels of resistance to various TSWV isolates has a great deal of commercial importance.
• Plasmid BIN19-N + was constructed and transferred to A. tumefaciens strain LBA4404 in accordance with Example IV, and transferred to Nicotiana benthamiana in accordance with Example V.
• the nucleocapsid genes of INSV-Beg and -LI were amplified with oligomer primers INSV-A
• nucleocapsid gene of an INSV isolate were purified in accordance with Example III, and digested and sequenced in accordance with Example IV.
• Transgenic seedlings from the six R 0 lines were selected by germinating seeds on kanamycin selection medium, and these seedlings were inoculated with the five Tospoviruses.
• the inoculated R1 plants were rated susceptible if virus symptoms were observed on
• the low N gene expressing line N + -21 showed the best resistance against the homologous (78%) and closely related TSWV-10W (57%) isolates and very little resistance to the two INSV isolates (3% and 10%); only three N + -21 plants showed the resistant phenotype when inoculated with the INSV isolates.
• Leaf samples from these INSV- resistant N + -21 R 1 plants gave much higher ELISA reactions (OD 405n m 0.5 to 1.00) and thus higher amounts of the N protein than the susceptible N + -21 plants (OD 405n m 0.02 to 0.20).
• the high N gene expressing lines N + -34 and -37 showed the highest resistance to INSV isolates (18%-25%) followed by the homologous TSWV-BL isolate (7% and 11%) while none of the plants showed resistance to TSWV-10W; however, the N + -34 and -37 R 1 plants that became infected with INSV or TSWV-BL did show various lengths of delays in symptom expression. None of the R1 plants from these four transgenic N + lines were resistant to TSWV-B; some of the R1 plants from the N + -34 and -37 lines showed a slight delay of symptom appearance
• the inoculated N + R 1 plants in the preceding table were re-organized into four groups based on the intensity of their ELISA reactions of tissues taken before inoculation irrespective of original R 0 pants.
• the N + R 1 plants that expressed low levels of the N protein (0.02-0.2 OD) showed high resistance (100% and 80%) to TSWV-BL and -10W but were all susceptible to INSV-Beg and -LI, showing no detectable delay in symptom expression relative to control N- plants.
• N + R1 plants with high levels of the N protein showed various levels of protection against TSWV-BL, INSV-Beg and -LI, ranging from a short delay of symptom expression to complete resistance with most of these plants showing various lengths of delay in symptom development relative to control N" plants.
• none of the N + R 1 plants were resistant to TSWV-B regardless of the level of N gene expression; however, a short delayed symptom appearance was observed in the N + R 1 plants producing high levels of the N protein.
• All control N- R 1 plants and transgenic N + R 1 plants with undetectable ELISA reactions (0 to 0.02 OD) were susceptible to all the Tospoviruses tested.
• Protoplasts derived from R 1 plants of the low expressor line N + -21 supported the replication of INSV-LI whereas protoplasts from R 1 plants of the higher expressor line N + -37 did not until 42 hours after inoculation at which low levels of viral replication were observed.
• the same protoplasts at various time intervals e.g. 0, 19, 30 and 42 hours were also assayed by DAS-ELISA using antibodies specific to the TSWV-BL N protein to monitor the expression level of the transgene.
• protoplast from N + -21 R 1 plants produced relatively low levels (0.338-0.395 OD405nm) whereas protoplasts from N + -37 R 1 plants accumulated high levels (0.822-0.865 OD 405n m ). The expression level was found to be consistent at all time points.
• TSWV-BL N protein are highly resistant to the homologous and closely related (TSWV-10W) isolates, while plants that accumulate high amounts of this protein posses moderate levels of protection against both the homologous and distantly related (INSV-Beg and INSV-LI) viruses. More importantly, these findings indicate that transgenic N. benthamiana plants (a systemic host of INSV) are protected against INSV-Beg and INSV-LI isolates.
• transgenic plants expressing the N gene of TSWV are resistant to homologous isolates, and that such plants expressing the TSWV-BL N gene are resistant to both TSWV and INSV. It has also been shown the best resistance to homologous and closely related isolates was found in transgenic plants accumulating low levels of N protein while transgenic plants with high levels of TSWV-BL N protein were more resistant to serologically distant INSV isolates. This observation led us to suspect the role of the translated N protein product in the observed protection against homologous and closely related isolates and to speculate that either the N gene itself which was inserted into the plant genome or its transcript was involved in the protection.
• transgenic plants is shown in figure 7.
• the construct pBIN19-N contains the promoterless N gene inserted into the plant transformation vector pBIN19 (see Example IV). All other constructs contain a double 35S promoter of CaMV, a 5'-untranslated leader sequence of alfalfa mosaic virus and a 3'-untranslated/polyadenylation sequence of the nopaline synthase gene.
• pBI525 is a plant expression vecor and is used in this study as a control;
• pBI525-mN contains the mutant (untranslatable) form of the N gene;
• pBI525-asN contains the antisense form of the untranslatable N gene.
• One nucleotide deletion at the 5'-terminus of the mutant N gene is indicated by the dash symbol. ATG codons are underlined and inframe termination codons in the mutant gene are shown in bold.
• the gel-isolated intact and mutant N gene fragments were digested with the appropriate restriction enzyme(s) and directly cloned into BamHI/Xbal-digested plant transformation vector pBIN19 and Ncol- digested plant expression vector pBI525, respectively as described in Example IV.
• the resulting plasmids were identified and designated as pBIN19-N containing the intact, promoterless N gene, and pBI525-mN and pBI525-asN containing the mutant coding sequence in the sense and antisense orientations, respectively, relative to cauliflower mosaic virus 35S promoter.
• the translatability of the mutant N coding sequence in the expression cassette was checked by transient
• PCR was performed on each R 0 transgenic line as described above.
• the oligomer primers A and B were used to determine the presence of the N coding sequence of TSWV-BL.
• the oligomer primers A and B were used to determine the presence of the N coding sequence of TSWV-BL.
• RNA transcript level in transgenic plants was estimated using polyclonal antibodies against the TSWV-BL N protein.
• total plant RNAs were isolated according to Napoli [see The Plant Cell 2:279 (1990)], and were separated on a formaldehyde-containing agarose gel (10 ⁇ g/lane). The agarose gels were then stained with ethidium bromide to ensure uniformality of total plant RNAs in each lane. Hybridization conditions were as described in the GeneScreen Plus protocol by the manufacturer.
• Resulting signal blots were compared and normalized based on the N gene transcript band of the control lane (the mN R 1 plant producing a high level of the N gene transcript) included in each blot.
• transgenic plants that gave density readings Hewlet ScanJet and Image Analysis Program
• density readings Hewlet ScanJet and Image Analysis Program
• Tobacco protoplasts were prepared from surface-sterilized leaves derived from R 1 plants [see Z. Rooanphysiol. 78:453 (1992) with modifications].
• the isolated protoplasts (6 x 10 6 protoplasts) were transformed with 0.68 OD 260nm of the purified TSWV-BL virion preparation using the PEG method [see Plant Mol. Biol. 8:363 (1987)].
• the transformed protoplasts were then cultured at the final density of 1 x 10 6 protoplasts /ml in the culture medium at 26°C in the dark.
• Viral multiplication was estimated by measuring the N protein of the virus using DAS-ELISA.
• transgenic tobacco producing none or barely detectable amounts of the N protein were resistant to homologous and closely related isolates. This result suggested that the observed resistance may have been due to trans interactions of the incoming viral N gene RNA with either the N gene transcript produced in the transgenic plants or the N coding sequence itself.
• transgenic P°N R 0 lines and R 1 plants from two P°N lines were challenged with four Tospoviruses (TSWV-BL, TSWV-10W, INSV- Beg and TSWV-B). Only asymptomatic plants were rated resistant while plants showing any symptoms were rated susceptible. All inoculated R 0 and R 1 plants were susceptible to the viruses.
• amN and asN represent plants expressing the sense and antisense untranslatable N genes, respectively, P°N represents plants containing the promoterless N gene; bthe level of the N gene RNA was estimated in each line by Northern blots, nd indicates that the N gene transcript was not detected;
• c30-fold diluted leaf extracts of the N. benthamiana plants infected with TSWV-BL were applied to three leaves of each plant at the 6-7 leaf stage. Each extract was first applied to all test piants followed by control healthy plants. Data were taken daily for 45 days after inoculation and only the asymptomatic plants were rated resistant.
• transgenic plants to TSWV-BL were related to their relative levels of N gene transcript, transgenic progenies from four mN and three asN R 0 lines with either high or low N gene transcript levels were selected by germination on kanamycin-containing media. These transgenic plants were tested for resistance to the four Tospoviruses at the 3 to 4 leaf stage, except that some R 1 plants from two asN lines were inoculated at the 6 to 7 leaf stage. The results are summarized in the following table:
• cthe fraction in parenthesis represents the inoculation data obtained from plants inoculated at the 6-7 leaf stage; the remaining data in this table were generated from plants inoculated at the 3-4 leaf stage; inoculated plants were observed daily for 45 days after inoculation.
• protoplasts derived from plants that produced high levels of the respective RNA transcripts supported the replication of the virus, whereas protoplasts from mN low expressor (mN-18) did not.
• Protoplasts from an asN low expressor (asN-9) supported much lower levels of viral replication.
• transgenic plants expressing sense or antisense form of untranslatable N gene coding sequence are resistant to homologous (TSWV-BL) and closely related (TSWV-10W), but not to distantly related (INSV-Beg and TSWV-B) Tospoviruses.
• TSWV-BL homologous
• TSWV-10W closely related
• INSV-Beg and TSWV-B distantly related
• clevel of resistance may depend upon the concentration of inoculum.
• Tospoviruses according to the present invention.
• One mechanism involves the N gene transcript (RNA-mediated), and another involves the N protein (protein-medicated).
• RNA-mediated N gene transcript
• protein-medicated N protein
• the results of the protoplast experiments indicate that N gene RNA-mediated protection is achieved through a process that inhibits viral replication, and the data contained in the above tables suggest that protection against the distantly related INSV-Beg isolate is conferred by the N protein of TSWV-BI, and not by the gene transcript.
• the following describes the cloning of one-half N gene fragments of TSWV-BL in order to demonstrate this final aspect of the present invention.
• the first and second halves of both the translatable and untranslatable N gene were generqated by reverse transcription and then PCR as described above.
• the nucleotide deletion or insertions at the 5'-terminals of the untranslatable half N gene fragments are indicated by the dash symbol; ATG codons are underlined and all possible termination codons immediately after the initiation codon of the untranslatable half N gene fragments are shown in bold.
• the first half of the N gene was produced by RT-PCR using oligoprimers i (5'-TACAGTGGATCCATGGTTAAGGTAATCCATAGGCTTGAC), which is complementary to the central region of the TSWV-BL N gene, and ii (5'-AGCTAACCATGGTTAAGCTCACTAAGGAAAGCATTGTTGC) for the translatable or iii
• the latter two oligomer primers are identical to the 5'-terminus of the N gene.
• the second half of the N gene was produced by RT-PCR using oligomer primers iv (5'-AGCATTGGATCCATGGTTAACACACTAAGCAAGCAC) which is complementary to the 3'-noncoding region of the TSWV-BL N gene, and v (5'-TACAGTTCTAGAACCATGGATGATGCAAAGTCTGTGAGG) for the translatable or vi
• the oligomer primer iii contains a frameshift mutation immediately after the translation codon and several termination codons to block possible translation readthroughs while the oligomer primer vi contains several inframe termination codons immediately after the translation
• the half gene fragments were purified on a 1.2% agarose gel as described above, and the gel-isolated gene fragments were digested with the restriction enzyme Ncol and directly cloned into Ncol
• the resluting plasmids were identified and designated as (1) pBI525-1 N containing the first half translatable N gene, (2) pBI525-1 N' containing the first half
• tumefaciens strain LBA4404 using the procedure described by Holsters supra.
• Leaf discs of N. benthamiana were inoculated with A. tumefaciens strain LBA4404 containing the various constructs.
• Transgenic plants were self-pollinated and seeds were selectively germinated on kanamycin as described above.
• Example VIII Analysis of transgenic plants by PCR and Northern hybridization PCR was performed on each R 0 transgenic line as described previously.
• the oligomer primers i to vi were used to determine the presence of the N coding sequence of TSWV-BL.
• the oligomer primer 35S-Promoter (see Example VIII) was combined with one of the above oligomer primers to confirm the orientation (relative to the CaMV 35S promoter) of the half gene sequences inserted into the plant genome.
• Northern analysis was conducted as described in Example VIII.
• TSWV-BL Lettuce isolate of TSWV (TSWV-BL) was used to challenge transgenic plants. Inoculation was done using test plants at the 3-4 leaf stage as described above. To avoid the possibility of escapes, control pants were used in each experiment and each inoculum extract was used to first inoculate the transgenic plants followed by control plants.
• translatable and untranslatable half N gene fragements were then placed downstream of the CaMV 35S promoter of the vector pBI525 in the sense orientation or in the antisense
• the expressin of the half N coding sequences of TSWV-BL was thus controlled by a double CaMV 35S promoter fused to the 5'- untranslated leader sequence of alfalfa mosaic virus (ALMV) of the expression vector pBI525.
• AMV alfalfa mosaic virus
• Expression vectors that utilize the stacked double CaMV 35S promoter elements are known to yield higher levels of mRNA trnscription than similar vectors with a single 35S promoter element.
• Expression cassettes were transferred from the vector pBI525 to the pant transformation vector pBIN19. The resluting plasmids as well as the control plasmid pBIN19 were then transferred into A. tumefaciens strain LBA4404. Transgenic plants were obtained with nomenclature of the transgenic lines shown in figure 8.
• Each transgeinc R0 line which was grown for seeds was then assayed using Northern blot. Six out of six 1 N, four out of six 1 N', six out of six 1 N-, six out of six 2N, seven out of eight 2N', and six out of seven 2N- transgenic R 0 lines were found to produce half N gene RNAs.
• a set of transgenic R 0 plants was challenged with the
• transgenic R 0 lines Another set of transgenic R 0 lines was brought to maturity for seed production. Seedlings were germinated on kanamycin-containing medium and inoculated with TSWV-BL. As shown in the following table, control seedlings and seedlings from some of the transgenic lines were susceptible to the isolate whereas seedlings from lines 1 N-151 , IN'- 123, and 2N'-134 showed variojs levels of protection , ranging from delays in symptom expression to compete resistance.
• this aspect of the present invention shows that transgenic plants expressing the first or the second half of either translatable or untranslatable N gene fragment are highly resistant to the homologous TSWV-BL isolate. This result demonstrates that a portin of the N gene is sufficient for resistance to the virus.
• TGCAAAGCTC CTTTTGAATT ATCAATGATG TTTTCTGATT TAAAGGAGCC 350 TTACAACATT GTTCATGACC CTTCATACCC CAAAGGATCG GTTCCAATGC 400
• AAAGGAAATA TTTCCTTTCA AAAACACTTG AATGTCTTCC ATCTAACACA 600 CAAACTATGT CTTACTTAGA CAGCATCCAA ATCCCTTCAT GGAAGATAGA 650
• TTAAAATTTC TCCACAATCT ATTTCAGTTG CAAAATCTTT GTTAAATCTT 700 GATTTAAGCG GGATTAAAAA GAAAGAATCT AAGATTAAGG AAGCATATGC 750
• TTAAAATTTC TCCACAATCT ATTTCAGTTG CAAAATCTTT GTTAAATCTT 700
• TAAACACACT TATTTAAAAT TTAACACACT AAGCAAGCAC AAACAATAAA 1200 GATAAAGAAA GCTTTATATA TTTATAGGCT TTTTTATAAT TTAACTTACA 1250
• TCCTTTAGCA TTAGGATTGC TGGAGCTAAG TATAGCAGCA
• ACTCTTTCC 1400 CCTTCTTCAC CTCATCTTCA TTCATTTCAA ATCCTTTTCT TTTCAGCACA 1450
• GCTTCGGCTA CACTTCAAAA ATTGGTGATA TTCCTGCTGT AGAGGAGGAA 300 ATTTTATCTC AGAACGTTCA TATCCCAGTG TTTGATGATA TTGATTTCAG 350
• GCCCAATTGC ATCCCTTTGA ACCTCTGATG AGCAGGTCAG AGATTGCTAG 500
• CTGCTGCTAA CAAGGGATCT CTCTCCTGTG TCAAAGAACA TACTTACAAA 600 GTCGAAATGA GCCACAATCA GGCTTTAGGC AAAGTGAATG TTCTTTCTCC 650
• CTCATGGCTA CAGAAAACAA CATTATGCCT AACTCTCAAG CTTTTGTTAA 800
• AAG AAA ATG ACT ATC ACT TCA TGT TTG ACT TTC TTG AAG AAT CGC 180

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Molecular Biology (AREA)
• Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Biotechnology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biophysics (AREA)
• General Engineering & Computer Science (AREA)
• Virology (AREA)
• Biochemistry (AREA)
• Biomedical Technology (AREA)
• Physics & Mathematics (AREA)
• Cell Biology (AREA)
• Plant Pathology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Microbiology (AREA)
• Medicinal Chemistry (AREA)
• Gastroenterology & Hepatology (AREA)
• Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
• Peptides Or Proteins (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Agricultural Chemicals And Associated Chemicals (AREA)

Priority Applications (4)

Applications Claiming Priority (2)

Related Child Applications (1)

Publications (1)

Family

ID=21745644

Family Applications (1)

Country Status (8)

Cited By (4)

Families Citing this family (6)

Citations (1)

Family Cites Families (4)

• 1994
  • 1994-01-27 CN CN94191418A patent/CN1094976C/zh not_active Expired - Lifetime
  • 1994-01-27 WO PCT/US1994/001046 patent/WO1994016550A1/en not_active Ceased
  • 1994-01-27 AU AU61298/94A patent/AU685428B2/en not_active Expired
  • 1994-01-27 CA CA002154695A patent/CA2154695A1/en not_active Abandoned
  • 1994-01-27 KR KR1019950703146A patent/KR100406666B1/ko not_active Expired - Lifetime
  • 1994-01-27 EP EP94907916A patent/EP0681427A4/en not_active Withdrawn
  • 1994-01-27 US US08/495,484 patent/US6329568B1/en not_active Expired - Lifetime
  • 1994-01-27 JP JP6517360A patent/JPH08506242A/ja not_active Withdrawn
• 2005
  • 2005-08-01 JP JP2005223108A patent/JP4644557B2/ja not_active Expired - Lifetime
• 2006
  • 2006-09-26 JP JP2006261120A patent/JP2007020579A/ja active Pending

Patent Citations (1)

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events