WO1994004696A1 - Apport nucleaire de macromolecules facilite par un signal de translocation - Google Patents

Apport nucleaire de macromolecules facilite par un signal de translocation Download PDF

Info

Publication number
WO1994004696A1
WO1994004696A1 PCT/US1993/007945 US9307945W WO9404696A1 WO 1994004696 A1 WO1994004696 A1 WO 1994004696A1 US 9307945 W US9307945 W US 9307945W WO 9404696 A1 WO9404696 A1 WO 9404696A1
Authority
WO
WIPO (PCT)
Prior art keywords
domain
dna
polypeptide
gene
macromolecule
Prior art date
Application number
PCT/US1993/007945
Other languages
English (en)
Inventor
Thomas R. Barnett
Rathindra C. Das
Original Assignee
Miles Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Miles Inc. filed Critical Miles Inc.
Priority to JP6506592A priority Critical patent/JPH08504565A/ja
Priority to KR1019950700814A priority patent/KR950703650A/ko
Priority to AU50885/93A priority patent/AU674026B2/en
Priority to EP93920291A priority patent/EP0658210A1/fr
Publication of WO1994004696A1 publication Critical patent/WO1994004696A1/fr
Priority to FI950866A priority patent/FI950866A/fi
Priority to NO950726A priority patent/NO950726L/no

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/21—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pseudomonadaceae (F)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/6415—Toxins or lectins, e.g. clostridial toxins or Pseudomonas exotoxins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/55—Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin

Definitions

  • the invention relates to methods of introducing foreign materials into a cell nucleus. More particularly, the present specification discloses methods for transporting nucleotide sequences or proteins into the nucleus using a novel translocation signal facilitated delivery system.
  • Such treatment involves the introduction of genes and regulators for factor VIII for hemophiliacs and al- antitrypsin for patients suffering from hereditary emphysema or adult respiratory distress syndrome (ARDS).
  • ARDS adult respiratory distress syndrome
  • Such approaches can even be extended to re-transform aberrant tumor cells in cancer patients.
  • the most attractive manner for achieving such therapeutic transformation is to deliver a gene coding for the deficient gene product into the nucleus of somatic cells.
  • In vitro delivery of foreign DNA into mammalian cells for gene expression has been achieved by three distinct approaches.
  • the first approach takes advantage of the natural ability of viruses to infect cells and express viral DNA in the form of specific RNA and protein species (Cournoyer et al., 1991 , "Gene transfer of adenosine deaminase into primitive human hematopoetic progenitor cells". Human Gene Therapy, 2:203; Rosenberg et al., 1990, "Gene transfer into humans: immunotherapy of patients with advanced melanoma using infiltrating lymphocytes modified by retroviral gene transduction". New England Journal of Medicine, 323 :570).
  • advantage has been taken of mammalian retroviruses as vector systems that permit infection of a variety of cell types and allow for expression of many different foreign genes.
  • Retroviruses and their recombinant forms are thought to bind to cells via specific receptors on the cell surface, after which they are internalized by endocytosis. Once endocytosed, the virus is able to evade the endosome-lysosome pathway by a mechanism which is thought to disrupt the endosome, escape degradation and permit entry into the cell nucleus .
  • a second approach fuses artificial lipophilic vesicles containing exogenous DNA with a cellular target (Feigner et al., 1987, "Lipofection: a highly efficient, lipid-mediated DNA- transfection procedure", Proc. Natl. Acad. Sci. USA, 84:7413). Delivery of DNA to the nucleus via lipophilic vesicle fusion is thought to be possible because it is hypothesized that endosome- associated degradation might be bypassed.
  • a third, non-specific approach for introduction of foreign DNA into cells is achieved by mixing exogenous DNA with a polycationic support, such as DEAE-dextran (McCutchan et al., 1968, "Enhancement of the infectivity of simian virus 40 deoxyribonucleic acid with diethyl aminoethyl-dextran", J. Natl. Cancer Inst., 41 :351); or by complexing with calcium phosphate (Graham et al., 1973, “A new technique for the assay of infectivity of human adenovirus 5 DNA", Virology, 52:456).
  • exogenous DNA mixture with polycationic support or calcium phosphate is then incubated with live cells (i.e. a transfection step).
  • Uptake or endocytosis of DNA can be monitored by subsequent selection of the expressed phenotype, typically by complementation or by antibody-reactive surface markers.
  • the mechanism of DNA uptake by the cells is largely unknown, but it is generally accepted that the DEAE- dextran or calcium phosphate protects the DNA from the nuclease activity of lysosomal cell compartments, followed by escape to the nucleus where expression occurs.
  • Increased efficiency of expression using the transfection method can be achieved when lysosomotropic agents, such as chloroquine (Luthman et al., 1983, "High efficiency polyoma DNA transfection of chloroquine treated cells", Nucl. Acids Res., 1 1 : 1295), are included in the transfection mixtures.
  • Lysosomotropic agents apparently reduce lysosomal destruction of DNA by increasing the relatively low pH necessary for activation of degradation.
  • in vitro methods have been proposed for introduction of foreign DNA into mammalian cells.
  • these known methods have inherent drawbacks in use.
  • problems and considerations have to be addressed. These problems include, but are not limited to the practical administration of a gene to an individual suffering from a particular disease amenable to therapy; targeting of the gene of interest to a particular cell-type or organ; efficient uptake of the gene by the cells; targeting of the gene to the nucleus; and efficient and sustained expression of the gene product.
  • retroviruses While valuable as in vitro tools, retroviruses have considerable problems when used in vivo, including a very broad cell type specificity, the requirement for dividing cells to permit replication of the genome, inefficient expression of an inserted gene once in the nucleus, and questions of human safety.
  • adenovirus like other viruses, evades intracellular destruction and targets its genome to the cell nucleus (Curiel et al., 1991 , "Adenovirus enhancement of, transferrin- polylysine-mediated gene delivery", Proc. Natl. Acad. Sci. USA, 88:8850).
  • Advantage was taken of the ability of the adenovirus particle to "uncoat" its capsid proteins and permit early escape from the endosome-lysosome pathway.
  • This group added adenovirus particles to a mix of transferrin-poly-L-lysine that was electrostatically linked to DNA in the range of a few kilobases to nearly fifty kilobases to mediate enhanced expression of, in this case, the product of the luciferase gene (Cotten et al., 1992, "High-efficiency receptor-mediated delivery of small and large (48 kilobase) gene constructs using the endosome- disruption activity of defective or chemically inactivated adenovirus particles", Proc. Natl. Acad. Sci. USA, 89:6094).
  • a major disadvantage of the adenovirus-facilitated gene delivery technique is that success relies on the tedious preparation of chemically-derived protein-DNA-virus complexes of unknown quality to achieve the enhanced levels of expression reported.
  • a further drawback is the requirement of the concomitant expression of both transferrin and adenovirus receptors on the desired cell targets.
  • the present invention is a translocation signal facilitated system for providing efficient, reproducible and targeted delivery of protein or DNA-protein complexes with therapeutic value, to the nuclei of mammalian cells, our approach takes advantage of the natural ability of some proteins, not just viruses, to enter cells and perform specific functions, such as directing their way out of endosomes into cytoplasm with the help of a cytoplasmic trans- location signal, and further directing their way to the nucleus with the help of a specific nuclear targeting signal.
  • exotoxin A of Pseudomonas aeruginosa which generally infects patients at the site of surface injury, but which can also target its virulence at fibroblast cells and systemically, primarily to the liver, and secondarily to organs such as the kidney and spleen.
  • Exotoxin A is composed of four domains, which are organized starting from the amino terminus as domains la, II, lb, and III (Allured et al., 1986, "Structure of exotoxin A of Pseudomonas aeruginosa at 3.0- Angstrom resolution", Proc. Natl. Acad. Sci. USA, 83: 1320) ( Figure 1).
  • Domain la (amino acids 1-252) binds the exotoxin specifically to a cell-surface receptor; domain II (amino acids 253-364) is the region of the exotoxin that is specifically cleaved after activation in the low pH compartment of the endosome and translocates the distal regions of the exotoxin out of the endosome; domain III (amino acids 405-613) contains the ADP- ribosylating activity of the toxin that inactivates ribosome associated protein elongation factor 2; domain lb appears to be a structural, rather than functional, domain (amino acids 365-404).
  • exotoxin protein which are important for each step in its uptake and delivery to the cell cytoplasm are described in Siegall et al., 1989, "Functional analysis of domains II, lb and III of Pseudomonas exotoxin", J. Biol. Chem., 264:14256.
  • chimeric molecules can be constructed which allow attachment of other non-toxin-related receptor-binding domains to the ADP-ribosylation domain III for targeting toxin activity to the cytoplasm of certain cells for the purpose of cancer chemotherapy.
  • exotoxin A domains la and II can be used to deliver an unrelated domain, in this case, a bacterial nuclease, barnase, to the cytoplasm of mammalian cells (Prior et al.. 1992, "Translocation mediated by domain II of Pseudomonas exotoxin A: transport of barnase into the cytosol”. Biochemistry, 31 :3555).
  • FIG. 2 A schematic representation of the molecular system designed for the nuclear targeting and delivery of DNA or proteins is depicted in Figure 2. This figure shows the preferered configuration of the critical domains needed f or targeting a macromolecule to the nucleus for therapeutic intervention.
  • FIG. 3 shows the construction of a specific carrier protein
  • Figure 4 shows a schematic representation of the protein carrier- mediated delivery of a target protein to a cellular receptor for the exotoxin A binding domain.
  • the receptor-binding domain is domain la derived from the Pseudomonas exotoxin A gene
  • the functional domain is ⁇ - galactosidase, the nuclear delivery of which is measured by the development of blue color in the presence of 5-bromo-4-chloro-3- indoyl- ⁇ -D- galactopyranoside (X-gal) substrate.
  • the delivery system consists of domains la and II from Pseudomonas exotoxin A, a nuclear targeting signal (NTS) from SV40 T-antigen, and a functional version of 0- galactosidase.
  • Domain la provides a natural means for directing the chimera to a particular cell type containing exotoxin A receptors such as fibroblasts, or to an organ such as the liver, by binding to a specific cell-surface receptor.
  • the protein-carrier complex is internalized into the cell by endocytosis, and the complex becomes engulfed in endosomes.
  • the pH of the endosome becomes more acidic, whereupon a pH-driven cleavage of domain II occurs, and it is the activation of this domain that is the key to the translocation of the distal portion of the protein (part of domain II, NTS, and ⁇ -galactosidase) to the cytoplasm (see Figure 3).
  • NTS nuclear targeting signal
  • the polypeptide domain in this case derived from ⁇ - galactosidase, is free to function appropriately.
  • domain la could be substituted by other receptor-binding domains (for example, transforming growth factor alpha (TGF- ⁇ ) ; or other toxin- derived ligands such as from diphtheria toxin) and that ⁇ -galactosidase can be equally substituted by other protein domains, for example, transcription factors.
  • TGF- ⁇ transforming growth factor alpha
  • ⁇ -galactosidase can be equally substituted by other protein domains, for example, transcription factors.
  • NTS nuclear translocation signal
  • the SV40 nuclear translocation signal domain can be substituted with others such as yeast alpha-2, GAL 4, etc.
  • domain " Z" is no longer a functional polypeptide domain, but rather a DNA-binding domain.
  • This DNA- binding domain is attached by electrostatic binding either specifically or non-specifically to a piece of DNA, comprising either a sense or antisense oligonucleotide, or an expressible gene that includes replication, regulatory, transcriptional and/or translational sequence signals.
  • Figure 5 shows a pictorial representation of a protein carrier designed to deliver nucleic acid (DNA) to a cell nucleus for gene therapy.
  • Figure 6 shows the construction of a protein carrier to be used for DNA binding, in which the receptor-binding domain ("X” ) is domain la derived from the Pseudomonas exotoxin A gene, domain II and the NTS domains are as described above, and domain "Z” is a stretch of poly-L-lysine which is used for electrostatic interaction with a plasmid DNA molecule that codes for galactosidase.
  • X receptor-binding domain
  • domain la derived from the Pseudomonas exotoxin A gene
  • domain II and the NTS domains are as described above
  • domain "Z” is a stretch of poly-L-lysine which is used for electrostatic interaction with a plasmid DNA molecule that codes for galactosidase.
  • domain la is used for binding of the delivery system-DNA complex molecule to a cellular receptor.
  • pH dependent cleavage of domain II occurs and translocation of the truncated complex to the cytoplasm ensues, where the NTS domains and their respective binding proteins transport the complex into the nucleus.
  • the NTS domain binds to a cytoplasmic protein which mediates translocation of the complex to the nucleus. Once translocated, nuclear processes can unwind the DNA-binding domain from the DNA itself, followed by transcription and translation of RNAs coding for therapeutic proteins; if appropriate, replication of the targeted DNA may ensue.
  • polypeptide domains that bind DNA including poly-L-lysine and poly-D- lysine, repeats of nuclear translocation signal sequences ("poly-NTS"), ornithine, putrescine, spermidine, spermine, histones and other non- sequence-specific basic DNA-binding proteins, and sequence-specific DNA-binding proteins like homeobox domains.
  • poly-NTS nuclear translocation signal sequences
  • ornithine putrescine
  • spermidine spermidine
  • spermine histones and other non- sequence-specific basic DNA-binding proteins
  • sequence-specific DNA-binding proteins like homeobox domains.
  • polycationic macromolecules can be substituted as means for connecting DNA to the delivery system such as synthetic chemical linkers.
  • poly-L- (or -D-) lysine other types of DNA-binding proteins often have NTS signals coded within them.
  • NTS domains can be contiguously translated as part of the chimeric molecule or attached to the basic construct by chemical modification.
  • An alternative to the use of poly-L-lysine is to include within a DNA construct targeted for nuclear expression a short specific DNA sequence that could be bound by a specific DNA-binding protein, for example, a homeobox domain or other transcription factor. Free poly-L-lysine or poly-D-lysine can then be added to aid in the collapse of the DNA molecule itself to facilitate subsequent gene expression.
  • the receptor-binding domain la of Pseudomonas exotoxin A can be substituted with other receptor-binding domains.
  • the key to successful delivery of DNA or proteins to the nucleus pursuant to the present invention include (1) the use of Pseudomonas exotoxin A domain II or its functional equivalent to mediate translocation to the cytoplasm, and (2) the use of a nuclear targeting signal to mediate translocation to the nucleus.
  • Genomic DNA is prepared according to the method described by
  • Genomic DNA is cleaved with restriction endonucleases NotI and EcoRI, then is electrophoretically separated on a 0.8% low- melting agarose gel, from which a region of ⁇ 2 to 2.6 kilobase pairs is excised (the expected size of the exotoxin A gene segment is 2.3 kb. Gray et al., 1984, "Cloning, nucleotide sequence, and expression in Escherichia coli of the exotoxin A structural gene of Pseudomonas aeruginosa", Proc. Natl. Acad. Sci. USA., 81 :2645) and the DNA eluted.
  • Notl-EcoRI DNA is ligated to the phosphatased arms of bacteriophage ; ⁇ gt 1 1 previously cleaved with NotI and EcoRI (Promega Corp., Madison, WI) in a reaction using T4 DNA ligase f or 16 hours at 15°C.
  • DNA is packaged into infectious particles using complementing packaging extracts obtained from Stratagene Corp. (San Diego, CA). Approximately 1000 recombinant ⁇ particles are plated on indicator Escherichia coli Y1090 and lifted onto nitrocellulose filters. DNA is lysed in situ as described in Maniatis et al., 1982, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor, NY.
  • Filters are then screened by hybridization with a DNA probe corresponding to the la domain of Pseudomonas exotoxin A (ETA), prepared by PCR amplification of cleaved Pseudomonas aeruginosa PA103 DNA using oligonucleotides GT105F (5'-GGATCCTCATGAGCGCCGAGGAAGCCTTCGACCTC) (SEQ. ID. NO. 1) and GT103R (5'-AAGCTTGGGAAAGTGCAGGCGATGACTGAT) (SEQ. ID. NO. 2) in the presence of digoxigenin-dUTP (Boehringer Mannheim Biochemicals, Indianapolis, IN).
  • GT105F 5'-GGATCCTCATGAGCGCCGAGGAAGCCTTCGACCTC
  • GT103R 5'-AAGCTTGGGAAAGTGCAGGCGATGACTGAT
  • Positive plaques are amplified for small-scale preparation of DNA which is recloned for easy manipulation into the Bluescript KS+ plasmid vector (Stratagene Corp., San Diego, CA).
  • the 2.3 kilobase ETA genomic DNA is used as a source of template f or further amplifications and modifications of different ETA domains.
  • the 2.3 kb DNA from Example 1 is used for polymerase chain reaction-mediated amplification of the binding (la) and cytoplasmic translocation (II) domains of the ETA gene, oligonucleotides GT105F (5 '- GGATCCTCATGAGCGCCGAGGAAGCCTTCGACCTC) (SEQ. ID. NO. 1) and
  • GT106R2 (5'-AAQ£TT ⁇ GTGCCCTGCCGGACGAAGCGCT) (SEQ. ID. NO. 3) are used to amplify and for cloning DNA sequences coding for domains la and II, followed by downstream expression of the domains as non-secreted polypeptides in bacterial and insect cells.
  • Incorporated into the 5 ' ends of the oligonucleotides are restriction sites, BamHI and Hindlll (underlined above) to facilitate downstream cloning and manipulation of domains.
  • pSE380 Invitrogen Corporation, San Diego, CA
  • a second version of the clone is prepared using a forward oligonucleotide that primes within the DNA sequence coding for the Pseudomonas exotoxin A signal peptide sequence (GTO01SPF; TCATGATCCTGATACCCCATTGGATTCCCCTG) (SEQ. ID. NO.4); for secretion in the insect cell expression system, a forward oligonucleotide coding within the signal sequence of an abundant baculovirus envelope glycoprotein, gp67 (Stewart et al.,.
  • Figure 7a shows the modified forms of domains la and II as a BamHI-BspHI/Hindlll DNA cassette.
  • NTS nuclear translocation signal
  • FIG. 7b shows amplified NTS domain produced by this method as a Hindlll- Hindlll cassette. This cassette is then ligated by T4 DNA ligase at the 3 " end of ETA domains la and II. The position of the Hindlll-Hind III SV40 NTS cassette relative to ETA IA-II domain cassette is shown in Figure 7d.
  • constructs that include an amino-terminal truncated version of the bacterial lac Z ('lac Z) gene coding for ⁇ - galactosidase.
  • This DNA segment was obtained by amplification of the lac Z gene-containing plasmid, pCHl lO (Pharmacia, Piscataway, NJ), using oligonucleotides GT107F
  • Figure 7c shows the 'lac Z gene sequence as a Hindlll-PstI cassette.
  • Protein ETA domains la and 11/ NTS / ⁇ -galactosidase
  • Figure 7d shows the assembly of DNA cassettes coding for
  • the ETA IA-II DNA cassette is ligated to the NTS and lac Z DNA cassettes by T4 DNA ligase using the common Hindlll restriction sites that are included within the PCR amplification primers.
  • the final DNA construct is inserted into plasmid vectors for expression in the baculovirus system using one of several baculovirus expression plasmids (for example, PVL1393; Webb et al., 1990, "Expression of proteins using recombinant baculoviruses".
  • Protein constructs expressed in either baculovirus or bacteria are purified from cell lysates and/or media over anti- ⁇ - galactosidase antibody columns linked via protein A. Proteins thus prepared are suitable for targeting for targeting functional ⁇ - galactosidase to the nucleus by in vitro incubation with exotoxin A-sensitive mammalian cells (for example, L-M cells, American Type Culture Collection CCL 1.2 or Chang liver cells, American Type Culture Collection CCL 13) and/or after injection into the mammalian blood circulation for in vivo targeting to either the liver and/or secondary organ sites.
  • exotoxin A-sensitive mammalian cells for example, L-M cells, American Type Culture Collection CCL 1.2 or Chang liver cells, American Type Culture Collection CCL 13
  • Figure 8 shows the preferred configuration for a continuous polypeptide that has a polycation stretch at the "Z" domain.
  • poly-L-lysine as the polycation stretch.
  • a polylysine polypeptide segment is generated from a synthetic DNA segment of ⁇ 200 - 300 bases of poly AAA/AAG (lysine codons) containing an Hindlll restriction site at its 5' end and a PstI site at its 3' end (as in 'lac Z). Just proximal to the PstI site is placed a stop codon like TAG, TGA or TAA to terminate translation.
  • a DNA segment containing as many as 20-30 NTS repeats derived from the SV40 sequence (since the SV40 nuclear targeting signal is polycationic), or a smaller number of repeats if they are derived from other longer nuclear targeting signals, can be used (Figure 9). Any one of these different polycationic segments can be ligated at the 3 ' end of the core construct consisting of ETA IA-II/ NTS (BamHI-Hindlll-Hindlll) cassette (refer to Figure 7d).
  • polylysine for example, can be covalently coupled by chemical modification to a bacterial or baculovirus -expressed ETA IA-II-NTS core construct in order to achieve a similar effect ( Figure 10).
  • Figure 11 shows an alternative method for preparing a DNA binding protein domain (domain "Z").
  • This polypeptide domain is derived from any of several nuclear proteins that bind specific DNA sequences, for example, homeobox domains or yeast GAL4 protein. These domains are amplified by the PCR from genomic DNA or from cDNA coding for these domains. Included at the 5' and 3' ends of the amplified domain are the Hindlll and PstI restriction sites that are also used for constructing 'lac Z or polylysine domains.
  • a short defined DNA sequence is included in the construction of a DNA gene that will be targeted for expression in the nucleus, one or more of these domains can be used to bind DNA; subsequent complex formation would include addition of non-covalently added basic proteins or polycations, like poly-L-lysine (or poly-D-lysine).
  • Figure 12 shows the preferred method for preparing a protein carrier that can deliver a DNA construct to the nucleus of a mammalian cell for the purpose of expressing a gene coding for ⁇ - galactosidase.
  • the ETA IA-II domains described above are ligated to the NTS domain by T4 DNA ligase using the common Hindlll restriction sites that are included within the amplimers.
  • This DNA construct is inserted into plasmid vectors for expression in the baculovirus system using one of several baculovirus expression plasmids (for example, pVL1393; Webb et al., 1990, "Expression of proteins using recombinant baculoviruses".
  • Expressed protein carriers are purified from cell lysates and/or media by conventional ion exchange chromatography over an anionic exchange column such as carboxymethyl-Sepharose, that will bind basic proteins.
  • an anionic exchange column such as carboxymethyl-Sepharose
  • Commercially available poly-L-lysine 40, 000 mol. wt.
  • NHS N-hydroxysuccinimide
  • Uncomplexed poly-L-lysine is removed by chromatography over Sephadex G- 100 (or its equivalent) in phosphate-buffered saline.
  • the resultant purified protein carrier is then incubated with pCHl lO, a commercially available mammalian expression plasmid coding for ⁇ -galactosidase (Pharmacia, Piscataway, NJ), in 2M NaCl, 10 mM Tris-HCl, pH 7.5. 1 mM EDTA and diluted down to 150 mM NaCl by dialysis.
  • pCHl lO a commercially available mammalian expression plasmid coding for ⁇ -galactosidase
  • protein-DNA complexes are determined by gel electrophoresis on 1 % agarose, where plasmid DNA alone migrates in its supercoiled form at a relative molecular marker weight position of 7.2 kb, while complexes of supercoiled DNA with the ETA Ia-II/NTS/poly-L- lysine migrate at the top of the agarose gel, indicating very high molecular weight complexes. Uncomplexed DNA is separated by size exclusion chromatography on Sepharose gel bead matrices.
  • Protein carrier-DNA complexes prepared in this way are suitable for targeting to the nucleus by in vitro incubation with exotoxin A-sensitive mammalian cells (for example, L-M cells, American Type Culture Collection CCL 1.2 or Chang liver cells, American Type Culture Collection CCL 13) and/or after injection into the mammalian blood circulation for in vivo targeting to liver and/or secondary organ sites.
  • exotoxin A-sensitive mammalian cells for example, L-M cells, American Type Culture Collection CCL 1.2 or Chang liver cells, American Type Culture Collection CCL 13
  • Successful nuclear targeting can then be assayed histochemically by the conversion of the colorless X-gal substrate to blue, indicating functional ⁇ -galactosidase.
  • nucleic acid - oligonuleotide primer (iii) PUBLICATION INFORMATION:
  • nucleic acid - oligonuleotide primer (iii) PUBLICATION INFORMATION: (A) AUTHORS: Gray et al.
  • nucleic acid - oligonuleotide primer (iii) PUBLICATION INFORMATION: (A) AUTHORS: Stewart et al.
  • nucleic acid - oligonuleotide primer (iii) PUBLICATION INFORMATION:
  • nucleic acid - oligonuleotide primer (iii) PUBLICATION INFORMATION:
  • MOLECULAR TYPE Other nucleic acid - oligonuleotide primer

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Toxicology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Formation Of Insulating Films (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

Procédés d'introduction de protéines ou de séquences nucléotidiques dans le noyau au moyen d'un nouveau système d'apport induit par un récepteur. La structure du système d'apport comprend un domaine récepteur-fixateur de cellules, un domaine de translocation cytoplasmique, ainsi qu'un domaine de signal de translocation nucléaire. Ce système peut transporter une macromolécule fonctionnelle agissant une fois intégrée dans le noyau.
PCT/US1993/007945 1992-08-25 1993-08-24 Apport nucleaire de macromolecules facilite par un signal de translocation WO1994004696A1 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
JP6506592A JPH08504565A (ja) 1992-08-25 1993-08-24 高分子のトランスロケーションシグナル促進核輸送
KR1019950700814A KR950703650A (ko) 1992-08-25 1993-08-24 마크로 분자의 전좌 신호 촉진 핵 전달방법(translocation signal facilitated nuclear delivery of macromolecules)
AU50885/93A AU674026B2 (en) 1992-08-25 1993-08-24 Translocation signal facilitated nuclear delivery of macromolecules
EP93920291A EP0658210A1 (fr) 1992-08-25 1993-08-24 Apport nucleaire de macromolecules facilite par un signal de translocation
FI950866A FI950866A (fi) 1992-08-25 1995-02-24 Makromolekyylien vienti solutumaan translokaatiosignaalin avustuksella
NO950726A NO950726L (no) 1992-08-25 1995-02-24 Nukleær levering av makromolekyler med translokasjonssignal

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US93507492A 1992-08-25 1992-08-25
US07/935,074 1992-08-25

Publications (1)

Publication Number Publication Date
WO1994004696A1 true WO1994004696A1 (fr) 1994-03-03

Family

ID=25466554

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/007945 WO1994004696A1 (fr) 1992-08-25 1993-08-24 Apport nucleaire de macromolecules facilite par un signal de translocation

Country Status (10)

Country Link
EP (1) EP0658210A1 (fr)
JP (1) JPH08504565A (fr)
KR (1) KR950703650A (fr)
AU (1) AU674026B2 (fr)
CA (1) CA2143308A1 (fr)
FI (1) FI950866A (fr)
IL (1) IL106760A (fr)
NZ (1) NZ255870A (fr)
WO (1) WO1994004696A1 (fr)
ZA (1) ZA936189B (fr)

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994023751A1 (fr) * 1993-04-14 1994-10-27 Boehringer Mannheim Gmbh Peptides de tranfert d'acides nucleiques et leur utilisation pour injecter des acides nucleiques dans des cellules eucaryotes
WO1995022618A1 (fr) * 1994-02-22 1995-08-24 Dana-Farber Cancer Institute Systeme de liberation d'acide nucleique, son procede de synthese et ses utilisations
WO1995028494A1 (fr) * 1994-04-15 1995-10-26 Targeted Genetics Corporation Proteine de fusion d'apport de gene
WO1995033766A1 (fr) * 1994-06-09 1995-12-14 The Ontario Cancer Institute Peptide ramifie de synthese utilise comme ligand
WO1996013599A1 (fr) * 1994-11-01 1996-05-09 Winfried Wels Systeme de transfert de l'acide nucleique
EP0773719A1 (fr) * 1994-07-29 1997-05-21 Emory University Compositions de ciblage de materiaux sur des cellules contenant des recepteurs androgenes
WO1998011907A1 (fr) * 1996-09-20 1998-03-26 Bristol-Myers Squibb Company Inhibiteurs peptidiques de translocation nucleaire de proteines presentant des sequences de localisation nucleaire et leurs procedes d'utilisation
EP0846772A1 (fr) * 1996-11-29 1998-06-10 Hoechst Aktiengesellschaft Système de ligand multifonctionnel pour le transfert d'acide nucléique spécifiquement dans une cellule
WO1998042876A1 (fr) * 1997-03-26 1998-10-01 Board Of Regents, The University Of Texas System Methodes et compositions recourant a des proteines transmembranaires pour transporter des materiaux a travers la membrane de cellules
WO1998059065A1 (fr) * 1997-06-20 1998-12-30 Chiron S.P.A. Nouveau procede de transfert d'adn dans des cellules
WO1999007723A1 (fr) * 1997-08-07 1999-02-18 University Of Maryland, Baltimore Vehicule de fixation d'apport d'acide nucleique
US5962415A (en) * 1996-09-20 1999-10-05 Bristol-Myers Squibb Co. Compositions comprising a peptide inhibitor of nuclear protein translocation and an immunosuppressant and methods of use thereof
US6037329A (en) * 1994-03-15 2000-03-14 Selective Genetics, Inc. Compositions containing nucleic acids and ligands for therapeutic treatment
US6051429A (en) * 1995-06-07 2000-04-18 Life Technologies, Inc. Peptide-enhanced cationic lipid transfections
WO2000045850A2 (fr) * 1999-02-06 2000-08-10 Aurx Inc. Vehicule servant a administrer un medicament
WO2000053790A1 (fr) * 1999-03-10 2000-09-14 Aventis Pharma Deutschland Gmbh Proteines multivalentes (pmv) specifiques a des cellules cibles
WO2000067697A2 (fr) * 1999-05-10 2000-11-16 Centre National De La Recherche Scientifique (Cnrs) Conjugue acide nucleique-anticorps pour delivrer un acide nucleique etranger dans les cellules
WO2001078785A2 (fr) * 2000-04-18 2001-10-25 Biotectid Gmbh Conjugues de principe actif avec des ligands a action intracellulaire
WO2001029233A3 (fr) * 1999-10-20 2002-02-07 Univ Johns Hopkins Med Compositions chimeriques immunogenes et acides nucleiques codant pour de telles compositions
US6387684B1 (en) * 1999-09-13 2002-05-14 Academia Sinica Topoisomerase 1-mediated DNA delivery
WO2002083166A1 (fr) * 2001-04-10 2002-10-24 Santen Pharmaceutical Co., Ltd. Complexes de polymeres d'interferons et leur utilisation medicinale
US6660830B1 (en) * 1996-03-26 2003-12-09 Razvan T Radulescu Peptides with antiproliferative properties
EP1947116A3 (fr) * 2003-02-10 2008-08-20 TO-BBB Holding B.V. Acides nucléiques exprimés par action différentielle dans la barrière hématoencéphalique sous des conditions inflammatoires
EP2334693A1 (fr) * 2008-07-18 2011-06-22 Chee Keong Choo Procédés de culture à long terme de cellules eucaryotes et utilisations de ceux-ci
US8007781B2 (en) 2000-08-03 2011-08-30 The Johns Hopkins University Molecular vaccine linking an endoplasmic reticulum chaperone polypeptide to an antigen
US8128922B2 (en) 1999-10-20 2012-03-06 Johns Hopkins University Superior molecular vaccine linking the translocation domain of a bacterial toxin to an antigen
US8945884B2 (en) 2000-12-11 2015-02-03 Life Technologies Corporation Methods and compositions for synthesis of nucleic acid molecules using multiplerecognition sites
US9011866B2 (en) 2005-01-06 2015-04-21 The Johns Hopkins University RNA interference that blocks expression of pro-apoptotic proteins potentiates immunity induced by DNA and transfected dendritic cell vaccines
US9085638B2 (en) 2007-03-07 2015-07-21 The Johns Hopkins University DNA vaccine enhancement with MHC class II activators
US9358300B2 (en) 1998-11-12 2016-06-07 Life Technologies Corporation Transfection reagents
US9534252B2 (en) 2003-12-01 2017-01-03 Life Technologies Corporation Nucleic acid molecules containing recombination sites and methods of using the same
US9701725B2 (en) 2003-05-05 2017-07-11 The Johns Hopkins University Anti-cancer DNA vaccine employing plasmids encoding signal sequence, mutant oncoprotein antigen, and heat shock protein
US10195280B2 (en) 2014-07-15 2019-02-05 Life Technologies Corporation Compositions and methods for efficient delivery of molecules to cells

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991009958A2 (fr) * 1989-12-21 1991-07-11 Whitehead Institute For Biomedical Research Procede d'acheminement de molecules dans des cellules eukaryotes
WO1992005250A1 (fr) * 1990-09-25 1992-04-02 University Of Connecticut Prolongation de l'expression de polynucleotides introduits dans une cellule
EP0544292A2 (fr) * 1991-11-27 1993-06-02 Roche Diagnostics GmbH Méthode d'introduction d'acides nucléiques dans des cellules
WO1993017102A1 (fr) * 1992-02-19 1993-09-02 The Trustees Of The University Of Pennsylvania MODULATION DE FONCTIONS CELLULAIRES AVEC DES PROTEINES HnRNP
WO1993018759A1 (fr) * 1992-03-20 1993-09-30 Baylor College Of Medicine Systeme de transport de l'adn et mode d'emploi

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991009958A2 (fr) * 1989-12-21 1991-07-11 Whitehead Institute For Biomedical Research Procede d'acheminement de molecules dans des cellules eukaryotes
WO1992005250A1 (fr) * 1990-09-25 1992-04-02 University Of Connecticut Prolongation de l'expression de polynucleotides introduits dans une cellule
EP0544292A2 (fr) * 1991-11-27 1993-06-02 Roche Diagnostics GmbH Méthode d'introduction d'acides nucléiques dans des cellules
WO1993017102A1 (fr) * 1992-02-19 1993-09-02 The Trustees Of The University Of Pennsylvania MODULATION DE FONCTIONS CELLULAIRES AVEC DES PROTEINES HnRNP
WO1993018759A1 (fr) * 1992-03-20 1993-09-30 Baylor College Of Medicine Systeme de transport de l'adn et mode d'emploi

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
E. WAGNER ET AL.: "Coupling of adenovirus to transferrin-polylysine/DNA complexes greatly enhances receptor-mediated gene delivery and expression of transfected genes", PROC. NATL. ACAD SCI., vol. 89, no. 13, 1 July 1992 (1992-07-01), NATL. ACAD SCI., WASHINGTON, DC, US;, pages 6099 - 6103 *
G.Y. WU AND C. H. WU: "Receptor-mediated in vitro gene transformation by a soluble DNA carrier system", J. BIOL. CHEM., vol. 262, no. 10, 5 April 1987 (1987-04-05), AM. SOC. MOL. BIOL., INC.,BALTIMORE, US;, pages 4429 - 4432 *
J.M. WILSON ET AL.: "Hepatocyte-directed gene transfer in vivo leads to transient improvement of hypercholesterolemia in low density lipoprotein receptor-deficient rabbits", J. BIOL. CHEM., vol. 267, no. 2, 15 January 1992 (1992-01-15), AM. SOC. MOL. BIOL., INC.,BALTIMORE, US;, pages 963 - 967 *
T.I. PRIOR ET AL.: "Translocation mediated by domain II of Pseudomonas exotoxin A: Transport of barnase into the cytososl", BIOCHEMISTRY, vol. 31, no. 14, 14 April 1992 (1992-04-14), AM. CHEM. SOC.,WASHINGTON,DC,US;, pages 3555 - 3559 *

Cited By (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994023751A1 (fr) * 1993-04-14 1994-10-27 Boehringer Mannheim Gmbh Peptides de tranfert d'acides nucleiques et leur utilisation pour injecter des acides nucleiques dans des cellules eucaryotes
US7186697B2 (en) 1994-02-22 2007-03-06 Dana-Farber Cancer Institute Nucleic acid delivery system, methods of synthesis and use thereof
WO1995022618A1 (fr) * 1994-02-22 1995-08-24 Dana-Farber Cancer Institute Systeme de liberation d'acide nucleique, son procede de synthese et ses utilisations
US7138381B2 (en) 1994-03-15 2006-11-21 Prizm Pharmaceuticals, Inc. Compositions containing nucleic acids and ligands for therapeutic treatment
US6503886B1 (en) 1994-03-15 2003-01-07 Selective Genetics, Inc. Compositions containing nucleic acids and ligands for therapeutic treatment
US6037329A (en) * 1994-03-15 2000-03-14 Selective Genetics, Inc. Compositions containing nucleic acids and ligands for therapeutic treatment
AU706572B2 (en) * 1994-04-15 1999-06-17 Targeted Genetics Corporation Gene delivery fusion proteins
WO1995028494A1 (fr) * 1994-04-15 1995-10-26 Targeted Genetics Corporation Proteine de fusion d'apport de gene
WO1995033766A1 (fr) * 1994-06-09 1995-12-14 The Ontario Cancer Institute Peptide ramifie de synthese utilise comme ligand
EP0773719A1 (fr) * 1994-07-29 1997-05-21 Emory University Compositions de ciblage de materiaux sur des cellules contenant des recepteurs androgenes
EP0773719A4 (fr) * 1994-07-29 1998-09-02 Univ Emory Compositions de ciblage de materiaux sur des cellules contenant des recepteurs androgenes
WO1996013599A1 (fr) * 1994-11-01 1996-05-09 Winfried Wels Systeme de transfert de l'acide nucleique
US6498233B1 (en) * 1994-11-01 2002-12-24 Winfried Wels Nucleic acid transfer system
US6051429A (en) * 1995-06-07 2000-04-18 Life Technologies, Inc. Peptide-enhanced cationic lipid transfections
US6660830B1 (en) * 1996-03-26 2003-12-09 Razvan T Radulescu Peptides with antiproliferative properties
US5962415A (en) * 1996-09-20 1999-10-05 Bristol-Myers Squibb Co. Compositions comprising a peptide inhibitor of nuclear protein translocation and an immunosuppressant and methods of use thereof
US5877282A (en) * 1996-09-20 1999-03-02 Bristol-Myers Squibb Company Peptide inhibitors of nuclear protein translocation having nuclear localization sequences and methods of use thereof
WO1998011907A1 (fr) * 1996-09-20 1998-03-26 Bristol-Myers Squibb Company Inhibiteurs peptidiques de translocation nucleaire de proteines presentant des sequences de localisation nucleaire et leurs procedes d'utilisation
AU731725B2 (en) * 1996-09-20 2001-04-05 Bristol-Myers Squibb Company Peptide inhibitors of nuclear protein translocation having nuclear localization sequences and methods of use thereof
EP0846772A1 (fr) * 1996-11-29 1998-06-10 Hoechst Aktiengesellschaft Système de ligand multifonctionnel pour le transfert d'acide nucléique spécifiquement dans une cellule
US6376248B1 (en) 1997-03-14 2002-04-23 Life Technologies, Inc. Peptide-enhanced transfections
US6086900A (en) * 1997-03-26 2000-07-11 Board Of Regents, The University Of Texas Systems Methods and compositions for using membrane-penetrating proteins to carry materials across cell membranes
WO1998042876A1 (fr) * 1997-03-26 1998-10-01 Board Of Regents, The University Of Texas System Methodes et compositions recourant a des proteines transmembranaires pour transporter des materiaux a travers la membrane de cellules
WO1998059065A1 (fr) * 1997-06-20 1998-12-30 Chiron S.P.A. Nouveau procede de transfert d'adn dans des cellules
WO1999007723A1 (fr) * 1997-08-07 1999-02-18 University Of Maryland, Baltimore Vehicule de fixation d'apport d'acide nucleique
US9358300B2 (en) 1998-11-12 2016-06-07 Life Technologies Corporation Transfection reagents
WO2000045850A3 (fr) * 1999-02-06 2001-07-05 Aurx Inc Vehicule servant a administrer un medicament
WO2000045850A2 (fr) * 1999-02-06 2000-08-10 Aurx Inc. Vehicule servant a administrer un medicament
WO2000053790A1 (fr) * 1999-03-10 2000-09-14 Aventis Pharma Deutschland Gmbh Proteines multivalentes (pmv) specifiques a des cellules cibles
WO2000067697A3 (fr) * 1999-05-10 2001-06-28 Centre Nat Rech Scient Conjugue acide nucleique-anticorps pour delivrer un acide nucleique etranger dans les cellules
FR2793414A1 (fr) * 1999-05-10 2000-11-17 Centre Nat Rech Scient Conjugue acide nucleique-anticorps pour delivrer un acide nucleique etranger dans les cellules
WO2000067697A2 (fr) * 1999-05-10 2000-11-16 Centre National De La Recherche Scientifique (Cnrs) Conjugue acide nucleique-anticorps pour delivrer un acide nucleique etranger dans les cellules
US6387684B1 (en) * 1999-09-13 2002-05-14 Academia Sinica Topoisomerase 1-mediated DNA delivery
WO2001029233A3 (fr) * 1999-10-20 2002-02-07 Univ Johns Hopkins Med Compositions chimeriques immunogenes et acides nucleiques codant pour de telles compositions
US9758551B2 (en) 1999-10-20 2017-09-12 The Johns Hopkins University Superior molecular vaccine linking the translocation domain of a bacterial toxin to an antigen
US8128922B2 (en) 1999-10-20 2012-03-06 Johns Hopkins University Superior molecular vaccine linking the translocation domain of a bacterial toxin to an antigen
WO2001078785A3 (fr) * 2000-04-18 2002-05-10 Biotectid Gmbh Conjugues de principe actif avec des ligands a action intracellulaire
WO2001078785A2 (fr) * 2000-04-18 2001-10-25 Biotectid Gmbh Conjugues de principe actif avec des ligands a action intracellulaire
US8007781B2 (en) 2000-08-03 2011-08-30 The Johns Hopkins University Molecular vaccine linking an endoplasmic reticulum chaperone polypeptide to an antigen
US9309520B2 (en) 2000-08-21 2016-04-12 Life Technologies Corporation Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
US8945884B2 (en) 2000-12-11 2015-02-03 Life Technologies Corporation Methods and compositions for synthesis of nucleic acid molecules using multiplerecognition sites
WO2002083166A1 (fr) * 2001-04-10 2002-10-24 Santen Pharmaceutical Co., Ltd. Complexes de polymeres d'interferons et leur utilisation medicinale
EP1947116A3 (fr) * 2003-02-10 2008-08-20 TO-BBB Holding B.V. Acides nucléiques exprimés par action différentielle dans la barrière hématoencéphalique sous des conditions inflammatoires
US9701725B2 (en) 2003-05-05 2017-07-11 The Johns Hopkins University Anti-cancer DNA vaccine employing plasmids encoding signal sequence, mutant oncoprotein antigen, and heat shock protein
US9534252B2 (en) 2003-12-01 2017-01-03 Life Technologies Corporation Nucleic acid molecules containing recombination sites and methods of using the same
US9011866B2 (en) 2005-01-06 2015-04-21 The Johns Hopkins University RNA interference that blocks expression of pro-apoptotic proteins potentiates immunity induced by DNA and transfected dendritic cell vaccines
US9085638B2 (en) 2007-03-07 2015-07-21 The Johns Hopkins University DNA vaccine enhancement with MHC class II activators
EP2334693A4 (fr) * 2008-07-18 2011-09-21 Chee Keong Choo Procédés de culture à long terme de cellules eucaryotes et utilisations de ceux-ci
EP2334693A1 (fr) * 2008-07-18 2011-06-22 Chee Keong Choo Procédés de culture à long terme de cellules eucaryotes et utilisations de ceux-ci
US10195280B2 (en) 2014-07-15 2019-02-05 Life Technologies Corporation Compositions and methods for efficient delivery of molecules to cells
US10792362B2 (en) 2014-07-15 2020-10-06 Life Technologies Corporation Compositions and methods for efficient delivery of molecules to cells
US11872285B2 (en) 2014-07-15 2024-01-16 Life Technologies Corporation Compositions and methods for efficient delivery of molecules to cells

Also Published As

Publication number Publication date
ZA936189B (en) 1995-01-10
AU674026B2 (en) 1996-12-05
KR950703650A (ko) 1995-09-20
IL106760A (en) 1999-12-31
AU5088593A (en) 1994-03-15
NZ255870A (en) 1996-09-25
JPH08504565A (ja) 1996-05-21
FI950866A (fi) 1995-04-24
IL106760A0 (en) 1993-12-08
CA2143308A1 (fr) 1994-03-03
FI950866A0 (fi) 1995-02-24
EP0658210A1 (fr) 1995-06-21

Similar Documents

Publication Publication Date Title
AU674026B2 (en) Translocation signal facilitated nuclear delivery of macromolecules
US6498233B1 (en) Nucleic acid transfer system
Schwartz et al. Synthetic DNA-compacting peptides derived from human sequence enhance cationic lipid-mediated gene transfer in vitro and in vivo
CA2012311C (fr) Nouveau produit de conjugaison proteine-polycation
Uherek et al. DNA-carrier proteins for targeted gene delivery
Wagstaff et al. Nucleocytoplasmic transport of DNA: enhancing non-viral gene transfer
US20080220527A1 (en) Modular transfection systems
US6720310B1 (en) Transfer method for specific cellular localization of nucleic acids
JP2001503385A (ja) ポリヌクレオチド送達のための組成物および方法
Medina-Kauwe et al. Nonviral gene delivery to human breast cancer cells by targeted Ad5 penton proteins
Min et al. Gene delivery using a derivative of the protein transduction domain peptide, K-Antp
Chan et al. Enhancement of MSH receptor-and GAL4-mediated gene transfer by switching the nuclear import pathway
CA2241923C (fr) Systeme de transfert de genes par l'intermediaire de recepteurs pour therapie genique ciblee de tumeurs
NZ521563A (en) Peptide conjugates for drug delivery
US20090155853A1 (en) Non-viral gene delivery complex
Kim et al. Cell-penetrating DNA-binding protein as a safe and efficient naked DNA delivery carrier in vitro and in vivo
Sloots et al. Recombinant derivatives of the human high‐mobility group protein HMGB2 mediate efficient nonviral gene delivery
Hellgren et al. Factors controlling the efficiency of Tat-mediated plasmid DNA transfer
AU2020310380A1 (en) Complex for intracellular delivery of molecules
Rolland et al. Pharmaceutical gene medicines for non-viral gene therapy
김은신 Membrane transducing activity of recombinant Hoxc8 and its application as a delivery vector
Lucas Cationic polypeptides for gene delivery to eukaryotic cells
Parker Development of peptide-targeted gene delivery systems
Balicki Gene transfer mediated by histone H2A
MXPA99003470A (en) Polypeptides comprising gax protein domains, involved in repressing transcription and/or interacting with other proteins, corresponding nucleic acids and their use

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA FI JP KR NO NZ

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2143308

Country of ref document: CA

Ref document number: 950866

Country of ref document: FI

WWE Wipo information: entry into national phase

Ref document number: 255870

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 1993920291

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1993920291

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1993920291

Country of ref document: EP