WO1992008789A1 - Measles virus recombinant poxvirus vaccine - Google Patents
Measles virus recombinant poxvirus vaccine Download PDFInfo
- Publication number
- WO1992008789A1 WO1992008789A1 PCT/US1991/008703 US9108703W WO9208789A1 WO 1992008789 A1 WO1992008789 A1 WO 1992008789A1 US 9108703 W US9108703 W US 9108703W WO 9208789 A1 WO9208789 A1 WO 9208789A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- virus
- plasmid
- dna
- recombinant
- vaccinia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24041—Use of virus, viral particle or viral elements as a vector
- C12N2710/24043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
- C12N2710/24141—Use of virus, viral particle or viral elements as a vector
- C12N2710/24143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18411—Morbillivirus, e.g. Measles virus, canine distemper
- C12N2760/18422—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18411—Morbillivirus, e.g. Measles virus, canine distemper
- C12N2760/18434—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- the present invention relates to a modified poxvirus and to methods of making and using the same. More in particular, the invention relates to recombinant poxvirus, which virus expresses gene products of a Morbillivirus gene, and to vaccines which provide protective immunity against Morbillivirus infections.
- Vaccinia virus and more recently other poxviruses have been used for the insertion and expression of foreign genes.
- the basic technique of inserting foreign genes into live infectious poxvirus involves recombination between pox DNA sequences flanking a foreign genetic element in a donor plasmid and homologous sequences present in the rescuing poxvirus (Piccini et al., 1987).
- the recombinant poxviruses are constructed in two steps known in the art and analogous to the methods for creating synthetic recombinants of the vaccinia virus described in U.S. Patent No. 4,603,112, the disclosure of which patent is incorporated herein by reference.
- the DNA gene sequence to be inserted into the virus is placed into an E. coli plasmid construct into which DNA homologous to a section of DNA of the poxvirus has been inserted.
- the DNA gene sequence to be inserted is ligated to a promoter.
- the promoter-gene linkage is positioned in the plasmid construct so that the promoter-gene linkage is flanked on both ends by DNA homologous to a DNA sequence flanking a region of pox DNA containing a nonessential locus.
- the resulting plasmid construct is then amplified by growth within E. coli bacteria (Clewell, 1972) and isolated (Clewell et al. , 1969; Maniatis et al., 1982).
- the isolated plasmid containing the DNA gene sequence to be inserted is transfected into a cell culture, e.g. chick embryo fibroblasts, along with the poxvirus.
- a cell culture e.g. chick embryo fibroblasts
- Recombination between homologous pox DNA in the plasmid and the viral genome respectively gives a poxvirus modified by the presence, in a nonessential region of its genome, of foreign DNA sequences.
- the term "foreign" DNA designates exogenous DNA, particularly DNA from a non-pox source, that codes for gene products not ordinarily produced by the genome into which the exogenous DNA is placed.
- RNA may replace DNA.
- homologous sections of nucleic acid are sections of nucleic acid (DNA or RNA) which have the same sequence of nucleotide bases.
- Genetic recombination may take place naturally during the replication or manufacture of new viral genomes within the infected host cell.
- genetic recombination between viral genes may occur during the viral replication cycle that takes place in a host cell which is co-infected with two or more different viruses or other genetic constructs.
- a section of DNA from a first genome is used interchangeably in constructing the section of the genome of a second co-infecting virus in which the DNA is homologous with that of the first viral genome.
- recombination can also take place between sections of DNA in different genomes that are not perfectly homologous. If one such section is from a first genome homologous with a section of another genome except for the presence within the first section of, for example, a genetic marker or a gene coding for an antigenic determinant inserted into a portion of the homologous DNA, recombination can still take place and the products of that recombination are then detectable by the presence of that genetic marker or gene in the recombinant viral genome.
- Successful expression of the inserted DNA genetic sequence by the modified infectious virus requires two conditions. First, the insertion must be into a nonessential region of the virus in order that the modified virus remain viable.
- the second condition for expression of inserted DNA is the presence of a promoter in the proper relationship to the inserted DNA. The promoter must be placed so that it is located upstream from the DNA sequence to be expressed.
- Canine distemper virus (CDV) and measles virus (MV) are members of the Morbillivirus subgroup of the family Paramyxovirus genus (Diallo, 1990; Kingsbury et al., 1978). The viruses contain a non-segmented single-stranded RNA genome of negative polarity. Canine distemper is a highly infectious febrile disease of dogs and other carnivores. The mortality rate is high; ranging between 30 and 80 percent. Dogs surviving often have permanent central nervous system damage (Fenner, et al., 1987). Similarly, measles virus causes an acute infectious febrile disease characterized by a generalized macropapular eruption. The disease mainly affects children.
- Morbilliviruses have recently been reviewed by Norrby and Oxman (1990) and Diallo (1990) .
- two structural proteins are crucial for the induction of a protective immune response. These are the membrane glycoprotein hemagglutinin (HA) , which is responsible for hemagglutination and attachment of the virus to the host cell, and the fusion glycoprotein (F) , which causes membrane fusion between the virus and the infected cell or between the infected and adjacent uninfected cells (Graves et al., 1978).
- the order of genes in the MV genome has been deduced by Richardson et al. (1985) and Dowling et al. (1986).
- the nucleotide sequence of the MVHA gene and MVF gene has been determined by Alkhatib and Briedis (1986) and Richardson et al. (1986) , respectively.
- CDV and MV are structurally similar and share a close serological relationship. Immunoprecipitation studies have shown that antiserum to MV will precipitate all CDV proteins (P, NP, F, HA and M) . By contrast, antiserum to CDV will precipitate all MV proteins except the HA glycoprotein (Hall et al. , 1980; Orvell et al., 1980; Stephenson, et al., 1979). In light of this close serological relationship, it has previously been demonstrated that vaccination with MV will elicit protection against CDV challenge in dogs (Gillespie et al., 1960; Moura et al., 1961; Warren et al. , 1960).
- MV HA and F genes have been expressed in several viral vectors including vaccinia virus (Drillien et al., 1988; Wild et al., 1991), fowlpox virus (Spehner et al., 1990; Wild et al., 1990), adenovirus (Alkhatib et al. , 1990) and baculovirus (Vialard et al., 1990).
- authentic MV proteins were expressed which were functional in hemagglutination (Vialard et al., 1990) hemolysis (Alkhatib et al., 1990; Vialard et al.
- European Patent Application No. 0 314 569 relates to the expression of an MV gene in fowlpox.
- Perkus et al. (1990.) recently described the definition of two unique host range genes in vaccinia virus. These genes encode host range functions which permit vaccinia virus replication on various cell substrates in vitro.
- the genes encode host range functions for vaccinia virus replication on human cells as well as cells of rabbit and porcine origin. Definition of these genes provides for the development of a vaccinia virus vector, which, while still expressing foreign genes of interest, would be severely restricted in its ability to replicate in defined cells. This would greatly enhance the safety features of vaccinia virus recombinants.
- An attenuated vector has been developed by the sequential deletion of six non-essential regions from the Copenhagen strain of vaccinia virus. These regions are known to encode proteins that may have a role in viral virulence. The regions deleted are the tk gene, the hemorrhagic gene, the A-type inclusion gene, the hemagglutinin gene and the gene encoding the large subunit of the ribonucleotide reductase as well as the C7L through K1L sequences defined previously (Perkus et al., 1990). The sequences and genomic locations of these genes in the Copenhagen strain of vaccinia virus have been defined previously (Goebel et al., 1990 a,b) . The resulting attenuated vaccinia strain is designated as NYVAC.
- the technology of generating vaccinia virus recombinants has recently been extended to other members of the poxvirus family which have a more restricted host range.
- the avipoxvirus, fowlpox has been engineered as a recombinant virus expressing the rabies G gene (Taylor et al., 1988b). This recombinant virus is also described in PCT Publication No. W089/03429.
- On inoculation of the recombinant into a number of non-avian species an immune response to rabies is elicited which in mice, cats and dogs is protective against a lethal rabies challenge.
- Both canine distemper and measles are currently controlled by the use of live attenuated vaccines (Fenner et al., 1987; Preblud et al., 1988). Immunization is recommended for control of CDV using a live attenuated vaccine at eight weeks of age and again at 12 to 16 weeks of age. Although immunity to CDV is life-long, because of the highly infectious nature of the agent and the severity of the disease, annual revaccination is usually recommended.
- CDV immune mothers pass neutralizing antibody to offspring in the colostrum. It is difficult to ascertain when these antibody levels will wane such that pups can be vaccinated. This leaves a window when pups may be susceptible to CDV infection.
- Use of a recombinant vaccine expressing only the measles virus glycoproteins may provide a means to overcome the inhibitory effects of maternal antibody and allow vaccination of newborns.
- CDV-specific antibodies in pups that suckled CDV immune mothers did not prevent the development of MV-specific antibodies when inoculated with a MV vaccine (Baker et al., 1966).
- the modified live CDV vaccines have also been shown to induce distemper in other animal species including foxes, Kinkajous, ferrets, and the panda (Bush et al., 1976; Carpenter et al., 1976; Kazacos et al., 1981). Therefore, the use of a recombinant CDV vaccine candidate would eliminate the continual introduction of modified live CDV into the environment and potential vaccine-associated and vaccine-induced complications which have arisen with the use of the conventional CDV vaccines.
- poxvirus vectors may also provide a means of overcoming the documented inhibitory effect that maternal antibody has on vaccination with presently utilized live attenuated CDV strains in dogs. Pups born to mothers previously immunized at a young age with a poxvirus recombinant may avoid the interference of CDV-specific maternal antibody. Additionally, the ability of both vaccinia virus and canarypox virus vectors harboring MV HA and F genes to elicit these responses and the lack of serological cross-reactivity between the two poxviruses provides a further advantage in that one vector could be utilized early in the pup's life and the other later, to boost CDV-specific immunity. This would eliminate the release of live attenuated CDV strains into the environment, an event linked to the occurrence of vaccine-induced and vaccine-associated complications (Tizard, 1990) .
- the present invention relates to a recombinant poxvirus containing therein a DNA sequence from Morbillivirus in a nonessential region of the poxvirus genome.
- the poxvirus is advantageously a vaccinia virus or an avipox virus, such as canarypox virus.
- the Morbillivirus is advantageously measles virus.
- the recombinant poxvirus expresses gene products of the foreign Morbillivirus gene.
- the foreign DNA codes for a measles virus glycoprotein, advantageously measles virus hemagglutinin glycoprotein and measles virus fusion glycoprotein.
- a plurality of measles virus glycoproteins are co-expressed in the host by the recombinant poxvirus.
- the present invention relates to a vaccine for inducing an immunological response in a host animal inoculated with the vaccine, said vaccine including a carrier and a recombinant poxvirus containing, in a nonessential region thereof, DNA from Morbillivirus, particularly measles virus.
- the DNA codes for and expresses a measles virus glycoprotein, particularly measles virus hemagglutinin glycoprotein and measles virus fusion glycoprotein.
- a plurality of measles virus glycoproteins advantageously are co-expressed in the host.
- the poxvirus used in the vaccine according to the present invention is advantageously a vaccinia virus or an avipox virus, such as canarypox virus.
- FIG. 1 schematically shows a method for the construction of plasmid pSPM2LHAVC used to derive recombinant vaccinia virus VP557 expressing the MV hemagglutinin gene
- FIG. 2 schematically shows a method for the construction of plasmid pSPMFVC used to derive recombinant vaccinia virus vP455 expressing the MV fusion gene;
- FIG. 3 schematically shows a method for the construction of plasmid pRW843 used to derive recombinant vaccinia virus vP756 expressing the MV hemagglutinin gene;
- FIG. 4 schematically shows a method for the construction of plasmid pRW850 used to derive recombinant vaccinia virus vP800 expressing the MV fusion gene;
- FIG. 5 schematically shows a method for the construction of plasmid pRW800 used to derive recombinant canarypox virus VCP40 expressing the MV fusion gene;
- FIG. 6 schematically shows a method for the construction of plasmid pRW810 used to derive recombinant canarypox viruses VCP50 expressing the MV hemagglutinin gen and VCP57 co-expressing the MV fusion and hemagglutinin genes;
- FIG. 7 schematically shows a method for the construction of plasmid pRW852 used to derive recombinant canarypox virus VCP85 expressing the MV hemagglutinin gene;
- FIG. 8 schematically shows a method for the construction of plasmid pRW853A used to derive recombinant canarypox virus vCP82 co-expressing the MV hemagglutinin an fusion genes;
- FIG. 9 schematically shows a method for the construction of plasmid pSD460 for deletion of thymidine kinase gene and generation of recombinant vaccinia virus VP410;
- FIG. 10 schematically shows a method for the construction of plasmid pSD486 for deletion of hemorrhagic region and generation of recombinant vaccinia virus vP553;
- FIG. 11 schematically shows a method for the construction of plasmid pMP494 ⁇ for deletion of ATI region and generation of recombinant vaccinia virus vP618;
- FIG. 12 schematically shows a method for the construction of plasmid pSD467 for deletion of hemagglutinin gene and generation of recombinant vaccinia virus vP723
- FIG. 13 schematically shows a method for the construction of plasmid pMPCSKl ⁇ for deletion of gene cluster [C7L - K1L] and generation of recombinant vaccinia virus vP804;
- FIG. 14 schematically shows a method for the construction of plasmid pSD548 for deletion of large subunit, ribonucleotide reductase and generation of recombinant .vaccinia virus VP866 (NYVAC) ;
- FIG. 15 schematically shows a method for the construction of plasmid pRW857 used to derive recombinant NYVAC virus VP913 co-expressing the MV hemagglutinin and fusion genes.
- the rescuing virus used in the production of both recombinants was the Copenhagen strain of vaccinia virus from which the thymidine kinase gene had been deleted. All viruses were grown and titered on VERO cell monolayers.
- the early/late vaccinia virus H6 promoter (Rosel et al., 1986; Taylor et al., 1988a,b) was constructed by annealing four overlapping oligonucleotides, H6SYN A-D.
- the resultant H6 sequence is as follows:
- the plasmid pMP2LVC contains the leftmost 0.4kbp of the vaccinia virus
- Hindlll/Sall fragment from the Hindlll K region was isolated and blunt-ended with the Klenow fragment of the E . coli DNA polymerase in the presence of 2mM dNTPs. This fragment was inserted into pUC18 which had been digested with PvuII. The resulting plasmid was designated pMP2VC.
- the plasmid pMP2VC was linearized with Sspl.
- MPSYN52 (SEQ ID NO:3) (5 • -ATTATTTTTATAAGCTTGGA-
- the resultant plasmid pMP2LVC contains a multiple cloning region in the intergenic region between the K1L and K2L open reading frames.
- the plasmid pMH22 was derived from a full length cDNA clone of the measles HA gene by creating a Xhol site at the ATG initiation codon (Alkhatib et al., 1986).
- Xhol site between the H6 promoter and the initiation codon of the HA gene was removed by oligonucleotide directed double strand break mutagenesis (Mandecki, 1982) using oligonucleotide HAXHOD (SEQ ID NO:7) (5 1 -
- Plasmid pSPM2LHAVC was generated by this procedure. Insertion plasmid pSPM2LHAVC was used in in vitro recombination experiments with vaccinia virus vP458 as the rescue virus to generate recombinant vP557.
- VP458 contains the E. coli lac
- This vaccinia virus recombinant contains the measles HA gene in the M2L locus of the genome, replacing the lac Z gene.
- annealed oligonucleotides 3PA (SEQ ID NO:8) (5 1 -
- the resulting plasmid pMF3PR14 contains the 3' end of the Ikbp fragment of the measles fusion gene.
- the 820bp Smal/Sail fragment from pSPMF5P16 and the ikbp Sall/Ea ⁇ l fragment from pMF3PR14 were ligated into pTP15 digested with Smal and EagI.
- the plasmid pTP15 (Guo et al., 1989) contains the vaccinia virus early/late H6 promoter flanked by sequences from the HA locus of the vaccinia virus (Copenhagen strain) genome.
- the resultant plasmid containing the measles fusion gene juxtaposed 3 • to the H6 promoter within the HA insertion plasmid was designated pSPHMF7.
- Oligonucleotide directed mutagenesis was performed on pSPHMF7. Initially an in vitro mutagenesis reaction (Mandecki, 1982) was performed to create a precise ATG:ATG linkage of the H6 promoter with the measles fusion gene by removing the Smal site using the oligonucleotide SPMAD (SEQ ID NO:12) (5'-TATCCGTTAAGT-TTGTATGGTAATGGGTCTCAAGGTGAACGTCT- 3'). This resulted in the generation of pSPMF75M20.
- SPMAD SEQ ID NO:12
- VERO cell monolayers were infected at 10 pfu per cell with either parental or recombinant viruses in the presence of 35 S-methionine.
- the fusion protein was specifically precipitated from the infected cell lysate using a rabbit antiserum directed against a carboxy terminal fusion peptide.
- the hemagglutinin protein was specifically precipitated from the infected cell lysate using a polyclonal monospecific anti-hemagglutinin serum.
- Morbillivirus cytopathogenicity is the formation of syncytia which arise by fusion of infected cells with surrounding uninfected cells followed by migration of the nuclei toward the center of the syncytium (Norrby et al., 1982). This has been shown to be an important method of viral spread, which for Paramyxoviruses can occur in the presence of hemagglutinin specific antibody (Merz et al., 1980). This ability has been assigned by analogy with other Paramyxoviruses to the amino terminus of the FI peptide (Choppin et al., 1981; Novick et al., 1988; Paterson et al., 1987).
- VERO cell monolayers were inoculated with parental or recombinant viruses VP455 and VP557, respectively, at 1 pfu per cell. After 1 h absorption at 37°C the inoculum was removed, the overlay medium replaced, and the dishes incubated overnight at 37°C. At 18 h post-infection, plates were examined with a microscope and photographed. No cell fusing activity was evident in VERO cells inoculated with parental virus, vP455 or vP557. However, when VP455 and vP557 were co-inoculated, efficient cell fusing activity was observed.
- VN antibody testing was previously described in detail (Appel et al. , 1973) .
- Testing for CDV-VN antibody titers was made in VERO cells with the adapted Onderstepoort strain of CDV.
- Testing for MV-VN antibody titers was made in VERO cells with the adapted Edmonston strain of MV.
- the results of the serological tests are shown in Table 1. Dogs immunized as described in Example 6 with either the vaccinia parental virus or VP455 expressing the measles fusion protein did not develop neutralizing antibody to MV.
- Dogs immunized with either VP557 expressing the HA protein or co-inoculated with both recombinants VP455 and VP557 did develop neutralizing antibodies after one inoculation. Levels of antibody were equivalent to those induced by inoculation with the attenuated Edmonston strain of MV.
- Table 1 Measles virus neutralizing antibody titers in response to vaccination
- MV a Time of first immunization b) Time of second immunization (first immunization with MV) c) Time of challenge d) Titer expressed as log 1fJ of last antibody dilution showing complete neutralization of infectivity in a microtiter neutralization test as described by Appel et al. (1973).
- Each dog was inoculated with approximately 4 x 10 8 pfu of vaccinia virus in 1 ml amounts (0.6 ml subcutaneously and 0:4 ml intramuscularly) .
- Two control dogs received 10 5 50% tissue culture infectious doses (TCID 50 ) of the attenuated Edmonston strain of MV intramuscularly (1 ml amount) and two control dogs received 10 4 TCID 50 of the attenuated Rockborn strain of CDV subcutaneously two weeks before challenge with virulent CDV.
- TCID 50 tissue culture infectious doses
- Non-immunized control dogs and dogs vaccinated with parental vaccinia virus developed clinical signs of severe disease and were euthanized when dehydration was evident.
- Both dogs immunized with vP455 showed some signs of infection with CDV including weight loss, elevated body temperature, and lymphopenia although these symptoms were of shorter duration than were seen in control dogs. Nonetheless, both dogs survived lethal challenge with CDV.
- Dogs inoculated with vP557 or co-inoculated with both recombinants showed minimal signs of infection and survived challenge. Dogs inoculated with either attenuated Edmonston strain of MV or the attenuated Rockborn strain of CDV also survived challenge with minimal signs of disease.
- a second vaccinia virus recombinant containing the measles HA gene within the tk locus was generated (vP756) using insertion plasmid pRW843.
- pRW843 was constructed in the following manner. A 1.8kbp EcoRV/Smal fragment containing the 3 '-most 24bp of the H6 promoter fused in a precise ATG:ATG configuration with the HA gene lacking the 3'-most 26bp was isolated from pSPM2LHAVC. This fragment was used to replace the 1.8kbp EcoRV/Smal fragment of pSPMHAll to generate pRW803. Plasmid pRW803 contains the entire H6 promoter linked precisely to the entire measles HA gene.
- Pro 18 Single stranded template was derived from plasmid pRW819 which contains the H6/HA cassette from pRW803 in pIBI25 (IBI, New Haven, CT.).
- the mutagenized plasmid containing the inserted (CCC) to encode for a proline residue at codon 18 was designated pRW820.
- the sequence between the Hindlll and Xbal sites of pRW820 was confirmed by nucleotide sequence analysis. The Hindlll site is situated at the 5' border of the H6 promoter while the Xbal site is located 230bp downstream from the initiation codon of the HA gene.
- the mutagenized expression cassette contained within pRW837 was derived by digestion with Hindlll and EcoRI, blunt-ended using the Klenow fragment of E . coli DNA polymerase in the presence of 2mM dNTPs, and inserted into the Smal site of pSD573VCVQ to yield pRW843.
- the plasmid pRW843 was used in in vitro recombination experiments with VP618 as the rescue virus to yield vP756.
- Parental virus VP618 is a Copenhagen strain virus from which the thymidine kinase, hemorrhagic and A-type inclusion genes have been deleted.
- Recombinant VP756 has been shown by immunoprecipitation analysis to correctly express a hemagglutinin glycoprotein of approximately 75kd.
- a second vaccinia virus recombinant (vP800) harboring the measles fusion gene in the ATI locus of the genome was generated using insertion plasmid pRW850.
- pRW850 To construct pRW850, the following manipulations were performed.
- the plasmid pSPMF75M20 containing the measles fusion gene linked in a precise ATG:ATG configuration with the H6 promoter was digested with Nrul and EagI.
- the 1.7kbp blunt ended fragment containing the 3 '-most 28bp of the H6 promoter and the entire fusion gene was isolated and inserted into pRW823 digested with Nrul and Xbal and blunt-ended.
- the resultant plasmid pRW841 contains the H6 promoter linked to the measles fusion gene in the pIBI25 plasmid vector (IBI, New Haven, CT.).
- the H6/measles fusion expression cassette was derived from pRW841 by digestion with Smal and the resulting l. ⁇ kbp fragment was inserted into pSD494VC digested with Smal to yield pRW850.
- the plasmid pRW ⁇ 50 was used in in vitro recombination experiments with vP6l ⁇ as the rescue virus to yield VP800. Recombinant vP800 has been shown by immunoprecipitation analysis to express an authentically processed fusion glycoprotein.
- Two rabbits were inoculated intradermally at 5 sites with a total of lxlO 8 pfu of recombinant vP455 expressing the measles fusion protein. Both rabbits were boosted with an identical inoculation at week 12. Serial bleeds were collected, and at week 14, two weeks after the boost, the rabbits were tested for the presence of serum neutralizing antibodies.
- guinea pigs were inoculated subcutaneously with lxlO 8 pfu each of recombinant vP455. An identical booster inoculation was given at 21 days. Serial bleeds were collected.
- Measles/canarypox virus recombinants were developed using a similar strategy to that previously described for fowlpox virus (Taylor et al., 1988a,b) .
- Plasmids for insertion of the measles F and HA genes into canarypox virus were generated as follows.
- Plasmid pRW764.2 contains a 3.4kbp PvuII fragment from the canarypox genome having a unique EcoRI site which has been determined to be non-essential for viral replication.
- the resultant plasmid containing the measles F gene was designated pRW ⁇ OO and was used in recombination experiments with canarypox as the rescuing virus to generate vCP40.
- Plasmid pRW764.5 contains an 800bp PvuII fragment of the canarypox genome having a unique Bglll site which has previously been determined to be non-essential for viral growth. This insertion created plasmid pRW ⁇ lO which was used in recombination tests to generate vCP50.
- immunoprecipitation analysis* was performed using mono-specific sera directed against either the HA or F proteins.
- a correctly processed fusion polypeptide was specifically precipitated from lysates of cells infected with VCP40 and VCP57.
- VERO cell monolayers were infected with 1 pfu per cell of CP parental or recombinant viruses and examined for cytopathic effects at l ⁇ hours post infection. No cell fusing activity was evident in VERO cells inoculated with parental, VCP40 or VCP50 viruses. However, when VERO cells were inoculated with the double recombinant vCP57 or when cells are co-infected with both vCP40 and vCP50, efficient cell fusing activity is evident.
- Dogs inoculated as described in Example 13 with the canarypox/HA recombinant vCP50, vaccinia/HA recombinant vP557, the canarypox/HA/F double recombinant VCP57 or co- inoculated with vP455 and VP557 developed significant serum neutralizing antibody to measles virus after one inoculation.
- Neither of the two dogs inoculated with the canarypox/F recombinant vCP40 developed neutralizing antibody after one or two inoculations.
- the results of the serological tests are shown in Table 4.
- guinea pigs inoculated with the VCP40 recombinant did develop low but reproducible levels of serum neutralizing antibody.
- An 860 bp PvuII canarypox genomic fragment was inserted between the PvuII sites of pUC9.
- the resultant plasmid was designated pRW764.5.
- the nucleotide sequence of the 8 ⁇ 0 bp canarypox fragment was determined using the modified T7 enzyme SequenaseTM Kit (United States Biochemical, Cleveland, OH) according to manufacturer's specifications. Sequence reactions utilized custom synthesized primers (17-l ⁇ mers) prepared with the Biosearch 8700 (San Rafael, CA) or Applied Biosystems 3800 (Foster City, CA) . This enabled the definition of the C5 open reading frame.
- RW146 (SEQ ID N0:16): (5'-
- This C5 deletion plasmid was constructed without interruption of other canarypox virus open reading frames.
- the C5 coding sequence was replaced with the above annealed oligonucleotides (RW145 and RW146) which include the restriction sites for Hindlll, Smal. and EcoRI.
- the plasmid pRW ⁇ 38 was derived from pRW831 by the insertion of a Smal fragment containing the Rabies G gene (Taylor et al., 198 ⁇ b) juxtaposed 3' to the vaccinia virus H6 promoter. Ligation of the 1.8 kbp EcoRV/EcoRI fragment from pRW837 with the 3.2 kbp EcoRV/EcoRI fragment from pRW ⁇ 3 ⁇ led to the construction of plasmid pRW ⁇ 52. Plasmid pRW852 was used in recombination experiments with a canarypox isolate designated ALVAC to yield VCP85.
- ALVAC is a plaque cloned isolate of canarypox virus (CPV) derived from the Rentschler strain, a highly attenuated strain of CPV used for vaccination of canaries. Replication of ALVAC and derived recombinants is restricted to avian species. Immunoprecipitation analysis has confirmed that a protein of approximately 75kd recognized by a rabbit anti-HA serum is expressed in CEF cells infected with recombinant vCP ⁇ 5.
- CPV canarypox virus
- the 1.8kbp Smal fragment derived by digestion of pRW841 was inserted into the C5 deletion vector, pRW831.
- the plasmid pRW851 was linearized at the EcoRI site situated 3 ' to the fusion gene and was blunt-ended with the Klenow fragment of the E. coli DNA polymerase in the presence of 2mM dNTPs.
- the plasmid pRW837 containing the measles HA gene juxtaposed 3' to the H6 promoter sequences, was digested with Hindlll and EcoRI and blunt-ended with the Klenow fragment.
- the resultant l. ⁇ kbp fragment was isolated and inserted into pRW ⁇ l that had been linearized with EcoRI and blunt-ended.
- the resultant plasmid which contains both genes in a tail to tail configuration, was designated pRW853A and was utilized in in vitro recombination experiments with canarypox (ALVAC) as the rescue virus to generate vCP ⁇ 2 also designated ALVAC-MV.
- ALVAC-MV canarypox
- Expression analysis using immunoprecipitation and immunofluorescence confirmed that in cells infected with recombinant vCP ⁇ 2 authentically processed HA and F proteins were expressed.
- the recombinant was also functional for cell fusing activity.
- guinea pigs were inoculated by the subcutaneous route with ALVAC-MV (vCP ⁇ 2) .
- Two animals (026 and 027) each received lxlO 8 pfu and two animals (02 ⁇ and 029) each received lxlO 7 pfu.
- animals were re-inoculated with an identical dose.
- Two rabbits were inoculated with lxlO 8 pfu of ALVAC-MV (vCP ⁇ 2) by the subcutaneous route.
- animals were re-inoculated with an identical dose.
- Serological analysis of sera of guinea pigs inoculated with ALVAC-MV (vCP82) Analysis performed by microtiter serum neutralization assay.
- mice were inoculated by the intra muscular route with ALVAC-MV, and their serological response to measles virus monitored using the hemagglutination-inhibition (HI) test.
- the serological response to canarypox virus was monitored by ELISA assay.
- five guinea pigs were inoculated with 5.5 log 10 TCID 50
- thirty mice were inoculated with 4.8 log 10 TCID 50
- five rabbits were inoculated with 5.8 log 10 TCID 50 . All animals were re-inoculated at 28 days with an equivalent dose.
- mice Sera of mice were analyzed in groups of 5 animals (Table 9) . All animals showed a primary response to canarypox virus which was boosted after the second inoculation. The mice did not show a response to MV after one inoculation. Three of the six groups showed titers within the protective range at 8 weeks post-inoculation. Similarly, all guinea-pigs (Table 10) showed a response to canarypox virus after one inoculation which was boosted after the second inoculation. Four of five animals developed anti-HI titers after one inoculation, one of these being in the protective range. One week after the second inoculation, the titers of all animals were in the protective range.
- the Copenhagen vaccine strain of vaccinia virus was modified by the deletion of six nonessential regions of the genome encoding known or potential virulence factors.
- the " sequential deletions are detailed below. All designations of vaccinia restriction fragments, open reading frames and nucleotide positions are based on the terminology reported in Goebel et al. (1990a,b) .
- deletion loci were also engineered as recipient loci for the insertion of foreign genes.
- TK thymidine kinase gene
- HA hemagglutinin gene
- Plasmids were constructed, screened and grown by standard procedures (Maniatis et al., 1986; Perkus et al., 1985; Piccini et al., 1987). Restriction endonucleases were obtained from GIBCO/BRL, Gaithersburg, MD, New England Biolabs, Beverly, MA; and Boehringer Mannheim Biochemicals, Indianapolis, IN. Klenow fragment of E. coli polymerase was obtained from Boehringer Mannheim Biochemicals. BAL-31 exonuclease and phage T4 DNA ligase were obtained from New England Biolabs. The reagents were used as specified by the various suppliers.
- Synthetic oligodeoxyribonucleotides were prepared on a Biosearch 8750 or Applied Biosystems 380B DNA synthesizer as previously described (Perkus et al., 1989). DNA sequencing was performed by the dideoxy-chain termination method (Sanger et al., 1977) using Sequenase (Tabor et al., 1987) as previously described (Guo et al., 1989).
- PCR polymerase chain reaction
- GeneAmp DNA amplification Reagent Kit Perkin Elmer Cetus, Norwalk, CT
- Excess DNA sequences were deleted from plasmids by restriction endonuclease digestion followed by limited digestion by BAL-31 exonuclease and mutagenesis (Mandecki, 1986) using synthetic oligonucleotides.
- plasmid pSD406 contains vaccinia Hindlll J (pos. 83359 - 8 ⁇ 377) cloned into pUC ⁇ .
- pSD406 was cut with Hindlll and PvuII, and the 1.7 kb fragment from the left side of Hindlll J cloned into pUC ⁇ cut with Hindlll/Smal, forming pSD447.
- pSD447 contains the entire gene for J2R (pos. 63855 - 843 ⁇ 5) .
- the initiation codon is contained within an Nlalll site and the termination codon is contained within an Sspl site.
- Direction of transcription is indicated by an arrow in FIG. 9.
- a 0.8 kb Hindlll/EcoRI fragment was isolated from pSD447, then digested with Nlalll and a 0.5 kb HindiII/Nlalll fragment isolated.
- Annealed synthetic oligonucleotides MPSYN43/MPSYN44 SEQ ID NO:17/SEQ ID NO:18
- GTACATTAATTGATCGATGGGCCCTTAA 5' Nlalll EcoRI were ligated with the 0.5 kb Hindlll/Nlalll fragment into pUCl ⁇ vector plasmid cut with Hindlll/EcoRI, generating plasmid pSD449.
- pSD447 was cut with Sspl (partial) within vaccinia sequences and
- pSD460 was used as donor plasmid for recombination with wild type parental vaccinia virus Copenhagen strain VC-2.
- 32 P labeled probe was synthesized by primer extension using MPSYN45 (SEQ ID NO:19) as template and the complementary 20mer oligonucleotide MPSYN47 (SEQ ID NO:21)
- plasmid pSD419 contains vaccinia Sail G (pos. 160,744-173,351) cloned into pUC8.
- pSD422 contains the contiguous vaccinia Sail fragment to the right, Sail J (pos. 173,351-l ⁇ 2,746) cloned into pUC ⁇ .
- u, B13R - B14R pos. 172,549 - 173,552
- pSD419 was used as the source for the left flanking arm and pSD422 was used as the source of the right flanking arm.
- the direction of transcription for the u region is indicated by an arrow in FIG. 10.
- sequences to the left of the Ncol site were removed by digestion of pSD419 with Ncol/Smal followed by blunt ending with Klenow fragment of E . coli polymerase and ligation generating plasmid pSD476.
- a vaccinia right flanking arm was obtained by digestion of pSD422 with Hpal at the termination codon of B14R and by digestion with Nrul 0.3 kb to the right. This 0.3 kb fragment was isolated and ligated with a 3.4 kb Hindi vector fragment isolated from pSD476, generating plasmid pSD477.
- the location of the partial deletion of the vaccinia u region in pSD477 is indicated by a triangle.
- the remaining B13R coding sequences in pSD477 were removed by digestion with Clal/Hpal, and the resulting vector fragment was ligated with annealed synthetic oligonucleotides SD22mer/SD20mer (SEQ ID NO:22/SEQ ID NO:23)
- pSD479 contains an initiation codon (underlined) followed by a BamHI site.
- E . coli Beta-galactosidase in the B13-B14 (u) deletion locus under the control of the u promoter, a 3.2 kb BamHI fragment containing the Beta-galactosidase gene (Shapira et al., 1983) was inserted into the BamHI site of pSD479, generating pSD479BG.
- pSD479BG was used as donor plasmid for recombination with vaccinia virus vP410.
- Recombinant vaccinia virus VP533 was isolated as a blue plaque in the presence of chromogenic substrate X-gal.
- vP533 the B13R- B14R region is deleted and is replaced by Beta- galactosidase.
- plasmid pSD486 a derivative of pSD477 containing a polylinker region but no initiation codon at the u deletion junction, was utilized.
- Clal/Hpal vector fragment from pSD477 referred to above was ligated with annealed synthetic oligonucleotides SD42mer/SD40mer (SEQ ID NO:24/SEQ
- pSD486 was used as donor plasmid for recombination with recombinant vaccinia virus VP533, generating vP553, which was isolated as a clear plaque in the presence of X-gal.
- pSD414 contains Sail B cloned into pUC8.
- pSD414 was cut with Xbal within vaccinia sequences (pos. 137,079) and with Hindlll at the pUC/vaccinia junction, then blunt ended with Klenow fragment of E. coli polymerase and ligated, resulting in plasmid pSD483.
- pSD4 ⁇ 3 was cut with EcoRI (pos. 140,665 and at the pUC/vaccinia junction) and ligated, forming plasmid pSD484.
- pSD484 was cut with Ndel (partial) slightly upstream from the A26L ORF (pos. 139,004) and with Hpal (pos. 137,869) slightly downstream from the A26L ORF.
- the 5.2 kb vector fragment was isolated and ligated with annealed synthetic Oligonucleotides ATI3/ATI4 (SEQ ID NO:28/SEQ ID NO:29) Ndel ATI3 5• TATGAGTAACTTAACTCTTTTGTTAATTAAAAGTATATTCAAAAAATAAGT ATI4 3 ' ACTCATTGAATTGAGAAAACAATTAATTTTCATATAAGTTTTTTATTCA
- Bglll EcoRI Hpal TATATAAATAGATCTGAATTCGTT 3' ATI3 ATATATTTATCTAGACTTAAGCAA 5' ATI4 reconstructing the region upstream from A26L and replacing the A26L ORF with a short polylinker region containing the restriction sites Bglll, EcoRI and Hpal, as indicated above.
- the resulting plasmid was designated pSD485. Since the Bglll and EcoRI sites in the polylinker region of pSD485 are not unique, unwanted Bglll and EcoRI sites were removed from plasmid pSD483 (described above) by digestion with Bglll (pos.
- the resulting plasmid was designated pSD489.
- the 1.8 kb Clal (pos. 137,198) /EcoRV (pos. 139,048) fragment from pSD489 containing the A26L ORF was replaced with the corresponding 0.7 kb polylinker- containing Clal/EcoRV fragment from pSD485, generating pSD492.
- the Bglll and EcoRI sites in the polylinker region of pSD492 are unique.
- vaccinia Sail G restriction fragment (pos. 160,744-173,351) crosses the Hindlll A/B junction (pos. 162,539).
- pSD419 contains vaccinia Sail G cloned into pUC8.
- the direction of transcription for the hemagglutinin (HA) gene is indicated by an arrow in FIG. 12.
- Vaccinia sequences derived from Hindlll B were removed by digestion of pSD419 with Hindlll within vaccinia sequences and at the pUC/vaccinia junction followed by ligation.
- the resulting plasmid, pSD456, contains the HA gene, A56R, flanked by 0.4 kb of vaccinia sequences to the left and 0.4 kb of vaccinia sequences to the right.
- A56R coding sequences were removed by cutting pSD456 with Rsal (partial; pos. 161,090) upstream from A56R coding sequences, and with EagI (pos. 162,054) near the end of the gene.
- the 3.6 kb Rsal/EagI vector fragment from pSD456 was isolated and ligated with annealed synthetic oligonucleotides MPSYN59 (SEQ ID NO:31), MPSY62 (SEQ ID NO:32), MPSYN60 (SEQ ID NO:33), and MPSYN 61 (SEQ ID NO:34)
- Beta-galactosidase sequences were deleted from VP708 using donor plasmid pSD467.
- pSD467 is identical to pSD466, except that EcoRI, Smal and BamHI sites were removed from the pUC/vaccinia junction by digestion of pSD466 with EcoRI/BamHI followed by blunt ending with Klenow fragment of E. coli polymerase and ligation.
- Recombination between vP708 and pSD467 resulted in recombinant vaccinia deletion mutant, vP723, which was isolated as a clear plaque in the presence of X-gal.
- pSD420 is Sail H cloned into pUC ⁇ .
- pSD435 is Kpnl F cloned into pUCl ⁇ .
- pSD435 was cut with SphI and religated, forming pSD451.
- DNA sequences to the left of the SphI site (pos. 27,416) in Hindlll M are removed (Perkus et al., 1990).
- pSD409 is Hindlll M cloned into pUC8.
- E . coli Beta-galactosidase was first inserted into the vaccinia M2L deletion locus (Guo et al., 1990) as follows. To eliminate the Bglll site in pSD409, the plasmid was cut with Bglll in vaccinia sequences (pos. 28,212) and with BamHI at the pUC/vaccinia junction, then ligated to form plasmid pMP409B. pMP409B was cut at the unique SphI site (pos. 27,416) . M2L coding sequences were removed by mutagenesis (Guo et al., 1990; Mandecki,
- the resulting plasmid, pMP409D contains a unique Bglll site inserted into the M2L deletion locus as indicated above.
- the resulting plasmid, pMP409DBG (Guo et al., 1990), was used as donor plasmid for recombination with rescuing vaccinia virus vP723.
- Recombinant vaccinia virus, VP784, containing Beta- galactosidase inserted into the M2L deletion locus was isolated as a blue plaque in the presence of X-gal.
- a plasmid deleted for vaccinia genes [C7L-K1L] was assembled in pUC ⁇ cut with Smal, Hindlll and blunt ended with Klenow fragment of E. coli polymerase.
- the left flanking arm consisting of vaccinia Hindlll C sequences was obtained by digestion of pSD420 with Xbal (pos. 18,626) followed by blunt ending with Klenow fragment of E. coli polymerase and digestion with Bglll (pos. 19,706).
- the right flanking arm consisting of vaccinia Hindlll K sequences was obtained by digestion of pSD451 with Bglll (pos. 29,062) and EcoRV (pos. 29,778).
- the resulting plasmid, pMP581CK is deleted for vaccinia sequences between the BolII site (pos. 19,706) in Hindlll C and the Bglll site (pos. 29,062) in Hindlll K.
- the site of the deletion of vaccinia sequences in plasmid pMP581CK is indicated by a triangle in FIG. 13.
- plasmid pMP581CK was cut at the Ncol sites within vaccinia sequences (pos. 18, ⁇ ll; 19,655), treated with Bal- 31 exonuclease and subjected to mutagenesis (Mandecki, 1986) using synthetic oligonucleotide MPSYN233 (SEQ ID NO:36) 5'- TGTCATTTAACACTA- TACTCATATTAATAAAAATAATATTTATT-3 ' .
- the resulting plasmid, pMPCSKl ⁇ is deleted for vaccinia sequences positions 18,805-29,108, encompassing 12 vaccinia open reading frames [C7L - K1L] .
- plasmid pSD405 contains vaccinia Hindlll I (pos. 63,875-70,367) cloned in pUC8.
- pSD405 was digested with EcoRV within vaccinia sequences (pos. 67,933) and with Smal at the pUC/vaccinia junction, and ligated, forming plasmid pSD518.
- pSD518 was used as the source of all the vaccinia restriction fragments used in the construction of pSD548.
- the vaccinia I4L gene extends from position 67,371- 65,059. Direction of transcription for I4L is indicated by an arrow in FIG. 14.
- pSD518 was digested with BamHI (pos. 65,381) and Hpal (pos. 67,001) and blunt ended using Klenow fragment of E . coli polymerase. This 4.8 kb vector fragment was ligated with a 3.2 kb Smal cassette containing the E.
- coli Beta-galactosidase gene (Shapira et al., 1983) under the control of the vaccinia 11 kDa promoter (Bertholet et al., 19 ⁇ 5; Perkus et al., 1990), resulting in plasmid pSD524KBG.
- pSD524KBG was used as donor plasmid for recombination with vaccinia virus vP ⁇ 04.
- Recombinant vaccinia virus, vP855, containing Beta- galactosidase in a partial deletion of the I4L gene was isolated as a blue plaque in the presence of X-gal.
- deletion plasmid pSD548 was constructed.
- the left and right vaccinia flanking arms were assembled separately in pUC8 as detailed below and presented schematically in FIG. 14.
- pUC8 was cut with BamHI/EcoRI and ligated with annealed synthetic oligonucleotides 518A1/518A2
- pSD531 was cut with Rsal (partial) and BamHI and a 2.7 kb vector fragment isolated.
- pSD518 was cut with Bglll (pos. 64,459)/ Rsal (pos. 64,994) and a 0.5 kb fragment isolated. The two fragments were ligated together, forming pSD537, which contains the complete vaccinia flanking arm left of the I4L coding sequences.
- pUC ⁇ was cut with BamHI/EcoRI and ligated with annealed synthetic oligonucleotides 5l ⁇ Bl/51 ⁇ B2
- pSD532 was cut with Rsal (partial) /EcoRI and a 2.7 kb vector fragment isolated.
- pSD518 was cut with Rsal within vaccinia sequences (pos. 67,436) and EcoRI at the vaccinia/pUC junction, and a 0.6 kb fragment isolated. The two fragments were ligated together forming pSD538, which contains the complete vaccinia flanking arm to the right of I4L coding sequences.
- the right vaccinia flanking arm was isolated as a 0.6 kb EcoRI/Bglll fragment from pSD538 and ligated into pSD537 vector plasmid cut with EcoRI/Bglll.
- the I4L ORF pos. 65,047-67,386
- a polylinker region which is flanked by 0.6 kb vaccinia DNA to the left and 0.6 kb vaccinia DNA to the right, all in a pUC background.
- the site of deletion within vaccinia sequences is indicated by a triangle in FIG. 14.
- the vaccinia I4L deletion cassette was moved from pSD539 into pRCll, a pUC derivative from which all Beta- galactosidase sequences have been removed and replaced with a polylinker region (Colinas et al., 1990).
- pSD539 was cut with EcoRI/PstI and the 1.2 kb fragment isolated. This fragment was ligated into pRCll cut with EcoRI/PstI (2.35 kb) , forming pSD548.
- DNA from recombinant vaccinia virus vP866 was analyzed by restriction digests followed by electrophoresis on an agarose gel. The restriction patterns were as expected. Polymerase chain reactions (PCR) (Engelke et al., 1988) using vP866 as template and primers flanking the six deletion loci detailed above produced DNA fragments of the expected sizes. Sequence analysis of the PCR generated fragments around the areas of the deletion junctions confirmed that the junctions were as expected.
- Recombinant vaccinia virus vP ⁇ 66 containing the six engineered deletions as described above, was designated vaccinia vaccine strain "NYVAC.”
- the recombinant authentically expressed both measles glycoproteins on the surface of infected cells. Immunoprecipitation analysis demonstrated correct processing of both F and HA glycoproteins. The recombinant was also shown to induce syncytia formation.
- the rescuing virus used in the production of NYVAC- MV was the modified Copenhagen strain of vaccinia virus designated NYVAC. All viruses were grown and titered on Vero cell monolayers. Plasmid Construction
- plasmid pSPM2LHA contains the entire measles HA gene linked in a precise ATG to ATG configuration with the vaccinia virus H6 promoter which has been previously described (Taylor et al., 1988a,b; Guo et al., 1989; Perkus et al., 1989).
- a l. ⁇ kpb EcoRV/Smal fragment containing the 3' most 24 bp of the H6 promoter fused in a precise ATG:ATG configuration with the HA gene lacking the 3 * most 26 bp was isolated from pSPM2LHA.
- Plasmid pRW ⁇ 03 contains the entire H6 promoter linked precisely to the entire measles HA gene.
- Plasmid pSD513VCVQ was derived from plasmid pSD460 by the addition of polylinker sequences. Plasmid pSD460 was derived to enable deletion of the thymidine kinase gene from vaccinia virus (FIG. 9) .
- Plasmid pSPHMF7 contains the measles F gene juxtaposed 3* to the previously described vaccinia virus H6 promoter.
- oligonucleotide directed mutagenesis was performed using oligonucleotide SPMAD (SEQ ID NO:41).
- the plasmid pSPMF75M20 which contains the measles F gene now linked in a precise ATG for ATG configuration with the H6 promoter was digested with Nrul and EagI.
- the resultant plasmid pRW841 contains the H6 promoter linked to the measles F gene in the pIBI25 plasmid vector (IBI, New Haven, CT) .
- the H6/measles F cassette was excised from pRW841 by digestion with Smal and the resulting 1.8 kb fragment was inserted into pRW843 (containing the measles HA gene) .
- Plasmid pRW843 was first digested with NotI and blunt-ended with Klenow fragment of E. coli DNA polymerase in the presence of 2mM dNTPs.
- the resulting plasmid, pRW857 therefore contains the measles virus F and HA genes linked in a tail to tail configuration. Both genes are linked to the vaccinia virus H6 promoter.
- Plasmid pRW857 was transfected into NYVAC (vP866) infected Vero cells by using the calcium phosphate precipitation method previously described (Panicali et al., 1982; Piccini et al., 1987). Positive plaques were selected on the basis of in situ plaque hybridization to specific MV F and HA radiolabeled probes and subjected to 6 sequential rounds of plaque purification until a pure population was achieved. One representative plaque was then amplified and the resulting recombinant was designated NYVAC-MV (vP913) . Immunofluorescence
- Vero cell monolayers in 60mm dishes were inoculated at a multiplicity of 1 pfu per cell with parental or recombinant viruses. After 1 h absorption at 37°C the inoculum was removed, the overlay medium replaced and the dishes inoculated overnight at 37°C. At 20 h post- infection, dishes were examined.
- a characteristic of MV cytopathology is the formation of syncytia which arise by fusion of infected cells with surrounding infected or uninfected cells followed by migration of the nuclei toward the center of the syncytium (Norrby et al., 1982). This has been shown to be an important method of viral spread, which for Paramyxoviruses, can occur in the presence of HA-specific virus neutralizing antibody (Merz et al., 1980). In order to determine that the MV proteins expressed in vaccinia virus were functionally active, Vero cell monolayers were inoculated with NYVAC and NYVAC-MV and observed for cytopathic effects.
- Example 14 The in vivo analysis of i munogenicity of ALVAC-MV (vCP82) shown in Example 14 indicates that on inoculation of a range of species, the recombinant is able to induce a serological response which is measurable in standard serological tests.
- the titers achieved are in the range required for protection from disease. Inoculation of NYVAC- MV (vP913) into rabbits similarly induces a level of measles virus neutralizing antibody which would be protective.
- Table 13 Anti-measles neutralizing antibody titers (log 10 ) in sera of rabbits inoculated with NYVAC-MV (vP913)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Pulmonology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE4192786A DE4192786B4 (de) | 1990-11-20 | 1991-11-20 | Masernvirus-Rekombinanter Pockenvirus-Impfstoff |
| GB9309414A GB2264949B (en) | 1990-11-20 | 1991-11-20 | Measles virus recombinant poxvirus vaccine |
| CH2364/92A CH683921A5 (fr) | 1990-11-20 | 1991-11-20 | Vaccin à poxvirus recombinant contre le virus de la rougeole. . |
| NL9120026A NL195058C (nl) | 1990-11-20 | 1991-11-20 | Recombinant vacciniavirus en vaccin dat dit recombinant vacciniavirus bevat. |
| JP50520492A JP3617668B2 (ja) | 1990-11-20 | 1991-11-20 | 麻疹ウイルス組換え体ポックスウイルスワクチン |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US62161490A | 1990-11-20 | 1990-11-20 | |
| US621,614 | 1990-11-20 | ||
| US77686791A | 1991-10-22 | 1991-10-22 | |
| US776,867 | 1991-10-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1992008789A1 true WO1992008789A1 (en) | 1992-05-29 |
Family
ID=27089007
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1991/008703 Ceased WO1992008789A1 (en) | 1990-11-20 | 1991-11-20 | Measles virus recombinant poxvirus vaccine |
Country Status (12)
| Country | Link |
|---|---|
| JP (2) | JP3617668B2 (cg-RX-API-DMAC7.html) |
| AU (1) | AU1253892A (cg-RX-API-DMAC7.html) |
| BE (1) | BE1005908A5 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2096633A1 (cg-RX-API-DMAC7.html) |
| CH (1) | CH683921A5 (cg-RX-API-DMAC7.html) |
| DE (2) | DE4192786T1 (cg-RX-API-DMAC7.html) |
| FR (1) | FR2669346B1 (cg-RX-API-DMAC7.html) |
| GB (2) | GB2264949B (cg-RX-API-DMAC7.html) |
| IE (2) | IE68404B1 (cg-RX-API-DMAC7.html) |
| IT (1) | IT1252687B (cg-RX-API-DMAC7.html) |
| NL (2) | NL195058C (cg-RX-API-DMAC7.html) |
| WO (1) | WO1992008789A1 (cg-RX-API-DMAC7.html) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5505941A (en) * | 1981-12-24 | 1996-04-09 | Health Research, Inc. | Recombinant avipox virus and method to induce an immune response |
| WO1997028265A1 (en) * | 1996-02-05 | 1997-08-07 | University Of Massachusetts Medical Center | Measles immunization by dna transcription unit inoculation |
| EP0759072A4 (en) * | 1994-04-06 | 1998-03-04 | Virogenetics Corp | RECOMBINATION PRODUCTS OF POXVIRUS AND DOG SQUARE VIRUS (CDV) AND COMPOSITIONS AND METHODS USING THE SAME |
| US5942235A (en) * | 1981-12-24 | 1999-08-24 | Health Research, Inc. | Recombinant poxvirus compositions and methods of inducing immune responses |
| US6183750B1 (en) | 1981-12-24 | 2001-02-06 | Health Research, Inc. | Avipox virus containing DNA sequences encoding herpesvirus glycoproteins |
| CN1089370C (zh) * | 1994-12-08 | 2002-08-21 | 中国预防医学科学研究院病毒学研究所 | 表达麻疹病毒l4株血凝素及融合蛋白基因的重组痘苗病毒 |
| US6605465B1 (en) | 1989-04-17 | 2003-08-12 | Health Research, Inc. | Methods for avoiding maternal immunity |
| JP2004537974A (ja) * | 2001-03-08 | 2004-12-24 | アメリカ合衆国 | 改変HIVエンベロープ、gag、およびpol遺伝子を発現するMVA |
| WO2007115385A3 (en) * | 2006-04-11 | 2008-01-10 | Inst Nac De Tecnologia Agropec | Transfer plasmidic vector and recombinant canarypox virus |
| US7767449B1 (en) | 1981-12-24 | 2010-08-03 | Health Research Incorporated | Methods using modified vaccinia virus |
| US7850956B2 (en) | 1992-03-23 | 2010-12-14 | University Of Massachusetts Medical Center | Immunization by inoculation of DNA transcription unit |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU672581B2 (en) * | 1991-03-07 | 1996-10-10 | Virogenetics Corporation | Immunodeficiency virus recombinant poxvirus vaccine |
| DE69233158T2 (de) * | 1991-03-07 | 2004-05-13 | Connaught Technology Corp., Greenville | Gentechnologisch hergestellter stamm für impfstoffe |
| US5989561A (en) * | 1991-03-07 | 1999-11-23 | Virogenetics Corporation | Recombinant poxvirus-calicivirus rabbit hemorrhagic disease virus (RHDV) compositions and uses |
| AU674491B2 (en) * | 1991-03-20 | 1997-01-02 | Virogenetics Corporation | Recombinant poxvirus malaria vaccine |
| US6211165B1 (en) | 1997-05-09 | 2001-04-03 | The Trustees Of The University Of Pennsylvania | Methods and compositions for reducing ischemic injury of the heart by administering adenosine receptor agonists and antagonists |
| EP1095948A1 (en) * | 1999-10-28 | 2001-05-02 | Universitätsklinikum Freiburg | Idiotype vaccines |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2617715B1 (fr) * | 1987-07-07 | 1990-08-31 | Transgene Sa | Vecteur viral et adn recombinant codant pour une ou des proteines de surface (ha et/ou f) d'un morbillivirus, culture cellulaire infectee, proteines obtenues, vaccin et anticorps obtenus |
| DE10399032I1 (de) * | 1987-08-28 | 2004-01-29 | Health Research Inc | Rekombinante Viren. |
| FR2632863B2 (fr) * | 1987-10-29 | 1990-08-31 | Transgene Sa | Virus du fowlpox recombinant et vaccins derives de ces virus |
| JPH01218590A (ja) * | 1988-02-29 | 1989-08-31 | Toa Nenryo Kogyo Kk | 組換ワクチニアウイルスを用いたリンダペスト(牛疫)ウイルスワクチン |
-
1991
- 1991-11-13 IE IE396091A patent/IE68404B1/en not_active IP Right Cessation
- 1991-11-13 IE IE960091A patent/IE71643B1/en not_active IP Right Cessation
- 1991-11-19 BE BE9101066A patent/BE1005908A5/fr not_active IP Right Cessation
- 1991-11-19 FR FR9114256A patent/FR2669346B1/fr not_active Expired - Lifetime
- 1991-11-20 GB GB9309414A patent/GB2264949B/en not_active Expired - Lifetime
- 1991-11-20 AU AU12538/92A patent/AU1253892A/en not_active Abandoned
- 1991-11-20 IT ITMI913092A patent/IT1252687B/it active IP Right Grant
- 1991-11-20 JP JP50520492A patent/JP3617668B2/ja not_active Expired - Fee Related
- 1991-11-20 NL NL9120026A patent/NL195058C/nl not_active IP Right Cessation
- 1991-11-20 DE DE4192786T patent/DE4192786T1/de active Pending
- 1991-11-20 CA CA002096633A patent/CA2096633A1/en not_active Abandoned
- 1991-11-20 WO PCT/US1991/008703 patent/WO1992008789A1/en not_active Ceased
- 1991-11-20 GB GB9500214A patent/GB2283021B/en not_active Expired - Lifetime
- 1991-11-20 DE DE4192786A patent/DE4192786B4/de not_active Expired - Lifetime
- 1991-11-20 CH CH2364/92A patent/CH683921A5/fr not_active IP Right Cessation
-
2003
- 2003-07-15 NL NL9900036A patent/NL195095C/nl not_active IP Right Cessation
-
2004
- 2004-06-09 JP JP2004170929A patent/JP3824619B2/ja not_active Expired - Fee Related
Non-Patent Citations (6)
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6183750B1 (en) | 1981-12-24 | 2001-02-06 | Health Research, Inc. | Avipox virus containing DNA sequences encoding herpesvirus glycoproteins |
| US7767449B1 (en) | 1981-12-24 | 2010-08-03 | Health Research Incorporated | Methods using modified vaccinia virus |
| US5505941A (en) * | 1981-12-24 | 1996-04-09 | Health Research, Inc. | Recombinant avipox virus and method to induce an immune response |
| US5942235A (en) * | 1981-12-24 | 1999-08-24 | Health Research, Inc. | Recombinant poxvirus compositions and methods of inducing immune responses |
| US6605465B1 (en) | 1989-04-17 | 2003-08-12 | Health Research, Inc. | Methods for avoiding maternal immunity |
| US7850956B2 (en) | 1992-03-23 | 2010-12-14 | University Of Massachusetts Medical Center | Immunization by inoculation of DNA transcription unit |
| EP0759072A4 (en) * | 1994-04-06 | 1998-03-04 | Virogenetics Corp | RECOMBINATION PRODUCTS OF POXVIRUS AND DOG SQUARE VIRUS (CDV) AND COMPOSITIONS AND METHODS USING THE SAME |
| CN1089370C (zh) * | 1994-12-08 | 2002-08-21 | 中国预防医学科学研究院病毒学研究所 | 表达麻疹病毒l4株血凝素及融合蛋白基因的重组痘苗病毒 |
| WO1997028265A1 (en) * | 1996-02-05 | 1997-08-07 | University Of Massachusetts Medical Center | Measles immunization by dna transcription unit inoculation |
| JP2004537974A (ja) * | 2001-03-08 | 2004-12-24 | アメリカ合衆国 | 改変HIVエンベロープ、gag、およびpol遺伝子を発現するMVA |
| JP2010115208A (ja) * | 2001-03-08 | 2010-05-27 | Usa Government | 改変HIVエンベロープ、gag、およびpol遺伝子を発現するMVA |
| US7867982B2 (en) | 2001-03-08 | 2011-01-11 | Emory University | MVA expressing modified HIV envelope, gag, and pol genes |
| US8916172B2 (en) | 2001-03-08 | 2014-12-23 | Emory University | MVA expressing modified HIV envelope, gag, and pol genes |
| WO2007115385A3 (en) * | 2006-04-11 | 2008-01-10 | Inst Nac De Tecnologia Agropec | Transfer plasmidic vector and recombinant canarypox virus |
Also Published As
| Publication number | Publication date |
|---|---|
| FR2669346B1 (fr) | 1995-07-21 |
| JP3824619B2 (ja) | 2006-09-20 |
| GB2283021A (en) | 1995-04-26 |
| AU1253892A (en) | 1992-06-11 |
| DE4192786B4 (de) | 2006-08-24 |
| ITMI913092A1 (it) | 1993-05-20 |
| NL9120026A (nl) | 1993-09-01 |
| NL9900036A (nl) | 2003-10-01 |
| DE4192786T1 (de) | 1994-01-13 |
| FR2669346A1 (fr) | 1992-05-22 |
| NL195058C (nl) | 2003-07-01 |
| GB9500214D0 (en) | 1995-03-01 |
| IT1252687B (it) | 1995-06-23 |
| JPH06502996A (ja) | 1994-04-07 |
| CA2096633A1 (en) | 1992-05-21 |
| IE68404B1 (en) | 1996-06-12 |
| CH683921A5 (fr) | 1994-06-15 |
| NL195095C (nl) | 2004-01-21 |
| BE1005908A5 (fr) | 1994-03-08 |
| IE71643B1 (en) | 1997-02-26 |
| GB9309414D0 (en) | 1993-07-14 |
| ITMI913092A0 (it) | 1991-11-20 |
| JP3617668B2 (ja) | 2005-02-09 |
| JP2005040129A (ja) | 2005-02-17 |
| GB2264949B (en) | 1995-07-05 |
| IE913960A1 (en) | 1992-05-20 |
| GB2283021B (en) | 1995-07-05 |
| GB2264949A (en) | 1993-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5364773A (en) | Genetically engineered vaccine strain | |
| KR970011149B1 (ko) | 재조합 아비폭스 바이러스 | |
| JP4108742B2 (ja) | ポックスウイルス−イヌジステンパーウイルス(cdv)組み換え体類および組成物類および前記組み換え体類を用いる方法 | |
| US7144578B2 (en) | Poxvirus-rabies recombinants and compositions and methods employing the recombinants | |
| Taylor et al. | Nonreplicating viral vectors as potential vaccines: recombinant canarypox virus expressing measles virus fusion (F) and hemagglutinin (HA) glycoproteins | |
| US5843456A (en) | Alvac poxvirus-rabies compositions and combination compositions and uses | |
| CA1341234C (en) | Recombinant fowlpox virus | |
| NL195058C (nl) | Recombinant vacciniavirus en vaccin dat dit recombinant vacciniavirus bevat. | |
| AU724172B2 (en) | Recombinant poxvirus-feline infectious peritonitis virus, compositions thereof and methods for making and using them | |
| US5989561A (en) | Recombinant poxvirus-calicivirus rabbit hemorrhagic disease virus (RHDV) compositions and uses | |
| US5503834A (en) | Measles virus recombinant poxvirus vaccine | |
| WO1996039177A9 (en) | Recombinant poxvirus-calicivirus [rabbit hemorrhagic disease virus (rhdv)] compositions and uses | |
| US5759841A (en) | Immunological composition of measles virus utilizing recombinant poxvirus | |
| EP0623172B1 (en) | Marek's disease virus recombinant vaccinia virus vaccine | |
| AU699903B2 (en) | Measles virus recombinant poxvirus vaccine | |
| AU720448B2 (en) | Poxvirus-canine distemper virus (CDV) recombinants and compositions and methods employing the recombinants | |
| CA2187207C (en) | Poxvirus-canine distemper virus (cdv) recombinants and compositions and methods employing the recombinants | |
| AU769221B2 (en) | Recombinant poxvirus-feline infectious peritonitis virus, compositions thereof and methods for making and using them | |
| Hu | Development of raccoon poxvirus-vectored feline recombinant vaccines |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AT AU CA CH DE DK GB JP KR LU NL |
|
| COP | Corrected version of pamphlet |
Free format text: PAGES 1/17-17/17,DRAWINGS,REPLACED BY NEW PAGES 1/17-17/17 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 9309414.2 Country of ref document: GB |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2096633 Country of ref document: CA |
|
| RET | De translation (de og part 6b) |
Ref document number: 4192786 Country of ref document: DE Date of ref document: 19940113 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 4192786 Country of ref document: DE |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8607 |