CA2187207C

CA2187207C - Poxvirus-canine distemper virus (cdv) recombinants and compositions and methods employing the recombinants

Info

Publication number: CA2187207C
Application number: CA002187207A
Authority: CA
Inventors: Enzo Paoletti; James Tartaglia; Jill Taylor; Russell Gettig
Original assignee: Virogenetics Corp
Current assignee: Virogenetics Corp
Priority date: 1994-04-06
Filing date: 1995-04-06
Publication date: 2006-04-04
Anticipated expiration: 2015-04-06
Also published as: CA2187207A1

Abstract

Attenuated recombinant viruses containing DNA coding for a canine distemper virus antigen or measles M or N antigen, as well as methods and compositions employing the viruses, are disclosed and claimed . The recombinant viruses can be NYVAC or ALVAC recombinant viruses. The DNA can code for at least one of: canine distemper virus fusion protein, canine distemper virus hemagglutan in glycoprotein, canine distemper nucleocaspid protein, canine distemper matrix protein, measles virus nucleocaspid protein, and measle s virus matrix protein. The recombinant viruses and gene products therefrom are usef ul for eliciting protection against canine distemper vir us and/or measles virus, and, the gene products and antibodies elicited thereby are useful in assays. Additionally, DNA from the recomb inants is used for probes or for generating PCR primers.

Description

77354-69 (S) pOxVIRQB - CANINE DISTEMPER VIROS ICDV) RECOMHINANTB l~ND
COMPOSITIQNB AND METHODS EMPLOYING THE RECOMHINANTB
MELD OF THE INVENTION
The present invention relates to poxvirus-canine distemper virus (CDV) recombinants, especially NYVAC-CDV
and ALVAC-CDV recombinants, expression products from such recombinants, compositions, such as an antigenic, immunological or vaccine composition, containing a poxvirus-CDV recombinant or an expression product from 1o such a recombinant; to methods of making and using the poxvirus-CDV recombinant; and, to methods of making and using the composition.
Various publications are cited throughout the following text, with the full citation of these publications appearing in the section headed References.
O
Vaccinia virus and more recently other poxviruses 2o have been used for the insertion and expression of foreign genes. The basic technique of inserting foreign genes into live infectious poxvirus involves recombination between pox DNA sequences flanking a foreign genetic element in a donor plasmid and homologous sequences present in the rescuing poxvirus (Piccini et al., 1987).
Specifically, the recombinant poxviruses are constructed in two steps known in the art and analogous to the methods for creating synthetic recombinants of poxviruses such as the vaccinia virus and avipox virus described in U.S. Patent Nos. 4,769,330, 4,772,848, 4,603,112, 5,100,587, and 5,179,993, First, the DNA gene sequence to be inserted into the virus, particularly an open reading frame from a non-pox source, is placed into an E. cold plasmid construct into which DNA homologous to a section of DNA of the poxvirus has been inserted. Separately, the DNA gene sequence to WO 95127780 2 ~ 8 .~-~ ~ ~ PCTlUS95/04394 be inserted is ligated to a promoter. The promoter-gene linkage is positioned in the plasmid construct so that the promoter-gene linkage is flanked on both ends by DNA
homologous to a DNA sequence flanking a region of pox DNA
containing a nonessential locus. The resulting plasmid construct is then amplified by growth within E. coli bacteria (Clewell, 1972) and isolated (Clewell et al., 1969; Maniatis et al., 1982).
Second, the isolated plasmid containing the DNA gene sequence to be inserted is transfected into a cell culture, e.g. chick embryo fibroblasts, along with the poxvirus. Recombination between homologous pox DNA in the plasmid and the viral genome respectively gives a poxvirus modified by the presence, in a nonessential region of its genome, of foreign DNA sequences. The term "foreign" DNA designates exogenous DNA, particularly DNA
from a non-pox source, that codes for gene products not ordinarily produced by the genome into which the exogenous DNA is placed.
Genetic recombination is in general the exchange of homologous sections of DNA between two strands of DNA.
In certain viruses RNA may replace DNA. Homologous sections of nucleic acid aresections of nucleic acid (DNA or RNA) which have the same sequence of nucleotide bases.
Genetic recombination may take place naturally during the replication or manufacture of new viral genomes within the infected host cell. Thus, genetic recombination between viral genes may occur during the viral replication cycle that takes place in a host cell which is co-infected with two or more different viruses or other genetic constructs. A section of DNA from a .
first genome is used interchangeably in constructing the section of the genome of a second co-infecting virus in which the DNA is homologous with that of the first viral genome.

WO 95127780 ~ ~ PCT/US95/04394 However, recombination can also take place between sections of DNA in different genomes that are not perfectly homologous. If one such section is from a first genome homologous with a section of another genome except for the presence within the first section of, for example, a genetic marker or a gene coding for an antigenic determinant inserted into a portion of the homologous DNA, recombination can still take place and the products of that recombination are then detectable by lD the presence of that genetic marker or gene in the recombinant viral genome. Additional strategies have recently been reported for generating recombinant vaccinia virus.

Successful expression of the inserted DNA genetic sequence by the modified infectious virus requires two conditions. First, the insertion must be into a nonessential region of the virus in order that the modified virus remain viable. The second condition for expression of inserted DNA is the presence of a promoter 2D in the proper relationship to the inserted DNA. The promoter must be placed so that it is located upstream from the DNA sequence to be expressed.

Vaccinia virus has been used successfully to immunize against smallpox, culminating in the worldwide eradication of smallpox in 1980. In the course of its history, many strains of vaccinia have arisen. These different strains demonstrate varying immunogenicity and are implicated to varying degrees with potential complications, the most serious of which are post-vaccinial encephalitis and generalized vaccinia (Behbehani, 1983).

With the eradication of smallpox, a new role for vaccinia became important, that of a genetically . engineered vector for the expression of foreign genes.

Genes encoding a vast number of heterologous antigens have been expressed in vaccinia, often resulting in protective immunity against challenge by the WO 95127780 2 1 8 7 2.0 7 PCTIUS95104394 corresponding pathogen (reviewed in Tartaglia et al., 1990, 1993a).
The genetic background of the vaccinia vector has been shown to affect the protective efficacy of the expressed foreign immunogen. For example, expression of Epstein Barr Virus,(EBV) gp340 in the Wyeth vaccine strain of vaccinia virus did not protect cottontop ' tamarins against EBV virus induced lymphoma, while expression of the same gene in the WR laboratory strain of vaccinia virus was protective (Morgan et al., 1988). .
A fine balance between the efficacy and the safety of a vaccinia virus-based recombinant vaccine candidate is extremely important. The recombinant virus must present the immunogen(s) in a manner that elicits a protective immune response in the vaccinated animal but lacks any significant pathogenic properties. Therefore attenuation of the vector strain would be a highly desirable advance over the current state of technology.
A number of vaccinia genes have been identified which are non-essential for growth of the virus in tissue culture and whose deletion or inactivation reduces virulence in a variety of animal systems.
The gene encoding the vaccinia virus thymidine kinase (TK) has been mapped (Hruby et al., 1982) and sequenced (Hruby et al., 1983; Weir et al., 1983).
Inactivation or complete deletion of the thymidine kinase gene does not prevent growth of vaccinia virus in a wide variety of cells in tissue culture. TK- vaccinia virus is also capable of replication in vivo at the site of inoculation in a variety of hosts by a variety of routes.
It has been shown for herpes simplex virus type 2 that intravaginal inoculation of guinea pigs with TK-virus resulted in significantly lower virus titers in the spinal cord than did inoculation with TK+ virus (Stanberry et al., 1985). It has been demonstrated that herpesvirus encoded TK activity in vitro was not important for virus growth in actively metabolizing W O 95127780 ~ ~ PCT/US95/04394 cells, but was required for virus growth in quiescent cells (Jamieson et al., 1974).

Attenuation of TK' vaccinia has been shown in mice inoculated by the intracerebral and intraperitoneal 5 routes (Buller et al., 1985). Attenuation was observed both for the WR neurovirulent laboratory strain and for the Wyeth vaccine strain. In mice inoculated by the intradermal route, TK' recombinant vaccinia generated equivalent anti-vaccinia neutralizing antibodies as compared with the parental TK+ vaccinia virus, indicating, that in this test system the loss of TK function does not significantly decrease immunogenicity of the vaccinia virus vector. Following intranasal inoculation of mice with TK' and TK+ recombinant vaccinia virus (WR strain), significantly less dissemination of virus to other locations, including the brain, has been found (Taylor et al., 1991a).

Another enzyme involved with nucleotide metabolism is ribonucleotide reductase. Loss of virally encoded 2o ribonucleotide reductase activity in herpes simplex virus (HSV) by deletion of the gene encoding the large subunit was shown to have no effect on viral growth and DNA

synthesis in dividing cells in vitro, but severely compromised the ability of the virus to grow on serum starved cells (Goldstein et al., 1988). Using a mouse model for acute HSV infection of the eye and reactivatable latent infection in the trigeminal ganglia, reduced virulence was demonstrated for HSV deleted of the large subunit of ribonucleotide reductase, compared to 3o the virulence exhibited by wild type HSV (Jacobson et al., 1989).

Both the small (Slabaugh et al., 1988) and large (Schmidtt et al., 1988) subunits of ribonucleotide reductase have been identified in vaccinia virus.

Insertional inactivation of the large subunit of ribonucleotide reductase in the WR strain of vaccinia WO 95!27780 2 ~ g 7 2 0 7 pCTlUS95104394 virus leads to attenuation of the virus as measured by intracranial inoculation of mice (Child et al., 1990).
The vaccinia virus hemagglutinin gene (HA) has been mapped~and sequenced (Shida, 1986). The HA gene of vaccinia virus is nonessential for growth in tissue culture (Ichihashi et al., 1971). Inactivation of the ffiA
gene of vaccinia virus results in reduced neurovirulence ' in rabbits inoculated by the intracranial route and smaller lesions in rabbits at the site of intradermal l0 inoculation (Shida et al., 1988). The fiA locus was used for the insertion of foreign genes in the WR strain (Shida et al., 1987), derivatives of the Lister strain (Shida et al., 1988) and the Copenhagen strain (Guo et al., 1989) of vaccinia virus. Recombinant HA- vaccinia virus expressing foreign genes have been shown to be immunogenic (Guo et al., 1989; Itamura et al., 1990;
Shida et al., 1988; Shida et al., 1987) and protective against challenge by the relevant pathogen (Guo et al., 1989; Shida et al., 1987).
Cowpox virus (Brighton red strain) produces red (hemorrhagic) pocks on the chorioallantoic membrane of chicken eggs. Spontaneous deletions within the cowpox genome generate mutants which produce white pocks (Pickup et al., 1984). The hemorrhagic function (g) maps to a 38 kDa protein encoded by an early gene (Pickup et al., 1986). This gene, which has homology to serine protease inhibitors, has been shown to inhibit the host inflammatory response to cowpox virus (Palumbo et al., 1989) and is an inhibitor of blood coagulation.
The g gene is present in WR strain of vaccinia virus (Kotwal et al., 1989b). Mice inoculated with a WR
vaccinia virus recombinant in which the u_ region has been _ inactivated by insertion of a foreign gene produce higher antibody levels to the foreign gene product compared to mice inoculated with a similar recombinant vaccinia virus in which the ~ gene is intact (Zhou et al., 1990). The ~
region is present in a defective nonfunctional form in R'O 95!27780 218 7 2 0 7 PCT~S9510439J

Copenhagen strain of vaccinia virus (open reading frames B13 and B14 by the terminology reported in Goebel et al., 1990a,b).
Cowpox virus is localized in infected cells in cytoplasmic A type inclusion bodies (ATI) (Kato et al., 1959). The function of ATI is thought to be the protection of cowpox virus virions during dissemination from animal to animal (Bergoin et al., 1971). The ATI
region of the cowpox genome encodes a 160 kDa protein which forms the matrix of the ATI bodies (Funahashi et al., 1988; Patel et al., 1987). Vaccinia virus, though containing a homologous region in its genome, generally does not produce ATI. In WR strain of vaccinia, the ATI
region of the genome is translated as a 94 kDa protein (Pate! et al., 1988). In Copenhagen strain of vaccinia virus, most of the DNA sequences corresponding to the ATI
region are deleted, with the remaining 3~ end of the region fused with sequences upstream from the ATI region to form open reading frame (ORF) A26L (Goebel et al., 1990a,b).
A variety of spontaneous (Altenburger et al., 1989;
Drillien et al., 1981; Lai et al., 1989; Moss et al., 1981; Paez et al., 1985; Panicali et al., 1981) and engineered (Perkus et al.,~ 1991; Perkus et al., 1989;
Perkus et al., 1986) deletions have been reported near the left end of the vaccinia virus genome. A WR strain of vaccinia virus with a 10 kb spontaneous deletion (Moss et al., 1981; Panicali et al., 1981) was shown to be attenuated by intracranial inoculation in mice (Buller et al., 1985). This deletion was later shown to include 17 potential-ORFs (Kotwal et al., 1988). Specific genes within the deleted region include the virokine N1L and a kDa protein (C3L, by the terminology reported in Goebel et al., 1990a,b). Insertional inactivation of N1L
35 reduces virulence by intracranial inoculation for both normal and nude mice (Kotwal et al., 1989a). The 35 kDa protein is secreted like N1L into the medium of vaccinia WO 95127780 PCTlUS95104394 virus infected cells. The protein contains homology to the family of complement control proteins, particularly the complement 4B binding protein (C4bp) (Kotwal et al., 1988). Like the cellular C4bp, the vaccinia 35 kDa protein binds the fourth component of complement and inhibits the classical complement cascade (Kotwal et al., 1990). Thus the vaccinia 35 kDa protein appears to be involved in aiding the virus in evading host defense mechanisms.
The left end of the vaccinia genome includes two genes which have been identified as host range genes, K1L
(Gillard et al., 1986) and C7L (Perkus et al., 1990).
Deletion of both of these genes reduces the ability of vaccinia virus to grow on a variety of human cell lines (Perkus et al., 1990).
Two additional vaccine vector systems involve the use of naturally host-restricted poxviruses, avipoxviruses. Both fowlpoxvirus (FPV) and canarypoxvirus (CPV) have been engineered to express 2o foreign gene products. Fowlpox virus (FPV) is the prototypic virus of the Avipox genus of the Poxvirus family. The virus causes an economically important disease of poultry which has been well controlled since the 1920's by the use of live attenuated vaccines.
Replication of the avipox viruses is limited to avian species (Matthews, 1982) and there are no reports in the literature of avipoxvirus causing a productive infection in any non-avian species including man. This host restriction provides an inherent safety barrier to transmission of the virus to other species and makes use of avipoxvirus based vaccine vectors in veterinary and human applications an attractive proposition. .
FPV has been used advantageously as a vector expressing antigens from poultry pathogens. The hemagglutinin protein of a virulent avian influenza virus was expressed in an FPV recombinant (Taylor et al., 1988a). After inoculation of the recombinant into W095I27780 2 S g 7 2 ~ 7 PCT~S95/04394 chickens and turkeys, an immune response was induced which was protective against either a homologous or a heterologous virulent influenza virus challenge (Taylor et al., 1988a). FPV recombinants expressing the surface glycoproteins of Newcastle Disease Virus have also been developed (Taylor et al., 1990; Edbauer et al., 1990).

Despite the host-restriction for replication of FPV

and CPV to avian systems, recombinants derived from these viruses were found to express extrinsic proteins in cells of nonavian origin. Further, such recombinant viruses were shown to elicit immunological responses directed towards the foreign gene product and where appropriate were shown to afford protection from challenge against the corresponding pathogen (Tartaglia et al., 1993 a,b;

Taylor et al., 1992; 1991b; 1988b).

Canine distemper (CD) is a highly infectious, febrile disease of dogs and other carnivores (reviewed by Fenner, et al., 1987). The mortality rate is high;

ranging between 30 and 80 percent. Dogs surviving often have permanent central nervous system damage (Fenner, et al. 1987). Similarly, measles virus (MV) causes an acute infectious febrile disease characterized by a generalized macropapular eruption. The disease mainly affects children. The established etiology of CD is infection by a member of the Paramyxovirus family; morbillivirus genus known as CD virus (CDV). In general, Paramyxoviruses are enveloped viruses containing a 18-20 kb single-stranded RNA genome of negative polarity. The genome encodes 5 to 7 structural proteins including a fusion (F) and either a hemagglutinin-neuraminidase (HN) or hemagglutinin (HA) glycoprotein. The membrane glycoprotein hemagglutinin (HA), is responsible for hemagglutination and attachment of the virus to the host cell, and the fusion glycoprotein (F), causes membrane fusion between the virus and the infected cell or between the infected and adjacent uninfected cells (Graves et al., 1978). The order of genes in the MV genome has been deduced by R'O 95/27780 PCTIUS95104394 Richardson et al. (1985) and bowling et al. (1986). The nucleotide sequence of the MVHA gene and MVF gene has been determined by Alkhatib and Briedis (1986) and Richardson et al. (1986), respectively. In the case of 5 CDV, both an F and HA glycoprotein are found present in the viral envelope and on the surface of infected cells.
By inference from analyses with other morbillivirus ' members, in particular measles virus, the CDV F and HA
glycoproteins appear important for CDV infectivity and 10 its immunobiology (reviewed by Diallo, 1990). From studies with measles virus, it has been established that the HA and F proteins induce neutralizing antibodies (Norrby et al., 1975). Further, poxvirus-based recombinants expressing the measles HA or F alone or in combination have been shown to elicit protective immune =espouses in mice against MV encephalitis (Drillien et al., 1988; Wild et al., 1990) and in dogs against a lethal CDV challenge (Taylor et al., 1991d; Taylor et al., 1992). Specific to CDV, purified F protein has been shown to provide protection in dogs against CDV challenge (Norrby et al., 1986).
CDV and MV are structurally similar and share a close serological relationship. Immunoprecipitation studies have shown that antiserum to MV will precipitate all CDV proteins (P, NP, F, HA and M). By contrast, antiserum to CDV will precipitate all MV proteins except the HA glycoprotein (Hall et al., 1980; Orvell et al., 1980; Stephenson et al., 1979). In light of this close serological relationship, it has previously been demonstrated that vaccination with MV will elicit protection against CDV challenge in dogs (Gillespie et al., 1960; Moura et al., 1961; Warren et al., 1960).
Neutralizing antibodies against CDV have been reported in human anti-MV sera (Adams et al., 1957; Imagawa et al., , 1960; Karzon, 1955; Karzon, 1962) but neutralizing antibodies against MV have not been found in anti-CDV

WO 95127780 218 7 2 0 7 PCT~S95I0439.J

sera from dogs (Delay et al., 1965; Karzon, 1962;

Roberts, 1965).

Thus, the protection of dogs with MV antigens or with MV antigens expressed by a recombinant poxvirus fails to teach or suggest protection from CDV antigens or from a recombinant poxvirus expressing CDV antigens.

Indeed, heretofore coding sequences for CDV antigens and a recombinant poxvirus containing coding sequences for CDV antigens were not known or suggested.

Presently, vaccination with live, attenuated vaccine strains provides an effective means for controlling canine distemper. However, vaccine-associated complications stemming from the replication competency of these vaccine strains in the vaccinated animal have been documented (Tizard, 1990). It can therefore be appreciated that NYVAC and ALVAC based CDV and/or MV

recombinants, not heretofore taught or suggested, provide a means for eliminating the deliberate introduction of live, modified CDV or MV into the environment while providing safe and efficacious means for expressing CDV

or MV gene products from the expression thereof and antigenic, immunological or vaccine compositions.

O$JECTS AND SUDf3ARY OF INVENTION

It is therefore an object of this invention to provide modified recombinant viruses, which viruses have enhanced safety, and to provide a method of making such recombinant viruses.

It is an additional object of this invention to provide a recombinant poxvirus antigenic, immunological or vaccine composition having an increased level of safety compared to known recombinant poxvirus vaccines, or antigenic or immunological compositions.

It is a further object of this invention to provide a modified vector for expressing a gene product in a host, wherein the vector is modified so that it has attenuated virulence in the host.

77354-69(S) It is another object of this invention to provide a method for expressing a gene product in a cell cultured in vitro using a modified recombinant virus or modified vector having an increased level of safety.
These and other objects and advantages of the present invention will become more readily apparent after consideration of the following.
In one aspect, the present invention relates to a modified recombinant virus having inactivated virus-encoded genetic functions so that the recombinant virus has attenuated virulence and enhanced safety. The functions can be non-essential, or associated with virulence. The virus is advantageously a poxvirus, particularly a vaccinia virus or an avipox virus, such as fowlpox virus and canarypox virus.
The modified recombinant virus can include, within a non-essential region of the virus genome, a heterologous DNA
sequence which encodes an antigenic protein, e.g., derived from a pathogen, such a Morbillivirus, preferably CDV or MV.
Accordingly, there is provided a recombinant modified poxvirus wherein said modified poxvirus has deleted therefrom or disrupted therein the thymidine kinase gene J2R, the hemorrhagic region genes B13R and B14R, the A type inclusion body gene A26L, the hemagglutinin gene A56R, the host range region C7L-K1L, and the large subunit ribonucleotide reductase gene I4L, or said modified poxvirus is NYVAC, or a poxvirus having all of the identifying characteristics of NYVAC, said modified poxvirus further comprising exogenous DNA in a nonessential region of the virus genome, said exogenous DNA encoding at least one antigen selected from the group consisting of canine distemper virus fusion protein, canine distemper virus 77354-69(S) 12a hemagglutinin glycoprotein, canine distemper nucleocapsid protein, canine distemper matrix protein, measles virus nucleocapsid protein and measles virus matrix protein.
In another aspect, the present invention relates to a vaccine for inducing an antigenic response in a host animal inoculated with an antigenic or immunological composition vaccine, said composition including a carrier and a modified recombinant virus having inactivated nonessential virus-encoded genetic functions so that the recombinant virus has attenuated virulence and enhanced safety. The virus used in the vaccine antigenic or immunological composition according to the present invention is advantageously a poxvirus, particularly a vaccinia virus or an avipox virus, such as fowlpox virus and canarypox virus. The modified recombinant virus can include, within a non-essential region of the virus genome, a heterologous DNA sequence which encodes an antigenic protein, e.g., derived from a pathogen, such as Morbillivirus, preferably CDV or MV.
According to another aspect of the present invention, there is provided a use for inducing an antigenic or immunological response in a dog or other carnivore against canine distemper virus of a composition comprising a virus as described above in admixture with a suitable carrier.
In yet another aspect, the present invention relates to an immunogenic composition containing a modified WO 95127780 ~ ~ PCTJIJS95I0439d recombinant virus having inactivated nonessential virus-encoded genetic functions so that the recombinant virus has attenuated virulence and enhanced safety. The modified recombinant virus includes, within a non-- 5 essential region of the virus genome, a heterologous DNA

sequence which encodes an antigenic protein (e. g., derived from a pathogen, such as Morbillivirus, preferably CDV or MV) wherein the composition, when administered to a host, is capable of inducing an l0 immunological response specific to the protein encoded by the pathogen.

In a further aspect, the present invention relates to a method for expressing a gene product in a cell cultured in vitro by introducing into the cell a modified 15 recombinant virus having attenuated virulence and enhanced safety. The modified recombinant virus can include, within a non-essential region of the virus genome, a heterologous DNA sequence which encodes an antigenic protein, e.g., from a pathogen, such as 20 Morbillivirus, preferably CDV or MV.

In a still further aspect, the present invention relates to a modified recombinant virus having nonessential virus-encoded genetic functions inactivated therein so that the virus has attenuated virulence, and 25 wherein the modified recombinant virus further contains DNA from a heterologous source in a nonessential region of the virus genome. The DNA codes for an antigen, of Morbillivirus, preferably CDV or MV, and, more preferably, codes for the F and/or HA antigens of CDV

30 and/or the M and/or N antigens of CDV or MV. In particular, the genetic functions are inactivated by deleting an open reading frame encoding a virulence factor or by utilizing naturally host restricted viruses.

The virus used according to the present invention is r 35 advantageously a poxvirus, particularly a vaccinia virus or an avipox virus, such as fowlpox virus and canarypox virus. Advantageously, the open reading frame is WO 95!27780 PCT/US95/04394 selected from the group consisting of J2R, B13R + B14R, A26L, A56R, C7L - R1L, and I4L (by the terminology reported in Goebel et al., 1990a,b); and, the combination thereof. In this respect, the open reading frame comprises a thymidine kinase gene, a hemorrhagic region, -an A type inclusion body region, a hemagglutinin gene, a host range gene region or a large subunit, ribonucleotide reductase; or, the combination thereof. The modified Copenhagen strain of vaccinia virus is identified as NYVAC (Tartaglia et al., 1992).
The antigenic, immunological or vaccine composition preferably elicits Morbillivirus neutralizing antibodies, hemagglutination-inhibiting antibodies and protective immunity against Morbillivirus, especially CDV, and especially in dogs. The expression products of the recombinants and antibodies elicited thereby can be used in binding assays to determine the presence or absence of CDV or MV in a sample; and, DNA from the recombinants can be used for preparing DNA probes and primers.
Other objects and embodiment of the invention are disclosed in or obvious from the following detailed description.
DESCRIPTION OF TH
The following detailed description, given by way of example, but not intended to limit the invention solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings, in which:
FIG. 1 schematically shows a method for the construction of plasmid pSD460 for deletion of thymidine kinase gene and generation of recombinant vaccinia virus vP410;
FIG. 2 schematically shows a method for the construction of plasmid pSD486 f.or deletion of hemorrhagic region and generation of recombinant vaccinia virus vP553;

0 7 '.. PCTlUS95104394 FIG. 3 schematically shows a method for the constructian of plasmid pMP494~ for deletion of ATI

region and generation of recombinant vaccinia virus vP618;

FIG. 4 schematically shows a method for the construction of plasmid pSD467 for deletion of hemagglutinin gene and generation of recombinant vaccinia virus vP723;

FIG. 5 schematically shows a method for the construction of plasmid pMPCKI~ for deletion of gene cluster [C7L - K1L] and generation of recombinant vaccinia virus vP804;

FIG. 6 schematically shows a method for the construction of plasmid pSD548 for deletion of large subunit, ribonucleotide reductase and generation of recombinant vaccinia virus vP866 (NYVAC);

FIG. 7 schematically shows a method for the construction of plasmid pRW842 for insertion of rabies glycoprotein G gene into the TK deletion locus and generation of recombinant vaccinia virus vP879;

FIG. 8 shows the DNA sequence (SEQ ID N0:39) of a canarypox PvuII fragment containing the C5 ORF.

FIGS. 9A and 9B schematically show a method for the construction of recombinant canarypox virus vCP65 (ALVAC-RG) ;

FIG. 10 shows schematically the ORFs deleted to generate NYVAC;
FIG. 11 shows the nucleotide sequence (SEQ ID N0:48) of a fragment of TROVAC DNA containing an FS ORF;
FIG. 12 shows the DNA sequence (SEQ ID N0:51) of a 2356 base pair fragment of TROVAC DNA containing the F7 ORF;
FIGS. 13A to 13D show graphs of rabies neutralizing antibody titers (RFFIT, IU/ml), booster effect of HDC and vCP65 (105'5 TCID50) in volunteers previously immunized with either the same or the alternate vaccine (vaccines given at days 0, 28 and 180, antibody titers measured at days 0, 7, 28, 35, 56, 173, 187 and 208);
FIGS. 14A-D show the nucleotide sequence of H6 promoted CDV HA and CDV HA translation (SEQ ID N0:83);
FIGS. 15A-D show the nucleotide sequence of H6 promoted CDV F and CDV F translation (SEQ ID N0:86);
FIGS. 16A-G show the nucleotide sequence derived from plasmid pMM126 of the H6 promoted canine distemper virus (CDV) F, H6 promoted CDV HA, NYVAC sequences flanking I4L, and translations of CDV open reading frames (SEQ ID NOS:91, 92);
FIGS. 17A-G show the predicted nucleotide sequence of the H6 promoted canine distemper virus (CDV) F, H6 promoted CDV HA, ALVAC sequences flanking C6, and translations of CDV open reading frames (SEQ ID NOS: 93, 94);
FIG. 18 shows the nucleotide sequence of the CDV N
gene (SEQ ID N0:125);
FIG. 19 shows the nucleotide sequence of the CDV M
gene (SEQ ID N0:130);
FIG. 20 shows the nucleotide sequence of the MV N
gene (SEQ ID N0:134); and, FIG. 21 shows the nucleotide sequence of the MV M
gene (SEQ ID N0:139).
DETAILED DEBCRIPTION OF THE INVENTION
To develop a new vaccinia vaccine strain, NYVAC
(vP866), the Copenhagen vaccine strain of vaccinia virus was modified by the deletion of six nonessential regions of the genome encoding known or potential virulence factors. The sequential deletions are detailed below.
All designations of vaccinia restriction fragments, open reading frames and nucleotide positions are based on the , terminology reported in Goebel et al., 1990a,b.
The deletion loci were also engineered as recipient loci for the insertion of foreign genes.
fihe regions deleted in NYVAC are listed below. Also listed are the abbreviations and open reading frame 77354-69(S?

designations for the deleted regions (Goebel et al., 1990a,b) and the designation of the vaccinia recombinant (vP) containing all deletions through the deletion specified:
(1) thymidine kinase gene (TK; J2R) vP410;
(2) hemorrhagic region (g; H13R + 814R) vP553;
(3) A type inclusion body region (ATI; A26L) vP618;
(4) hemagglutinin gene (HA; A56R) vP723;
(5) host range' gene region (C7L - KiL) vP804; and (6) large subunit, ribonucleotide reductase (I4L) vP866 (NYVAC).
NYVAC is a genetically engineered vaccinia virus strain that was generated by the specific deletion of eighteen open reading frames encoding gene products associated with virulence and host range. NYVAC is highly attenuated by a number of criteria including i) decreased virulence after intracerebral inoculation in newborn mice, ii) inocuity in genetically (~+JDy+) or chemically (cyclophosphamide) immunocompromised mice, iii) failure to cause disseminated infection in immunocompromised mice, iv) lack of significant induration and ulceration on rabbit skin, v) rapid clearance from the site of inoculation, and vi) greatly reduced replication competency on a number of tissue culture cell lines including those of human origin.
Nevertheless, NYVAC based vectors induce excellent responses to extrinsic immunogens and provided protective inm~unity.
TROVAC refers to an attenuated fowlpox that was a plaque-cloned isolate derived from the FP-1 vaccine strain of fowlpoxvirus which is licensed for vaccination of 1 day old chicks. ALVAC is an attenuated canarypox virus-based vector that was a plaque-cloned derivative of the licensed canarypox vaccine, KanapoX (Tartaglia et al., 1992). ALVAC has some general properties which are the same as some general properties of Kanapox. ALVAC-based recombinant viruses expressing extrinsic immunogens *Trade-mark have also been demonstrated efficacious as vaccine vectors (Tartaglia et al., 1993 a,b). This avipox vector is restricted to avian species for productive replication. On human cell cultures, canarypox virus replication is aborted early in the viral replication cycle prior to viral DNA synthesis. Nevertheless, when engineered to express extrinsic immunoqens, authentic ' expression and processing is observed in vitro in mammalian cells and inoculation into numerous mammalian species induces antibody and cellular immune responses to the extrinsic immunogen and provides protection against challenge with the cognate pathogen (Taylor et al., 1992;
Taylor et al., 1991c). Recent Phase I clinical trials in both Europe and the United States of a canarypox/rabies glycoprotein recombinant (ALVAC-RG) demonstrated that the experimental vaccine was well tolerated and induced protective levels of rabiesvirus neutralizing antibody titers (Cadoz et al., 1992; Fries et al., 1992).
Additionally, peripheral blood mononuclear cells (PBMCs) derived from the ALVAC-RG vaccinates demonstrated significant levels of lymphocyte proliferation when stimulated with purified rabies virus (Fries et al., 1992).
Accordingly, NYVAC, ALVAC and TROVAC are preferred vectors for insertion of coding for Morbillivirus antigens, especially CDV antigens and, preferably coding for CDV F and/or HA and/or CDV or MV M and/or N. In the vaccine, antigenic or immunological compositions, the recombinant poxvirus according to the invention is preferably in admixture with a suitable carrier, diluent or excipient such as sterile water, physiological saline, glucose or the like.
More generally, the inventive antigenic, immunological or vaccine compositions (compositions containing the poxvirus recombinants of the invention) can be prepared in accordance with standard techniques well known to those skilled in the pharmaceutical or WO 95!27780 218 7 2 ~
Z PCT~S9510439d veterinary art. Such compositions can be administered to an animal or human patient in need of such administration in dosages and by techniques well known to those skilled in the medical or veterinary arts taking into consideration such factors as the age, sex, weight, and condition of the particular human or animal patient, and the route of administration.

Examples of compositions of the invention include liquid preparations for orifice, e.g., oral, nasal, anal, vaginal, etc., administration such as suspensions, syrups or elixirs; and, preparations for parental, subcutaneous, intradermal, intramuscular or intravenous administration (e. g., injectable administration) such as sterile suspensions or emulsions. In such compositions the recombinant poxvirus may be in admixture with a suitable carrier, diluent, or excipient, such as sterile water, physiological saline, glucose or the like.

The administration procedure for recombinant virus compositions of the invention such as immunological, 2o antigenic or vaccine compositions can be via a parental route (intradermal, intramuscular or subcutaneous). Such an administration enables a systemic immune response.

Other routes of administration can be oral, nasal, anal, vaginal, etc. Solidified compositions such as edibles, e.g., recombinant poxvirus infected foodstuff, or suppositories are also compositions of the invention and are prepared by techniques known in the veterinary and pharmaceutical arts.

Further, the products of expression of the inventive 3o recombinant poxviruses can be used directly to stimulate an immune response in individuals or in animals. Thus, the expression products can be used in compositions of the invention instead or in addition to the inventive recombinant poxvirus in the aforementioned compositions.

Additionally, the inventive recombinant poxvirus and the expression products therefrom stimulate an immune or antibody response in humans and animals. From those 77354-69(S) antibodies or by techniques well-known in the art, monoclonal antibodies can be prepared and, those monoclonal antibodies, can be employed in well-known antibody binding assays, diagnostic kits or tests to 5 determine the presence or absence of particular Morbillivirus antigens) and therefore the presence or absence of the virus, or to determine whether an immune response to the virus or antigens) has simply been stimulated. Those monoclonal antibodies can also be 10 employed in immunoadsorption chromatography to recover immunodeficiency virus or expression products of the inventive recombinant poxvirus.
Monoclonal antibodies are immunoglobulins produced by hybridoma cells. A monoclonal antibody reacts with a 15 single antigenic determinant and provides greater specificity than a conventional, serum-derived antibody.
Furthermore, screening a large number of monoclonal antibodies makes it possible to select an individual antibody with desired specificity, avidity and isotype.
20 Hybridoma cell lines provide a constant inexpensive source of chemically identical antibodies and preparations of such antibodies can be easily standardized. Methods for producing monoclonal antibodies are well-known to those of ordinary skill in the art, e.g., Roprowski, H. et al., U.S. Patent No.
4,196,265, issued April 1, 1989, incorporated herein by reference.
Uses of monoclonal antibodies are known. One such use is in diagnostic methods, e.g.,~ David, G. and Greene, H., U.S. Patent No. 4,376,110, issued March 8, 1983;
incorporated herein by reference. Monoclonal antibodies have also been used to recover materials by immunoadsorption chromatography, e.g., Milstein, C., 1980, Scientific American 243:66, 70.
Additionally, the DNA from inventive recombinants can be used as probes to detect the presence of Morbillivirus DNA in a sample or, to generate PCR

primers, by methods known in the art.

Accordingly, the inventive recombinant poxvirus has several utilities: In antigenic, immunological or vaccine compositions such as for administration to seronegative animals or individuals. in vitro to produce antigens which can be further used in antigenic, immunological or vaccine compositions or in therapeutic compositions. To generate antibodies (either by direct administration or by administration of an expression product of the inventive recombinant poxvirus) which can be further used: in diagnosis, tests or kits to ascertain the presence or absence of antigens in a sample such as sera, for instance, to ascertain the presence or absence of Morbillivirus in a sample such as sera or, to determine whether an immune response has elicited to the virus or, to particular antigen(s); or, in immunoadsorption chromatography. And, to generate DNA

for use as hybridization probes or to prepare PCR

primers. Other utilities also exist for embodiments of the invention.

A better understanding of the present invention and of its many advantages will be had from the following examples, given by way of illustration.

L~gAMPLEB

pNA 07onina and Synthesis. Plasmids were constructed, screened and grown by standard procedures (Maniatis et al., 1982; Perkus et al., 1985; Piccini et al., 1987). Restriction endonucleases were obtained from Bethesda Research Laboratories, Gaithersburg, MD, New England Biolabs, Beverly, MA; and Boehringer Mannheim Biochemicals, Indianapolis, IN. Rlenow fragment of E.

coli polymerase was obtained from Boehringer Mannheim Biochemicals. BAL-31 exonuclease and phage T4 DNA ligase were obtained from New England Biolabs. The reagents were used as specified by the various suppliers.

77354-69 (S) Synthetic oligodeoxyribonucleotides were prepared on a Hiosearch 8750 or Applied Hiosystems 3808 DNA
synthesizer as previously described (Perkus et al., 1989). DNA sequencing was performed by the dideoxy-chain termination method (Sanger et al., 1977) using Sequenase (Tabor et al., 1987) as previously described (Guo et al., 1989). DNA amplification by polymerase chain reaction (PCR) for sequence verification (Engelke et al., 1988) was performed using, custom synthesized oligonucleotide primers and GeneAmp DNA amplification Reagent Kit (Perkin Elmer Cetus, Norwalk, CT) in an automated Perkin Elmer Cetus DNA Thermal Cycler. Excess DNA sequences were deleted from plasmids by restriction endonuclease digestion followed by limited digestion by BAL-31 exonuclease and mutagenesis (Mandecki, 1986) using synthetic oligonucleotides.
Ce~.l$,, Virus . end Transfegtion. Tie origins and conditions of cultivation of the Copenhagen strain of vaccinia virus has been previously described (Guo et al., 1989). Generation of recombinant virus by recombination, fn sf to hybridization of nitrocellulose filters and screening for H-galactosidase activity are as previously described (Piccini et al., 1987).
The origins and conditions of cultivation of the Copenhagen strain of vaccinia virus and NYVAC has been previously described (Guo et al., 1989; Tartaglia et al., 1992). Generation of recombinant virus by recombination, in situ hybridization of nitrocellulose filters and screening for B-galactosidase activity are as previously described (Panicali et al., 1982; Perkus et al., 1989).
The parental canarypox virus (Rentschler strain) is a vaccinal strain for canaries. The vaccine strain was obtained from a wild type isolate and attenuated through more than 200 serial passages on chick embryo fibroblasts. A master viral seed was subjected to four successive plaque purifications under agar and one plaque clone was amplified through five additional passages *Trade-mark WO 95127780 ~ PCT/I7S95/04394 after which the stock virus was used as the parental virus in in vitro recombination tests. The plaque purified canarypox isolate is designated ALVAC.
The strain of fowlpox virus (FPV) designated FP-1 has been described previously (Taylor et al., 1988a). It is an attenuated vaccine strain useful in vaccination of day old chickens. The parental virus strain Duvette was obtained in France as a fowlpox scab from a chicken. The virus was attenuated by approximately 50 serial passages in chicken embryonated eggs followed by 25 passages on chicken embryo fibroblast cells. The virus was subjected to four successive plaque purifications. One plaque isolate was further amplified in primary CEF cells and a stock virus, designated as TROVAC, established.
NYVAC, ALVAC and TROVAC viral vectors and their derivatives were propagated as described previously (Piccini et al., 1987; Taylor et al., 1988a,b). Vero cells and chick embryo fibroblasts (CEF) were propagated as described previously (Taylor et al., 1988a,b).
Example 1 CONSTRUCTION OF PLASMID pSD460 FOR
DELETION OF THYMIDINE RINA88 GENE (J2R) Referring now to FIG. 1, plasmid pSD406 contains vaccinia ~j,y~'ndIII J (pos. 83359 - 88377) cloned into pUC8.
pSD406 was cut with dIII and vuII, and the 1.7 kb fragment from the left side of indIII J cloned into pUC8 cut with ~gdIII/SmaI, forming pSD447. pSD447 contains the entire gene for J2R (pos. 83855 - 84385). The initiation codon is contained within an NIaIII site and the termination codon is contained within an SsvI site.
Direction of transcription is indicated by an arrow in FIG. 1.
To obtain a left flanking arm, a 0.8 kb dIII/ coRI fragment was isolated from pSD447, then digested with VIII and a 0.5 kb ~dIII/NIaIII fragment isolated. Annealed synthetic oligonucleotides MPSYN43/MPSYN44 (SEQ ID NO:1/SEQ ID N0:2) 218 7 2 0 7 pCT/US95104394 Smal MPSYN43 5' TAATTAACTAGCTACCCGGG 3' MPSYN44 3' GTACATTAATTGATCGATGGGCCCTTAA 5' VIII ~qRI
were ligated with the 0.5 kb ~dIII/~III fragment into pUCl8 vector plasmid cut with ~dIII/~oRI, generating plasmid pSD449.
To obtain a restriction fragment containing a to vaccinia right flanking arm and pUC vector sequences, pSD447 was cut with ~I (partial) within vaccinia sequences and jdIII at the pUC/vaccinia junction, and a 2.9 kb vector fragment isolated. This vector fragment was ligated with annealed synthetic oligonucleotides 15. MPSYN45/MPSYN46 (SEQ ID N0:3/SEQ ID N0:4) HindIII SmaI
MPSYN45 5' AGCTTCCCGGGTAAGTAATACGTCAAGGAGAAAACGAA
MPSYN46 3' AGGGCCCATTCATTATGCAGTTCCTCTTTTGCTT
a o Notl ~pI
ACGATCTGTAGTTAGCGGCCGCCTAATTAACTAAT 3' MPSYN45 TGCTAGACATCAATCGCCGGCGGATTAATTGATTA 5' MPSYN46 generating pSD459.
25 To combine the left and right flanking arms into one plasmid, a 0.5 kb ~dIII/~I fragment was isolated from pSD449 and ligated with pSD459 vector plasmid cut with ~,gdIII/smaI, generating plasmid pSD460. pSD460 was used as donor plasmid for recombination with wild type 30 parental vaccinia virus Copenhagen strain VC-2. 32P
labelled probe was synthesized by primer extension using MPSYN45 (SEQ ID N0:3) as template and the complementary 20mer oligonucleotide MPSYN47 (SEQ ID NO:5) (5' TTAGTTAATTAGGCGGCCGC 3') as primer. Recombinant virus 35 vP4lo was identified by plaque hybridization.
ExamplA 22 - CONSTRUCTION OF PLABMID p8D486 FOR
DELETION OF HEMORRHAGIC REGION (B13R +
814R) 40 Referring now to FIG. 2, plasmid pSD419 contains , vaccinia ~,1I G (pos. 160,744-173,351) cloned into pUC8.
pSD422 contains the contiguous vaccinia S.a.lI fragment to the right, ,~1I J (pos. 173,351-182,746) cloned into WO 95127780 218 7 2 ~J ~ fCT~595/04394 pUC8. To construct a plasmid deleted for the hemorrhagic region, u, 8138 - B14R (pos. 172,549 - 173,552), pSD419 was used as the source for the left flanking arm and pSD422 was used as the source of the right flanking arm.

5 The direction of transcription for the ~ region is indicated by an arrow in FIG. 2.

To remove unwanted sequences from pSD419, sequences to the left of the ~rgI site (pos. 172,253) were removed by digestion of pSD419 with NcoI/S.maI followed by blunt 1o ending with Klenow fragment of E. coli polymerase and ligation generating plasmid pSD476. A vaccinia right flanking arm was obtained by digestion of pSD422 with ~I at the termination codon of B14R and by digestion with ~I 0.3 kb to the right. This 0.3 kb fragment was 15 isolated and ligated with a 3.4 kb ~cII vector fragment isolated from pSD476, generating plasmid pSD477. The location of the partial deletion of the vaccinia _u region in pSD477 is indicated by a triangle. The remaining B13R

coding sequences in pSD477 were removed by digestion with 20 ~I/~a_I, and the resulting vector fragment was ligated with annealed synthetic oligonucleotides SD22mer/SD2omer (SEQ ID N0:6/SEQ ID N0:7) ~I CHI ~I .

SD22mer 5' CGATTACT~GAAGGATCCGTT 3' 25 SD20mer 3' TAATGATACTTCCTAGGCAA 5' generating pSD479. pSD479 contains an initiation codon (underlined) followed by a g~FII site. To place E. coli Beta-galactosidase in the B13-B14 (u) deletion locus under the control of the a promoter, a 3.2 kb CHI

fragment containing the Beta-galactosidase gene (Shapira et al., 1983) was inserted into the CHI site of pSD479, generating pSD479BG. pSD479BG was used as donor plasmid for recombination with vaccinia virus vP410. Recombinant vaccinia virus vP533 was isolated as a blue plaque in the ' presence of chromogenic substrate X-gal. In vP533 the B13R-B14R region is deleted and is replaced by Beta-galactosidase.

WO 95!27780 ~ PCT/US95104394 To remove Beta-galactosidase sequences from vP533, plasmid pSD486, a derivative of pSD477 containing a polylinker region but no initiation codon at the u_ deletion junction, was utilized. First the ~aI/i~aI
vector fragment from pSD477 referred to above was ligated with annealed synthetic oligonucleotides SD42mer/SD40mer (SEQ ID N0:8/SEQ ID N0:9) ~I SacI ~I j~I
SD42mer 5' CGATTACTAGATCTGAGCTCCCCGGGCTCGAGGGATCCGTT
3' SD40mer 3' TAATGATCTAGACTCGAGGGGCCCGAGCTCCCTAGGCAA
5' $g],II maI CHI
generating plasmid pSD478. Next the coRI site at the pUC/vaccinia junction was destroyed by digestion of pSD478 with SRI followed by blunt ending with Klenow fragment of E. coli polymerase and ligation, generating plasmid pSD478E-. pSD478E- was digested with $amHI and ~aIand ligated with annealed synthetic oligonucleotides HEMS/HEM6 (SEQ ID NO:10/SEQ-ID NO:11) BamHI SRI Hp~I
HEM5 5' GATCCGAATTCTAGCT 3' HEM6 3' GCTTAAGATCGA 5' generating plasmid pSD486. pSD486 was used as donor plasmid for recombination with recombinant vaccinia virus vP533, generating vP553, which was isolated as a clear plaque in the presence of X-gal.
a 3 - CONSTRUCTION OF PLASMID pMP494d FOR DELETION OF ATI REGION fA26L) Referring now to FIG. 3, pSD414~contains S.aII B
cloned into pUC8. To remove unwanted DNA sequences to the left of the A26L region, pSD414 was cut with ~I
within vaccinia sequences (pos. 137,079) and with dIII -at the pUC/vaccinia junction, then blunt ended with Rlenow fragment of E. coli polymerase and ligated, .
resulting in plasmid pSD483. To remove unwanted vaccinia DNA sequences to the right of the A26L region, pSD483 was cut with coRI (pos. 140,665-and at the pUC/vaccinia WO 95127780 2 ~ g ~ 2 ~ ~ PCT/US951Od394 junction) and ligated, forming plasmid pSD484. To remove the A26L coding region, pSD484 was cut with NdgI
(partial) slightly upstream from the A26L ORF (pos.
139,004) and with ~aI (pos. 137,889) slightly downstream from the A26L ORF. The 5.2 kb vector fragment was isolated and ligated with annealed synthetic oligonucleotides ATI3/ATI4 (SEQ ID N0:12/SEQ ID N0:13) T eI
ATI3 5' TATGAGTAACTTAACTCTTTTGTTAATTAAAAGTATATTCAAAAAATAAGT
ATI4 3' ACTCATTGAATTGAGAAAACAATTAATTTTCATATAAGTTTTTTATTCA
III EcQRI ~I
TATATAAATAGATCTGAATTCGTT 3' ATI3 ATATATTTATCTAGACTTAAGCAA 5' ATI4 reconstructing the region upstream from A26L and replacing the A26L ORF with a short polylinker region containing the restriction sites ~c_1II, EcoRI and Hnal, as indicated above. The resulting plasmid was designated pSD485. Since the ~c_lII and coRI sites in the polylinker region of pSD485 are not unique, .unwanted $g~II and SRI sites were removed from plasmid pSD483 (described above) by digestion with B~II (pos. 140,136) and with ~cqRI at the pUC/vaccinia junction, followed by blunt ending with Klenow fragment of E. coli polymerase and ligation. The resulting plasmid was designated pSD489. The 1.8 kb ~aI (pos. 137,198)/EcoRV (pos.
139,048) fragment from pSD489 containing the A26L ORF was replaced with the corresponding 0.7 kb polylinker-containing C aI/ coRV fragment from pSD485, generating pSD492. The III and ~cc RI sites in the polylinker region of pSD492 are unique.
A 3.3 kb Bg~II cassette containing the E. coli Beta-galactosidase gene (Shapira et al., 1983) under the - 35 control of the vaccinia 11 kDa promoter (Bertholet et al., 1985; Perkus et al., 1990) was inserted into the III site of pSD492, forming pSD493KBG. Plasmid pSD493KBG was used in recombination with rescuing virus vP553. Recombinant vaccinia virus, vP581, containing Beta-galactosidase in the A26L deletion region, was isolated as a blue plaque in the presence of X-gal.
To generate a plasmid for the removal of Beta-galactosidase sequences from vaccinia recombinant virus vP581, the polylinker region of plasmid pSD492 was deleted by mutagenesis (Mandecki, 1986) using synthetic oligonucleotide MPSYN177 (SEQ ID N0:14) (5' AAAATGGGCGTGGATTGTTAACTTTATATAACTTATTTTTTGAATATAC
3'). In the resulting plasmid, pMP494~, vaccinia DNA
encompassing positions [137,889 - 138,937], including the entire A26L ORF is deleted. Recombination between the pMP494A and the Beta-galactosidase containing vaccinia recombinant, vP581, resulted in vaccinia deletion mutant vP618, which was isolated as a clear plaque in the presence of X-gal.
E$ample 4 - CONSTRUCTION OF PLASNID pSD467 FOR
nFrFT=ON OF HEMAGGLUTININ GENE (A56RD
Referring now to FIG. 4, vaccinia ~I G restriction fragment (pos. 160,744-173,351) crosses the ~dIII A/B
junction (pos. 162,539). pSD419 contains vaccinia ,~I G
cloned into pUC8. The direction of transcription for the hemagglutinin (HA) gene is indicated by an arrow in FIG.
4. Vaccinia sequences derived from ~dIII B were removed by digestion of pSD419 with ~gdIII within vaccinia sequences and at the pUC/vaccinia junction followed by ligation. The resulting plasmid, pSD456, contains the HA gene, A56R, flanked by 0.4 kb of vaccinia sequences to the left and 0.4 kb of vaccinia sequences to the right. A56R coding sequences were removed by cutting pSD456 with saI (partial; pos. 161,090) upstream from A56R coding sequences, and with ~agI (pos. 162,054) near the end of the gene. The 3.6 kb ~s I/Eaal vector fragment from pSD456 was isolated and ligated with annealed synthetic oligonucleotides MPSYN59 (SEQ ID , NO:15), MPSYN62 (SEQ ID N0:16), MPSYN60 (SEQ ID N0:17), and MPSYN61 (SEQ ID N0:18) WO 95/27780 2 7 8 7 2 0 7 PCTlUS95/04394 $~I
MPSYN59 5' ACACGAATGATTTTCTAAAGTATTTGGAAAGTTTTATAGGT-MPSYN62 3' TGTGCTTACTAAAAGATTTCATAAACCTTTCAAAATATCCA-MPSYN59 AGTTGATAGAACAAAATACATAATTT 3' I MPSYN62 TCAACTATCT 5' MPSYN60 5' TGTAAAAATAAATCACTTTTTATA
MPSYN61 3' TGTTTTATGTATTAAAACATTTTTATTTAGTGAAAAATAT
~lII SCI ~I ~gI
MPSYN60 CTAAGATCTCCCGGGCTGCAGC 3~
MPSYN61 GATTCTAGAGGGCCCGACGTCGCCGG 5' reconstructing the DNA sequences upstream from the A56R
ORF and replacing the A56R ORF with a polylinker region as indicated above. The resulting plasmid is pSD466.
The vaccinia deletion in pSD466 encompasses positions [161,185-162,053). The site of the deletion in pSD466 is indicated by a triangle in FIG. 4.

A 3.2 kb c~II/BamHI (partial) cassette containing the E. coli Beta-galactosidase gene (Shhpira et al., 1983) under the control of the vaccinia 11 kDa promoter (Bertholet et al., 1985; Guo et al., 1989) was inserted into the III site of pSD466, forming pSD466KBG.

Plasmid pSD466KBG was used in recombination with rescuing virus vP618. Recombinant vaccinia virus, vP708, containing Beta-galactosidase in the A56R deletion, was isolated as a blue plaque in the presence of X-gal.
Beta-galactosidase sequences were deleted from vP708 using donor plasmid pSD467. pSD467 is identical to pSD466, except that ,~oR2, Smal and ~I sites were removed from the pUC/vaccinia junction by digestion of pSD466 with ~,goRI/~gii2 followed by blunt ending with Klenow fragment of E. coli polymerise and ligation.

Recombination between vP708 and pSD467 resulted in recombinant vaccinia deletion mutant, vP723, which was isolated as a clear plaque in the presence of X-gal.

Example 5 - CONSTRUCTION OF PLASMID pMPC8R10 FOR
DFLFTTON OF OPEN READING FRAMES fC7L-R1L1 Referring now to FIG. 5, the following vaccinia 5 clones were utilized in the construction of pMPCSKl~.
pSD420 is ~I H cloned into pUC8. -pSD435 is--~nI F
cloned into pUCl8. pSD435 Was cut with ~I and -religated, forming pSD451. In pSD451, DNA sequences to the left of the ~I site (pos. 27,416) in '~ndIII M are 10 removed (Perkus et al., 1990). pSD409 is #jj,NdIII M
cloned into pUC8.
To provide a substrate for the deletion of the [C7L-KiL] gene cluster from vaccinia, E. colt Beta-galactosidase was first inserted into the vaccinia M2L
15 deletion locus (Guo et al., 1990) as follows: To eliminate the III site in pSD409, the plasmid was cut with ~gllI in vaccinia sequences (pos. 28,212) and with CHI at the pUC/vaccinia junction, then ligated to form plasmid pMP409B. pMP409B was cut at the unique SohI site 20 (pos. 27,416). M2L coding sequences were removed by mutagenesis (Guo et al., 1990; Mandecki, 1986) using synthetic oligonucleotide $g~I I
MPSYN82 (SEQ ID N0:19) 5'.TTTCTGTATATTTGCACCAATTTAGATCTT-25 ACTCAAAATATGTAACAATA 3' The resulting plasmid, pMP409D, contains a unique III
site inserted into the M2L deletion locus as indicated above. A 3.2 kb BamHI (partial)/Bg~II cassette 30 containing the .E. colt Beta-galactosidase gene (Shapira et al., 1983) under the control of the il kDa promoter (Bertholet et al., 1985) was inserted into pMP409D cut with ~gll2. The resulting plasmid, pMP409DBG (GL10 et al., 1990), was used as donor plasmid for recombination with rescuing vaccinia virus vP723. Recombinant vaccinia ' virus, vP784, containing Beta-galactosidase inserted into the M2L deletion locus, was isolated as a blue plaque in the presence of-X-gal.
A plasmid deleted for vaccinia genes [C7L-K1L] was assembled in pUC8 cut with Sm~I, indIII and blunt ended WO 95!27780 PCT/ITS95I04394 with Klenow fragment of E, coli polymerase. The left flanking arm consisting of vaccinia HxndIII C sequences was obtained by digestion of pSD420 with ~I (pos.

18,628) followed by blunt ending with Klenow fragment of E. coli polymerase and digestion with III (pos.

19,706). The right flanking arm consisting of vaccinia i~j,~dIII K sequences was obtained by digestion of pSD451 with c~II (pos. 29,062) and ~cqRV (pos. 29,778). The resulting plasmid, pMP581CK is deleted for vaccinia sequences between the III site (pos. 19,706) in ~dIII
C and the $g~II site (pos. 29,062) in ~dIII K. The site of the deletion of vaccinia sequences in plasmid pMP581CK is indicated by a triangle in FIG. 5.

To remove excess DNA at the vaccinia deletion junction, plasmid pMP581CK, was cut at the I~cgl sites within vaccinia sequences (pos. 18,811; 19,655), treated with Bal-31 exonuclease and subjected to mutagenesis (Mandecki, 1986) using synthetic oligonucleotide MPSYN233 (SEQ ID N0:20) 5~-TGTCATTTAACACTATACTCATATTAATAAAAATAATATTTATT-3~.
The resulting plasmid, pMpCSKI~, is deleted for vaccinia sequences positions 18,805-29,108, encompassing 12 vaccinia open reading frames [C7L - R1L]. Recombination between pMPCSK1~ and the Beta-galactosidase containing .
vaccinia recombinant, vP784, resulted in vaccinia deletion mutant, vP804, which was isolated as a clear plaque in the presence of X-gal.

E7tamDle 6 - CONSTRUCTION OF PLA8MID pSD548 FOR
DELETION OF LARGE BUBUNIT, RIBONUCLEOTIDE
REDUCTASE fI4L) ' Referring now to FIG. 6, plasmid pSD405 contains vaccinia I~g' dIII I (pos. 63,875-70,367) cloned in pUC8.
pSD405 was digested with ~r RV within vaccinia sequences (pos. 67,933) and with ~I at the pUC/vaccinia junction, and ligated, forming plasmid pSD518. pSD518 was used as the source of all the vaccinia restriction fragments used in the construction of pSD548.

WO 95127780 218 7 2 ~ ~ PCTIUS95I04394 The vaccinia I4L gene extends from position 67,371-65,059. Direction of transcription for I4L is indicated by an arrow-in FIG. 6. To obtain a vector plasmid fragment deleted for a portion of the I4L coding sequences, pSD518 was digested with BamHI (pos. 65,381) and ~p~I (pos. 67,001) and blunt ended using Klenow fragment of E. colt polymerase. This 4.8 kb vector fragment was ligated with a 3.2 kb ~I cassette containing the E. coli Beta-galactosidase gene (Shapira et al., 1983) under the control of the vaccinia 11 kDa promoter (Bertholet et al., 1985;,Perkus et al., 1990), resulting in plasmid pSD524KBG. pSD524KBG was used as donor plasmid for recombination with vaccinia virus vP804. Recombinant vaccinia virus, vP855, containing Beta-galactosidase in a partial deletion of the I4L gene, was isolated as a blue plaque in the presence of X-gal.
To delete Beta-galactosidase and the remainder of the I4L ORF from vP855, deletion plasmid pSD548 was constructed. The left and right vaccinia flanking arms were assembled separately in pUC8 as detailed below and presented schematically in FIG. 6.
To construct a vector.plasmid to accept the left vaccinia flanking arm, pUC8 was cut with ~amHI/ECORI and ligated with annealed synthetic oligonucleotides 518A1/518A2 (SEQ ID NOS:21, 22) ~FiI saI
518A1 5' GATCCTGAGTACTTTGTAATATAATGATATATATTTTCACTTTATCTCAT
518A2 3' GACTCATGAAACATTATATTACTATATATAAAAGTGAAATAGAGTA
$y~II~cgRl-TTGAGAATAAAAAGATCTTAGG 3' 518A1 AACTCTTATTTTTCTAGAATCCTTAA 5' 518A2 forming plasmid pSD531. pSD531 was cut with RsaI
(partial) and $amHI and a 2.7 kb vector fragment isolated. pSD518 was cut with $g~II (pos. 64,459)/ saI
(pos. 64,994) and a 0.5 kb fragment isolated. The two fragmentd were ligated together, forming pSD537, which W095/27780 2 ~ R 7 ~ a 7 PCTIUS95104394 contains the complete vaccinia flanking arm left of the I4L coding sequences.
To construct a vector plasmid to accept the right vaccinia flanking arm, pUC8 was cut with BamHI/~gr RI and ligated with annealed synthetic oligonucleotides 518B1/518B2 (SEQ ID N0:23, 24) I III I
518B1 5' GATCCAGATCTCCCGGGAAAAAAATTATTTAACTTTTCATTAATAG
518B2 3' GTCTAGAGGGCCCTTTTTTTAATAAATTGAAAAGTAATTATC
GGATTTGACGTATGTAGC$GTA~CTAG~RI 3' S18B1 CCTAAACTGCATACTACGCATGATCCTTAA 5' 518B2 forming plasmid pSD532. pSD532 was cut with t~I
(partial)/~r RI and a 2.7 kb vector fragment isolated.
pSD518 was cut with I within vaccinia sequences (pos.
67,436) and SRI at the vaccinia/pUC junction, and a 0.6 kb fragment isolated. The two fragments were ligated together, forming pSD538, which contains the complete vaccinia flanking arm to the right of I4L coding sequences.
The right vaccinia flanking arm was isolated as a 0.6 kb ~RI/~II fragment from pSD538 and ligated into pSD537 vector plasmid cut with ~gRI/~g~,II. In the resulting plasmid, pSD539, the I4L ORF (pos. 65,047-67,386) is replaced by a polylinker region, which is flanked by 0.6 kb vaccinia DNA to the left and 0.6 kb vaccinia DNA to the right, all in a pUC background. The site of deletion within vaccinia sequences is indicated by a triangle in FIG. 6. To avoid possible recombination of Beta-galactosidase sequences in the pUC-derived portion of pSD539 with Beta-galactosidase sequences in ' recombinant vaccinia virus vP855, the vaccinia I4L
- 35 deletion cassette was moved from pSD539 into pRCll, a pUC
derivative from which all Beta-galactosidase sequences have been removed and replaced with a polylinker region (COlinas et al., 1990). pSD539 was cut with ~cgRl/Ps~I
and the 1.2 kb fragment isolated. This fragment was ligated into pRCl1 cut with EcoRI/~stl (2.35 kb), forming pSD548. Recombination between pSD548 and the Beta-galactosidase containing vaccinia recombinant, vP855, resulted in vaccinia deletion mutant vP866, which was isolated as a clear plaque in the presence of X-gal.
DNA from recombinant vaccinia virus vP866 was analyzed by restriction digests followed by electrophoresis on an agarose gel. The restriction patterns were as expected. Polymerase chain reactions (PCR) (Engelke et al., 1988) using vP866 as template and primers flanking the six deletion loci detailed above produced DNA fragments of the expected sizes. Sequence analysis of the PCR generated fragments around the areas of the deletion junctions confirmed that the junctions were as expected. Recombinant vaccinia virus vP866, containing the six engineered deletions as described above, was designated vaccinia vaccine strain "NYVAC."
~~plg 7 - INSERTION OF A RABIES GLYCOPROTEIN
i. ne.;srm Tvmn wlltVTf~
The gene encoding rabies glycoprotein G under the control of the vaccinia H6 promoter (Taylor et al., 1988a,b) was inserted into TK deletion plasmid pSD513.
pSD513 is identical to plasmid pSD460 (FIG. 1) except for the presence of a polylinker region.
Referring now to FIG. 7, the polylinker region was inserted by cutting pSD460 with ~I and ligating the plasmid vector with annealed synthetic oligonucleotides VQ1A/VQ1B (SEQ ID NOS:25, 26) S a Bc7~II XhoI PstI NdXI Ba VQ1A 5' GGGAGATCTCTCGAGCTGCAGGGCGCCGGATCCTTTTTCT 3' VQ1B 3' CCCTCTAGAGAGCTCGACGTCCCGCGGCCTAGGAAAAAGA 5' to form vector plasmid pSD513. pSD513 was cut with ,~I , and ligated with a ,$i~a_I ended 1.8 kb cassette containing the gene encoding the rabies glycoprotein G gene under the control of the vaccinia H6 promoter (Taylor et al., 1988ayb). The resulting plasmid was designated pRW842.
pRW842 was used as donor plasmid for recombination with NYVAC rescuing virus (vP866). Recombinant vaccinia virus WO 95/27780 2 i 8 7 2 0 7 PCTlUS95l0439d vP879 was identified by plaque hybridization using 32p-labelled DNA probe to rabies glycoprotein G coding sequences.
The modified recombinant viruses of the present 5 invention provide advantages as recombinant vaccine vectors. The attenuated virulence of the vector advantageously reduces the opportunity for the ' possibility of a runaway infection due to vaccination in the vaccinated individual and also diminishes l0 transmission from vaccinated to unvaccinated individuals or contamination of the environment.
The modified recombinant viruses are also advantageously used in a method for expressing a gene product in a cell cultured in vitro by introducing into 15 the cell the modified recombinant virus having foreign DNA which codes for and expresses gene products in the cell.
tile 8 - CONSTRUCTION OF TROVAC-NDV E%PRES8ING THE
FUSION AND HEMpGGLUTININ-NEURAtSINIDASE
20 GLYCpPROTEINB OF N ~ IoC_agmr v nrav "SVO
This example describes the development of TROVAC, a fowlpox virus vector and, of a fowlpox Newcastle Disease Virus recombinant designated TROVAC-NDV and its safety 25 and efficacy. A fowlpox virus (FPV) vector expressing both F and HN genes of the virulent NDV strain Texas was constructed. The recombinant produced was designated TROVAC-NDV. TROVAC-NDV expresses authentically processed NDV glycoproteins in avian cells infected with the 30 recombinant virus and inoculation of day old chicks protects against subsequent virulent NDV challenge.
Cells and Virm~a~_ The Texas strain of NDV is a veloqenic strain. Preparation of cDNA clones of the F
and HN genes has been previously described (Taylor et 35 al., 1990; Edbauer et al., 1990). The strain of FPV
designated FP-1 has been described previously (Taylor et a1.,,1988a). It is a vaccine strain useful in vaccination of day old chickens. The parental virus strain Duvette was obtained in France as a fowlpox scab WO 95127780 2 ~ g 7 ~ 0 7 PCTIUS95104394 from a chicken. The virus was attenuated by approximately 50 serial passages in chicken embryonated eggs followed by 25 passages on chicken embryo fibroblast cells. The virus was subjected to four successive plaque purifications. one plaque isolate was further amplified in primary CEF cells and a stock virus, designated as TROVAC, established. The stock virus used in the is vitro recombination test to produce TROVAC-NDV had been subjected to twelve passages in primary CEF cells from l0 the plaque isolate.
~~~ ration of a Cassette for NDV-F. A 1.8 kbp CHI fragment containing all but 22 nucleotides from the 5' end of the F protein coding sequence was excised from pNDV81 (Taylor et al., 1990) and inserted at the ~mHI
site of pUCl8 to form pCEl3. The vaccinia virus H6 promoter previously described (Taylor et al., 1988a,b;
Guo et al., 1989; Perkus et al., 1989) was inserted into pCEl3 by digesting pCEl3 with ~.I, filling in the sticky ends with Klenow fragment of E. coli DNA polymerase and digesting with ~ndIII. A ~dIII - ARV fragment containing the H6 promoter sequence was then inserted into pCEl3 to form pCE38. A perfect 5' end was generated by digesting pCE38 with ~I and I~I and inserting the annealed and kinased oligonucleotides CE75 (SEQ ID N0:27) and CE76 (SEQ ID N0:28) to generate pCE47.
CE75:
CGATATCCGTTAAGTTTGTATCGTAATGGGCTCCAGATCTTCTACCAGGATCCCGGT
AC
CE76:
CGGGATCCTGGTAGAAGATCTGGAGCCCATTACGATACAAACTTAACGGATATCG.
In order to remove non-coding sequence from the 3' end of , the NDV-F a ~I to gstl fragment from pCEl3 was inserted into the ~I and ~I sites of pUCl8 to form pCE23. The non-coding sequences were removed by sequential digestion of pCE23 with Sacl, $a~HI. Exonuclease III, SI nuclease and SRI. The annealed and kinased oligonucleotides WO 95!27780 , ~' ~ ~ ~ PCT/IJS95/04394 CE42 (SEQ ID N0:29) and CE43 (SEQ ID N0:30) were then inserted to form pCE29.
CE42: AATTCGAGCTCCCCGGG
CE43: CCCGGGGAGCTCG
The 3' end of the NDV-F sequence was then inserted into plasmid pCE20 already containing the 5~ end of NDV-F by cloning a ps~I - ~I fragment from pCE29 into the ,~g~I
and ,girl sites of pCE20 to form pCE32. Generation of pCE20 has previously been described in Taylor et al., 1990.
In order to align the H6 promoter and NDV-F 5~
sequences contained in pCE47 with the 3~ NDV-F sequences contained in pCE32, a ~dIII - g~I fragment of pCE47 was inserted into the ~dIII and ~I sites of pCE32 to form pCE49. The H6 promoted NDV-F sequences were then transferred to~the de-ORFed F8 locus (described below) by cloning a ~dIII - TAI fragment from pCE49 into the ~dIII and S.nial sites of pJCA002 (described below) to form pCE54. Transcription stop signals were inserted into pCE54 by digesting pCE54 with S.acl, partially digesting with CHI and inserting the annealed and kinased oligonucleotides CE166 (SEQ ID N0:31) and CE167 (SEQ ID N0:32) to generate pCE58.
CE166: CTTTTTATAAAAAGTTAACTACGTAG
CE167: GATCCTACGTAGTTAACTTTTTATAAAAAGAGCT
A perfect 3~ end for NDV-F was obtained by using the polymerise chain reaction (PCR) with pCE54 as template and oligonucleotides CE182 (SEQ ID N0:33) and CE183 (SEQ
ID N0:34) as primers.
CE182: CTTAACTCAGCTGACTATCC
CE183: TACGTAGTTAACTTTTTATAAAAATCATATTTTTGTAGTGGCTC
The PCR fragment was digested with ~v II and ~I and cloned into pCE58 that had been digested with ICI and partially digested with Pt~II. The resulting plasmid was designated pCE64. Translation stop signals were inserted by cloning a ~dIII - ~I fragment which contains the complete H6 promoter and F coding sequence from pCE64 WO 95~Z~~g~ 2 1 ~ 7 Z ~ 7 pCTlUS95~~439a into the HindIII and ;i_pa_I sites of pRW846 to generate pCE7l, the final cassette for NDV-F. Plasmid pRW846 is essentially equivalent to plasmid pJCA002 (described below) but containing the H6 promoter and transcription and translation stop signals. Digestion of pRW846 with ~~gdIII and gp~I eliminates the H6 promoter but leaves the stop signals intact.
f ~ruct~on of Cassette for NDV-HN. Construction of plasmid pRW802 was previously described in Edbauer et al., 1990. This plasmid contains the NDV-HN sequences linked to the 3' end of the vaccinia virus H6 promoter in a pUC9 vector. A ~dIII -EO~RV fragment encompassing the 5' end of the vaccinia virus H6 promoter was inserted into the ~dIII and ARV sites of pRW802 to form--pRW830. A perfect 3' end for NDV-HN was obtained by inserting the annealed and kinased oligonucleotides CE162 (SEQ ID N0:35) and CE163 (SEQ ID N0:36) into the c~oRI
site of pRW830 to form pCE59, the final cassette for NDV-HN.
CE162:
AATTCAGGATCGTTCCTTTACTAGTTGAGATTCTCAAGGATGATGGGATTTAATTTT
TATAAGCTTG
CE163:
AATTCAAGCTTATAAAAATTAAATCCCATCATCCTTGAGAATCTCAACTAGTAAAGG
AACGATCCTG
~,onstruct~on of FpV Tnsertion Vector. Plasmid pRW731-15 contains a lOkb p~II - ,~1II fragment cloned from genomic DNA. The nucleotide sequence was determined on both strands for a 3660 by III - ARV fragment.
The limits of an open reading frame designated here as F8 were determined. Plasmid pRW761 is a sub-clone of pRW731-15 containing a 2430 by coRV -ARV fragment.
The F8 ORF was entirely contained between an ~bal site and an ~I site in pRW761. In order to create an , insertion plasmid which on recombination with TROVAC
genomic DNA would eliminate the F8 ORF, the following steps were followed. Plasmid pRW761 was completely PCTlUS95/0439a ~ 2187201 digested with yb~I and partially digested with ~spl. A
3700 by I - ~I band was isolated from the gel and ligated with the annealed double-stranded oligonucleotides JCA017 (SEQ ID N0:37) and JCA018 (SEQ ID
N0:38).

JCA017:5' CTAGACACTTTATGTTTTTTAATATCCGGTCTTAAAAGCTTCCCGGGGATCCTTATA
CGGGGAATAAT

JCA018:5' ATTATTCCCCGTATAAGGATCCCCCGGGAAGCTTTTAAGACCGGATATTAAAAAACA
TAAAGTGT

The plasmid resulting from this ligation was designated pJCA002.

On ruction of Doub~e Tnser4-;on Vector fir Nnv x and HN.The H6 promoted NDV-HN sequence was inserted into the H6 promoted NDV-F cassette by cloning a gj,gdIII
fragment from pCE59 that had been filled in with Rlenow fragment of E. coli DNA polymerase into the ~I site of pCE71 to'form pCE80. Plasmid pCE80 was completely digested with ~I and partially digested with III to generate an ICI - gc~Il 4760 by fragment containing the NDV F and HN genes both driven by the H6 promoter and linked to F8 flanking arms, plasmid pJCA021 was obtained by inserting a 4900 by ~v II
- j~dII fragment from pRW731-15 into the SCI and ~dII sites of pBSSK+.
Plasmid pJCA021 was then digested with ~i I arid III and ligated to the 4760 by I eI - III fragment of pCE80 to form pJCA024. Plasmid pJCA024 therefore contains the NDV-F and HN genes inserted in opposite orientation with 3' ends adjacent between FPV flanking arms. Both genes are linked to the vacciaia virus H6 promoter. The right flanking arm adjacent to the NDV-F sequence consists of 2350 by of FPV sequence. The left flanking arm adjacent to the NDV-HN sequence consists of 1700 by of FPV
sequence.

Deve~opmerit of TROVAC NDV. Plasmid pJCA024 was transfected into TROVAC infected primary CEF cells by pCTIUS95104394 using the calcium phosphate precipitation method previously described (Panicali et al., 1982; Piccini et al., 1987). Positive plaques were selected on the basis of hybridization to specific NDV-F and HN radiolabelled probes and subjected to five sequential rounds of plaque purification until a pure population was achieved. One representative plaque was then amplified and the resulting TROVAC recombinant was designated TROVAC-NDV
(vFP96).
Tmm»nofluorescence. Indirect immunofluorescence was performed as described (Taylor et al., 1990) using a polyclonal anti-NDV serum and, as mono-specific reagents, sera produced in rabbits against vaccinia virus recombinants expressing NDV-F or NDV-HN.
r~munoprecip~tation. Immunoprecipitation reactions were performed as described (Taylor et al., 1990) using a polyclonal anti-NDV serum obtained from SPAFAS Inc., Storrs, CT.
The stock virus was screened by in situ plaque hybridization to confirm that the F8 ORF was deleted.
The correct insertion of the NDV genes into the TROVAC
genome and the deletion of the F8 ORF was also confirmed by Southern blot hybridization.
In NDV-infected cells, the F glycoprotein is anchored in the membrane via a hydrophobic transmembrane region near the carboxyl terminus and requires post-translational cleavage of a precursor, Fp, into two disulfide linked polypeptides F1 and F2. Cleavage of Fp is important in determining the pathogenicity of a given NDV strain (Homma and Ohuchi, 1973; Nagai et al., 1976;
Nagai et al., 1980), and the sequence of amino acids at , the cleavage site is therefore critical in determining viral virulence. It has been determined that amino acids at the cleavage site in the NDV-F sequence inserted into , FPV to form recombinant vFP29 had the sequence Arg - Arg - Gln - Arg - Arg (SEQ ID N0:39) (Taylor et al., 1990) which conforms to the sequence found to be a requirement for virulent NDV strains (Chambers et al., 1986; Espion et al., 1987; Le et al., 1988; McGinnes and Morrison, 1986; Toyoda et al., 1987). The HN glycoprotein . synthesized in cells infected with virulent strains of NDV is an uncleaved glycoprotein of 74 kDa. Extremely avirulent strains such as Ulster and Queensland encode an HN precursor (HNo) which requires cleavage for activation (Garten et al., 1980).
The expression of F and HN genes in TROVAC-NDV was analyzed to confirm that the gene products were authentically processed and presented. Indirect-immunofluorescence using a polyclonal anti-NDV chicken serum confirmed that immunoreactive proteins were presented on the infected cell surface. To determine that both proteins were presented on the plasma membrane, mono-specific rabbit sera were produced against vaccinia recombinants expressing either the F or HN glycoproteins.
Indirect immunofluorescence using these sera confirmed the surface presentation of both proteins.
Immunoprecipitation experiments were performed by using (355) methionine labeled lysates of CEF cells infected with parental and recombinant viruses. The expected values of apparent molecular weights of the glycosylated forms of F1 and FZ are 54.7 and 10.3 kDa respectively (Chambers et al., 1986). In the immunoprecipitation experiments using a polyclonal anti-NDV serum, fusion specific products of the appropriate size were detected from the NDV-F single recombinant vFP29 (Taylor et al., 1990) and the TROVAC-NDV double recombinant vFP96. The HN glycoprotein of appropriate - size was also detected from the NDV-HN single recombinant VFP-47 (Edbauer et al., 1990) and TROVAC-NDV. No NDV
specific products were detected from uninfected and parental TROVAC infected CEF cells.
In CEF cells, the F and HN glycoproteins are appropriately presented on the infected cell surface where they are recognized by NDV immune serum.

WO 95127780 PCTIUS9510439d Immunoprecipitation analysis indicated that the Fp protein is authentically cleaved to the F~ and FZ components required in virulent strains. Similarly, the HN
glycoprotein was authentically processed in CEF cells , infected with recombinant TROVAC-NDV.
Previous reports (Taylor et al., 1990; Edbauer,et ;
al., 1990; Boursnell et al., 1990a,b,c; Ogawa et al., 1990) would indicate that expression of either HN or F
alone is sufficient to elicit protective immunity against NDV challenge. Work on other paramyxoviruses has indicated, however, that antibody to both proteins may be required for full protective immunity. It has been demonstrated that SV5 virus could spread in tissue culture in the presence of antibody to the HN
glycoprotein but not to the F glycoprotein (Merz et al., 1980). In addition, it has been suggested that vaccine failures with killed measles virus vaccines were due to inactivation of the fusion component (Norrby et al., 1975). Since both NDV glycoproteins have been shown to be responsible for eliciting virus neutralizing antibody (Avery et al., 1979) and both glycoproteins, when expressed individually in a fowlpox vector are able to induce a protective immune response, it can be appreciated that the most efficacious NDV vaccine should express both glycoproteins.
Example 9 - _CON8TRUCTION OF ALVAC RECOMBINANTB
EBPRESSING RAB=ES VIIttTB GI.YCOPROTEIN G
This example describes the development of ALVAC, a canarypox virus vector and, of a canarypox-rabies recombinant designated as ALVAC-RG (vCP65) and its safety and efficacy.
coi't~ and Viruses. Theparental canarypox virus .
(Rentschler strain) is a vaccinal strain for canaries.
The vaccine strain was obtained from a wild type isolate and attenuated through more than 200 serial passages on chick embryo fibroblasts. A master viral seed was subjected to four successive plaque purifications under WO 95!27780 PCTlUS95I0439.( f 218727 agar and one plaque clone was amplified through five additional passages after which the stock virus was used as the parental virus in in vitro recombination tests.
The plaque purified canarypox isolate is designated ALVAC.
Construction of a Canarvoox rr,~p t; v 880 by canarypox vtIl fragment was cloned between the ~v II sites of pUC9 to form pRW764.5. The sequence (SEQ
ID N0:39j of this fragment is shown in FIG. 8 between positions 1372 and 2251. The limits of an open reading frame designated as C5 were defined. It was determined that the open reading frame was initiated at position 166 within the fragment and terminated at position 487. The C5 deletion was made without interruption of adjacent open reading frames. Bases from position 167 through position 455 were replaced with the sequence (SEQ ID
N0:40) GCTTCCCGGGAATTCTAGCTAGCTAGTTT. This replacement sequence contains ~gdIII, S,mal and ~qRI insertion sites followed by translation stops and a transcription termination signal recognized by vaccinia virus RNA
polymerase (Yuen et al., 1987). Deletion of the C5 ORF
was performed as described below. Plasmid pRW764.5 was partially cut with $~I and the linear product was isolated. The $g~I linear fragment was recut with gq~Il and the pRW764.5 fragment now with a ~s I to c~II
deletion from position 156 to position 462 was isolated and used as a vector for the following synthetic oligonucleotides:
RW145 (SEQ ID N0:41):
ACTCTCAAAAGCTTCCCGGGAATTCTAGCTAGCTAGTTTTTATAAA
RW146 (SEQ ID N0:42):
_ GATCTTTATAAAAACTAGCTAGCTAGAATTCCCGGGAAGCTTTTGAGAGT
Oligonucleotides RW145 and RW146 were annealed and inserted into the pRW 764.5 ~I and j~II vector described above. The resulting plasmid is designated pRW831.

WO 95127780 PCTlUS95104394 ~~~°'~ruction of Insertion Vector Contairiiria the Rah~es G Gene." Construction_of pRW838_,is illustrated below. Oligonucleotides A through E, which overlap the translation initiation codon of the H6 promoter with the , ATG of rabies G, were cloned into pUC9 as pRW737.
Oligonucleotides A through E contain the H6 promoter, ;
starting at NruI, through the ~dIII site of rabies G
followed by $g~II. Sequences of oligoriucleotides A
through E (SEQ ID N0:43-47) are:
A (SEQ ID N0:43): CTGAAATTATTTCATTATCGCGATATCCGTTAA
GTTTGTATCGTAATGGTTCCTCAGGCTCTCCTGTTTGT
B (SEQ ID N0:44): CATTACGATACAAACTTAACGGATA
TCGCGATAATGAAATAATTTCAG
C (SEQ ID N0:45): ACCCCTTCTGGTTTTTCCGTTGTGTTTT
GGGAAATTGCCTATTTACACGATCCCAGACAAGCTTAGATCTCAG
D (SEQ ID N0:46): CTGAGATCTAAGCTTGTCTGGGAT
CGTGTAAATAGGGAATTTCCCAAAACA
E (SEQ ID N0:47): CAACGGAAAAACCAGAAGGGGTACAAA
CAGGAGAGCCTGAGGAAC
The diagram of annealed oligonucleotides A through E is as follows:
A C
___________________ B E D
Oligonucleotides A through E were kinased, annealed (95°C for 5 minutes, then cooled to room temperature), and inserted between the gy~II sites of pUC9. The resulting plasmid, pRW737, was cut with ~dIII and Bg~II
and used as a vector for the 1.6 kbp 'F~ndIII-~g,lII
fragment of ptg155PR0 (Kieny et al., 1984) generating pRW739. The ptg155PR0 ~dIII siteis 86 bpdownstream of the rabies G translation initiation codon. Bc~II is downstream of the rabies G translation stop codon in PCTJiJ595104394 Wo 95nTgo 2 i 8 7 2 0 ~
i ptg155PR0. pRW739 was partially cut with completely cut with ,~g~II, and a 1.7 kbp ~I- c~II
fragment, containing the 3~ end of the H6 promoter previously described (Taylor et al., 1988a,b; Guo et al., 5 1989; Perkus et al., 1989) through the entire rabies G
gene, was inserted between the ~yI and HamHI sites of pRW824. The resulting plasmid is designated pRW832.
Insertion into pRW824 added the H6 promoter 5~ of I.
pRW824 is a plasmid that contains a nonpertinent gene 10 linked precisely to the vaccinia virus H6 promoter.
Digestion with ~I and CHI completely excised this nonpertinent gene. The 1.8 kbp pRW832 ,$~I fragment, containing H6 promoted rabies G, was inserted into the ~I of pRW831, to form plasmid pRW838.
15 Develobment of A vnr_Qr, Plasmid pRW838 was transfected into ALVAC infected primary CEF cells by using the calcium phosphate precipitation method previously described (Panicali et al., 1982; Piccini et al., 1987). Positive plaques were selected on the basis 20 of hybridization to a specific rabies G probe and subjected to 6 sequential rounds of plaque purification until a pure population was achieved. one representative plaque was then amplified and the resulting ALVAC
recombinant was designated ALVAC-RG (vCP65) (see also 25 FIGS. 9A and 9B). The correct insertion of the rabies G
gene into the ALVAC genome without subsequent mutation was confirmed by sequence analysis.
TnmunO ~~or n During the final stages of assembly of mature rabies virus particles, the 30 glycoprotein component is transported from the golgi apparatus to the plasma membrane where it accumulates with the carboxy terminus extending into the cytoplasm and the bulk of the protein on the external surface of the cell membrane. In order to confirm that the rabies 35 glycoprotein expressed in ALVAC-RG was correctly presented, immunofluorescence was performed on primary CEF cells infected with ALVAC or ALVAC-RG.

WO 95J27780 2 ~ g 7 2 ~ 7 PCTIUS95/04394 Immunofluorescence was performed as previously described (Taylor et al., 1990) using a rabies G monoclonal antibody. Strong surface fluorescence was detected on CEF cells infected with ALVAC-RG but not with the parental ALVAC.
Tmmnnnprecipitation. Preformed monolayers of primary CEF, Vero (a line of African Green monkey kidney cells ATCC ~ CCL81) and MRC-5 cells (a fibroblast-like cell line derived from normal human fetal lung tissue ATCC ~ CCL171) were inoculated at 10 pfu per cell with parental virus ALVAC and recombinant virus ALVAC-RG in the presence of radiolabelled 35S-methionine and treated as previously described (Taylor et al., 1990).
Immunoprecipitation reactions were performed using a rabies G specific monoclonal antibody. Efficient expression of a rabies specific glycoprotein with a molecular weight of approximately 67 kDa was detected with the recombinant ALVAC-RG. No rabies specific products were detected in uninfected cells or cells infected with the parental ALVAC virus.
aP.."Pntiaff Passaaina Experiment. In studies with ALVAC virus in a range of non-avian species no proliferative infection or overt disease was observed (Taylor et al., 1991c). However, in order to establish that neither the parental nor recombinant virus could be adapted to grow in non-avian cells, a sequential passaging experiment was performed.
The two viruses, ALVAC and ALVAC-RG, were inoculated in 10 sequential blind passages in three cell substrates:
(1) Primary chick embryo fibroblast (CEF) cells produced from 11 day old white leghorn embryos;
(2) Vero cells - a continuous line of African Green monkey kidney cells (ATCC # CCL81); and (3) MRC-5 cells - a diploid cell line derived from .
human fetal lung tissue (ATCC ~ CCL171).
The initial inoculation was performed at an m.o.i. of 0.1 pfu per cell using three 60mm dishes of each cell-substrate containing 2 X 106 cells per dish. One dish was inoculated in the presence of 40~g/ml of Cytosine arabinoside (Ara C), an inhibitor of DNA replication.
After an absorption period of 1 hour at 37°C, the inoculum was removed and the monolayer washed to remove unabsorbed virus. At this time the medium was replaced with 5m1 of EMEM + 2% NBCS on two dishes (samples t0 and t7) and 5m1 of EMEM + 2% NBCS containing 40 ~,g/ml Ara C
on the third (sample t7A). Sample t0 was frozen at -70°C
to provide an indication of the residual input virus.
Samples t7 and t7A were incubated at 37°C for 7 days, after which time the contents were harvested and the cells disrupted by indirect sonication.
One ml of sample t7 of each cell substrate was inoculated undiluted onto three dishes of the same cell substrate (to provide samples t0, t7 and t7A) and onto one dish of primary CEF cells. Samples t0, t7 and t7A
were treated as for passage one. The additional inoculation on CEF cells was included to provide an amplification step for more sensitive detection of virus which might be present in the non-avian cells.
This procedure was repeated for 10 (CEF and MRC-5) or 8 (Veto) sequential blind passages. Samples were then frozen and thawed three times and assayed by titration on primary CEF monolayers.
Virus yield in each sample was then determined by plaque titration on CEF monolayers under agarose.
Summarized results of the experiment are shown in Tables 1 and 2. _ The results indicate that both the parental ALVAC
- and the recombinant ALVAC-RG are capable of sustained replication on CEF monolayers with no loss of titer. In Veto cells, levels of virus fell below the level of - detection after 2 passages for ALVAC and 1 passage for ALVAC-RG. In MRC-5 cells, a similar result was evident, and no virus was detected after 1 passage. Although the results for only four passages are shown in Tables 1 and pCT/US95104394 W 0 95127780 2 ~ g 7 2 0 7 2 the series was continued for 8 (Vero) and 10 (MRC-5) passages with no detectable adaptation of either virus to growth in the non-avian cells.
In passage 1 relatively high levels of virus were present in the t7 sample in MRC-5 and Vero cells.
However this level of virus was equivalent to that seen in the t0 sample and the t7A sample incubated in the presence of Cytosine arabinoside in which no viral replication can occur. This demonstrated that the levels of virus seen at 7 days in non-avian cells represented residual virus and not newly replicated virus.
In order to make the assay more sensitive, a portion of the 7 day harvest from each cell substrate was inoculated onto a permissive CEF monolayer and harvested at cytopathic effect (CPE) or at 7 days if no CPE was evident. The results of this experiment are shown in Table 3. Even after amplification through a permissive cell substrate, virus was only detected in MRC-5 and Vero cells for two additional passages. These results indicated that under the conditions used, there was no adaptation of either virus to growth in Vero or MRC-5 cells.
~a+; on of Macaaues. Four HIV seropositive macaques were initially inoculated with AhVAC-RG as described in Table 4. After 100 days these animals were re-inoculated to determine a booster effect, and an additional seven animals were inoculated with a range of doses. Blood was drawn at appropriate intervals and sera analyzed, after heat inactivation at 56°C for 30 minutes, for the presence of anti-rabies antibody using the Rapid Fluorescent Focus Inhibition Assay (Smith et al., 1973). , +'nn of fh;mDanzees. Two adult male chimpanzees (50 to 65 kg weight range) were inoculated intramuscularly or subcutaneously with 1 X 107 pfu of _ vCP65. Animals were monitored for reactions and bled at regular intervals for analysis for the presence of anti-rabies antibody with the RFFI test (Smith et al., 1973).

218 7 2 0 7 PCT1~1S95J04394 Animals were re-inoculated with an equivalent dose 13 weeks after the initial inoculation.
Tnoculat~on of Mice. Groups of mice were inoculated with 50 to 100 ~1 of a range of dilutions of different batches of vCP65. Mice were inoculated in the footpad.
On day 14, mice were challenged by intracranial inoculation of from 15 to 43 mouse hDSO of the virulent CVS strain of rabies virus. Survival of mice was monitored and a protective dose 50% (PDso) calculated at 28 days post-inoculation.
Tnoculation of Doas and Cats. Ten beagle dogs, 5 months old, and 10 cats, 4 months old, were inoculated subcutaneously with either 6.7 or 7.7 loglo TCID50 of ALVAC-RG. Four dogs and four cats were not inoculated.
Animals were bled at 14 and 28 days post-inoculation and anti-rabies antibody assessed in an RFFI test. The animals receiving 6.7 loglo TCIDSO of ALVAC-RG were challenged at 29 days post-vaccination with 3.7 logyo mouse LDSO (dogs) or 4.3 loglo mouse LDSO (cats) of the NYGS rabies virus challenge strain.
Tnocu~at~on of Sau~rre~ Monkeys. Three groups of four squirrel monkeys (Saimiri sciureus) were inoculated with one of three viruses (a) ALVAC, the parental canarypox virus, (b) ALVAC-RG, the recombinant expressing the rabies G glycoprotein or (c) vCP37, a canarypox recombinant expressing the envelope glycoprotein of feline leukemia virus. Inoculations were performed under ketamine anaesthesia. Each animal received at the same time: (1) 20 ~1 instilled on the surface of the right eye without scarification; (2) 100 ul as several droplets in the mouth; (3) 100 ;C1 in each of two intradermal injection sites in the shaven skin of the external face of the right arm; and (4) 100 ~1 in the anterior muscle of the right thigh.
Four monkeys were inoculated with each virus, two with a total of 5.0 loglo pfu and two with a total of 7.0 loglo pfu. Animals were bled at regular intervals and W0 95127780 P~/j7S95104394 sera analyzed for the presence of antirabies antibody using an RFFI test (Smith et al., 1973). Animals were monitored daily for reactions to vaccination. Six months after the initial inoculation the four monkeys receiving 5 ALVAC-RG, two monkeys initially receiving vCP37, and two monkeys initially receiving ALVAC, as well as one naive monkey were inoculated with 6.5 1og10 pfu of ALVAC-RG
subcutaneously. Sera were monitored for the presence of rabies neutralizing antibody in an RFFI test (Smith et 10 al., 1973).
y ~-+;~n of Human Cell Lines with ALVAC-RG. In order to determine whether efficient expression of a foreign gene could be obtained in non-avian cells in which the virus does not productively replicate, five 15 cell types, one avian and four non-avian, were analyzed for virus yield, expression of the foreign rabies G gene and viral specific DNA accumulation. Tie cells inoculated were:
(a) Vero, African Green monkey kidney cells, ATCC
20 CCL81;
(b) MRC-5, human embryonic lung, ATCC # CCL 171;
(c) WISH human amnion, ATCC f CCL 25;
(d) Detroit-532, human foreskin, Downs~s syndrome, ATCC ~ CCL 54; and 25 (e) Primary CEF cells.
Chicken embryo fibroblast cells produced from 11 day old white leghorn embryos were included as a positive control. All inoculations were performed on preformed monolayers of 2 X 106 cells as discussed below.
30 A. Methods for DNA analysis.
Three dishes of each cell line were inoculated at 5 pfu/cell of the virus under test, allowing one extra dish of each cell line un-inoculated. One dish was incubated in the presence of 40 ;Cg/ml of cytosine .
35 arabinoside (Ara C). After an adsorption period of minutes at 37°C, the inoculum was removed and the monolayer washed twice to remove unadsorbed virus.

WO 95127780 ~ i 8 7 2 0 7 PCTlIJS95l04394 Medium (with or without Ara C) was then replaced.

Cells from one dish (without Ara C) were harvested as a time zero sample. The remaining dishes were incubated at 37C for 72 hours, at which time the cells were harvested and used to analyze DNA

accumulation. Each sample of 2 X 106 cells was ' resuspended in 0.5 ml phosphate buffered saline (PBS) containing 40 mM EDTA and incubated for 5 minutes at 37C. An equal volume of 1.5% agarose prewarmed at 42C and containing 120 mM EDTA was added to the cell suspension and gently mixed. The suspension was transferred to an agarose plug mold and allowed to harden for at least 15 min. The agarose plugs were then removed and incubated for 12-16 hours at 50C in a volume of lysis buffer (1%

sarkosyl, 100 ug/ml proteinase K, 10 mM Tris HC1 pH

7.5, 200 mM EDTA) that completely covers the plug.

The lysis buffer was then replaced with 5.0 ml sterile 0.5 X TBE (44.5 mM Tris-borate, 44.5 mM

boric acid, 0.5 mM EDTA) and equilibrated at 4C for 6 hours with 3 changes of TBE buffer. The viral DNA

within the plug was fractionated from cellular F2NA

and DNA using a pulse field electrophoresis system.

Electrophoresis was performed for 20 hours at 180 V

with a ramp of 50-90 sec at 15C in 0.5 X TBE. The DNA was run with lambda DNA molecular weight standards. After electrophoresis the viral DNA band was visualized by staining with ethidium bromide.

The DNA was then transferred to a nitrocellulose membrane and probed with a radiolabelled probe prepared from purified ALVAC genomic DNA.

B. Estimation of virus yield.

Dishes were inoculated exactly as described above, with the exception that input multiplicity was 0.1 pfu/cell. At 72 hours post infection, cells were lysed by three successive cycles of freezing and WO 95/27780 2 ~ g 7 2-~ 7 PCTIU595104394 thawing. Virus yield-was assessed by plaque titration on CEF monolayers.
C. Analysis of expression of Rabies G gene.
Dishes were inoculated with recombinant or parental virus at a multiplicity of 10 pfu/cell, allowing an additional dish as an uninfected virus control.
After a one hour absorption period, the medium was removed and replaced with methionine free medium.
After a 30 minute period, this medium was replaced with methionine-free medium containing 25 uCi/ml of 35S-Methionine. Infected cells were labelled overnight (approximately 16 hours), then lysed by the addition of buffer A lysis buffer.
Immunoprecipitation was performed as previously described (Taylor et al., 1990) using a rabies G
specific monoclonal antibody.
Resu~ts~ Estimation of Vira~ viPi~. The results of titration for yield at 72 hours after inoculation at 0.1 pfu per cell are shown in Table 5. The results indicate that while a productive infection can be attained in the avian cells, no increase in virus yield can be detected by this method in the four non-avian cell systems.
Analvsis of Viral DNA Ac~mm,mwtinn~ In order to determine whether the block to productive viral replication in the non-avian cells occurred before or after DNA replication, DNA from the cell lysates was fractionated by electrophoresis, transferred to nitrocellulose and probed for the presence of viral specific DNA. DNA from uninfected CEF cells, ALVAC-RG
infected CEF cells at time zero, ALVAC-RG infected CEF
cells at 72 hours post-infection and ALVAC-RG infected _ CEF cells at 72 hours post-infection in the presence of ~g/ml of cytosine arabinoside all showed some background activity, probably due to contaminating CEF
35 cellular DNA in the radiolabelled ALVAC DNA probe preparation. However, ALVAC-RG infected CEF cells at 72 hours post-infection exhibited a strong band in the WO 95!27780 218 l 2 ~ 7 PCT~S95/0439J

region of approximately 350 kbp representing ALVAC-specific viral DNA accumulation. No such band is detectable when the culture is incubated in the presence of the DNA synthesis inhibitor, cytosine arabinoside.

Equivalent samples produced in Vero cells showed a very faint band at approximately 350 kbp in the ALVAC-RG

infected Vero cells at time zero. This level represented residual virus. The intensity of the band was amplified at 72 hours post-infection indicating that some level of viral specific DNA replication had occurred in Vero cells which had not resulted in an increase in viral progeny.

Equivalent samples produced in MRC-5 cells indicated that no viral specific DNA accumulation was detected under these conditions in this cell line. This experiment was then extended to include additional human cell lines, specifically WISH and Detroit-532 cells. ALVAC infected CEF cells served as a positive control. No viral specific DNA accumulation was detected in either WISH or Detroit cells inoculated with ALVAC-RG. It should be noted that the limits of detection of this method have not been fully ascertained and viral DNA accumulation may be occurring, but at a level below the sensitivity of the method. Other experiments in which viral DNA replication was measured by 3H-thymidine incorporation support the results obtained with Vero and MRC-5 cells.

Analvsis of Rabies Gene Expression. To determine if any viral gene expression, particularly that of the inserted foreign gene, was occurring in the human cell lines even in the absence of viral DNA replication, immunoprecipitation experiments were performed on 35S-methionine labelled lysates of avian and non-avian cells _ infected with ALVAC and ALVAC-RG. The results of immunoprecipitation using a rabies G specific monoclonal antibody illustrated specific immunoprecipitation of a 67 kDa glycoprotein in CEF, Vero and NfftC-5, WISH and Detroit cells infected with ALVAC-RG. No such specific rabies WO 95!27780 PCTIUS95I04394 gene products were detected in any of the uninfected and parentally infected cell lysates:
The results of this experiment indicated that in the human cell lines analyzed, although the ALVAC-RG
recombinant was able to initiate an infection and express a foreign gene product under the transcriptional control of the H6 early/late vaccinia virus promoter, the replication did not proceed through DNA replication, nor was there any detectable viral progeny produced. In the Vero cells, although some level of ALVAC-RG specific DNA
accumulation was observed, no viral progeny was detected by these methods. These results would indicate that in the human cell lines analyzed the block to viral replication occurs prior to the onset of DNA replication, while in Vero cells, the block occurs following the onset of viral DNA replication.
In order to determine whether the rabies glycoprotein expressed in ALVAC-RG was immunogenic, a number of animal species were tested by inoculation of the recombinant. The efficacy of current rabies vaccines is evaluated in a mouse model system. A similar test was therefore performed using ALVAC-RG. Nine different preparations of virus (including one vaccine batch (J) produced after l0 serial tissue culture passages of the seed virus) with infectious titers ranging from 6.7 to 8.4 1og10 TCIDsp per ml were serially diluted and 50 to 100 ~C1 of dilutions inoculated into the footpad of four to six week old mice. Mice were challenged 14 days later by the intracranial route with 300 ul of the CVS strain of rabies virus containing from 15 to 43 mouse LD50 as determined by lethality titration in a control group of , mice. Potency, expressed as the PDSO (Protective dose .
50%), was calculated at 14 days post-challenge. The results of the experiment are shown in Table 6. The _ results indicated that ALVAC-RG was consistently able to protect mice against rabies virus challenge with a PD50 value ranging from 3.33 to 4.56 with a mean value of 3.73 WO 95!27780 21 ~ ~ 2 ~ 7 PCT/IJS95/DJ39J
(STD 0.48). As an extension of this study, male mice were inoculated intracranially with 50 ~1 of virus containing 6.0 loglo TCID50 of ALVAC-RG or with an equivalent volume of an uninfected cell suspension. Mice 5 were sacrificed on days 1, 3 and 6 post-inoculation and their brains removed, fixed and sectioned.

Histopathological examination showed no evidence for neurovirulence of ALVAC-RG in mice.

In order to evaluate the safety and efficacy of 10 ALVAC-RG for dogs and cats, a group of 14, 5 month old beagles and 14, 4 month old cats were analyzed. Four animals in each species were not vaccinated. Five animals received 6.7 1og10 TCID50 subcutaneously and five animals received 7.7 1og10 TCID50 by the same route.

15 Animals Were bled for analysis for anti-rabies antibody.

Animals receiving no inoculation or 6.7 loglo TCID50 of ALVAC-RG were challenged at 29 days post-vaccination with 3.7 loglo mouse LDSO (dogs, in the temporal muscle) or 4.3 1og10 mouse LD50 (cats, in the neck) of the NYGS rabies 2o virus challenge strain. The results of the experiment are shown in Table 7.

No adverse reactions to inoculation were seen in either cats or dogs with either dose of inoculum virus.

Four of 5 dogs immunized with 6.7 1og10 TCID50 had 25 antibody titers on day 14 post-vaccination and all dogs had titers at 29 days. All dogs were protected from a challenge which killed three out of four controls. In cats, three of five cats receiving 6.7 1og10 TCID50 had specific antibody titers on day 14 and all cats were 30 positive on day 29 although the mean antibody titer was low at 2.9 IU. Three of five cats survived a challenge which killed all controls. All cats immunized with 7.7 1og10 TCID50 had antibody titers on day 14 and at day 29 _ , the Geometric Mean Titer was calculated as 8.1 35 International Units.

The immune response of squirrel monkeys (Saimiri sciureus) to inoculation with ALVAC, ALVAC-RG and an WO 95127780 ~ PCTII1S95104394 unrelated canarypox virus recombinant was examined.
Groups of monkeys were inoculated as described above and sera analyzed for the presence of rabies specific antibody. Apart from minor typical skin reactions to inoculation by the intradermal route, no adverse reactivity was seen in any of the monkeys. Small amounts of residual virus were isolated from skin lesions after intradermal inoculation on days two and four post-inoculation only. All specimens were negative on day seven and later. There was no local reaction to intra-muscular injection. All four monkeys inoculated with ALVAC-RG developed anti-rabies serum neutralizing antibodies as measured in an RFFI test. Approximately six months after the initial inoculation all monkeys and one additional naive monkey were re-inoculated by the subcutaneous route on the external face of the left thigh with 6.5 loglp TCID50 of ALVAC-RG. Sera were analyzed for the presence of anti-rabies antibody. The results are shown in Table 8.
Four of the five monkeys naive to rabies developed a serological response by seven days post-inoculation with ALVAC-RG. All five monkeys had detectable antibody by 11 days post-inoculation. Of the four monkeys with previous exposure to the rabies glycoprotein, all showed a significant increase in serum neutralization titer between days 3 and 7 post-vaccination. The results indicate that vaccination of squirrel monkeys with ALVAC-RG does not produce adverse side-effects and a primary neutralizing antibody response can be induced. An anamnestic response is also induced on re-vaccination.
Prior exposure to ALVAC or to a canarypox recombinant , expressing an unrelated foreign gene does not interfere .
with induction of an anti-rabies immune response upon re-vaccination. _ The immunological response of HIV-2 seropositive macaques to inoculation with ALVAC-RG was assessed.
Animals were inoculated as described above and the W O 95127780 PCTliT59510.~.394 presence of anti-rabies serum neutralizing antibody assessed in an RFFI test. The results, shown in Table 9, indicated that HIV-2 positive animals inoculated by the subcutaneous route developed anti-rabies antibody by 11 days after one inoculation. An anamnestic response was detected after a booster inoculation given approximately three months after the first inoculation. No response was detected in animals receiving the recombinant by the oral route. In addition, a series of six animals were l0 inoculated with decreasing doses of ALVAC-RG given by either the intra-muscular or subcutaneous routes. Five of the six animals inoculated responded by 14 days post-vaccination with no significant difference in antibody titer.
Two chimpanzees with prior exposure to HIV were inoculated with 7.0 loglo pfu of ALVAC-RG by the subcutaneous or intra-muscular route. At 3 months post-inoculations both animals were re-vaccinated in an identical fashion. The results are shown in Table 10.
No adverse reactivity to inoculation was noted by either intramuscular or subcutaneous routes. Both chimpanzees responded to primary inoculation by 14 days and a strongly rising response was detected following re-vaccination.

Table 1. Sequen tial Passage ALVAC Avian and non-of in Avian Cells.

CEF Vero ~2C-5 Pass Sample to 2.4 3.0 2.6 _ t7b 7.0 1.4 0.4 t7A' 1.2 1.2 0.4 Pass Sample to 5.0 0.4 N.D.d t7 7.3 0.4 N.D.

t7A 3.9 N.D. N.D.

Pass Sample to 5.4 0.4 N.D.

t7 7.4 N.D. N.D.

t7A 3.8 N.D. N.D.

Pass Sample to 5.2 N.D. N.D.

t7 7.1 N.D. N.D.

t7A 3.9 N.D. N.D.

a: This sample was harvested at zero time and represents the residual input virus. The titer is expressed as log~opfu per ml.
b: This sample was harvested at 7 days post-infection.
c: This sample was inoculated in the presence of 40 ~g/ml of Cytosine arabinoside and harvested at 7 days post infection.
d: Not detectable W095127780 ~ PCT/fIS9510439:1 Table 2. Sequential ALVAC-RG in Avian and Passage of non-Avian Cells CEF Vero MRC-5 Pass Sample t0a 3.0 2.9 2.9 t7b 7.1 1.0 1.4 t7A~ 1.8 1.4 1.2 Pass Sample t0 5.1 0.4 0.4 t7 7.1 N.D.d N.D.

t7A 3.8 N.D. N.D.

Pass Sample t0 5.1 0.4 N.D.

t7 7.2 N.D. N.D.

t7A 3.6 N.D. N.D.

Pass Sample t0 5.1 N.D. N.D.

t7 7.0 N.D. N.D.

t7A 4.0 N.D. N.D.

a: This sample was harvested at zero time and represents the residual input virus. The titer is expressed as loglopfu per ml.
,. 30 b: This sample was harvested at 7 days post-infection.
c: This sample was inoculated in the presence of 40 ~g/ml of Cytosine arabinoside and harvested at 7 ' days post-infection.
' 35 d: Not detectable. ' WO 95f27780 PCTIUS95104394 Table 3. Amplification of residual virus by passage in CEF cells CEF Vero Na2C-5 a) ALVAC ' Pass 2a 7.Ob 6.0 5.2 3 7.5 4.1 4.9 4 7.5 N.D. N.D.

5 7.1 N.D. N.D.

b) ALVAC-RG

Pass 2 7.2 5.5 5.5 3 7.2 5.0 5.1 4 7.2 N.D. N.D.

5 7.2 N.D. N.D.

a: Pass 2 represents the amplification in CEF cells of the 7 day sample from Pass 1.
b: Titer expressed as loglo pfu per ml c: Not Detectable W095127780 21 8 i'~~595104394 ~~
~

Table 4. Schedule of i noculation rhesus macaques with of AhVAC-RG (vCP 65) Animal Inoculation 176L Primary: 1 X 10$ of vCP65orally in TANG
pfu Secondary:1 X 10~ of vCP65plus pfu 1 X 10T of vCP82by SC route pfu 185 L Primary: 1 R 10$ of vCP65orally in Tang pfu Secondary:1 X 10~ of vCP65plus pfu 1 X 10~ of vCP82by SC route pfu 177 L Primary: 5 X 10~ SC of pfu vCP65 by SC
route Secondary:1 X 107 of vCP65plus pfu 1 X 10~ of vCP82by SC route pfu 186L Primary: 5 X 10~ of vCP65by SC route pfu Secondary:1 X 10~ of vCP65plus pfu 1 X 10~ of vCP82by SC route pfu 178L Primary: 1 X 10~ of vCP65by SC route pfu 182L Primary: 1 X 10~ of vCP65by IM route pfu 179L Primarys 1 X 106 of vCP65by SC route pfu 183L Primary: 1 X 106 of vCP65by IM route pfu 180L Primary: 1 X 106 of vCP65by SC route pfu 184L Primary: 1 X 105 of vCP65by IM route pfu 187L Primary 1 X 107 of vCP65orally pfu a: vCP82 is a canarypox virus recombinant expressing the measles virus fusion and hemagglutinin genes.

WO 95!27780 PCTlUS95I04394 Table 5. Analysis of yield in avian and non-avian cells inoculated with ALVAC-RG-Sample Time Cell Type t0 t72 t72Ab Expt 1 CEF 3.3' 7.4 1.7 Vero - 3.0 1.4 1.7 -MRC-5 3.4 2.0 - 1.7 Expt 2 CEF 2.9 7.5 <1.7 WISH 3.3 2.2 2.0 Detroit-532 2.8 1.7 <1.7 a: Titer expressed as logo pfu per ml b: Culture incubated in the presence of 40 ~g/ml of Cytosine arabinoside WO 95!27780 PCT/IlS95/04394 Table 6. Potency of ALVAC-RG as tested in mice Test Challenge Dosea PDSo Initial seed 43 4.56 Primary seed 23 3.34 Vaccine Batch H 23 4.52 Vaccine Batch I 23 3.33 Vaccine Batch K 15 3.64 Vaccine Batch L 15 4.03 Vaccine Batch M 15 3.32 Vaccine Batch N 15 3.39 Vaccine Batch J 23 3.42 a: Expressed as mouse LD50 b: Expressed as loglo TCIDSo 21872~~7 Table 7. Efficacy of ALVAC-RG in dogs and cats boas Cats Dose Antibodya Survivalb Antibody Survival 6.7 11.9 5/5 2.9 3/5 7.7 10.1 N.T. 8.1 N.T.
a: Antibody at day 29 post inoculation expressed as the geometric mean titer in International Units.
b: Expressed as a ratio of survivors over animals challenged WO 95!27780 PCT/IJS951D4394 ss 21812D7 .., x ~ v ~

p ~ N N H H N sFH .Oof ~ ~ I
N

3 N N x x rlt x rlN
1 ~

rl i.) 1 Ir i t'1N N N N 1D1pO r N ~ N N N N PIPIf1V N fC

~1 ' N n-1N VfW GDN r N
O

Vl i~ N r1 / ~

~ ~ N N N N 1~f71hV'N la (U

W IIJ p.I

O >; ,C I .'I
W
D
LL
"J
.'~

N

B ~ r r r N t0N t0r ~

~ I~ ' V .-1.i.iM nln1c.1.-1 rl CO

~"~
W
W
W
N

O
O
O
O

fV N N N N N 1l1N ~
~

i O
O
O
O

i V V V V V V N V V 2f N
~ N
~ In ~ O
A ~

1 ~ N
k N
N
N

U U
O U U
O

I N N N N N 1 ~
. H
H
H
H

N -~r N

O
v o o ..~~ ~ ~ ~ ., ~ ..~ O
O
O
~
~

~g8'8' p .,~ , V V v V V V v V

r-i ri ~I
.-i t0 O
O
O
O

N

'~ O' 1 a N N r N Ri i.1 N
,n ,n ,n t~

1 i Z x x x N N N n1~ ~

~
O
O
O
O
O

.., N I
>
>

ro ro ~ ~ i v ~ w w 2s r-, ~
.~
..
~
-~
..
I

c~c~o o 0 0 1 rt s~
d v d v a a a a s;op,ooooU

1 .~J -r-IUl 1 V V 9 0 I 1 I I -rl O
N
O

OI
GI

'O

v-1 U >O 1 U U r r U U U U

1' H 1 ~ > U U ~ ~ ~ ~ O

" a a a Glb Ul ~..t G Lw , ~ ~ ~ ~ i ~ ~ t0 N

N
N

x + Ca,a .a~,.i.ad asa ~,..Iroro~a~I.u ~ F ro b co N
C
G
a ~
o i MHO
>a.~a~x ~I x ~, , n o , ~a o 1 N ~ M ~ m ~ ~ N N

H ~ 1 c0 ~lt U'ONW2T

IC1 O If1 O tC1 rl N N

O O
W

n a y o -p.~
m "a C
N

d ..a W

W

11 b a s ro n .~ d c m m ' a .
-~
H
w a I I I 1 1 1 p x~
E ~ O

O CD

H
U c ~ N ,O

H ~ A ~

' ,~ a ~ G
O N ~

P U~ ~ t 1 1 t M ~ 4 S 7 -1 ~

U N ~I .t .~ .

bi n-I ct N N M
~. '~

11 c0 I 1 I .-I'i d H ~ n n m IG r1 a o ri n .-i U ~ ~' M ~

U 1 t I I I 1 t . .4 O -I

S C ~ a ~ a a . ~
~'' ~

.~
. A' ' ., 'r ~N~ I I C1 10M C a ~
.~'. T3 H ~ ~ A

' ..

N

n ~
A
~
O

.
v i .-~
N

is ~ 1 1 1 I I I ~ ~ . a~Cm~w U i W V7 1~ U W N
.a O

a eb .-~
a C

m o a OO OD N ~D ODt0 10N N 10 OD"t'.. U
I
~

0)U 10 1 1 I +I N rlIn N lf1tf1rlei If1 N C
' N W .,1 b .i O

,4V1 -i Il7N v-1N N InIl1N v-Ip ~ ~
Lt ~ y ' N
m G Oa .
m ~

W O a 1 I tl 10 N N ~l'd'~ N N N t0 00"'~

O (.x ~ ~ M m o ~ovo M W n N .-1a a ~
~ e.~
sa -I ~ pl O -.pl t~

y u.,Hyaro 1 1 1 t 1 ~O N N m b ~
C a~
'6 aJ tf1 I 1 I 1 I I 1 .-i m O ~ t (O ~ .-IchM ~ U
O

e1IC W
U m ~~A~na ~
1 I I 1 1 I I t t 1 1 1 ~ ~ ~ ~,y a ~,y ~

H W -I ll ro W m , a b.~
w.~ m H of o0 al H
E E N

N .1.1 N .,i Oi >...t Y

01Of0 NCObC-1 p,rl W~rIGIOH

N

riN U

~ ~ c ~ m .-I a mne mn~ u rnm 1~
o~ o E La I I M tD rl M If11~01 N t0v-iN lL1tIW E A
H 'i U 'O

WO 95!27780 ~ ~ ~ ~ ~ / PCTIUS951D439J

Table 10. Inoculation of chimpanzees with ALVAC-RG

Weeks post- Animal 431 Animal 457 Inoculation I.M. S.C.

' 0 <88 <8 1 <8 <8 12b/0 16 8 a: Titer expressed as reciprocal of last dilution showing inhibition of fluorescence in an RFFI test b: Day of re-inoculation Example IO - I3~SUNIZATION OF HBMANS USING CANARYPOS

fALVAC-RG: yCP65) ALVAC-RG (vCP65) was generated as described in Example 9 and FIGS. 9A and 9B. For scaling-up and ' vaccine manufacturing ALVAC-RG (vCP65) was grown in , primary CEF derived from specified pathogen free eggs.
Cells were infected at a multiplicity of 0.1 and incubated at 37°C for three days.
The vaccine virus suspension was obtained by ultrasonic disruption in serum free medium of the infected cells; cell debris were then removed by centrifugation and filtration. The resulting clarified suspension was supplemented with lyophilization stabilizer (mixture of amino-acids), dispensed in single dose vials and freeze dried. Three batches of decreasing titer were prepared by ten-fold serial dilutions of the virus suspension in a mixture of serum free medium and lyophilization stabilizer, prior to lyophilization.
Quality control tests were applied to the cell substrates, media and virus seeds and final product with emphasis on the search for adventitious agents and inocuity in laboratory rodents. No undesirable trait was found.
Preclinical data. Studies in vitro indicated that VERO or MRC-5 calls do not support the growth of ALVAC-RG
(vCP65); a series of eight (VERO) and 10 (NmC) blind serial passages caused no detectable adaptation of the virus to grow in these non avian lines. Analyses of human cell lines (MRC-5, WISH, Detroit 532, HEL, HNK or EBV-transformed lymphoblastoid cells) infected or inoculated with ALVAC-RG (vCP65) showed no accumulation of virus specific DNA suggesting that in these cells the block in replication occurs prior to DNA synthesis.
Significantly, however, the expression of the rabies virus glycoprotein gene in all cell lines tested indicating that the abortive step in the canarypox replication cycle occurs prior to viral DNA replication.

218 7 2 0 ~ PCTlUS95/04394 The safety and efficacy of ALVAC-RG (vCP65) were documented in a series of experiments in animals. A

number of species including canaries, chickens, ducks, . geese, laboratory rodents (suckling and adult mice), hamsters, guinea-pigs, rabbits, cats and dogs, squirrel monkeys, rhesus macaques and chimpanzees, were inoculated with doses ranging from 105 to 10$ pfu. A variety of routes were used, most commonly subcutaneous, intramuscular and intradermal but also oral (monkeys and mice) and intracerebral (mice).

In canaries, ALVAC-RG (vCP65) caused a "take" lesion at the site of scarification with no indication of disease or death. Intradermal inoculation of rabbits resulted in a typical poxvirus inoculation reaction which did not spread and healed in seven to ten days. There was no adverse side effects due to canarypox in any of the animal tests. Immunogenicity was documented by the development of anti-rabies antibodies following inoculation of ALVAC-RG (vCP65) in rodents, dogs, cats, and primates, as measured by Rapid Fluorescent Focus Inhibition Test (RFFIT). Protection was also demonstrated by rabies virus challenge experiments in mice, dogs, and cats immunized with ALVAC-RG (vCP65).

Volunteers. Twenty-five healthy adults aged 20-45 with no previous history of rabies immunization were enrolled. Their health status was assessed by complete medical histories, physical examinations, hematological and blood chemistry analyses. Exclusion criteria included pregnancy, allergies, immune depression of any kind, chronic debilitating disease, cancer, injection of immune globins in the past three months, and , seropositivity to human immunodeficiency virus (HIV) or to hepatitis B virus surface antigen.

_ Study desian. Participants were randomly allocated to receive either standard Human Diploid Cell Rabies Vaccine (HDC) batch no E0751 (Pasteur Merieux Serums &

70 !1 Vaccine, Lyon, France) or the study vaccine ALVAC-RG
(vCP65).
The trial was designated as a dose escalation study.
Three batches of experimental ALVAC-RG (vCP65) vaccine were used sequentially in three groups of volunteers (Groups A, B and C) with two week intervals between each step. The concentration of the three batches was lb3's, -104's, 105~5 Tissue Culture Infectious Dose (TCID50) per dose, respectively.
Each volunteer received two doses of the same vaccine subcutaneously in the deltoid region at an interval of four weeks. The nature of the injected vaccine was not known by the participants at the time of the first injection but-was known by the investigator.
In order to minimize the risk of immediate hypersensitivity at the time of the second injection, the volunteers of Group B allocated to the medium dose of experimental vaccine were injected 1 h previously with the lower dose and those allocated to the higher dose (Group C) received successively the lower and the medium dose at hourly intervals.
Six months later, the recipients of the highest dosage of ALVAC-RG (vCP65) (Group C) and HDC vaccine were offered a third dose of vaccine; they were then randomized to receive either the same vaccine as previously or the alternate vaccine. As a result, four groups were formed corresponding to the following immunization scheme: 1. HDC, HDC - HDC; 2. HDC, HDC -ALVAC-RG (vCP65); 3. ALVAC-RG (vCP65), ALVAC-RG (vCP65) - HDC; 4. ALVAC-RG (vCP65), ALVAC-RG (vCP65), ALVAC-RG
(vCP65). .
Mon~tor~na of S~de Effects. .All subjects were .
monitored for 1 h after injection and re-examined every day for the next five days. They were asked to record local and systemic reactions for the next three weeks and were questioned by telephone two times a week.

WO 95127780 218 7 2 ~ ~ PCZ'rt1S95/04394 Laboratory Investicxa ~ra.Blood specimens were obtained before enrollment and two, four and six days after each injection. Analysis included complete blood cell count, liver enzymes and creatine kinase assays.

Alltibodv assays. Antibody assays were performed seven days prior to the first injection and at days 7, 28, 35, 56, 173, 187 and 208 of the study.

The levels of neutralizing antibodies to rabies were determined using the Rapid Fluorescent Focus Inhibition test (REFIT) (Smith et al., 1973). Canarypox antibodies were measured by direct ELISA. The antigen, a suspension of purified canarypox virus disrupted with 0.1% Triton X100, was coated in microplates. Fixed dilutions of the sera were reacted for two hours at room temperature and reacting antibodies were revealed with a peroxidase labelled anti-human IgG goat serum. The results are expressed as the optical density read a,t 490nm.

Analysis. Twenty-five subjects were enrolled and completed the study. There were 10 males and 15 females and the mean age was 31.9 (21 to 48). All but three subjects had evidence of previous smallpox vaccination;

the three remaining subjects had no typical scar and vaccination history. Three subjects received each of the lower doses of experimental vaccine (103'5 and 1045 TCID50), nine subjects received 105'5 TCIDSo and ten received the HDC vaccine.

Safety (Tab~e ~~~. During the primary series of immunization, fever greater than 37.7C was noted within 24 hours after injection in one HDC recipient (37.8C) and in one vCP65 105-5 TCIDSO recipient (38C). No other systemic reaction attributable to vaccination was observed in any participant.

Local reactions were noted in 9/10 recipients of HDC

_ vaccine injected subcutaneously and in 0/3, 1/3 and 9/9 recipients of vCP65 103'5, 1p4.5~ 105.5 TCIDSO, respectively.

WO 95127780 PCTlUS95104394 Tenderness was the most common symptoms and was always mild. Other local symptoms included redness and induration which were also mild and transient. All symptoms usually subsided within 24 hours and never , lasted more than 72 hours.
There was no significant change in blood cell counts, liver enzymes or creatine kinase values.
ne Responses ~Ieutralizina Antibodies to Rabies iTable i21. Twenty eight days after the first injection all the~HDC recipients had protective titers (~0.5 IU/ml). By contrast none in groups A and B (103'5 and 104'5 TCIDSO) and only 2/9 in group C (105'5 TCIDSp) ALVAC-RG (vCP65) recipients reached this protective titer.
At day 56 (i.e. 28 days after the second injection) protective titers were achieved in 0/3 of Group A, 2/3 of Group B and 9/9 of Group C recipients of ALVAC-RG (vCP65) vaccine and persisted in all 10 HDC recipients.
At day 56 the geometric mean titers were 0.05, 0.47, 4.4 and 11.5 IU/ml in groups A, B, C and HDC
respectively.
At day 180, the rabies antibody titers had substantially decreased in all subjects but remained above the minimum protective titer of 0.5 IU/ml in 5/10 HCD recipients and in 5/9 ALVAC-RG (vCP65) recipients;
the geometric mean titers were 0.51 and 0.45 IU/ml in groups HCD and C, respectively.
Antsbodies to the Ganarvnox virus (Table 131. The pre-immune titers observed varied widely with titers varying from 0.22 to 1.23 O.D. units despite the absence of any previous contact with canary birds in those subjects with the highest titers. When defined as a .
greater than two-fold increase between preimmunization and post second injection titers, a seroconversion was obtained in 1/3 subjects in group B and in 9/9 subjects in group C whereas no subject seroconverted in groups A
or HDC.

wo 95m~go 2.1 8 7 2 0 7 p~T~s9s~oa~9a Booster Injection. The vaccine was similarly well tolerated six months later, at the time of the booster injection: fever was noted in 2/9 HDC booster recipients and in 1/10 ALVAC-RG (vCP65) booster recipients. Local reactions were present in 5/9 recipients of HDC booster and in 6/10 recipients of the ALVAC-RG (vCP65) booster.

Observations. FIGS. 13A-13D shows graphs of rabies neutralizing antibody titers (Rapid Fluorescent Focus Inhibition Test or RFFIT, IU/ml): Booster effect of HDC

and vCP65 (105'5 TCIDSO) in volunteers previously immunized with either the same or the alternate vaccine.

Vaccines were given at days 0, 28 and 180. Antibody titers were measured at days 0, 7, 28, 35, 56, 173, and 187 and 208.

As shown in FIGS. 13A to 13D, the booster dose given resulted in a further increase in rabies antibody titers in every subject whatever the immunization scheme.

However, the ALVAC-RG (vCP65) booster globally elicited lower immune responses than the HDC booster and the ALVAC-RG (vCP65), ALVAC-RG (vCP65) - ALVAC-RG (vCP65) group had significantly lower titers than the three other groups. Similarly, the ALVAC-RG (vCP65) booster injection resulted in an increase in canarypox antibody titers in 3/5 subjects who had previously received the HDC vaccine and in all five subjects previously immunized with ALVAC-RG (vCP65).

In general, none of the local side effects from administration of vCP65 was indicative of a local replication of the virus. In particular, lesions of the skin such as those observed after injection of vaccine were absent. In spite of the apparent absence of replication of the virus, the injection resulted in the volunteers generating significant amounts of antibodies to both the canarypox vector and to the expressed rabies glycoprotein.

Rabies neutralizing antibodies were assayed with the Rapid Fluorescent Focus Inhibition Test (RFFIT) which is WO 95127780 2 ~ g 7 2 0 7 PCT/US95104394 known to correlate well with the sero neutralization test in mice. Of 9 recipients of 105'5 TCIDSO, five had low level responses after the first dose. Protective titers of rabies antibodies were obtained after the second injection in all recipients of the highest dose tested and even in 2 of the 3 recipients of the medium dose. In this study, both vaccines were given subcutaneously as usually recommended for live vaccines, but not for the inactivated HDC vaccine. This route of injection was selected as it best allowed a careful examination of the injection site, but this could explain the late appearance of antibodies in HDC recipients: indeed, none of the HDC recipients had an antibody increase at day 7, whereas, in most studies where HDC vaccine is give intramuscularly a significant proportion of subjects do (Klietmann et al., Int'1 Green Cross - Geneva, 1981;
Kuwert et al., Int'1 Green Cross - Geneva, 1981).
However, this invention is not necessarily limited to the subcutaneous route of administration.
The GMT (geometric mean titers) of rabies neutralizing antibodies was lower with the investigational vaccine than with the HDC control vaccine, but still well above the minimum titer required for protection. The clear dose effect response obtained with the three dosages used in this study suggest that a higher dosage might induce a stronger response.
Certainly from this disclosure the skilled artisan can select an appropriate dosage for a given patient.
The ability to boost the antibody response is another important result of this Example; indeed, an increase in rabies antibody titers was obtained in every f subject after the 6 month dose whatever the immunization scheme, showing that preexisting immunity elicited by either the canarypox vector or the rabies glycoprotein had no blocking effect on the booster with the recombinant vaccine candidate or the conventional HDC
rabies vaccine. This contrasts findings of others with WO95/27780 218 7 2 ~ ~ pCT/ITS95J04394 vaccinia recombinants in humans that immune response may be blocked by pre-existing immunity (Gooney et al., 1991;
Etinger et al., 1991).
Thus, this Example clearly demonstrates that a non-5 replicating poxvirus can serve as an immunizing vector in humans, with all of the advantages that replicating agents confer on the immune response, but without the safety problem created by a fully permissive virus.
10 TABLE 11: Reactions in the 5 days following vaccination vCP65 dosage 103'5 104-5 105'5 H
(TCID50) D
C
control i Injection 1st 2nd 1st 2nd 1st 2nd 1st 2nd 15 No. vaccinees 3 3 3 3 9 9 10 10 temp >37.7C 0 0 0 0 0 1 1 0 soreness 0 0 1 1 6 8 8 6 redness 0 0 0 0 0 4 5 4 induration 0 0 0 0 0 4 5 4 WO 95!27780 218 7 2 0 7 7 6 PCT/US95f04394 TABLE 12: Rabies neutralizing antibodies (REFIT; IU/ml) Individual titers and geometric mean titers (GMT) Days No. TCID50/ 0 7 28 35 56 dose 1 103'5 < 0.1 < 0.1 < 0.1 < 0.1 0.2 3 103'5 < 0.1 < 0.1 < 0.1 < 0.1 < 0.3 ' 4 103'5 < 0.1 < 0.1 < 0.1 < 0.1 < 0.1 G.M.T. < 0.1 < 0.1 < 0.1 < 0.1 < 0.1 6 104'5 < 0.1 < 0.1 < 0.1 < 0.1 < 0.1 7 104'5 < 0.1 < 0.1 < 0.1 2.4 1.9 10 104'5 < 0.1 < 0.1 < 0.1 1.6 1.1 G.M.T. < 0.1 < 0.1 0.1 0.58 0.47 11 105'5 < 0.1 < 0.1 1.0 3.2 4.3 13 105'5 < 0.1 < 0.1 0.3 6.0 8.8 14 105'5 < 0.1 < 0.1 0.2 2.1 9.4 17 105'5 < 0.1 < 0.1 < 0.1 1.2 2.5 18 105'5 < 0.1 < 0.1 0.7 8.3 12.5 20 105'5 < 0.1 < 0.1 < 0.1 0.3 3.7 21 105'5 < 0.1 < 0.1 0.2 2.6 3.9 23 105'5 < 0.1 < 0.1 < 0.1 1.7 4.2 105'5 < 0.1 < 0.1 < 0.1 0.6 0.9 G.M.T. < 0.1 < 0.1 0.16 1.9 4.4*

25 2 HDC < 0.1 < 0.1 0.8 7.1 7.2 5 HDC < 0.1 < 0.1 9.9 12.8 18.7 8 HDC < 0.1 < 0.1 12.7 21.1 16.5 9 HDC < 0.1 < 0.1 6.0 9.9 14.3 12 HDC < 0.1 < 0.1 5.0 9.2 25.3 15 HDC < 0.1 < 0.1 2.2 5.2 8.6 16 HDC < 0.1 < 0.1 2.7 7.7 20.7 19 HDC < 0.1 < 0.1 2.6 9.9 9.1 22 HDC < 0.1 < 0.1 1.4 8.6 6.6 -24 HDC < 0.1 < 0.1 0.8 5.8 4.7 I ~ G.M.T. ~ < 0.1 I < 0.1 I 2.96 I 9.0 I 11.5* ' ' I

* p = 0.007 student t test WO 95(27780 PCTIUS95J0439J

TABLE 13: Canarypox antibodies: ELISA Geometric Mean Titers*
Days ' 5 vCP65 0 7 28 35 56 dosage - TCID50/dose 103'5 D.69 ND 0.76 ND 0.68 104'5 0.49 0.45 0.56 0.63 0.87 105'5 0.38 0.38 0.77 1.42 1.63 HDC control 0.45 0.39 0.40 0.35 0.39 * optical density at 1/25 dilution 77354-69 (S) sample il - COMPARISON OF THE LDSO OF AhVAC AND NYOAC
WITS VARIOUS VACCINIA VIRUS STRAINS
ice. Male outbred Swiss Webster mice were purchased from Taconic Farms (Germantown, NY) and maintained on mouse chow and water sd libitum until use at 3 weeks of age ("normal" mice). Newborn outbred Swiss Webster mice were of both sexes and were obtained following timed pregnancies performed by Taconic Farms.
All newborn mice used were delivered within a two day period.
Viruses. ALVAC was derived by plaque purification of a canarypox virus population and was prepared in primary chick embryo fibroblast cells (CEF). Following purification by centrifugation over sucrose density gradients, ALVAC was enumerated for plaque forming units in CEF cells. The WR(L) variant of vaccinia virus was derived by selection of large plaque phenotypes of WR
(Panicali et al., 1981). The Wyeth New York State Board of Health vaccine strain of vaccinia virus was obtained from Pharmaceuticals Calf Lymph Type vaccine Dryvax control number 302001B. Copenhagen strain vaccinia virus VC-2 was obtained from Institut Merieux, France.
Vaccinia virus strain NYVAC was derived from Copenhagen VC-2. All vaccinia virus strains except the Wyeth strain were cultivated in Vero African green monkey kidney cells, purified by sucrose gradient density centrifugation and enumerated for plaque forming units on Vero cells. The Wyeth strain was grown in CEF cells and enumerated for plaque forming units in CEF cells.
Inoculations: Groups of 10 normal mice were inoculated intracranially (ic) with 0.05 ml of one of several dilutions of virus prepared by 10-fold serially diluting the stock preparations in sterile phosphate-buffered saline. In some instances, undiluted stock virus preparation was used for inoculation.
*Trade-mark W O 95!27780 218 7 2 0 7 PCT~S95104394 Groups of 10 newborn mice, 1 to 2 days old, were inoculated is similarly to the normal mice except that an injection volume of 0.03 ml was used.

All mice were observed daily for mortality for a period of 14 days (newborn mice) or 21 days (normal mice) after inoculation. Mice found dead the morning following inoculation were excluded due to potential death by trauma.

The lethal dose required to produce mortality for 50% of the experimental population (LDsp) was determined by the proportional method of Reed and Muench.

Comparison of the LDS~ of ALVAC and NYVAC with Various Vaccinia Virus Strains for Normal. Younct Outbred Mice by the is Route. In young, normal mice, the virulence of NYVAC and ALVAC were several orders of magnitude lower-than the other vaccinia virus strains tested (Table 14). NYVAC and ALVAC were found to be over 3,000 times less virulent in normal mice than the Wyeth strain; over 12,500 times less virulent than the parental VC-2 strain; and over 63,OOD,D00 times less virulent than the WR(L) variant. These results would suggest that NYVAC is highly attenuated compared to other vaccinia strains, and that ALVAC is generally nonvirulent for young mice when administered intracranially, although both may cause mortality in mice at extremely high doses (3.85x108 PFUs, ALVAC and 3x108 PFUs, NYVAC) by an undetermined mechanism by this route of inoculation.

Comparison of the LDS~ of ALVAC and NYVAC with Various Vaccinia Virus Strains for Newborn Outbred Mice by the is Route. The relative virulence of 5 poxvirus . strains for normal, newborn mice was tested by titration _ in an intracranial (ic) challenge model system (Table 15). With mortality as the endpoint, LDSD values indicated that ALVAC is over 100,000 times less virulent than the Wyeth vaccine strain of vaccinia virus; over 200,000 times less virulent than the Copenhagen VC-2 strain of vaccinia virus; and over 25,000,000 times less WO 95!27780 218 7 2 0 7 PCT/U595104394 virulent than the WR-L variant of vaccinia virus.
Nonetheless, at the highest dose tested, 6.3x107 PFUs, 100% mortality resulted. Mortality rates of 33.3% were observed at 6.3x106 PFUs. The cause of death, while not 5 actually determined, was not likely of toxicological or traumatic nature since the mean survival time (MST) of mice of the highest dosage group (approximately 6.3 LDSo) was 6.7 ~ 1.5 days. When compared to WR(Lj at a challenge dose of 5 LDSp, wherein MST is 4.8 t 0.6 days, 10 the MST of ALVAC challenged mice was significantly longer (P=0.001).
Relative to NYVAC, Wyeth was found to be over 15,000 times more virulent; VC-2, greater than 35,000 times more virulent; and WR(L), over 3,000,000 times more virulent.
15 Similar to ALVAC, the two highest doses of NYVAC, 6x108 and 6x107 PFUs, caused 100% mortality. However, the MST
of mice challenged with the highest dose, corresponding to 380 LD50, was only 2 days (9 deaths on day 2 and 1 on day 4). In contrast, all mice challenged with the 20 highest dose of WR-L, equivalent to 500 LDSp, survived to day 4.

W0 95127780 PCTlUS95f0439:1 Table 14. Calculated 50% Lethal Dose for mice by various vaccinia virus strains and for canarypox virus (ALVAC) by the is route.
POXVIRUS CALCULATED
STRAIN LDSO (PFUs) WR(L) 2.5 VC-2 1.26x104 WYETH 5.00X104 NYVAC 1.58x108 ALVAC 1.58x108 L
fable 15. Calculated 50% Lethal Dose for newborn mice by various vaccinia virus strains and for canarypox virus (ALVAC) by the is route.
POXVIRUS CALCULATED
STRAIN LD50 (PFUs) WR(L) 0.4 VC-2 0.1 WYETH 1.6 NYVAC 1.58x106 ALVAC 1.00x107 77354-69 (S) ~z~pie i2 - EVAi~UATZON OF NYVAC (vP866) lIND NYVAC-RG
(VP879) ~nmunoprecioitations. Preformed monolayers of avian or non-avian cells were inoculated with 10 pfu per cell of parental NYVAC (vP866) or NYVAC-RG (vP8~9) virus. The inoculation was performed in EMEM free of methionine and supplemented with 2% dialyzed fetal bovine serum. After a one hour incubation, the inoculum was removed and the medium replaced with EMEM (methionine free) containing 20 ~Ci/ml of 35S-methionine. After an overnight incubation of approximately 16 hours, cells were lysed by the addition of Buffer A (1% Nonidet*P-40, 10 mM Tris pH7.4, 150 mM NaCl, 1 mM EDTA, 0.01% sodium azide, 500 units per ml of aprotinin, and 0.02% phenyl methyl sulfonyl fluoride). Immunoprecipitation was performed using a rabies glycoprotein specific monoclonal antibody designated 24-3F10 supplied by Dr. C. Trimarchi, Griffith Laboratories, New York State Department of Health, Albany, New York, and a rat anti-mouse conjugate obtained from Boehringer Mannheim Corporation (Cat. X605-500).
Protein A Sepharose CL-48 obtained from Pharmacia LKB
Biotechnology Inc., Piscataway, New Jersey, was used as a support matrix: Immunoprecipitates were fractionated on 10% polyacrylamide gels according to the method of Dreyfuss et. al. (1984). Gels were fixed, treated for fluorography with 1M Na-salicylate for one hour, and exposed to Kodak*XAR-2 film to visualize the immunoprecipitated protein species..
,sources of Animals. New Zealand White rabbits were obtained from Hare-Marland (Hewitt, New Jersey). Three week old male Swiss Webster outbred mice, timed pregnant female Swiss Webster outbred mice, and four week old Swiss Webster nude (nu+nu+) mice were obtained from Taconic~Farms, Inc. (Germantown, New York). AlI animals were maintained according to NIH guidelines. All animal protocols were approved by the institutional IACUC. When *Trade-mark WO 95!27780 7 PCT/US95/0439d deemed necessary, mice which were obviously terminally ill were euthanized.

E~aluat~on of Lesions in Rabbsts. Each of two rabbits was inoculated intradermally at multiple sites with 0.1 ml of PBS containing 104 or 108 , , , , pfu of each test virus or with PBS alone. The rabbits were observed daily from day 4 until lesion resolution.

Indurations and ulcerations were measured and recorded.

Virus Recovery from Inoculation Sites. A single rabbit was inoculated intradermally at multiple sites of 0/1 ml of PBS containing 106 or 108 pfu of each test , , virus or with PBS alone. After 11 days, the rabbit was euthanized and skin biopsy specimens taken from each of the inoculation sites were aseptically prepared by mechanical disruption and indirect sonication for virus recovery. Infectious virus was assayed by plaque titration on CEF monolayers.

Virulence in Mice. Groups of ten mice, or five in the nude mice experiment, were inoculated ip with one of several dilutions of virus in 0.5 ml of sterile PBS.

Reference is also made to Example li.

~clonhosph wide fCYI Treatment. Mice were injected by the ip route with 4 mg (0.02 ml) of CY (SIGMA) on day -2, followed by virus injection on day 0. On the following days post infection, mice were injected ip with CY: 4 mg on day 1; 2 mg on days 4, 7 and 11; 3 mg on days 14, 18, 21, 25 and 28. Immunosuppression was indirectly monitored by enumerating white blood cells with a Coulter Counter on day 11. The average white blood cell count was 13,500 cells per ~.1 for untreated mice (n=4) and 4,220 cells per ul for CY-treated control mice (n=5).

Calculation of LD50. The lethal dose required to produce 50% mortality (LD50) was determined by the proportional method of Reed and Muench (Reed and Muench 1938).

Potency Testing of NWAC RG in Mice. Four to six week old mice were inoculated in the footpad with 50 to WO 95/27780 2 ~ g 7 2 0 7 PCT/US95104394 100 ~tl of a range of dilutions (2.0 - 8.0 1og10 tissue culture infective dose 50% (TCID50)) of either W-RG
(Kieny et al., 1984), ALVAC-RG (Taylor et al., 1991b), or the NYVAC-RG. Each group consisted of eight mice. At 14 days post-vaccination, the mice were challenged by intracranial inoculation with 15 LD50 of the rabies virus .
CVS strain (0.03 ml). On day 28, surviving mice were counted and protective does 50% (PD50) calculated.
nPr;vat;nn of NYVAC fvP866).The NYVAC strain of l0 vaccinia virus was generated from VC-2, a plaque cloned isolate of the COPENHAGEN vaccine strain. To generate NYVAC from VC-2, eighteen vaccinia ORFs, including a number of viral functions associated with virulence, were precisely deleted in a series of sequential manipulations as described earlier in this disclosure. These deletions were constructed in a manner designed to prevent the appearance of novel unwanted open reading frames. FIG.
10 schematically depicts the ORFs deleted to generate NYVAC. At the top of FIG. 10 is depicted the ~,gdIII
restriction map of the vaccinia virus genome (VC-2 plaque isolate, COPENHAGEN strain). Expanded are the six regions of VC-2 that were sequentially deleted in the generation of NYVAC. The deletions were described earlier in this disclosure (Examples 1 through 6). Below such deletion locus is listed the ORFs which were deleted from that locus, along with the functions or homologies and molecular weight of their gene products.
ReDl~cation Studies of NYVAC and ALVAC on Human Tissue Cell Lines. In order_to determine,the level of replication of NYVAC strain of vaccinia virus (vP866) in cells of human origin, six cell lines were inoculated at , an input multiplicity of 0.1 pfu per cell under liquid culture and incubated for 72 hours. The COPENHAGEN
parental clone (VC-2) was inoculated in parallel. _ Primary chick embryo fibroblast (CEF) cells (obtained from 10-11 day old embryonated eggs of SPF origin, Spafas, Inc., Storrs, CT) were included to represent a WO 95f27780 2 .18 7 2 0 7 PCT/US95/04394 permissive cell substrate for all viruses. Cultures were analyzed on the basis of two criteria: the occurrence of productive viral replication and expression of an extrinsic antigen.

5 The replication potential of NYVAC in a number of human derived cells are shown in Table 16. Both VC-2 and NYVAC are capable of productive replication in CEF cells, although NYVAC with slightly reduced yields. VC-2 is also capable of productive replication in the six human 10 derived cell lines tested with comparable yields except .

in the EBV transformed lymphoblastoid cell line JT-1 (human lymphoblastoid cell line transformed with Epstein-Barr virus, see Rickinson et al., 1984). In contrast, NYVAC is highly attenuated in its ability to productively 15 replicate in any of the human derived cell lines tested.

Small increases of infectious virus above residual virus levels were obtained from NYVAC-infected MRC-5 (ATCC

,~CCL171, human embryonic lung origin), DETROIT 532 (ATCC

#CCL54, human foreskin, Dawns Syndrome), HEL 299 (ATCC

20 #CCL137, human embryonic lung cells) and HNK (human neonatal kidney cells, Whittiker Bioproducts, Inc.

Walkersville, MD, Cat ,~70-151) cells. Replication on these cell lines was significantly reduced when compared to virus yields obtained from NYVAC-infected CEF cells or 25 with parental VC-2 (Table 16). It should be noted that the yields at 24 hours in CEF cells for both NYVAC and VC-2 is equivalent to the 72-hour yield. Allowing the human cell line cultures to incubate an additional 48 hours (another two viral growth cycles) may, therefore, 30 have amplified the relative virus yield obtained.

Consistent with the low levels of virus yields obtained in the human-derived cell lines, MFtC-5 and DETROIT 532, detectable but reduced levels of NYVAC-specific DNA accumulation were noted. The level of DNA

35 accumulation in the 1~2C-5 and DETROIT 532 NYVAC-infected cell lines relative to that observed in NYVAC-infected CEF cells paralleled the relative virus yields. NYVAC-WO 95f27780 2 1 8 7 2 0 7 PCTIUS95I04394 specific viral DNA accumulation was not observed in any of the other human-derived cells.
An equivalent experiment was also performed using the avipox virus, ALVAC. The results of virus replication are also shown in Table 16. No progeny virus was detectable in any of the human cell lines consistent with the host range restriction of canarypox virus to avian species. Also consistent with a lack of productive replication of ALVAC in these human-derived cells is the observation that no ALVAC-specific DNA accumulation was detectable in any of the human-derived cell lines.
,f babies Glycoorotein by NYVAC-RG
jvP8791 in Human Cells. In order to determine whether efficient expression of a foreign gene could be obtained in the absence of significant levels of productive viral replication, the same cell lines were inoculated with the NYVAC recombinant expressing the rabies virus glycoprotein (vP879, Example 7) in the presence of 35S-methionine. Immunoprecipitation of the rabies glycoprotein was performed from the radiolabelled culture lysate using a monoclonal antibody specific for the rabies glycoprotein. Immunoprecipitation of a 67kDa protein was detected consistent with a fully glycosylated form of the rabies glycopratein. No serologically crossreactive product was detected in uninfected or parental NYVAC infected cell lysates. Equivalent results were obtained with all other human cells analyzed.
Tnocu~a ions on the Rabbit Skin. The induction and nature of skin lesions on rabbits following intradermal (id) inoculations has been previously used as a measure of pathogenicity of vaccinia virus strains (Buller et , al., 1988; Child et al., 1990; Fenner, 1958, Flexner et al., 1987; Ghendon and Chernos 1964). Therefore, the nature of lesions associated with id inoculations with the vaccinia strains WR (ATCC #VR119 plaque purified on CV-1 cells, ATCC #CCL7o, and a plaque isolate designated h variant, ATCC #VR2035 selected, as described in Panicali et al., 1981)), WYETH (ATCC #VR325 marketed as DRYVAC by Wyeth Laboratories, Marietta, PA), COPENHAGEN

(VC-2), and NYVAC was evaluated by inoculation of two rabbits (A069 and A128). The two rabbits displayed different overall sensitivities to the viruses, with rabbit A128 displaying less severe reactions than rabbit A069. In rabbit A128, lesions were relatively small and resolved by 27 days post-inoculation. On rabbit A069, lesions were intense, especially for the WR inoculation sites, and resolved only after 49 days. Intensity of the lesions was also dependent on the location of the inoculation sites relative to the lymph drainage network.

In particular, all sites located above the backspine displayed more intense lesions and required longer times to resolve the lesions located on the flanks. All lesions were measured daily from day 4 to the disappearance of the last lesion, and the means of maximum lesion size and days to resolution were calculated (Table 17). No local reactions were observed from sites injected with the control PBS. Ulcerative lesions were observed at sites injected with WR, VC-2 and WYETH vaccinia virus strains. Significantly, no induration or ulcerative lesions were observed at sites of inoculation with NYVAC.

persistence of In P t:n"s Virus at the Site of Inoculation. To assess the relative persistence of these viruses at the site of inoculation, a rabbit was inoculated intradermally at multiple sites with 0.1 ml PBS containing 106, 107 or 108 pfu of VC-2, WR, WYETH or NYVAC. For each virus, the 107 pfu dose was located above the backspine, flanked by the 106 and 108 doses. Sites of inoculation were observed daily for li days. WR elicited the most intense response, followed by VC-2 and WYETH

(Table 18). Ulceration was first observed at day 9 for WR and WYETH and day 10 for VC-2. Sites inoculated with NYVAC or control PBS displayed no induration or ulceration. At day 11 after inoculation, skin samples from the sites of inoculation were excised, mechanically disrupted, and virus was titrated on CEF-cells. The results are shown in Table 18. In no case was more virus recovered at this timepoint than was administered.
Recovery of vaccinia strain, WR, was approximately 106 pfu of virus at each site irrespective of amount of virus administered. Recovery of vaccinia strains WYETH and VC-2 was 103 to 104 pfu regardless of amount administered.
No infectious virus was recovered from sites inoculated with NYVAC.
Tn~~"~at;nn of Geneticallv or Chemicallv Immune Deficient Mice. Intraperitoneal inoculation of-high doses of NYVAC (5 X 108 pfu) or ALVAC (109 pfu) into nude mice caused no deaths, no lesions, and no apparent disease through the 100 day observation period. In contrast,- mice inoculated with WR (103 to 104 pfu), WYETH
(5 x 107 or 5 x 108 pfu) or VC-2 (104 to 109 pfu) displayed disseminated lesions typical of poxviruses first on the toes, then on the tail, followed by severe orchitis in some animals. In mice infected with WR or WYETH, the appearance of disseminated lesions generally led to eventual death, whereas most mice infected with VC-2 eventually recovered. Calculated LDSp values are given in Table 19.
In particular, mice inoculated with VC-2 began to display lesions on their toes (red papules) and 1 to 2 days later on the tail. These lesions occurred between 11 and 13 days post-inoculation (pi) in mice given the highest doses (109, 108, 107 and 106 pfu), on day 16 pi in mice given 105 pfu and on day 21 pi in mice given 104 pfu.
No lesions were observed in mice inoculated with 103 and 102 pfu during the 100 day observation period. Orchitis , was noticed on day 23 pi in mice given 109 and 10a pfu, , and approximately 7 days later in the other groups (107 to 104 pfu). Orchitis was especially intense in the 109 and lOa pfu groups and, although receding, was observed until the end of the 100 day observation period. Some WO 95J27780 2 1 8 7 L ~ ~ p~~S9510439d pox-like lesions were noticed on the skin of a few mice, occurring around 30-35 days pi. Most pox lesions healed normally between 60-90 days pi. Only one mouse died in the group inoculated with 109 pfu (Day 34 pi) and one mouse died in the group inoculated with 108 pfu (Day 94 pi). No other deaths were observed in the VC-2 inoculated mice.

Mice inoculated with 104 pfu of the WR strain of vaccinia started to display pox lesions on Day 17 pi.

These lesions appeared identical to the lesions displayed by the VC-2 injected mice (swollen toes, tail). Mice inoculated with 103 pfu of the WR strain did not develop lesions until 34 days pi. Orchitis was noticed only in the mice inoculated with the highest dose of WR (104 pfu). During the latter stages of the observation period, lesions appeared around the mouth and the mice stopped eating. All mice inoculated with 104 pfu of WR

died or were euthanized when deemed necessary between 21 days and 31 days pi. Four out of the 5 mice injected with 103 pfu of WR died or were euthanized when deemed necessary between 35 days and 57 days pi. No deaths were observed in mice inoculated with lower doses of WR (1 to 100 pfu).

Mice inoculated with the WYETH strain of vaccinia virus at higher doses 5 x 107 and 5 x 108 pfu) showed lesions on toes and tails, developed orchitis, and died.

Mice injected with 5 x 106 pfu or less of WYETH showed no signs of disease or lesions.

As shown in Table 19, CY-treated mice provided a more sensitive model for assaying poxvirus virulence than did nude mice. LD50 values for the WR, WYETH, and VC-2 - vaccinia virus strains were significantly lower in this model system than in the nude mouse model. Additionally, - lesions developed in mice injected with WYETH, WR and VC-2 vaccinia viruses, as noted below, with higher doses of each virus resulting in more rapid formation of lesions.

As was seen with nude mice, CY-treated mice injected with WO 95127780 218 7 2 0 7 PCTlUS95/04394 NYVAC or AhVAC did not develop lesions. However, unlike nude mice, some deaths were observed in CY-treated mice challenged with NYVAC or ALVAC, regardless of the dose.
These random incidences are suspect as to the cause of 5 death.
Mice injected with all doses of WYETH (9.5 x 104 to , 9.5 x 108 pfu) displayed pox lesions on their tail and/or ' on their toes between 7 and 15 days pi. In addition, the tails and toes were swollen. Evolution of lesions on the 10 tail was typical of pox lesions with formation of a papule, ulceration and finally formation of a scab. Mice inoculated with all doses of VC-2 (1.65 x 105 to 1.65 x 109) also developed pox lesions on their tails and/or their toes analogous to those of PIYETH injected mice.
15 These lesions were observed between 7-12 days post inoculation. No lesions were observed on mice injected with lower doses of WR virus, although deaths occurred in these groups.
--le-~~".. ~f NYVAC-RG. In order to determine 20 that attenuation of the COPENHAGEN strain of vaccinia virus had been effected without significantly altering the ability of the resulting NYVAC strain to be a useful vector, comparative potency tests were performed. In order to monitor the immunogenic potential of the vector 25 during the sequential genetic manipulations performed to attenuate the virus, a rabiesvirus glycoprotein was used as a reporter extrinsic antigen. The protective efficacy of the vectors expressing the rabies glycoprotein gene was evaluated in the standard NIH mouse potency test for 30 rabies (Seligmann, 1973). Table 20 demonstrates that the pDgo values obtained with the highly attenuated NYVAC
vector are identical to those obtained using a , COPENHAGEN-based recombinant containing the rabies glycoprotein gene in the tc locus (Kieny et al., 1984) 35 and similar to PDSp values obtained with ALVAC-RG, a canarypox based vector restricted to replication to avian species.

- PCTlIlS95/0439J

Obse vat;nn~. NYVAC, deleted of known virulence genes and having restricted in vitro growth characteristics, was analyzed in animal model systems to assess its attenuation characteristics. These studies were performed in comparison with the neurovirulent vaccinia virus laboratory strain, WR, two vaccinia virus vaccine strains, WYETH (New York City Board of Health) and COPENHAGEN (VC-2), as well as with a canarypox, virus strain, ALVAC (See also Example li). Together, these viruses provided a spectrum of relative pathogenic potentials in the mouse challenge model and the rabbit skin model, with WR being the most virulent strain, WYETH

and COPENHAGEN (VC-2j providing previously utilized attenuated vaccine strains with documented characteristics, and ALVAC providing an exam l f p e o a poxvirus whose replication is restricted to avian species. Results from these in vivo analyses clearly demonstrate the highly attenuated properties of NYVAC

relative to the vaccinia virus strains, WR, WYETH and COPENHAGEN (VC-2) (Tables 14-20). Significantly, the LDSo values for NYVAC were comparable to those observed with the avian host restricted avipoxvirus, ALVAC. Deaths due to NYVAC, as well as ALVAC, were observed only when extremely high doses of virus were administered via the intracranial route (Example 11, Tables 14, 15, 19). It has not yet been established whether these deaths were due to nonspecific consequences of inoculation of a high protein mass. Results from analyses in immunocompromised mouse models (nude and CY-treated) also demonstrate the relatively high attenuation characteristics of NYVA

C, as , compared to WR, WYETH and COPENHAGEN strains (Tables 17 and 18). Significantly, no evidence of disseminated vaccinia infection or vaccinial disease was observed in , NYVAC-inoculated animals or ALVAC-inoculated animals ov er the observation period. The deletion of multiple virulence-associated genes in NYVAC shows a synergistic effect with respect to pathogenicity. Another measure of WO 95!27780 218 ~ ~ ~ ~ PCTlUS95104394 i the inocuity of NYVAC was provided by the intradermal administration on rabbit skin (Tables 17 and 18).
Considering the results with ALVAC, a virus unable to replicate in nonavian species, the ability to replicate , at the site of inoculation is not the sole correlate with reactivity, since intradermal inoculation of ALVAC caused areas of induration in a dose dependent manner.
,Therefore, it is likely that factors other than the replicative capacity of the virus contribute to the formation of the lesions. Deletion of specific virulence-associated genes in NYVAC prevents lesion occurrence.
Together, the results in this Example and in foregoing Examples, including Example 11, demonstrate the highly attenuated nature of NYVAC relative to WR, and the previously utilized vaccinia virus vaccine strains, WYETH
and COPENHAGEN. In fact, the pathogeniF profile of NYVAC, in the animal model systems tested, was similar to that of ALVAC, a poxvirus known to productively replicate only in avian species. The apparently restricted capacity of NYVAC to productively replicate on cells derived from humans (Table 16) and other species, including the mouse, swine, dog and horse, provides a considerable barrier that limits or prevents potential transmission to unvaccinated contacts or to the general environment in addition to providing a vector with reduced probability of dissemination within the vaccinated individual.
Significantly, NYVAC-based vaccine candidates have been shown to be efficacious. NYVAC recombinants expressing foreign gene products from a number of pathogens have elicited immunological responses towards the foreign gene products in several animal species, including primates. In particular, a NYVAC-based , recombinant expressing the rabies glycoprotein was able to protect mice against a lethal rabies challenge. The potency of the NYVAC-based rabies glycoprotein WO 95127780 ~ PCTlIJS95l0439d recombinant was comparable to the PDSp value for a COPENHAGEN-based recombinant containing the rabies glycoprotein in the tk locus (Table 20). NYVAC-based recombinants have also been shown to elicit measles virus neutralizing antibodies in rabbits and protection against , pseudorabies virus and Japanese encephalitis virus challenge in swine. The highly attenuated NYVAC strain confers safety advantages with human and veterinary applications (Tartaglia et al., 1992). Furthermore, the use of NYVAC as a general laboratory expression vector system may greatly reduce the biological hazards associated with using vaccinia virus.

By the following criteria, the results of this Example and the Examples herein, including Example il, show NYVAC to be highly attenuated: a) no detectable induration or ulceration at site of inoculation (rabbit skin); b) rapid clearance of infectious virus from intradermal site of inoculation (rabbit skin); c) absence of testicular inflammation (nude mice); d) greatly reduced virulence (intracranial challenge, both three-week old and newborn mice); e) greatly reduced pathogenicity and failure to disseminate in immunodeficient subjects (nude and cyclophosphamide treated mice); and f) dramatically reduced ability to replicate on a variety of human tissue culture cells.

Yet, in spite of being highly attenuated, NYVAC, as a vector, retains the ability to induce strong immune responses to extrinsic antigens.

W0 95127780 94 PCT/eJS95104394 TABLE 16- Replication of COPENHAGEN (VC-2), NYVAC
and ALVAC in avian or human derived cell -lines Cells Hours YieldB %

infection VC-2 NYVAC ALVAC Yield CEF 0 3.8b 3.7 4.5 24 8.3 7.8 6.6 48 8.6 7.9 7.7 72 8.3 7.7 7.5 25 72A <1.4 1.8 3.1 MRC-5 0 3.8 3.8 4.7 72 7.2 4.6 3.8 0.25 72A 2.2 2.2 3.7 WISH* 0 3.4 3.4 4.3 72 7.6 2.2 3.1 0.0004 72A -d 1.9 2.9 DETROIT 0 3.8 3.7 4.4 72 7.2 5.4 3.4 1.6 72A 1.7 1.7 2.9 HEL 0 3.8 3.5 4.3 72 7.5 4.6 3.3 0.125 72A 2.5 2.1 3.6 JT-1 0 3.1 3.1 4.1 72 6.5 3.1 4.2 0.039 72A 2.4 2.1 4.4 HNK 0 3.8 3.7 4.7 72 7.6 4.5 3.6 0.079 72A 3.1 2.7 3.7 a: Yield of NYVAC at 72 hours post-infection expressed as a percentage of yield of VAC-2 after 72 hours on the same cell line.
b: Titer expressed as LOG50 pfu per ml. , c: Sample was incubated in the presence of 40~Cg/ml of _ cytosine arabinoside.
d: Not determined.
*: ATCC ~CCL25 Human amnionic cells.

w0 9512778U g5 218 7 2 0 7 PCT~S9510439J
Table 17. Induration and ulceration at the site of intradermal inoculation of the rabbit skin INDURA TION ULCER ATION

VIRUS DOSEa STRAIN Sizeb Days Size Days 10~ 877 35 204 35 WYETH 104 32 5 - a --10~ 202 17 3 24 105 86 8 __ __ 10~ 167 21 6 10 105 -- __ __ __ 106 -- -- __ -_ 10~ -- -- -- --108 __ __ -_ __ j pfu of indicated vaccinia virus in 0.1 ml PBS
inoculated intradermally into one site'.
' 30 mean maximum size of lesions (mma) mean time after inoculation for complete healing of lesion.
no lesions discernible.

WO 95127780 218 7 2 0 7 PCTlUS95104394 Table 18. Persistence of poxviruses at the site of intradermal inoculation Virus Inoculum Dose Total Virus Recovered WR 8.0 6.14 7.0 6.26 6.0 6.21 WYETH 8.0 3.66 7.0 4.10 6.0 3.59 VC-2 8.0 4.47 7.0 4.74 6.0 3.97 NYVAC 8.0 0 7.0 0 6.0 0 a: expressed as 1og10 pfu.
ao WO 95(27780 PCTlUS95/04394 Table 19. Virulence studies in immunocompromised mice Poxvirus LD

,. 5 Strain Nude mice Cyclophosphamide treated mice VC-2 >109 <1.65 x 105 WYETH 1.58 x 107 1.83 x 106 NYVAC >5.50 x 108 7.23 x 108 I ALVAC ~ >109 I 25.00 x 108b a: Calculated 50% lethal dose (pfu) for nude or cyclophosphamide treated mice by the indicated Vaccinia viruses and for ALVAC by intraperitoneal route.

b: 5 out of 10 mice died at the highest dose of 5 x 108 pfu.
Table 20. Comparative efficacy of NYVAC-RG and ALVAC-RG in mice Recombinant PD

W-RG 3 . 74 ALVAC-RG 3.86 -_-._ -NYVAC-RG ~ 3.70 a: Four to six week old mice were inoculated in the footpad with 50-100~a1 of a range of dilutions (2.0 -8.0 1og10 tissue culture infection dose 50% (TCIDgO) of either the W-RG (Kieny et al., 1984), ALVAC-RG
(vCP65) or NYVAC-RG (vP879). At day 14, mice of each group were challenged by intracranial inoculation of 30u1 of a live CVS strain rabies virus corresponding to 15 lethal dose 50% (LD50) per ' mouse. At day 28, surviving mice were counted and a . 40 protective dose 50% (PD50) was calculated.

EBamDxe 13 - CONSTRUCTION OF TROVAC RECOMBINANTS
EBPRESSING THE HEMAGGLUTININ GLYCOPROTEINS
OF AVIAN INFLUENZA VIRUSES
This Example describes the development of fowlpox virus recombinants expressing the hemagglutinin genes of three serotypes of avian influenza virus. ;
Cells and Viruses. Plasmids containing cDNA clones of the H4, H5 and H7 hemagglutinin genes were obtained from Dr. Robert Webster, St. Jude Children's Research Hospital, Memphis, Tennessee. The strain of FPV
designated FP-1 has been described previously (Taylor et al., 1988a, b). It is a vaccine strain useful in vaccination of day old chickens. The parental virus strain Duvette was obtained in France as a fowlpox scab from a chicken. The virus was attenuated by approximately 50 serial passages in chicken embryonated eggs followed by 25 passages on chick embryo fibroblast (CEF) cells. This virus was obtained in September 1980 by Rhone Merieux, Lyon, France, and a master viral seed established. The virus was received by Virogenetics in September 1989, where it was subjected to four successive plaque purifications. One plaque isolate was further amplified in primary CEF cells and a stock virus, designated as TROVAC, was established. The stock virus used in the in vitro recombination test to produce TROVAC-AIHS (vFP89) and TROVAC-AIH4 (vFP92) had been further amplified though 8 passages in primary CEF cells.
The stock virus used to produce TROVAC-AIH7 (vFP100) had been further amplified through 12 passages in primary CEF
cells.
Construction of Fowlpox Insertion Plasmid at F8 Locus. Plasmid pRW731.15 contains a 10 kbp III-Pv~II
fragment cloned from TROVAC genomic DNA. The nucleotide , sequence was determined on both strands for a 3659 by III- ccRV fragment. This sequence is shown in FIG. 11 (SEQ ID N0:48). The limits of an open reading frame designated in this laboratory as F8 were determined WO95f27780 O~ PCT/C1595/U4394 within this sequence. The open reading frame is initiated at position 495 and terminates at position 1887. A deletion was made from position 779 to position 1926, as described below.
Plasmid pRW761 is a sub-clone of pRW731.15 ~ containing a 2430 by coRV-EcoRV fragment. Plasmid pRW761 was completely digested with XbaI and partially digested with SstiI. A 3700 by y~~a_I-SspI band was isolated and ligated with the annealed double-stranded oligonucleotides JCA017 (SEQ ID N0:37) and JCA018 (SEQ ID
N0:38).
JCA017 (SEQ ID N0:37) 5' CTAGACACTTTATGTTTTTTAATAT
CCGGTCTTAAAAGCTTCCCGGGGATCCTTATACGGGGAATAAT 3' JCA018 (SEQ ID N0:38) 5' ATTATTCCCCGTATAAGGATCCCCCGGGAA
GCTTTTAAGACCGGATATTAAAAAACATAAAGTGT 3' The plasmid resulting from this ligation was designated pJCA002. Plasmid pJCA004 contains a non-pertinent gene linked to the vaccinia virus H6 promoter in plasmid pJCA002. The sequence of the vaccinia virus 2o H6 promoter has been previously described (Taylor et al., 1988a, b; Guo et al. 1989; Perkus et al., 1989). Plasmid pJCA004 was digested with coRV and ~a HI which deletes the non-pertinent gene and a portion of the 3' end of the H6 promoter. Annealed oligonucleotides RW178 (SEQ ID
N0:49) and RW179 (SEQ ID N0:50) were cut with coRV and CHI and inserted between the EcoRV and BamHI sites of JCA004 to form pRW846.
RW178 (SEQ ID N0:49): 5' TCATTATCGCGATATCCGTGTTAA
CTAGCTAGCTAATTTTTATTCCCGGGATCCTTATCA 3' RW179 (SEQ ID NO:50): 5' GTATAAGGATCCCGGGAATAAAAAT
TAGCTAGCTAGTTAACACGGATATCGCGATAATGA 3' Plasmid pRW846 therefore contains the H6 promoter 5' of EcoRV in the de-ORFed F8 locus. The incII site 3' of WO 95/27780 2 ~ g 7 2 r~ 7 PCTIUS95104394 the H6 promoter in pRW846 is followed by translation stop codons, a transcriptional stop sequence recognized by vaccinia virus early promoters (Yuen et al., 1987) and a I site.
Construction of Fowlpox Insertion Plasmid at F7 Locus. The original F7 non-de-ORFed insertion plasmid, pRW731.13, contained a 5.5 kb FP genomic g~II fragment in the vuII site of pUC9. The insertion site was a unique ~cII site within these sequences. The nucleotide sequence shown in FIG. 12 (SEQ ID N0:51) was determined for a 2356 by region encompassing the unique ~cII site. Analysis of this sequence revealed that the unique ~,y~cII site (FIG. 12, underlined) was situated within an ORF encoding a polypeptide of 90 amino acids.
The ORF begins with an ATG at position 1531 and terminates at position 898 (positions marked by arrows in FIG. 12).
The arms for the de-ORFed insertion plasmid were derived by PCR using pRW731.13 as template. A 596 by arm (designated as HB) corresponding to the region upstream from the ORF was amplified with oligonucleotides F73PH2 (SEQ ID N0:52) (5'-GACAATCTAAGTCCTATATTAGAC-3') and F73PB (SEQ ID N0:53) (5'-GGATTTTTAGGTAGACAC-3'). A
270 by arm (designated as EH) corresponding to the region downstream from the ORF was amplified using oligonucleotides F75PE (SEQ ID N0:54) (5'-TCATCGTCTTCATCATCG-3') and F73PH1 (SEQ ID N0:55) (5'-GTCTTAAACTTATTGTAAGGGTATACCTG-3').
Fragment EH was digested with ARV to generate a 126 by fragment. The ARV site is at the 3'-end and the 5'-end was formed, by PCR, to contain the 3' end of a ~,gcII site. This fragment was inserted into pBS-SK
(Stratagene, La Jolla, CA) digested with ~cII to form plasmid pF7Di. The sequence was confirmed by ' dideoxynucleotide sequence analysis. The plasmid pF7D1 was linearized with ~p~,I, blunt-ended using T4 DNA
polymerise, and ligated to the 596 by HB fragment. The W0 95(27780 L ~ 7 PCTlUS95104394 resultant plasmid was designated as pF7D2. The entire sequence and orientation were confirmed by nucleotide sequence analysis.

The plasmid pF7D2 was digested with ARV and ~g,~II

to generate a 600 by fragment. This fragment was inserted into pBS-SK that was digested with ~I, blunt-ended with T4 DNA polymerase, and subsequently digested with ~FII. The resultant plasmid was designated as pF7D3. This plasmid contains an HB arm of 404 by and a EH arm of 126 bp.

The plasmid pF7D3 was linearized with ' oI and blunt-ended with the Klenow fragment of the E. coli DNA

polymerase in the presence of 2mM dNTPs. This linearized plasmid was ligated with annealed oligonucleotides F7MCSB

(SEQ ID N0:56) (5'-AACGATTAGTTAGTTACTAAAAGCTTGCTGCAGCCCGGGTTTTTTATTAGTTTAGTT

AGTC-3') and F7MCSA (SEQ ID N0:57) (5'-GACTAACTAACTAATAAAAAA

CCCGGGCTGCAGCAAGCTTTTTGTAACTAACTAATCGTT-3'). This was performed to insert a multiple cloning region containing the restriction sites for ~dIII, ~stI and SmaI between the EH and HB arms. The resultant plasmid was designated as pF7D0.

.,~+r"r.t;on of Insertion Plasmid for the H4 xPma~~lutinin at the F8 Locus. AcDNA copy encoding the avian influenza H4 derived from A/Ty/Min/833/80 was obtained from Dr. R. Webster in plasmid pTM4H833. The plasmid was digested with ~dIII-and ~I and blunt-ended using the Klenow fragment of DNA polymerase in the presence of dNTPs. The blunt-ended 2.5 kbp '~ndIII-~I

_ fragment containing the H4 coding region was inserted into the ~cII site of pIBI25 (International Biotechnologies, Inc., New Haven, CT). The resulting plasmid pRW828 was partially cut with $~II, the linear product isolated and recut with ~,gdIII. Plasmid pRW828 now with a 10o by ~dIII-~pIIdeletion was used as a vector for the synthetic oligonucleotides RW152 (SEQ ID

WO 95127780 ~ ~ g 7 2 0 7 PCT~S95104394 N0:58) and RW153 (SEQ ID N0:59). These oligonucleotides represent the 3' portion of the H6 promoter from the ARV site and align the ATG of the promoter with the ATG
of the H4 cDNA.
RW152 (SEQ ID N0:58): 5' GCACGGAACAAAGCTTATCGCGATATCCGTTA .
AGTTTGTATCGTAATGCTATCAATCACGATTC
TGTTCCTGCTCATAGCAGAGGGCTCATCTCAG
AAT 3' RW153 (SEQ ID N0:59): 5' ATTCTGAGATGAGCCCTCTGCTATGAGCAGGA
ACAGAATCGTGATTGATAGCATTACGATACAA
ACTTAACGGATATCGCGATAAGCTTTGTTCCG
TGC 3' The oligonucleotides were annealed, cut with III and ~,gdIII and inserted into the 'j~ndIII-~rII deleted pRW828 vector described above. The resulting plasmid pRW844 was cut with ~qRV and p~I and the 1.7 kbp fragment containing the 3' H6 promoted H4 coding sequence was inserted between the ARV and ~gcII sites of pRW846 (described previously) forming plasmid pRW848. Plasmid pRW848 therefore contains the H4 coding sequence linked to the vaccinia virus H6 promoter in the de-ORFed F8 locus of fowlpox virus.
Construction of Insertion Plasmid for H5 FIemagalutinin at the F8 Locus. A cDNA clone of avian influenza H5 derived from A/Turkey/Ireland/1378/83 was received in plasmid pTH29 from Dr. R. Webster. Synthetic oligonucleotides RW10 (SEQ ID N0:60) through RW13 (SEQ ID
N0:63) were designed to overlap the translation initiation codon of the previously described vaccinia virus H6 promoter with the ATG of the H5 gene. The sequence continues through they' SCI site of the H5 gene and begins again at the 3' H5 raI site containing the H5 stop codon.

W O 95127780 218 7 2 0 7 PCTlIIS95104394 RW10 (SEQ ID N0:60): 5' GAAAAATTTAAAGTCGACCTGTTTTGTTGAGT
TGTTTGCGTGGTAACCAATGCAAATCTGGTC
_ ACT 3' RW11 (SEQ ID N0:61): 5' ' TCTAGCAAGACTGACTATTGCAAAAAGAAGCA

CTATTTCCTCCATTACGATACAAACTTAACG
GAT 3' RW12 (SEQ ID N0:62): 5' ATCCGTTAAGTTTGTATCGTAATGGAGGAAA
TAGTGCTTCTTTTTGCAATAGTCAGTCTTGCT
AGAAGTGACCAGATTTGCATTGGT 3' RW13 (SEQ ID N0:63j: 5' TACCACGCAAACAACTCAACAAAACAGGTCG
ACTTTAAATTTTTCTGCA 3' The oligonucleotides were annealed at 95°C for three minutes followed by slow cooling at room temperature.
This results in the following double strand structure with the indicated ends.
RW11 i RW10 Cloning of oligonucleotides between the coRV and ~I sites of pRW742B resulted in pRW744. Plasmid pRW742B contains the vaccinia virus H6 promoter linked to a non-pertinent gene inserted at the '~ncII site of pRW731.15 described previously. Digestion with per- I and ARV eliminates the non-pertinent gene and the 3'-end of the H6 promoter. Plasmid pRW744 now contains the 3' portion of the H6 promoter overlapping the ATG of avian ' 35 influenza H5. The plasmid also contains the H5 sequence through the 5' Sa I site and the 3' sequence from the H5 stop codon (containing a DraI site). Use of the ,p~2 site removes the H5 3' non-coding end. The oligonucleotides add a transcription termination signal WO 95!27780 PCT/US95104394 recognized by early vaccinia virus RNA polymerise (Yuen et al., 1987). To complete the H6 promoted H5 construct, the H5 coding region was isolated as a 1.6 kpb ,S~1,I-p~aI
fragment from pTH29. Plasmid pRW744 was partially digested with p~I, the linear fragment isolated, recut with ,gall and the plasmid now with eight bases deleted between Sa I and ~r I was used as a vector for the 1.6 kpb pTH29 SCI and ~I fragment. The resulting plasmid pRW759 was cut with ~qRV and g~I. The1.7 kbp PRW759 ~qRV-DraI fragment containing the 3' H6 promoter and the H5 gene was inserted between the coRV and ~,yncII sites of pRW846 (previously described). The resulting plasmid pRW849 contains the H6 promoted avian influenza virus H5 gene in the de-ORFed F8 locus.
~'onstruction of Insertion Vector for H7 HPmantlW,t;"in at the F7 Loaus. Plasmid pCVH71 containing the H7 hemagglutinin from A/CK/VIC/1/85 was received from Dr. R. Webster. An coRI-~FII fragment containing the H7 gene was blunt-ended with the Klenow fxagment of DNA
polymerise and inserted into the ~cII site of pIBI25 as PRW827. Synthetic oligonucleotides RW165 (SEQ ID N0:64) and RW166 (SEQ ID N0:65) were annealed, cut with j~cII
and S~yI and inserted between the ARV and ~yI sites of pRW827 to generate pRW845.
RW165 (SEQ ID N0:64): 5' GTACAGGTCGACAAGCTTCCCGGGTATCGCG
ATATCCGTTAAGTTTGTATCGTAATGAATACT
CAAATTCTAATACTCACTCTTGTGGCAGCCAT
TCACACAAATGCAGACAAAATCTGCCTTGGAC
ATCAT 3' RW166 (SEQ ID N0:65): 5' ATGATGTCCAAGGCAGATTTTGTCTGCP.TTTG
TGTGAATGGCTGCCACAAGAGTGAGTATTAGA
ATTTGAGTATTCATTACGATACAAACTTAACG
GATATCGCGATACCCGGGAAGCTTGTCGACCT
GTAC 3' Oligonucleotides RW165 (SEQ ID N0:64) and RW166 (SEQ
ID N0:65) link the 3' portion of the H6 promoter to the H7 gene. The 3' non-coding end of the H7 gene was removed by isolating the linear product of an ELI

digestion of pRW845, recutting it with SRI, isolating . the largest fragment and annealing with synthetic oligonucleotides RW227 (SEQ ID N0:66) and RW228 (SEQ ID

N0:67). The resulting plasmid was pRW854.

RW227 (SEQ ID N0:66): 5' ATAACATGCGGTGCACCATTTGTATAT

AAGTTAACGAATTCCAAGTCAAGC 3' RW228 (SEQ ID N0:67): 5' GCTTGACTTGGAATTCGTTAACTTATA

TACAAATGGTGCACCGCATGTTAT 3' The stop codon of H7 in PRW854 is followed by an ~I

site. The intermediate H6 promoted H7 construct in the de-ORFed F7 locus (described below) was generated by moving the pRW854 EcoRV-j~I fragment into pRW858 which had been cut with ~cqRV and blunt-ended at its g,~I site.

Plasmid pRW858 (described below) contains the H6 promoter in an F7 de-ORFed insertion plasmid.

2o The plasmid pRW858 was constructed by insertion of an 850 by S.ma2/I~I fragment, containing the H6 promoter linked to a non-pertinent gene, into the S~mai site of pF7D0 described previously. The non-pertinent sequences were excised by digestion of pRW858 with ARV (site 24 by upstream of the 3'-end of the H6 promoter) and ~s I.

The 3.5 kb resultant fragment was isolated and blunt-ended using the Klenow fragment of the E. coli DNA

polymerase in the presence of 2mM dNTps. This blunt-ended fragment was ligated to a 1700 by ~gRV/~I

fragment derived from pRW854 (described previously).

This ~rgRV/~ipal fragment contains the entire AIV HA (H7) gene juxtaposed 3' to the 3'-most 24 by of the W H6 promoter. The resultant plasmid was designated pRW861.

The 126 by EH arm (defined previously) was lengthened in pRW861 to increase the recombination frequency with genomic TROVAC DNA. To accomplish this a , 575 by gc~2/ r~B2 fragment was derived from pRW 731.13 WO 95!27780 2 ~ g 7 2 0 7 PCTIUS95104394 (defined previously). The fragment was isolated and inserted between the j~cc~I andaeI sites of pRW861. The resultant plasmid, containing an EH arm of 725 by and a HB arm of 404 by flanking the AIV H7 gene, was designated as pRW869. Plasmid pRW869 therefore consists of the H7 coding sequence linked at its 5~ end to the vaccinia virus H6 promoter. The left flanking arm consists of 404 by of TROVAC sequence and the right flanking arm of 725 by of TROVAC sequence which directs insertion to the de-ORFed F7 locus.
n~~ ~~3~ment of TROVAC-Avian Inf~uenza Virus _, Recombinants. Insertion plasmids containing the avian influenza virus HA coding sequences were individually transfected into TROVAC infected primary CEF cells by using the calcium phosphate precipitation method previously described (Panicali et al., 1982; Piccini et al., 1987). Positive plaques were selected on the basis of hybridization to HA specific radiolabelled probes and subjected to sequential rounds of plaque purification until a pure population was achieved. one representative plaque was then amplified to produce a stock virus.
Plasmid pRW849 was used in an in vitro recombination test to produce recombinant TROVAC-AIH5 (vFP89) expressing the H5 hemagglutinin. Plasmid pRW848 was used to produce recombinant TROVAC-AIH4 (vFP92) expressing the H4 hemagglutinin. Plasmid pRW869 was used to produce recombinant TROVAC-AIH7 (vFP100) expressing the H7 hemagglutinin.
TmmLr70f~uorescence. In_influenza virus infected cells, the HA molecule is synthesized and glycosylated as a precursor molecule at the rough endoplasmic reticulum. , During passage to the plasma membrane it undergoes extensive post-translational modification culminating in proteolytic _cleavage into the disulphide linked HA1 and HA2 subunits and insertion into the host cell membrane where it is subsequently incorporated into mature viral envelopes. To determine whether the HA molecules WO 95127780 PCTlUS95JD439J

produced in cells infected with the TROVAC-AIV

recombinant viruses were expressed on the cell surface, immunofluorescence studies were performed. Indirect immunofluorescence was performed as described (Taylor et al., 1990). Surface expression of the H5 hemagglutinin in TROVAC-AIH5, H4 hemagglutinin in TROVAC-AIH4 and H7 hemagglutinin in TROVAC-AIH7 was confirmed by indirect immunofluorescence. Expression of the H5 hemagglutinin was detected using a pool of monoclonal antibodies specific for the H5HA. Expression of the H4HA

was analyzed using a goat monospecific anti-H4 serum.

Expression of the H7HA was analyzed using a H7 specific monoclonal antibody preparation.

rmmLnonrecipi+at~~h. It has been determined that the sequence at and around the cleavage site of the hemagglutinin molecule plays an im orta t p n role in determining viral virulence since cleavage of the hemagglutinin polypeptide is necessary for virus particles to be infectious. The hemagglutinin proteins 2D of the virulent H5 and H7 viruses possess more than on e basic amino acid at the carboxy terminus of HA1 It i .
s thought that this allows cellular proteases which recognize a series of basic amino acids to cleave the hemagglutinin and allow the infectious virus to spread both ~n vitro and in v~vo. The hemagglutinin molecules of H4 avirulent strains are not cleaved in tissue culture unless exogenous trypsin is added.

In order to determine that the hemagglutinin molecules expressed by the TROVAC recombinants were 3D authentically processed, immunoprecipitation experiments were performed as described (Taylor et al., 1990) using the specific reagents described above.

Immunoprecipitation analysis of the H5 hemagglutinin _ expressed by TROVAC-AIH5 (vFP89) showed that the glycoprotein is evident as the two cleavage products HA1 and HA2 with approximate molecular weights of 44 and 23 kDa, respectively. No such proteins were precipitated WO 95!27780 2 ~ ~ 7,2 ~ ~ PCT/US95104394 .
1~8 from uninfected cells or cells infected with parental TROVAC. Similarly immunoprecipitation analysis of the hemagglutinin expressed by TROVAC-AIH7 (vFP100) showed specific precipitation of the HA2 cleavage product. The HA1 cleavage product was not recognized. No proteins were specifically precipitated from uninfected CEF cells or TROVAC infected CEF cells. In contrast, immunoprecipitation analysis of the expression product of TROVAC-AIH4 (vFP92) showed expression of only the precursor protein HAo. This is in agreement with the lack of cleavage of the hemagglutinins of avirulent subtypes in tissue culture. No H4 specific proteins were detected in uninfected CEF cells or cells infected with TROVAC. Generation of recombinant virus by recombination, in situ hybridization of nitrocellulose filters and screening for B-galactosidase activity are as previously described (Panicali et al., 1982; Perkus et al., 1989).
E~amDle 14 - GENERATION OF NYVAC RECOMBINANT CONTAINING
THE CANINE DI8TEMPEA VIRUS (ONDERSTEPOORT
r» aovnn_r_r.nmININ ORS' The Onderstepoort strain of canine distemper virus (CDV) was obtained from Dr. M. Appel (Cornell University, Ithaca, New York). RNA was harvested from CDV infected Vero cells and cDNA was prepared in the following manner.
RNA from CDV infected Vero cells was isolated by the guanidium isothiocyanate-cesium chloride method of Chirgwin, et al., (1979). First strand cDNA was synthesized with AMV reverse transcriptase (Life Sciences, St. Petersburg, Florida), the oligonucleotide primer CDVFSP (SEQ ID N0:68) (5'-CCAGGACATAGCAAGCCAACAGGTC-3'), and RNA from CDV infected cells. CDVFSP (SEQ ID N0:68) primes SObp upstream of the CDV fusion (F) start codon, yielding a positive sense single stranded cDNA product which contains the F and hemagglutinin (HA) coding sequences (Barrett et al., 1987; Curran et al., 1991).

The HA-specific open reading frame (ORF) (described in Curran et al., 1991) was amplified from the first strand cDNA product by polymerase chain reaction (PCR) (Engelke et al., 1988). Oligonucleotide primers CDVHA1 (SEQ ID N0:69) (5'-CGATATCCGTTAAGTTTGTATCGTAATGCTCCCCTACCAAGAC-3') and CDVHA2 (SEQ ID N0:70) (5'-GGGATAAAAATTAACGGTTACATGAGAATCTTATACGGAC-3') were used in a PCR with the CDVFSP derived first strand cDNA as template. CDVHA1 contains the 3' most region of the vaccinia virus H6 promoter (Perkus, et a1.,.1989) followed by a sequence which primes from the translation initiation codon into the CDV HA ORF (Curran et al., 1991). CDVHA2 (SEQ ID N0:70) primes from the stop codon of the HA ORF toward the CDV HA 5' end (Curran et al., 1991). The resultant l.8kbp PCR product was treated with the Klenow fragment from the E. coli DNA polymerase, in the presence of 20uM dNTPs, to blunt end the fragment.

The l.8Kbp blunt ended fragment was inserted between the ~I site within the H6 promoter, and the SCI site 3' of the H6 promoter in pSD554 (see below). The resultant plasmid pCDVHA should have contained the H6 promoted CDV

HA ORF, but there was an unexpected deletion at the CDV

HA 5' end. Repair of the deletion is described below.

Plasmid pSD554 contains the vaccinia K1L host range gene (Gillard et al., 1986) and vaccinia H6 promoter followed by insertion sites, within flanking vaccinia arms. The flanking vaccinia arms replace the ATI

region: open reading frames A25L and A26L (Goebel et al., 1990a,b). pSD554 was prepared in the following manner.

Left and right vaccinia flanking arms were constructed by PCR using the template pSD414 which contains vaccinia I B (Goebel et al., 1990a,b). The left arm was synthesized using oligonucleotide primers MPSYN267 (SEQ ID N0:71) (5'-GGGCTGAAGCTTGCTGGCCGCTCATTAGACAAGCGAATGAGGGAC-3'j and MPSYN268 (SEQ ID N0:72) (5'-WO 95127780 2 1 8 7 2 ~ 7 PCT/OS95104394 lI0 AGATCTCCCGGGCTCGAGTAATTAATTAATTTTTATTACACCAGAAAAGACGGCTTG
AGAT C-3') in a PCR with template pSD414. The right arm was synthesized using oligonucleotide primers MPSYN269 (SEQ ID N0:73) (5'-TAATTACTCGAGCCCGGGAGATCTAATTTAATTTAATTTATATAACTCATTTTTTGA
ATAT ACT-3') and MPSYN270 (SEQ ID N0:74) (5'- , TATCTCGAATTCCCGCGGCTTTAAATGGACGGAACTCTTTTCCCC-3') in a PCR with template pSD414. The two PCR-derived fragments containing the left and right arms were combined in a PCR. The resultant PCR product was digested with ~gRI
and ~dIII and a 0.9kb fragment was isolated. The 0.9kb fragment was inserted between the pUC8 E~RI and ~dIII
sites. The resultant plasmid pSD541 received the K1L
gene, and additional insertion sites, in the following manner.
Plasmid pSD541 was digested with c~,lII and ~o_I and ligated with annealed complementary oligonucleotides MPSYN333 (SEQ ID N0:75) (5'-GATCTTTTGTTAACAAAAACTAATCAGCTATCGCGAATCGATTCCCGGGGGATCCGG
TACC C-3') and MPSYN334 (SEQ ID N0:76) (5'-TCGAGGGTACCGGATCCCCCGGGAATCGATTCGCGATAGCTGATTAGTTTTTGTTAA
CAAA A-3'), generating plasmid pSD552. pSD452 (Perkus et al., 1990) contains the K1L gene. pSD452 was digested with ~I and partially digested with ~g~,II and the resultant lkbp fragment containing the K1L gene was inserted between the pSD552 gq~II and 3 aI sites. The resultant plasmid pSD553 was digested with ~I and a I/~I fragment containing the vaccinia H6 promoter (Perkus et al., 1989) was inserted. The resultant plasmid, pMP553H6, contains the vaccinia H6 promoter downstream from the K1L gene within the A26L insertion locus.
Plasmid pMP553H6 was digested with ~I and g~HI
and ligated with annealed synthetic oligonucleotides .
MPSYN347 (SEQ ID N0:77) (5'-CGATATCCGTTAAGTTTGTATCGTAATCTGCAGCCCGGGGGGG-3') and MPSYN348 (SEQ ID N0:78) (5'-GATCCCCCGGGCTGCAGATTACGATACAAACTTAA CGGATATCG-3'). The resultant plasmid pSD554 contains the K1L gene and the H6 promoter followed by insertion sites, within flanking vaccinia sequences which replace the ATI region.

The vaccinia virus H6 promoter and 5' end of the CDV

HA ORF were added to pCDVHA as a PCR derived fragment.

The ATG of the regulatory region H6 overlaps the CDV HA

translation initiation codon in the PCR derived fragment.

The vaccinia virus H6 promoter has been described in Perkus, et al., 1989.

pEIVC5L contains the modified H6 promoter (Perkus et al., 1989) and a nonpertinent gene. pEIVCSL was used in a polymerase chain reaction with oligonucleotide primers H65PH (SEQ ID N0:79) (5'-ATCATCAAGCTTGATTCTTTATTCTATAC-3') and CDVHAH6 (SEQ ID NO: 80) (5'-GTCTTGGTAGGGGAGCATTACGATACAAACTTAACG-3') to generate a 156bp fragment. CDVHAH6 contains the 5' 18 base pairs of CDV HA followed by a sequence which primes from the translation initiation codon toward the H6 promoter 5' end. H65PH (SEQ ID NO: 12) contains a ~gdIII site followed by a sequence which primes from the H6 promoter 5' end toward the 3' end. The 156 base pair PCR-derived H65PH/CDVHAH6 (SEQ ID N0:79/SEQ ID NO: 80) product contains the H6 promoter and the 5' 18 base pairs of the CDV HA coding sequence.

The CDVFSP (SEQ ID N0:68) first strand cDNA product was used in a PCR with oligonucleotide prilriers CDVHAATG

(SEQ ID N0:81) (5'-ATGCTCCCCTACCAAGAC-3') and CDVHAECO

(SEQ ID N0:82) (5'-GTAATTAGTAAAATTCACCTTG-3') to generate a 459 base pair fragment. CDVHAATG (SEQ ID NO:81) primes from the translation initiation codon toward the CDV HA

3' end. CDVHAECO (SEQ ID N0:82) primes from position 583 of the following H6 promoted CDV HA sequence toward the G
CDV HA 5' end. The 156 base pair and 459 base pair PCR-~

derived fragments were pooled and fused by PCR using H65PH (SEQ ID N0:79) and CDVHAECO (SEQ ID NO: 82) to generate a 597 base pair fragment. The PCR-derived WO 95f27780 PCTIU59510439d ~1872D7 _ product was digested with ~dIII and EcoRI, generating a 520 base pair fragment which contains the H6 promoter and 5' most 387 base pairs of the CDV HA coding sequence.
The 520 base pair ~dIII/~pRI digested PCR fragment was inserted between the ~dIII and coRI sites of pBS-SK
(Stratagene, La Jolla, California), yielding pBSCDVHASS. , Plasmid pBSCDVHASS contains the H6 promoted 5' end of the ' CDV HA ORF in pBS-SK (Stratagene, La Jolla, California), and the 3' end of the CDV HA ORF was added in the following manner.
Plasmid pCDVHA was digested with SCI followed by partial digestion with EcoRI to generate a l.4kbp fragment containing the 3' end of the CDV HA ORF. The l.4kbp pCDVHA roRI/SmaI fragment was insertedbetween the roRI and SmaI sites of pBSCDVHA5S. The resultant plasmid pBSCDVHA was digested with ~mHI and partially digested with ~I to generate a l.9kbp fragment containing the H6 promoted CDV HA open reading frame.
The l.9kbp ~amHI/ l~oI pBSCDVHA fragment was inserted between the ~gHI and ~qI sites ofpSD553 (see above).
The resultant insertion plasmid, pSDCDVHA, contains the H6 promoted CDV HA gene in the ATI insertion site. Figs.
14A-D show the nucleotide sequence of the H6 promoted CDV
HA and CDV HA translation (SEQ ID N0:83). pSDCDVHA was used in in vivo recombination experiments (Piccini et al., 1987) with NYVAC (vP866; Tartaglia et al., 1992) to generate vP1028.
ERample 15 - GENERATION OF NYVAC RECOMBINANT CONTAINING

The first strand cDNA, derived with the oligonucleotide primer CDVFSP (SEQ ID No:68), containing the CDV F and HA coding sequences is described above.
The CDV fusion (F) specific open reading frame (ORF) (described in Barrett et al., 1987) was amplified from _ the first strand cDNA by PCR. Oligonucleotide primers CDVATGF1 (SEQ ID N0:84) (5'-CATAAATTATTTCATTATCGCGATATCCGTTAAGTTTGTATCGTAATGCACAAGGGA

WO 95!27780 PCTlUS95104394 21872-~0 i ATCC CCAA AAGC-3') and CDVFT (SEQ ID N0:85) (5'-ATCATCGGATCCATAAAAATCAGTGTGATCTCACATAGGATTTCGAAG-3') were used in a PCR with the CDVFSP (SEQ ID N0:67) derived first strand cDNA as template. CDVATGF1 (SEQ ID N0:84) contains the 3' most region of the vaccinia virus H6 promoter (Perkus, et al., 1989) followed by a sequence which primes from the CDV F translation initiation codon into the CDV F ORF-(Barrett et al., 1987). CDVFT (SEQ ID
N0:85) contains a g~HIsitefollowed by a sequence which primes from the CDV F stop codon toward the CDV F 5' end (Barrett et al., 1987). ThE resultant PCR product was digested with ~I and $~a HI, yielding a 2kbp fragment which was inserted between the pSD554 (see above) ~Jr~uI
and g~HI sites. The resultant insertion plasmid, pATICDVFl, contains the H6 promoted CDV F ORF (SEQ ID
N0:86) in the vaccinia virus ATI insertion locus. Figs.
15A-D show the nucleotide sequence of H6, promoted CDV F
and CDV F translation. pATICDVFi was used in in vivo recombination (Piccini et al., 1987) experiments with NYVAC (vP866; Tartaglia et al., 1992) to generate vP1029.
~tbm~le 16 - GENERATION OF ALVAC RECOMBINANT CONTAINING
THE CA_rT'~NE DISTEMPER VIRUS BEMAGGLUTININ
Q$~
Oligonucleotides RW132 (SEQ ID N0:87) (5'-AGCTTCCCGGGTTAATTAATTAGTCATCAGGCAGGGCGAGAACGAGACTATCTGCTC
GTTA ATTA ATTAG-3') and RW133 (SEQ ID N0:88) (5'-AGCTCTAATTAATTAACGAGCAGATAGTCTCGTTCTCGCCCTGCCTGATGACTAATT
AATT AACC CGGGA-3') were annealed to form a double-stranded linker sequence. The RW132/RW133 (SEQ ID
N0:87/SEQ ID N0:88) double-stranded sequence was inserted into the indIII site 5' of the H6 promoted CDV HA ORF in pBSCDVHA. The resultant plasmid pBSCDVHAVQ was digested with SmaI, yielding a 2kbp fragment containing the H6 promoted CDV HA ORF (SEQ ID N0:83) which was inserted into the SmaI site of HC5LSP28. The resultant plasmid pC5CDVHA contains the H6 promoted CDV HA ORF (SEQ ID
N0:83) in the C5 locus. pCSCDVHA was used in in vivo WO 95!27780 PCT/US95I04394 21872i~7 recombination (Piccini et a1.,1987)experiments with ALVAC
(CPpp; Tartaglia et al., 1992) to generate vCP184.
~~RtDle 17 - GENERATION OF ALVAC RECOMBINANT CONTAINING
THE CANINE DISTEMPER VIRUS FUSION GENE
Plasmid pATICDVFi contains the H6 promoted CDV
fusion (F) ORF. The 2kbp pATICDVFl rtI/~hoI fragment, , containing the 3' 28 base pairs of the vaccinia virus H6 "
promoter (Perkus, et al., 1989) followed by the CDV F
open reading frame (SEQ ID N0:86) was inserted between the l~uI and , hoI sites of vQH6C3LSA.2. The resultant plasmid pMM115 contains the H6 promoted CDVF ORF (SEQ ID
N0:86) in the C3 locus. pt~B4115 was used in in vivo recombination (Piccini et al., 1987) experiments with ALVAC (CPpp; Tartaglia et a1.,1992) to generate vCP194.
~SamDle 18 - GENERATION OF NYVAC RECOMBINANT CONTAINING
THE CANINE DISTEMPER VIRUS FUSION AND
BEMAGGLUTININ ORFs Plasmids pC5CDVHA and pMM115 have been described above. The 2kbp pCSCDVHA S.maI fragment, which contains the H6 promoted CDV HA ORF (SEQ ID N0:83), was inserted into the ,~I site of the I4L vector pSD550. The resultant plasmid pMM124 was used as a vector for the H6 promoted CDV F ORF (SEQ ID N0:86).
Plasmid pSD55o was constructed by insertion of complementary oligonucleotides 539A (SEQ ID N0:89) (5'-AGAAAAATCAGTTAGCTAAGATCfCCCGGGCTCGAGGGTACCGGATCCTGATTAGTT
AATT TTTGT-3') and 539B (SEQ ID N0:90) (5'-GATCACAAAAATTAACTAATCAGGATCCGGTACCCTCGAGCCCGGGAGATCTTAGCT
AACTGATT TTTCT-3') between the III and ~I sites of the I4L insertion vector pSD548 (Tartaglia et al., 1992).
The resultant plasmid pSD550 contains additional I4L
insertion sites between the pSD548 $ql_II and SmaI sites.
The 2.2kbp pMM115 ~mHI fragment, which contains the H6 promoted CDV F ORF (SEQ ID N0:86), was inserted into the $~HI site of pMM124. The resultant plasmid pMM126 contains the.H6 promoted CDV F ORF and H6 promoted CDV HA
ORF (SEQ ID N0:91), with their transcripts directed away from each other, in the I4L locus.

W0 95/27780 ~~ ~ ~ 2 ~ 7 PCTIIIS95104394 11 v5 Figs. 16A-G show the 4343bp sequence derived from plasmid pMM126 of the H6 promoted canine distemper virus (CDV) F, H6 promoted CDV HA, NYVAC sequences flanking I4L, and translations of CDV open reading frames; (SEQ ID
NOS:91, 92). The 5' end of the H6 promoted CDV F is at position 2199. The CDV F coding sequence is from position 2075 through position 90. The 5' end of the H6 promoted CDV HA is at position 2355. The CDV HA coding sequence is from position 2479 through 4290. pMM126 was used in is vivo recombination (Piccini et al., 1987) experiments with NYVAC (vP866; Tartaglia et al., 1992) to generate vP1202.
EaamDle 19 - GENERATION OF ALVAC RECOMBINANT CONTAINING
THE CANINE DISTEMPER VIRUS FUSION AND
HEMAGGLUTININ ORFS
The 2kbp pBSCDVHAVQ SmaI fragment, which contains the H6 promoted CDV HA ORF (SEQ ID N0:83), was inserted into the HC5LSP28 SCI site. The resultant plasmid pCSLCDVHA was used as a vector for the H6 promoted CDV F
ORF (SED ID N0:86). The pCSLCDVHA vector was prepared by partial $~I digestion, followed by ~amHI digestion, and isolation of the 6.5kbp fragment which contains the H6 promoted CDV HA ORF (SEQ ID N0:83), ALVAC flanking arms, and pUC8. The 2.lkbp pATICDVF1 i~"~aI/~amHI fragment, containing the H6 promoted CDV F ORF (SEQ ID N0:86), was inserted between the above pC5LCDVHA SmaI and ~mHI
sites. The resultant plasmid pCSLCDVHAF1 contains the H6 promoted CDV F (SEQ ID No:86) and H6 promoted CDV HA
ORFSs (SEQ ID N0:83), with their transcripts directed away from each other, in the C5 locus.
pC5CDVHAF1 was digested with CHI and treated with the Klenow fragment from the E. colt DNA polymerise, in the presence of 20mM dNTPs to blunt end the ~mHI site, followed by digestion with SmaI. The 4.2kbp blunt ended ~HHI to SmaI fragment, containing the H6 promoted CDV F
and H6 promoted CDV HA ORFs (SEQ ID N0:93), was inserted into the S,,maI site of C6L. Figs. 17A-G predicted nucleotide sequence of the H6 promoted canine distemper WO 95127780 2 ~ 8 7 2 0 7 PCT/US95104394 virus (CDV) F, H6 promoted CDV HA, ALVAC sequences flanking C6, and translations of CDV open reading frames (SEQ ID NOS:93, 94). pMM103 was used for confirmation of all junction sequences and flanking sequences. The 5' end of the H6 promoted CDV F is at position 2307. The CDV F coding sequence is from position 2183 through , position 198. The 5' end of the H6 promoted CDV HA is at ' position 2464. The CDV HA coding sequence is from position 2588 through 4399 (SEQ ID N0:93). The resultant plasmid pMM103 was used in in vivo recombination (Piccini.
et al., 1987) experiments with ALVAC (CPpp; Tartaglia et al., 1992) to generate vCP258.
$B~Dle 20 - GENERSAT7CON OF C3 CS AND C6 ALOAC VECTORS
Locus C3 surrounds the EcoRI site within the 3.4kbp canarypox viII clone pRW764.2. The C3 vector VQH6C3LSA.2 was constructed to remove the C3 ORF in the following manner.
An 8.5kbp canarypox Bc~II fragment, containing the C3 ORF, was inserted into the CHI site of pBS-SK
(Stratagene, La Jolla, California) to form pWW5.
Oligonucleotide primers RG277 (SEQ ID N0:95) (5'-CAGTTGGTACCACTGGTATTTTATTTCAG-3') and RG278 (SEQ ID
N0:96) (5'-TATCTGAATTCCTGCAGCCCGGGTTTTTATAGCTAATTAGTCAAATGTGAGTTAATA
T TAG-3') were used in a PCR with the template pWW5 to generate a 280 by fragment. Oligonucleotide primers RG279 (SEQ ID NO: 97) (5'-TCGCTGAATTCGATATCAAGCTTATCGATTTTTATGACTAGTTAATCAAATAAAAAG
CATA CAAGC-3') and RG280 (SEQ ID N0:98) (5'-TTATCGAGCTCTGTAACATCAGTATCTAAC-3') were used in a PCR
with the template pWW5 to generate a 250 by fragment.
The 280 by fragment was digested with ~sp718 and E~gRI, the 250 by fragment was digested with S.acI and ~r RI, and the two fragments were inserted together between the _ ~g718 and SacI sites of pBS-SK (Stratagene, La Jolla, California). The resultant plasmid is pC3I.

W0 95/27780 PCTlUS95104394 21~72p7 Oligonucleotide primers CP16 (SEQ ID N0:99) (5'-TCCGGTACCGCGGCCGCAGATATTTGTTAGCTTCTGC-3') and CP17 (SEQ
ID NO: 100)(5'-TCGCTCGAGTAGGATACCTACCTACTACCTACG-3') were used in a PCR with template pWWS. The resultant 604 base pair canarypox fragment was digested with ~g718 and ~gI
and inserted between the x7718 and ~I sites of pIBI25 ' (International Biotechnologies, Inc., New Haven, CT), yielding SPC3LA. The 908 base pair pWWS NsiI/,~gI
canarypox fragment was inserted between the SPC3LA ARV
-and siI sites. The resultant plasmid SPCPLAX contains 1444 base pairs of canarypox upstream of the C3 locus.
pXX4 contains a 6.5kbp NsiI canarypox fragment in the g~I site of pBS-SK (Stratagene, La Jolla, California). Oligonucleotide primers CP19 (SEQ ID
N0:101) (5'-TCGCTCGAGCTTTCTTGACAATAACATAG-3') and CP20 (SEQ ID N0:102) (5'-TAGGAGCTCTTTATACTACTGGGTTACAAC-3') were used in a PCR with the template pXX4 to generate a 279 base pair canarypox fragment. The 279 base pair PCR
derived canarypox fragment was digested with ~I and ~rI for insertion between the SacI and ~I sites of pIBI25 (International Biotechnologies, Inc., New Haven, CT). The resultant plasmid is SPC3RA.
Additional insertion sites were added between the pC3I SRI and ~I sites by insertion of annealed complementary oligonucleotides CP12 (SEQ ID N0:103) (5'-AATTCCTCGAGGGATCC-3') and CP13 (SEQ ID N0:104) (5'-CGGGATCCCTCGAGG-3'), yielding plasmid SPCP3S. The 261 base pair III/ acI SPC3RA fragment and the 2178 base pair ~1,IIJ~yyI pXX4 fragment were inserted together between the SPCP3S SCI and Sa~cI sites. The resultant _ plasmid CPRAL contains 2572 base pairs of canarypox downstream of the C3 locus. The 1436 base pair ~gg718/AccI SPCPLAX fragment was inserted between tine SPCP3S ~gg718 and AccI sites. The resultant plasmid CPLAL contains 1457 base pairs of canarypox upstream of the C~ locus. The 2438 base pair ~yI/S.acI CPRAL
fragment was inserted between the CPLAL 9,_tyI and SacI

WO 95!27780 2 ~ 8 7 2 0 7 PCTIUS95104394 sites. The resultant plasmid CP3L contains 1457 base pairs of canarypox upstream -of the C3 locus.
The H6 promoter was added to CP3L as a PCR derived fragment. Plasmid pRW838 contains the H6 promoter and a nonpertinent gene. Oligonucleotide primers CP21 (SEQ ID
NO:.105) (5'-TCGGGATCCGGGTTAATTAATTAGTTATTAGACAAGGTG-3') , and CP22 (SEQ ID N0:106) (5'-TAGGAATTCCTCGAGTACGATACAAACTTAAGCGGATATCG-3') were used in a PCR with the pRW838 template. The 200 base pair PCR
derived fragment, containing the H6 promoter, was digested with BamHI and coRI for insertion between the CP3L g~HI and coRI sites. The resultant plasmid was designated VQH6CP3L.
One of the VQH6CP3L canarypox flanking arms was shortened by inserting the annealed complementary oligonucleotides CP34 (SEQ ID N0:107) (5'-GGCCGCGTCGACATGCA-3') and CP35 (SEQ ID NO: 108) (5'-TGTCGACGC-3') between the VQH6CP3L ~s'I and ~I sites.
The resultant plasmid VQH6C3LSA.2 contains the vaccinia virus H6 promoter followed by C3 insertion sites.
Locus C5 surrounds the two BglII sites in the 0.9kbp canarypox gy~lII clone pRW764.5. The C5 vector HC5LSP28 was constructed to remove the C5 ORF in the following manner.
Oligonucleotide primers C5A (SEQ ID N0:109) (5'-ATCATCGAATTCTGAATGTTAAATGTTATACTTTG-3') and C5B (SEQ ID
NO: 110) (5'-GGGGGTACCTTTGAGAGTACCACTTCAG-3') were used in a PCR with genomic canarypox DNA as template. The resultant l.5kbp fragment was digested at the C5A end with SRI and the other end remained blunt for insertion between the coRI and SmaIsites of pUC8, yielding CSLAB.
Oligonucleotide primers C5C (SEQ ID NO:111) (5'-GGGTCTAGAGCGGCCGCTTATAAAGATCTAAAATGCATAATTTC-3') and CSDA
(SEQ ID N0:112) (5'-ATCATCCTGCAGGTATTCTAAACTAGGAATAGATG-3') were used in a PCR with genomic canarypox DNA as temphtte. The resultant 400 base pair fragment was digested at the CSDA end with ~I and the other end WO 95127780 PCTlU595104394 2i872~7 remained blunt for insertion between the ~I and gs~I

sites of C5LAB, yielding pCSL. Annealed complementary oligonucleotides CP26 (SEQ ID N0:113) (5'-GTACGTGACTAATTAGCTATAAAAAGGATCCGGTACCCTCGAGTCTAGAATCGATCC

CGGG TTTT TATGACTAGTTAATCAC-3') and CP27 (SEQ ID N0:114) (5~_ ' GGCCGTGATTAACTAGTCATAAAAACCCGGGATCGATTCTAGACTCGAGGGTACCGG

ATCC TTTT TATAGCTAATTAGTCAC-3') were inserted between the pCSL X718 and l~otI sites. The resultant plasmid HC5LSP28 is a locus C5 vector.

Locus C6 surrounds the two SRI sites in the l.3kbp canarypox III clone pRW764.7. The C6 vector pC6L was constructed to remove the C6 ORF in the following manner.

Oligonucleotide primers C6A1 (SEQ ID N0:115) (5'-ATCATCGAGCTCGCGGCCGCCTATCAAAAGTCTTAATGAGTT-3') C6B1 (SEQ

, ID N0:116) (5'-GAATTCCTCGAGCTGCAGCCCGGGTTTTTATAGCTAATTAGTCATTTTTTCGTAAGT

AAGT ATTT TTATTTAA-3'), C6C1 (SEQ ID N0:117) (5'-CCCGGGCTGCAGCTCGAGGAATTCTTTTTATTGATTAACTAGTCAAATGAGTATATA

TAAT TGAA AAAGTAA-3') and C6D1 (SEQ ID N0:118) (5'-GATGATGGTACCTTCATAAATACAAGTTTGATTAAACTTAAGTTG-3') were used to construct pC6L. Oligonucleotide primers C6A1 (SEQ ID N0:115) and C6B1 (SEQ ID N0:116) were used in a PCR with canarypox DNA template to generate a 380 base pair fragment. A second PCR reaction with the canarypox DNA template, and oligonucleotide primers C6C1 (SEQ ID

N0:117) and C6D1 (SEQ ID N0:118), generated a 1155 base pair fragment. The two PCR reaction products were pooled and primed for a final PCR with C6A1 (SEQ ID N0:115) and C6D1 (SEQ ID N0:118), yielding a 1613 base pair fragment.

The final PCR product was digested with SacI and ~I, and inserted between the SacI and C~nI sites of pBS-SK

(Stratagene, La Jolla, California). The resultant C6 ' insertion plasmid was designated a,s pC6L.

l6ple 21 ESPRESSION ANALYSIS OF NYVAC- AND ALVAC-BASED CDV RECOMBINANT VIRBSES

Infected Vero cell lysates were prepared and immunoprecipitation analyses were performed as described previously (Taylor et al., 1990) using antiserum from CDV-seropositive dogs (for NYVAC-based recombinants) and monospecific antiserum derived from rabbits inoculated with vaccinia virus recombinants expressing either the , CDV HA or F glycoprotein (for ALVAC-based recombinants). ' Results from these analyses have confirmed expression of the appropriate CDV gene product by the recombinant viruses.
~xamule 22 PROTECTION OF DOGS AGAINST CDV CHALLENGE
EY ALVAC-CDVFiF (vCP258) The protective efficacy of the ALVAC-based CDV HA
and F recombinant virus was assessed by exposure of dogs to a live CDV challenge following vaccination. In this experiment, 13 CDV seronegative beagles were divided into two vaccinated groups (3 dogs for 10' pfu vCP258 vaccine dose and 4 dogs for 105'Spfu vaccine dose) and a non-vaccinated control group (6 dogs). Vaccination consisted of two subcutaneous inoculations with either 10' pfu (group 1) or 105'5 pfu (group 2) of vCP258 three weeks apart. on day 42, all dogs were challenged by a intracranial administration of a 1:10 NVSL CDV challenge stock. Dogs were observed daily for 28 days following challenge to monitor morbidity/mortality.
No local or systemic adverse reactions were noted in dogs vaccinated with vCP258. All non-vaccinated control dogs developed clinical signs of CDV infection including anorexia, conjunctivitis, depression, weight loss, and dehydration from 6 to 17 days post-challenge. Four febrile peaks (>103.5° F) were observed on days 1, 3, 8, ' and 13 days post-challenge. Four of the 6 control animals r had more severe clinical manifestations. In fact, one of these dogs died 12 days post-challenge while the other ' three were euthanized between 13 and 17 days post-challenge. The two surviving control animals, which had WO 95(27780 PCTlUS95lOd39d milder disease symptomology, started to recover and, in fact, began gaining weight 19 days post-challenge.
Significantly, no dogs in either vaccine dose group developed clinical signs of CDV infection. They all gained weight and displayed normal behavior during the s observation period. Further, no febrile episodes were observed.
Table 21 lists the CDV-specific serological responses in each group at various times prior to challenge. The antibody titers are expressed as the 50%
neutralization endpoint and represent the mean titer for each group. Interestingly, despite the 105'5 pfu vaccine dose not eliciting equivalent levels of CDV serum neutralizing activity, all dogs vaccinated with this lower dose were completely protected against the virulent CDV challenge.

WO 95!27780 218 l 2 01 PCT1U595l04394 .

Table 21. CDV-specific Serological Responses Vaccine Day 0 Day 14 Day 21 Day 42 group .

105-5 <1:3 1:1G 1:21 1:50 107' <1:3 1:19 1:19 1:151 Control <l:3 ND ND <1:3 ND = not determined Example 23 - EFFICACY IN DOGS OF ALVAC-CDV (vCP258) AHEN
' USED IN A COMBINATION FORM WITH OTHER CANINE
PATHOGENS
In order to determine whether ALVAC-CDV (vCP258) would provide protective efficacy when used in a vaccine combina-tion with other canine pathogens the following study was performed. ALVAC-CDV (vCP258) was diluted to doses of 104~s, 104'$ and 105'5 TCIDSO per ml and mixed with vaccine doses of canine Adenovirus type 2 (CAV2), Canine Corona Virus (CCV), Canine Parainfluenza (CPi), Canine Parvovirus (CPVx~), Lep-tospira Canicola-Icterohaemorrhagiae Bacterin (LCI) or ALVAC-Rabies (vCP65). Twenty four seronegative dogs and two seropositive dogs were inoculated as shown in Table 22 with ALVAC-CDV alone or in the canine combination. Dogs received two inoculations at 0 and 2I days by the subcutaneous route. Blood ;vas collected for determination of CDV serum neutralizing titers at days 0, 21 and prior to challenge. Dogs were challenged in two groups at either 24 or 50 days after the second inoculation by the intracranial route with the CDV challenge virus supplied by the USDA.
After challenge dogs were observed for up to 5 months to ~
monitor signs of CDV infection. The results of serology and challenge are shown in Table 23. "
The results indicate that dogs inoculated with 4.8 logo TCIDSO of ALVAC-CDV (vCP258) alone induced a CDV-WO 95!27780 218 7 2 0 T PCTIi3S95104394 specific mean neutralizing antibody titer of 1.2 while doses of 5.5 logyo and 4.8 logy0 in the canine vaccine combination induced mean titers of 1.0 and 0.7 respectively. All dogs in each of these vaccine groups survived challenge. One dog in the group receiving the combination plus 5.5 loglpTCIDSO had non-specific symptoms ' following challenge while one dog in the group receiving the combination plus 4.8 loglo TCIDSO developed symptoms specific of CDV infection.

In this study, the serological response to vaccination with the canine coronavirus vaccine, and the ALVAC-rabies vaccine was also monitored. Significantly, inclusion of the ALVAC-CDV in the combination vaccine did not interfere with the serological response to the canine coronavirus and rabies virus components.

~~ple 24 - QSE OF FERRETS AS A MODEL FOR CDV INFECTION

Canine distemper virus and measles virus (MV) are closely related members of the Morbillivfras genus in the family Paramyxoviridae. Hall et al. (1980) demonstrated that antiserum to MV could immunoprecipitate the HA, P, NP, F and M polypeptides of both MV and CDV while antiserum to CDV could precipitate all CDV polypeptides and all MV

polypeptides except HA. While Morbilliviruses are closely related to one another they do not cross-infect unnatural hosts with any facility (De Lay et al., 1965) perhaps because of the specific interaction of the viral hemagglutinin (HA) protein with a species-specific cellular receptor for each virus (Dorig et al., 1994). Thus no suitable small animal model exists for directly. studying Morbillivirus pathogenesis and vaccine development.

_ However, in their natural hosts different Morbilliviruses cause quite similar diseases and the mechanisms of protective immunity are closely related as well (Liu et al.

, . 1957, Kauffman et al. 1982, Beauverger et al. 1993, Krakowka et al., 1979, Stephensen and ter Meulen, 1979, Brown and McCarthy, 1974). However, CDV has been shown to naturally infect ferrets and to provide an excellent model 77354-69(S) of Morbillivirus pathogenesis. Additionally, immunization of ferrets with measles vaccines has been shown to provide protection against CDV challenge (Gerber et al., 1976, Baker et al., 1966) and heterologous MV vaccination of puppies has long been used by veterinarians as a way of overcoming maternal antibody inhibition of direct vaccina-tion with CDV (Baker et al., 1970, Chalmers et al., 1994, Strating , 1975, Dudley et al., 1978, Prydie, 1968). The CDV ferret model can thus be used to test the efficacy of both CDV and measles vaccines against challenge infection.
In order to determine the potential of the ferret model system for investigating the efficacy of CDV and MV
vaccines, the following experiment was performed. European ferrets (Mustela putor~us faro) were vaccinated by the in tramuscular route with lOS pfu of ALVAC-CDV HA+F (vCP258) or NYVAC-CDV HA+F (vP1202). Control animals were vaccinated with an equivalent dose of ALVAC or NYVAC
recombinants expressing the rabies glycoprotein G or with saline. One group of ferrets received an attenuated live-virus vaccine (DISTEM-RTC; Schering Corp., N.J.) which has been extensively tested in ferrets (Appel et al., 1988).
Ferrets were immunized at 14 and 18 weeks of age and their serological response monitored. At 22 weeks, 4 weeks after the second vaccination, ferrets were challenged with 1 x 103 TCIDS~ of the Snyder Hill strain of CDV by the intranasal route and the clinical course of the disease monitored.
The results of vaccination and challenge are shown in Table 24.
The results indicate that control animals did not develop CDV-specific neutralizing antibody titers and succumbed to lethal canine distemper by day 18 post-challenge after developing fever, weight loss, leukocytopenia, decreased activity, conjunctivitis, an erythematous rash typical of distemper and CNS signs. Both ALVAC-CDV and NYVAC-CDV and the live attenuated CDV vaccine produced virus neutralizing titers of 21:96 at challenge and all ferrets survived. Ferrets receiving the *Trade-mark WO 95127780 ~ 7 PCT/US95104394 recombinant vaccines showed no signs of infection. Ferrets vaccinated with the attenuated vaccine lost body weight, became lymphocytopenic and developed the typical erythematous rash. These data demonstrate that ferrets are an excellent model for evaluating the efficacy of candidate CDV vaccines.

Example 25 - EVALUATION OF THE ENHANCED EFFICACY THAT MAY

BE OBTAINED BY INCLUDING THE M AND N GENES

IN A POR-VECTORED VACCINE

Previous studies have demonstrated that expression of the CDV or MV HA and F proteins provide protection in dogs against lethal CDV challenge (this application and Taylor et al., 1992) and expression of these proteins would certainly form the basis of any vectored vaccine. The role of the N protein is less clear. Brinckmann et al. (1991) demonstrated complete protection against measles encephalitis in rats following inoculation of a W-based recombinant expressing the N gene. Further studies indicated that this protection was based on the presence of CD4' T lymphocytes specific for the N protein (Bankamp et al., 1991). In contrast, Wild et al. (1992) demonstrated that expression of the N protein alone was not sufficient to provide protection against challenge in BALB/c mice.

When co-expressed with F, the W-F-N recombinant did enhance protection in CBA mice over that induced by expression of F alone. It is not clear how much can be learned from protection induced against intra-cranial challenge by rodent adapted measles strains in what is nor-orally a disease acquired by respiratory infection. The role of the N protein in inducing protection needs to be investigated in a more relevant system. Similarly, the M

' protein as expressed alone by a W vector provided limited - protection in the rat model system (Brinckmann et al., 1991). However, since it is known that the M protein is ' involved in virion assembly (Norrby and Oxman, 1990), coexpression of M with other virion proteins may optimize antigen presentation in recombinant infected cells. These approaches could lead to enhanced immunogenicity of a WO 95127780 218 ~ 2 0 7 PCT~S95104394 candidate vaccine. In order to evaluate the additional benefit that may be obtained by including the M and N
proteins in a pox-vectored vaccine the following recombinants were engineered.
nPrivation of cDNA clones of the CDV M and N genes: ' Vero cell monolayers were inoculated with the Onderstepoort , strain of CDV. When early cytopathic effect-was evident, the infected cell monolayer was harvested and extracted to derive a total RNA preparation as described in Chirgwin et al. (1979). First strand cDNA was synthesized from this RNA preparation as described in Auynh et al. (1985) using random priming hexamers. The synthesis was monitored by following the incorporation of 32P dATP.
~neration of plasmids for insertion of CDV N into ALVAC __and NYVAC vectors: Following cDNA synthesis, the sequences containing the N gene were amplified by use of the Polymerise Chain Reaction (PCR) using specific primers.
The sequence of the primers 5'CDVNX (SEQ ID N0:123) and 3~CDVN2 (SEQ ID N0:124) included 5~ non-hybridizing sequences containing the entomopox 42K promoter. This PCR
product was digested with ~g718 and ybaI, isolated as a 1.6 kb band, and cloned into ~sg718 and Y.baI digested pBS
SK+.
Primer 5~CDVNX - SEQ ID N0:123 5'-CATCATGGTACCTCAAAATTGAAAATATATAATTACAATATAAAATGGCT-AGCCTTCTTAAAAGCCTC-3' Primer 3~CDVN2 - SEQ ID N0:124 5'- TACTACTCTAGATTAATTGAGTAGCTCTTTGTC-3' The sequence of the CDV N gene is shown in Fig. 18 as SEQ ID N0:125. When compared to the CDV N gene sequence for the Onderstepoort strain (Genbank Accession ~' L13194) this sequence has 11 nucleotide differences at positions 82, 83, 189, 190, 1050, 1051, 1052, 137D, 1402, 1409 and ' 1432. These result in 8 amino acid changes at amino acid positions 28, 63, 64, 351, 457, 468, 470, and 478.
Analysis of several independently derived cDNA clones gave identical sequences and thus indicates that these WO 95/27780 2 ~ 8 T 2 0 7 PCTIUS95104394 differences are real and not due to random RT or PCR
errors.
Sequencing of these clones also indicated that all contained deletions in the 42K promoter sequence. The y clone with the smallest deletion was then used as a template to amplify the 5' end of the N gene between the " ATG and the p~pAI site using primers 5'I3LN2 (SEQ ID

N0:126) and 3'XmaN2 (SEQ ID N0:127) which contain the vac-cinia I3L promoter sequences. A 175 by band was isolated and digested with 8gg718 and gs~AI, then cloned into an ~gg718 and ~I digested pBS SK+ as plasmid, HN7.

Sequencing confirmed that this clone contained the intact I3L promoter linked to the N gene. Plasmid HN7 was digested with X718 and ~baI, a 1.6 kb band isolated and cloned into plasmid VQC5L-SP1 which had been digested with X718 and I. PlasmidVQCSL-SP1 directs insertion to the C5 locus of ALVAC. The sequence of plasmid generated, VQCN1, was obtained to confirm the sequence of the N gene and the promoter linkage. To generate a NYVAC-based insertion plasmid, a 1.6 kb ~I/~718 fragment containing the N gene linked to the I3L promoter was isolated from plasmid HN7 and cloned into a 3.6 kb ~dIII/$~s.718 fragment derived from pSD544VC. Plasmid pSD544VC directs insertion to the HA locus of NYVAC. The resulting plasmid, pHADCDVNI3L, was sequenced to confirm appropriate insertion of the CDV N gene and promoter sequences.

Primer 5'I3LN2 - SEQ ID N0:26 5'-CATCATGGTACCTGAGATAAAGTGAAAATATATATCATTATATTACAAA-GTACAATTATTTAGGTTTAATCATGGCTAGCCTTCTTAAAAGCCTC-3' Primer 3' XmaN2 - SEQ ID N0:27 _ 5'-CATCATCCCGGGATTAGGACTATAATGACATGCTTT-3'3.

G~Deration of plasmids for insertion of CDV M into ALVAC Following cDNA synthesis, the sequences containing the M gene were amplified by use of the Polymerase Chain Reaction (PCR). The sequence of the primers 5'CDVM3 (SEQ

ID N0:128) and 3'CDVM2 (SEQ ID N0:129) included 5' non-hybridizing sequences specifying the E3L promoter. This WO 95!27780 I PCTIUS95I04394 PCR product was digested with BamHl, isolated as a 1.1 kb band, and cloned into BamH1 digested pBS SK+ as plasmid M1.
Plasmid M1 was sequenced and found to contain the intact E3L promoter and M gene. The sequence of the M gene is shown in Fig. 19 as SEQ ID N0:130. Compared to the CDV M
gene sequence for the Onderstpoort strain (Genbank Acces- , sion ~' L13194) this sequence has five nucleotide ' differences at positions 47, 474, 529, 584, and 637. These result in four amino acid changes at amino acid positions 16, 177, 195, and 213. Analysis of several independently derived cDNA clones gave identical sequences and thus indicates that these differences are real and not due to random RT or PCR errors.
Primer 5'CDVM3 - SEQ ID N0:28 5'-CATCATGGATCCGAATAAAAAAATGATAAAGTAGGTTCAGTTTTATTGC-TGGTTGTGTTAGTTCTCTCTAAAAATGACTGAGGTGTACGACTTCG-3'Primer 3'CDVM2 - SEQ ID H0:29 5'-TACTACGGATCCTTAGAGAATTTTGAAAAGACCCTG-3' Plasmid M1 was then digested with BamHI and cloned into ~H1 digested VQCSL-SP1. Plasmid VQCSL-SP1 directs insertion to the C5 locus of ALVAC. The plasmid generated, VQCM7, was resequenced to confirm the sequence of the M
gene and the promoter linkage.
generation of olasmids for insertion of CDV M and N
into ALVAC vectors. A 1.6 kb ~ai/~718 fragment containing CDV N linked to the I3L promoter was isolated from plasmid HN7 and cloned into ~,~p718/C~b~I digested VQCM7 which contains the M gene linked to the E3L promoter. The sequence of the resulting plasmid, VQCMN3 was generated to confirm appropriate insertion.
Qerivation of cDNA clones of the MV M and N ~c~enes:
Vero cell monolayers were inoculated with the Edmonston strain of MV. When early cytopathic effect was evident, the infected cell monolayer was harvested and extracted to derive a total RNA preparation as described in Chirgwin et al. ('1979). The first strand DNA was synthesized from this RNA preparation as described in Huynh et al. (1985) with WO 95!27780 2 l 8 7 2 0 7 PCTIS3S95104394 primer MVP1 (SEQ ID N0:131). The synthesis was monitored by following the incorporation of 3zP dATP.

Primer MVP1 - SEQ ID N0:31 5'-CTTAGGAGCAAAGTGATTGC-3' -Generation of plasmids for insertion of MV N into v ALVAC and NYVAC vectors. Following cDNA synthesis, the ' sequences containing the N gene were amplified by use of the Polymerase Chain Reaction (PCR). The sequence of the primers used, MVN1 (SEQ ID N0:132) and MVN2 (SEQ ID N0:133) included 5' non-hybridizing sequences specifying the I3L

promoter. This PCR product, designated J69 was digested with ~1/~dIII, isolated as a 1.6 kb band, and cloned ' into ,~stl/~dIII digested pBS- SK+ as plasmid QP1. A

second clone QP3 was also obtained.

Primer MVN1 - SEQ ID N0:132 5'-ATCATCAAGCTTATGGCCACACTTTTAAGGAG'-3' Primer MVN2 - SEQ ID N0:133 5'-ATCATCCTGCAGATAAAAACTAGAAGATTTCTGTCATTG'3' The nucleotide sequence of the MV N gene is shown in Fig. 20 as SEQ ID N0:134. Compared to the measles N gene sequence for the Edmonston strain (Billeter et al, 1990;

Genbank Accession ~' K01711, X16565) this sequence has 13 nucleotide differences at positions 665, 666, 922, 925, 944, 1044, 1140, 1263, 1291, 1479, 1480, 1490 and 1547.

These result in nine amino acid changes at amino acid posi-tions 222, 308, 309, 315, 421, 493, 494, 497 and 516.

Analysis of several independently derived cDNA clones gave identical sequences and thus indicates that these differences are real and not due to random RT or PCR

errors.
Sequencing of these clones also indicated that plasmid QP1 had a base error at position 145 and plasmid QP3 an error at position 1216. To correct these errors, an ~r RV/~dIII fragment of about 700 by was isolated from QP3 and cloned into a 3.8 kb ~coRV/~dIII fragment derived from QP1. The resulting plasmid QT1 was confirmed to be correct by sequence analysis and designated PBSMVN. PCR

W095I27780 ~ PCTIUS95104394 fragment J99 containing the I3L promoter and 5~N sequences up to the BamHI site was synthesized using primers JP290 (SEQ ID N0:13) and JP284 (SEQ ID N0:14) and PBSMVN as a template. PCR fragment J99 was digested with ~oI/~HI
and cloned into a 4.4 kb C~I/~nHI fragment isolated from PBSMVN. The resulting plasmid RM1 was confirmed by , sequence analysis. A 1.5 kb XhoI/PstI fragment was ' isolated from RM1 and cloned into a plasmid pMM117 which had been digested with ~I. Plasmid pMMil7 directs insertion to the C6 insertion locus in ALVAC. The sequence of the resulting plasmid pC6MVNI3L was confirmed. In order to generate the equivalent NYVAC insertion plasmid, a 1.5 kb ioI/gs~I fragment was derived from plasmid RM1 and cloned into a maI digested pSD550VC. Plasmid pSD550VC
directs insertion to the I4L locus of NYVAC. The sequence of the resulting plasmid pI4LMVNI3L Was confirmed.
Primer JP290 - SEQ ID N0:135 5'-CATTAGCTCGAGTGAGATAAAGTGAAAATATATATCATTATATTACAAA-GTACAATTATTTAGGTTTAATCATGGCCACACTTTTAAGGAGCTTAG-3' Primer JP284 - SEQ ID N0:136 5'-TCCACCGGATCCTGATG-3' Generation of olasmids for insertion of MV M into ALVAC and NYVAC vectors: Following cDNA synthesis, the sequences containing the M gene were amplified by use of the Polymerise Chain Reaction (PCR). PCR fragment J89 containing the measles M gene linked to the E3L promoter was generated using primers JP285 (SEQ ID N0:137) and JP286 (SEQ ID N0:138) on the first strand cDNA template.
Primer JP285 - SEQ ID N0:137 5'-CATCATCTGCAGGAATAAAAAAATGATAAAGTAGGTTCAGTTTTATTGC-TGGTTGTGTTAGTTCTCTCTAAAAATGACAGAGATCTACGAC-3' Primer JP286 - SEQ ID N0:138 5'-ATCATCCTGCAGATAAAAACTACAGAACTTTGAATAGTCC-3' The PCR J89 product was digested with ~st~I, isolated as a lkb band and cloned into a gstI digested pMM117 which directs insertion to the C6 locus of canarypox virus. The resulting plasmid RF1 was sequenced and found to contain a WO 95!27780 pCT1US95104394 mistake in the E3L promoter. The sequence of the matrix gene is shown in Fig. 21 as SEQ ID N0:139. Compared to the measles M gene sequence for the Edmonston strain (Billeter et al, 1990; Genbank Accession ~ K01711, X16565) this se-quence has two nucleotide differences at positions 190 and 425. These result in two amino acid changes at amino acid positions 64 and 142. Analysis of several independently derived cDNA clones gave identical sequences and thus indi-cates that these differences are real and not due to random RT or PCR errors. Isolated PCR J89 was then cloned into a ~I digested pBS-SK+. The resulting plasmid RH2 was sequenced and found to contain an intact E3L promoter. A
300 by ~I/~v II fragment containing the intact E3L
promoter and the 5~ end of the M gene to the AvrII site was isolated from RH2 and cloned into a 5.3 kb p~I/g~II
fragment isolated from RF1. The resulting plasmid RN1 was found to have the correct sequence but with the gene in the reverse orientation. A lkb PstI fragment was isolated from RN1 and cloned into a ~stl digested pMM117. The sequence of the resulting plasmid pC6MVME3L was confirmed. In order to generate the corresponding NYVAC insertion plasmid, a ikb g~tI fragment was isolated from plasmid RN1 and cloned into plasmid pSD550VC which had been digested with X718.
The sequence of the resulting plasmid, pI4LMVME3L, which directs insertion to the I4L locus was confirmed.
Generation of AhVAC and NYVAC-based recombinants ex-pressing CDV N uene: The insertion plasmids VQCN1 and pHADCDVNI3L containing the CDV N gene linked to the I3L
promoter were transfected into primary CEF cells infected with ALVAC or NYVAC virus respectively. Recombinant progeny were selected on the basis of in situ plaque hybridization using an N-specific radiolabelled probe.
Recombinants were plaque purified until a homogenous population was achieved at which time the recombinant was amplified in CEF cells and expression analysis performed.
Insertion of the CDV N gene into ALVAC resulted in recombinant vCP331 and insertion into NYVAC in recombinant WO 95127780 2 ~ 8 7 2 0 7 PCTlUS95104394 vP1331. Immunoprecipitation analysis from radiolabelled lysates of VERO cells infected with CDV, vP1331 or vCP331 was performed using an N-specific monoclonal antibody des-ignated D1101. This analysis demonstrated the expression of two proteins of 56 and 53 KDa in VERO cells infected with either CDV, vP1331 or vCP331. No proteins were , precipitated from uninfected cells or cells infected with the ALVAC parental virus. Plasmid pHADCDVNI3L was also used to transfect cells infected with recombinant NYVAC-CDV
(vP1202) which has been previously demonstrated to express the CDV HA and F genes. The resulting recombinant designated vP1330 was also shown to express the N gene by immunoprecipitation analysis.
QPnprat-;on of an ALVAC-based recombinant exvressina CDV M aene: Plasmid VQCM7 containing the CDV M gene linked to the E3L promoter was transfected into CEF cells infected with ALVAC parental virus. Recombinant progeny were selected on the basis of in situ plaque hybridization using an M-specific radiolabelled probe. The recombinant derived, vCP334 was shown to express a protein of approximately 37 KDa by western Blot analysis using an M
specific monoclonal antibody designated XI 6 10. This protein co-migrated with an equivalent protein seen in VERO
cells infected with CDV indicating the authenticity of the expressed product.
~pnerat~on of ALVAC-based recombinants egpress~na CDV
M and N genes: Plasmid VQCMN3 containing the CDV M gene linked to the E3L promoter and the CDV N gene linked to the I3L promoter was transfected into CEF cells infected with ALVAC parental virus or with ALVAC-CDV (vCP258) which has been previously shown to express the HA and F genes. _ Recombinant progeny were selected on the basis of in situ plaque hybridization using M- and N-specific radiolabelled probes. The ALVAC-based recombinant was designated vCP336 and the vCP258-based recombinant was designated vCP335.
Expression of the N protein in vCP335 and vCP336 was confirmed by immunoprecipitation analysis using the N-WO 95!27780 2 ~ g ~ ~ ~ ~ PCTlUS95104394 specific monoclonal antibody D11o1. Expression of the M
protein was confirmed by Western Blot analysis using the M-specific monoclonal XI 6 10.

Generation of ALVAC- and NYVAC based reco binan exoressina MV N aene: The insertion plasmids pC6MVNI3L and pI4LMVNI3L containing the MV N gene linked to the I3L

' promoter were transfected into primary CEF cells infected with ALVAC or NYVAC virus respectively. Recombinant progeny were selected on the basis of in situ plaque hybridization using an N-specific radiolabelled probe.

Insertion of the MV N gene into ALVAC resulted in recombinant vCP318 and insertion into NYVAC in recombinant vP1294. Immunoprecipitation analysis from radiolabelled lysates of HeLa cells infected with vP1294 or vCP318 was performed using an N-specific monoclonal antibody designated N25. This analysis demonstrated the expression of a protein of approximately 60 KDa consistent with the published size of the MV N protein. No proteins were precipitated from uninfected cells or cells infected with the parental viruses. Plasmid pC6MVNI3L was also used to transfect cells infected with recombinant ALVAC-MV (vCP82) which has been previously demonstrated to express the MV
HA

and F genes. The resulting recombinant designated vCP333 was also shown to express the N gene by immunoprecipitation analysis. Similarly, plasmid pI4LMVNI3L was also used to transfect cells infected with NYVAC-MV (vP913) which has previously been demonstrated to express the MV HA+F genes.

The resulting recombinant vP1326 was demonstrated to express the N gene by Western Blot analysis.

Generation of an ATVAC-based recombinant exorpss~ng;

MV M gene: Plasmid pC6MVME3L containing the MV M gene linked to the E3L promoter was transfected into CEF cells infected with ALVAC parental virus. Recombinant progeny were selected on the basis of in situ plaque hybridization using an M-specific radiolabelled probe. The recombinant derived, vCP317 was shown to express a protein of approximately 37 KDa by Western Blot analysis using a commercial M-specific monoclonal antibody designated 8910 obtained from Chemicon International Inc.

WO 95127780 ~ 7 PCTIf3S95104394 Table22 Schedule of vaccination of dogs inocLlated with ALVAGCDV (vCp258) alone or Ln combination with other canine vaccines Vacdnc Group # Doha 44 day Glullrngc~p ~y ca~tta,re vCP158 / 1 ~ dose ~ 5 I

Combination + vCp7585 5 / 1 dox Combination only 5 3 2 Combination + vCl'2584 I
/ 1(Y~ dose Combination + vCI25&4 _ 4 / 10 v dose 1~ CDV-xropositivcdot;s2 _ Z

Total WO 95!27780 2 ~ g 7 2 0 l PCT~S95104394 Table 21 Results of cemlogy and challenge of dog inoculated with ALVAGCDV
(vCP758) alone or in combination with other canine vaccines vao~e croups Ibg CDV Natnlmng Tuer Nasbidity (Tiger eap~ as eseaa) .

n.y o nay al nn as - n.~
Combination5 503 1.0 L0 - 1/Sc 0/5 vCi'?58 loss aas<

Combination4 _-'03 0.8 0.7 - 1/4u 0/4 vCP258 104'8 dose Combination4 ~.3 <_03 0.6 0. 4/4 4/4 ~5g 5 104'6 dose vCM58 6 .03 0.9 12 I. 1/6 0/6 104'8 done 2 Combinatloa5 SR3 =03 503 - S/5 3/5 0 only CDViem 2 Not Not Not 0/2 0/2 done done done positive dog a: Challenge an day 44, a days after the second inoculation b: Chattenge on day'10, 50 days after the second vaccination t: One dog had non-specific symptoms of anotexa and depreaion d: One dog displayed specific CDV signs (enteric/tespiratory/netwus symptoms) WO 95/27780 218 7 2 0 7 pCTlUS95104394 Table ?A_ Results of serology and challenge in ferrets inoculated with ALVAC-CDV HA * F (vCP158) and NYVAGCDV HA+F (vP1202) and chatlengcd with the Snyder HIll strain of CL~V
Antmat Mcan Survival N Vaccine CDV after /Sa Ncutralvin8 Titer Challcn8c _ 14 wk 18 wk 72 wk 17/F pLVAGCDV 3 I2 9G S

35/M ALVAGCDV <2 64 192 S

g5/F ALVAGCDV 2 ?SG 25G

~/M ALVAGCDV <2 192 3gq S

41/F ALVAGCDV <2 G4 512 S

2l./F ALVAGCDV <2 12B 384 S

IG/F ALVAGRG <2 <2 <2 D

43/F ALVAGRG <2 <2 <2 D

G8/M ALVAGRG . 2 <2 <2 D

34/M NYVAGCDV <2 128 512 S

Rl/F NYVAGCDV 3 128 . 25G S

36/M NYVACLDV 2 y5G 1~ S

S

7G/M <2 312 512 NYVAGCDV
<2 29G 12g 44/F w an tcanc NYVAGCI7V a m crrctswcrcvaeucwt all and __ _ ~._..~..b.~.r. a<w ~- S: Survived challenged D: Died following challenge WO 95127780 ~ ~ g l 2 0 7 PCTIUS95I04394 ~r~m 2a. (coot) Animal Vaaxmc M<an (;UV Ncutrulizmg liicrSurviwl after X

/Sex Quaengc IA wk IB wk 22 wk v 38/P NYVnGRG <2 <2 <2 D

39/M NTVAGRG 2 2 <16 D

2S/M N5'VAGRG <= <2 2 D

30/M NYVAGRG <E <2 <2 D

18/F D1511:M <2 >25G >1()Z1 5 71/I DISIliM <2 754 25G S

20/F UISI'CM 4 254 7G6 ., 70/F UISI'11N c2 >2G4 384 7/M SAL1NE <2 2 <1G 1 G9/F SALINE <2 <2 <2 i) 72/M SALINE <2 <2 <2 D

Fcnets were vaccinated at 14 and lg weeks and challenged at JA wccks.S:
Survived challcngcdD: DiW
following challenge S Survived challenged D: Died following challenge WO 95/27780 218 7 2 0 7 pCTNS951D439J

Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the appended claims is not to be limited by particular details set forth in the above descriptions as many apparent variations thereof are possible without departing from the spirit or scope thereof.

WO 95f27780 2 I 8 7 2 0 7 PCTIUS95/04394 REFERENCES
1. Adams, J.M., and D.T. Imagawa, Proc. Soc. Exper. Biol.
Med. 96, 240-244 (1957).
2. Alkhatib, G., and D. Briedis, Virology 150, 479-490 (1986).
3. Altenburger, W., C-P. Suter and J. Altenburger, .
Archives Virol. 105, 15-27 (1989).
4. Appel, M. J.G. and Harris, W.V., Journal of the American Veterinary Medical Association 193, 332-333 (1988).
5. Avery, R.J., and J. Niven., Infect. and Immun. 26, 795-801 (1979).
6. Baker, J.A., Journal of the American Veterinary Medical Association 156, 1743-1746 (1970).
7. Baker, J.A., Sheffey, B.E., Robson, D.S. and Gilmartin, J., Cornell Veterinarian 56(4) 588-594 (1966).
8. Bankamp, B., Brinckmann, U.G., Reich, A., Niewiesk, S., ter Meulen, V. and Liebert, U.G., Journal of Virology 65, 1695-1700 (1991).
9. Barrett, T., Clarke, D.K., Evans, S.A., and Rima, B.K., Virus Research 8, 373-386 (1987).
10. Beauverger, P., Buckland, R., Wild, T.F., Journal of General Virology 74, 2357-2363 (1993).
11. Behbehani, A.M., Microbiological Reviews 47, 455-509 (1983).

12. Bergoin, M., and Dales, S., ~ Comparative Virology, eds. K. Maramorosch and E. Kurstak, (Academic Press, NY) pp. 169-205 (1971).

13. Bertholet, C., Drillien, R., and Wittek, R., Proc.
Natl. Acad. Sci. USA 82, 2096-2100 (1985).

14. Boursnell, M.E.G., Green, P.F., Samson, A.C.R., Campell, J.I.A., Deuter, A., Peters, R.W., Millar, N.S., Emmerson, P.T., and Binns, M.M. Virology i?8, 297-300 (1990c).

15. Boursnell, M.E.G., Green, P.F., Campell, J.I.A., Deuter, A., Peters, R.W., Tomley, F.M., Samson, A.C.R., Emmerson, P.T., and Binns, M.M. Vet.
Microbiol. 23, 305-316 (1990b).

WO 95127780 218 7 2 0 7 P~~S95I04394 16. Boursnell, M.E.G., Green, P.F., Campell, J.I.A., Deuter, A., Peters, R.W., Tomley, F.M., Samson, A.C.R., Chambers, P., Emmerson, P.T., and Binns, M.M.
J. Gen. Virol. 71, 621-628 (1990a).

17. Brinckmann, U.G., Bankamp, B., Reich, A., ter Meulen, V. and Liebert, U.G., Journal of General Virology 72, 2491-2500 (1991).

18. Brown, A.L. and McCarthy, R.E., Nature 248, 344-345 (1974).

19. Buller, R.M.L., Chakrabarti, S., Cooper, J.A., Twardzik, D.R., and Moss, B., J.Virol. 62, 866-874 (1988).

20. Buller, R.M.L., G.L. Smith, Cremer, K., Notkins, A.L., and Moss, B., Nature 317, 813-815 (1985).

21. Cadoz, M., A. Strady, B. Meignier, J. Taylor, J.
Tartaglia, E. Paoletti and S. Plotkin, The Lancet, 339, 1429 (1992).

22. Chalmers, W.S.K. and Blaxendale, W., The Vetrinary Record 135, 349-353 (1994).

23. Chambers, P., N.S. Millar, and P.T. EYnmerson, J. Gen.
Virol. 67, 2685-2694 (1986).

24. Child, S.J., Palumbo, G.J., Buller, R.M.L., and Hruby, D.E. Virology 174, 625-629 (1990).

25. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J., Biochemistry 18, 5294-5299 (1979).

26. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J., and Rutter, W.J. Biochemistry. 18, 5294-5299 (1979).

27. Clewell, D.B. and D.R. Helinski, Proc. Natl. Acad.
Sci. USA 62, 1159-1166 (1969).

28. Clewell, D.B., J. Bacteriol 110, 667-676 (1972).

29. Colinas, R.J., R.C. Condit and E. Paoletti, Virus Research 18, 49-70 (1990).

30. Cooney E.L., Corrier A.C., Greenberg P.D., et al., Lancet 337, 567-572 (1991).
~ 50 31. Curran, M.D., Clarke, D.K., and Rima, B.K., J. Gen.
Virol. 72, 443-447 (1991).
32. Delay, P.D., Stone, S.S., Karzon, D.T., Katz, S. and Enders, J., American Journal of Veterinary Research 26, 1359-1373 (1965).

33. Delay, P.D., S.S. Stone, D.T. Karzon, S. Katz, and J.
Enders, Am. J. Vet. Res. 26, 1359-1373 (1965).
34. Diallo, A., Vet. Micro. 23, 155-163 (1990).
35. Dorig, R.E., Marcil, A., Richardson, C.D., Trends in Microbiology 2, 312-317 (1994).
36. bowling, P.C., B.M. Blumberg, J. Menonna, J.E. Adamus, P. Cook, J.C. Crowley, D. Kolakofsky, and S.D. Cook, J. Gen. Virol. 67, 1987-1992 (1986).
37. Dreyfuss, G., Adam, S.A., and Choi, Y.D., Mol. Cell.
Biol. 4, 415-423 (1984).
38. Drillien, R., F. Koehren and A. Kirn, Virology iii, 488-499 (1981).
39. Drillien, R., D. Spehner, A. Kirn, P. Giraudon, R.
Buckland, F. Wild, and J.P. Lecocq, Proc. Natl. Acad.
Sci. USA 85, 1252-1256 (1988).
40. Dudley, J.M " Nixon, A., Mumford, A.M., Journal of Small Animal Practice 19, 463-468 (1978).
41. Edbauer, C., R. Weinberg, J. Taylor, A. Rey-Senelonge, J.F. Bouquet, P. Desmettre, and E. Paoletti, Virology 179, 901-904 (1990).
42. Engelke, D.R., Hoener, P.A., and Collins, F.S., Proc.
Natl. Acad. Sci. USA 85, 544-548 (1988).
43. Espion,~D., De Henau, S., Letellier, C., Wemers, C.-D., Brasseur, R., Young, J.F., Gross, M., Rosenberg, M., Meulemans, G, and Burny, A. Arch. Virol. 95, 79-95 (1987) 44. Etinger H.M., Altenburger W., Vaccine 9, 470-472 (1991).
45. Fenner, F., Virology 5, 502-529 (1958).
46. Fenner, F., P.A. Bachmann, E.P.J. Gibbs, F.A. Murphy, M.J. Studdert, and D.O. white, In Veterinary Virology, ed. F. Fenner, (Academic Press, Inc., New York) pp.
485-503 (1987).
47. Flexner, C., Hugen, A., and Moss, B., Nature 330, 259-262 (1987).
' 48. Fries et al., 32nd Interscience Conference on Antimicrobial Agents and Chemotherapy, Anaheim, CA
(October 1992).
49. Funahashi, S., T. Sato and H. Shida, J. Gen. Virol.
69, 35-47 (1988).

WO 95127780 ~ ~ PCTlUS95104394 50. Garten, W., Kohama, T., and H-D. Klenk. J. Gen. Virol.
51, 207-211 (1980).
51. Gerber, J.D. and Marron, A.E., American Journal of Veterinary Research 37: 133-138 (1976).
52. Hall, W. , Lamb. R. and Choppin, P.W. , Virology 100, 433-449 (1980).
' 53. Ghendon, Y.Z., and Chernos, V.I., Acta Virol. 8, 359-368 (1964).
54. Gillard, S., Spehner, D., Drillien, R., and Kirn, A., Proc. Natl. Acad. Sci. USA 83, 5573-5577 (1986).
55. Gillespie, J.H., and D.T. Karzon, Proc. Soc. Exp. Biol Med. 105, 547-551 (1960).
56. Goebel, S.J., Johnson, G.P., Perkus, M.E., Davis, ' S.W., Winslow, J.P., Paoletti, E., Virology 179, 247 266 (1990a).
57. Goebel, S.J., G.P. Johnson, M.E. Perkus, S.W. Davis, J.P. Window and E. Paoletti, Virology 179, 517-563 (1990b).
58. Goldstein, D.J. and S.K. Weller, Virology 166, 41-51 (1988).
59. Graves, M.C., S.M. Silver, and P.W. Choppin, Virology 86, 254-263 (1978).
60. Guo, P., S. Goebel, S. Davis, M.E. Perkus, J. Taylor, E. Norton, G. Allen, B. Languet, P. Desmettre, and E.
Paoletti, J. Virol. 64, 2399-2406 (1990).
61. Guo, P., Goebel, S., Davis, S., Perkus, M.E., Languet, B., Desmettre, P., Allen, G., and Paoletti, E., J.
Virol. 63, 4189-4198 (1989).
62. Hall, W.W., R.A. Lamb, and P.W. Choppin, Virology 100, 433-449 (1980).
63. Homma, M., and M. Ohuchi, J. Virol. 12, 1457-1465 (1973).
64. Hruby, D.E. and L.A. Ball, J. Virol. 43, 403-409 (1982).
65. Hruby, D.E., R.A. Maki, D.B. Miller and L.A. Ball, ' 50 Proc. Natl. Acad. Sci. USA 80, 3411-3415 (1983).
66. Huynh, T.V., Young, R.A. and Davis, R.W., DNA Cloning, Volume 1, ed. D.M. Glover, IRL Press, Washington (1985).

W0 9$,27780 218 7 2 8 7 PCT/US95104399 67. Ichihashi, Y. and Dales, S., Virology 46, 533-543 (1971).
68. Imagawa, D.T., P. Goret, and J.M. Adams, Proc. Natl.
Acad. Sci. USA 46, 1119-1123 (1960).
69. Itamura, S., H. Iinuma, H. Shida, Y. Morikawa, K.
Nerome and A. Oya, J. Gen. Virol. 71, 2859-2865 (1990). ' 70. Jacobson, J.G., D.A. Leib, D.J. Goldstein, C.L.
Bogard, P.A. Schaffer, S.K. Weller and D.M. Coen, Virology i73, 276-283 (1989).
71. Jamieson, A.T., G.A. Gentry and J.H. Subak-Sharpe, J.
Gen. Virol. 24, 465-480 (1974).
72. Karzon, D.T., Annals of the N.Y. Academy of Sci. 101, 527-539 (1962).
73. Karzon, D.T., Pediatrics 16, 809-818 (1955).
74. Kato, S., M. Takahashi, S. Kameyama and J. Kamahora, Biken's 2, 353-363 (1959).
75. Kauffman, C.A., Bergman, A. G., O~Connor, R.P., Clinical and Experimental Immunology 47, 617-625 (1982).
76. Kieny, M. P. , Lathe, R. , Drillien, R. , Spehner, D. , Skory, S., Schmitt, D., Wiktor, T., Koprowski, H., and Lecocq, J. P., Nature (London) 312, 163-166 (1984).
77. Kleitmann W., Schottle A., Kleitmann B., et al., ~g Cell Culture Rabies Vaccines and Their Protective Effect in Man., ed. Kuwert/Wiktor/Koprowski, (International Green Cross - Geneva) pp. 330-337 (1981).
78. Kotwal, G.J. and B. Moss, J. Virol. 63, 600-606 (1989b).
79. Kotwal, G.J., S.N. Isaacs, R. McKenzie, M.M.
Frank and B. Moss, Science 250, 827-830 (1990).
80. Kotwal, G.J., A.W. Hugin and B. Moss, Virology 171, 579-587 (1989a).
81. Kotwal, G.J. and Moss, B., Nature (Lond.) 335, 176-178 (1988). ' 82. Krakowka, S., Wallace, A.L., American Journal of Veterinary Research 40, 669-672 (1979).
83. Lai, A. C.-K. and B. G.-T. Pogo, Virus Res. i2, 239-250 (1989).

WO 95127780 218 7 2 G~ 7 PCTIUS95I04394 i 84. Le, L., Brasseur, R., Wemers, C., Meulemans, G., and Burny, A. Virus Genes 1, 333-350 (1988).
85. Liu, C. and Coffin, D.L., Virology 3, 115-131 (1957).
_ 86. Mandecki, W., Proc. Natl. Acad. Sci. USA 83, 7177-7182 (1986).
' 87. Maniatis, T., Fritsch, E.F., and Sambrook, J.
l0 Molecular cloning: a laboratory manual, (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) (1982).
88. Matthews, R.E.F., Intervirology 17, 42-44 (1982b).
89. McGinnes, L.W. and Morrison, T.G. Virus Res. 5, 343-356 (1986).
90. Merz, D.C., A. Scheid, and P. Choppin, J. Exper. Med.
151, 275-288 (1980}.
91. Morgan, A.J., M. Mackett, S. Finerty, J.R. Arrand, F.T. Scullion and M.A. Epstein, J. Med. Virol. 25, 189-195 (1988).
92. Moss, B., E. Winters and J. A. Cooper, J. Virol. 40, 387-395 (1981).
93. Moura, R.A., and J. Warren, J. Bact. 82, 702-705 (1961).
94. Nagai, Y., H.D. Klenk, and R. Rott, Virology 72, 494-508 (1976).
95.. Nagai, Y., T. Yoshida, M. Hamaguchi, H. Naruse, M.
Iinuma, K. Maeno, and T. Matsumoto, Microbiol.
Immunol. 24, 173-177 (1980).
96. Norrby, E. and O~an, M.N., Virology, Second Ed. pp.
1013-1044, ed. B.N. Fields, D.M. Knipe et al., Raven Press, Ltd., New York (1990).
97. Norrby, E. Utter, G., Orvell, C., and M.J.G. Appel, J.
Virol. 58, 536-541 (1986).
98. Norrby, E., and Y. Gollmar, Infect. and Immun. 11, 231-239 (1975).
99. Norrby, E., G. Enders-Ruckle, and V. ter Meulen, J.
Infect. Dis. 132, 262-269 (1975).
' 100. Ogawa, R., Yanagida, N., Saeki, S., Saito, S., Ohkawa, S. , Gotoh, H. , Kodama, K. , Kamogawa, K. , Sawagucki, K., and Iritani, Y. Vaccine 8, 486-490 (1990).
101. Orvell, C., and E. Norrby, J. Gen. Virol. 50, 231-245 (1980).

W O 95f27780 2 18 7 2 0 7 pCTIUS9510439d 102. Pae2, E., S. Dallo and M. Esteban, Proc. Natl. Acad.
Sci. USA 82, 3365-3369 (1985).
103. Palumbo, G.J., Pickup, D.J., Fredrickson, T.N., Mcintyre, L.J., and Buller, R.M.L., Virology 172, 262 273 (1989).
104. Panicali, D., Davis, S.W., Mercer, S.R., and Paoletti, E., J. Virol. 37, 1000-1010 (1981).
105. Panicali, D. and E. Paoletti, Proc. Natl. Acad. Sci.
USA 79, 4927-4931 (1982).
106. Patel, D.D., Ray, C.A., Drucker, R.P., and Pickup, D.J., Proc. Natl. Acad. Sci. USA 85, 9431-9435 (1988).
107. Patel, D.D. and Pickup, D.J. EMBO J. 6, 3787-3794 (1987).
108. Perkus, M. E., D. Panicali, S. Mercer and E. Paoletti, Virology 152, 285-297 (1986).
109. Perkus, M.E., Limbach, K., and Paoletti, E., J. Virol.
63, 3829-3836 (1989).
110. Perkus, M.E., Goebel, S.J., Davis, S.W., Johnson, G.P., Limbach, K., Norton, E.K., and Paoletti, E., Virology 179, 276-286 (1990).
111. Perkus, M.E., S.J. Goebel, S.W. Davis, G.P. Johnson, E.K. Norton and E. Paoletti, Virology i80, 406-410 (1991).
112. Perkus, M.E., A. Piccini, B.R. Lipinskas and E.
Paoletti, Science 229, 981-984 (1985).
113. Piccini, A., M.E. Perkus, and E. Paoletti, Methods in Enzymology i53, 545-563 (1987).
114. Pickup, D.J., B.S. Ink, W. Hu, C.A. Ray and W.K.
Joklik, Proc. Natl. Acad. Sci. USA 83, 7698-7702 (1986).
115. Pickup, D.J., B.S. Ink, B.L. Parsons, W. Hu and W.K.
Joklik, Proc. Natl. Acad. Sci. USA 81, 6817-6821 (1984).
116. Prydie, R., Veterinary Record 83, 554-559 (1968). , 117. Reed, L.J. and Muench, A., Am. J. Hyg. 27, 493-497 (1938).
118. Richardson, C.D., A. Berkovich, S. Rozenblatt, and W.
Bellini, J. Virol. 54, 186-193 (1985).

WO 95/27780 2187 2 ~ ~ PCT/US95104394 119. Richardson, C., D. Hull, P. Greer, K. Hasel, A.
Berkovich, G. Englund, W. Bellini, B. Rima, and R.
Lazzarini, Virology i55, 508-523 (1986).
120. Rickinson, A.B., Rowe, M., Hart, I.J., Yao, Q.T., Hendersen, L. E. , Ralein, H. and Epstein, M.A. Cell.
Immunol. 87, 646-658 (1984).
' 121. Roberts, J.A., J. Immunol. 94, 622-628 (1965).
122. Sanger, F., Nickeln, S. Coulson, A.R., Proc. Natl.
Acad. Sci. 74, 5463-5467 (1977).
123. Sanger, F., S. Nicklen, and A.R. Coulson, Proc. Natl.
Acad. Sci. USA 74, 5463-5467 (1977).
124. Schmidtt, J.F.C. and H.G. Stunnenberg, J. Virol. 62, 1889-1897 (1988).
125. Seligmann, E.B., ~ Laboratory Techniques in Rabies, eds. M.M. Kaplan and H. Koprowski, (World Health Organization, Geneva) pp. 279-285 (1973).
126. Shapira, S.K., Chou, J., Richaud, F.V. and Casadaban, M.J., Gene 25, 71-82 (1983).
127. Shapira, S.K., J. Chou, F.V. Richaud, and M.J.
Casadaban, Gene 25, 71-82 (1983).
128. Shida, H., Virology 150, 451-462 (1986).
129. Shida, H., T. Tochikura, T. Sato, T. Konno, K.
Hirayoshi, M. Seki, Y. Ito, M. Hatanaka, Y. Hinuma, M.
Sugimoto, F. Takahashi-Nishimaki, T. Maruyama, K.
Miki, K. Suzuki, M. Morita, H. Sashiyama and M.
Hayami, EMBO 6, 3379-3384 (1987).
130. Shida, H., Hinuma, Y., Hatanaka, M., Morita, M., Ridokoro, M., Suzuki, K., Maruyzam, T., Takahashi Nishimaki, F., Sugimoto, M., Kitamura, R., Miyazawa, T., and Hayami, M., J. Virol. 62, 4474-4480 (1988).
131. Slabaugh, M., N. Roseman, R. Davis and C. Mathews, J.
Virol. 62, 519-527 (1988).
132. Smith, J.S., P.A. Yager and G.M. Baer, ~n Laboratory Techniques in Rabies, eds. M. M. Kaplan and H.
- Koprowski (WHO Geneva) pp. 354-357 (1973).
'_ 50 133. Stanberry, L. R., S. Kit and M. G. Myers, J. Virol.
55, 322-328 (1985).
134. Stephensen, J.R. and ter Meulen, V., Proceedings of the National Academy of Sciences, USA 76, 6601-6605 (1979).

WO 95127780 PCTlU595104394 135. Stephenson, J.R. and V. ter Meulen, Proc. Nat. Acad.
Sc7.. USA 76, 6601-6605 (1979).
136. Strating, A., Journal of the American Veterinary Medical Association 167, 59-62 (1975).
137. Tabor, S. and C. C. Richardson, Proc. Natl. Acad. Sci.
USA 84, 4767-4771 (1987).
138. Tartaglia, J., Jarrett, O., Desmettre, P., Paoletti, E., J. Virol. 67, 2370-2375 (1993b).
139. Tartaglia, J., Perkus, M.E., Taylor, J., Norton, E.K., Audonnet, J.-C., Cox, W.I., Davis, S.W., Van Der Hoeven, J., Meignier, B., Riviere, M., Languet, B., Paoletti, E., Virology 188, 217-232 (1992).
140. Tartaglia, J. & E. Paoletti, In Immunochemistry of Viruses, II. The Basis for Serodiagnosis and Vaccines.
M.H.V. van Regenmortel & A.R. Neurath, Eds. 125-151.
Elsevier Science Publishers, Amsterdam (1990).
141. Tartaglia, J. , J. Taylor, W.I. Cox, J.-C. Audonnet, M.E. Perkus, A. Radaelli, C. de Giuli Morghen, B.
Meignier, M. Riviere, K. Weinhold & E. Paoletti, In zTn~ Research.Reviews, W. Koff, F.~ Wong-Staal & R.C.
Kenedy, Eds., Vol. 3, Marcel Dekker, NY (In press)(1993a).
142. Taylor, J., Weinberg, R., Tartaglia, J., Richardson, C., Alkhatib, G., Briedis, D., Appel, M., Norton, E.
and Paoletti, E., Virology 187, 321-328 (1992).
143. Taylor, J., R. Weinberg, J. Tartaglia, C. Richardson, G. Alkhatib, D. Briedis, M. Appel, E. Norton & E.
Paoletti, Virology 187, 321-328 (1992).
144. Taylor, J., R. Weinberg, B. Languet, P. Desmettre, and E. Paoletti, Vaccine 6, 497-503 (1988b).
145. Taylor, J., S. Pincus, J. Tartaglia, C. Richardson, G.
Alkhatib, D. Briedis, M. Appel, E. Norton, and E.
_ Paoletti, J. Virol. 65, 4263-4272 (1991d).
146. Taylor, J., C. Trimarchi, R. Weinberg, B. Languet, F.
Guillemin, P. Desmettre and E. Paoletti, Vaccine 9, 190-193 (1991b).
147. Taylor, J., Weinberg, R., Rawaoka, Y., Webster, R.G., and Paoletti, E., Vaccine 6, 504-508 (1988a).
148. Taylor, J., C. Trimarchi, R. Weinberg, B. Languet, F.
Guillemin, P. Desmettre & E. Paoletti, Vaccine 9, 190 (1991c).

WO 95!27780 2 I8 7 2 0 l P~~S95104394 149. Taylor, G., E. J. Stott, G. Wertz and A. Ball, J. Gen.
Virol. 72, 125-130 (1991a).
150. Taylor, J., Edbauer, C., Rey-Senelonge, A., Bouquet, J.-F., Norton, E., Goebel, S., Desmettre, P., Paoletti, E., J. Virol. 64, 1441-1450 (1990).
151. Tizard, I., J. Am. Vet. Med. Assoc. 196, 1851-1858 (1990).
152. Toyoda, T., Sakaguchi, T., Imai, K., Inocencio, N.M., Gotoh, B., Hamaguchi, M., and Nagai, Y. Virology 158, 242-247 (1987).
153. Warren, J., M.K. Nadel, E. Slater, and S.J. Millian, Amer. J. Vet. Res. 21, 111-119 (1960).
154. Weir, J.P. and B. Moss, J. Virol. 46, 530-537 (1983).
155. Wild, T.F., Bernard, A., Spehner, D. and Drillien, R., Journal of General Virology 73, 359-367 (1992).
156. Wild, F., P. Giraudon, D. Spehner, R. Drillien, and J-P. Lecocq, Vaccine 8, 441-442 (1990).
157. Yuen, L., and Moss, B., Proc. Natl. Acad. Sci. USA 84, 6417-6421 (1987).
158. Zhou, J., L. Crawford, L. McLean, X. Sun, M. Stanley, N. Almond and G.L. Smith, J. Gen. Virol. 71, 2185-2190 (1990).

Claims

CLAIMS:

1. A recombinant modified poxvirus wherein said modified poxvirus has deleted therefrom or disrupted therein the thymidine kinase gene J2R, the hemorrhagic region genes B13R and B14R, the A type inclusion body gene A26L, the hemagglutinin gene A56R, the host range region C7L-K1L, and the large subunit ribonucleotide reductase gene I4L, or said modified poxvirus is NYVAC, or a poxvirus having all of the identifying characteristics of NYVAC, said modified poxvirus further comprising exogenous DNA in a nonessential region of the virus genome, said exogenous DNA encoding at least one antigen selected from the group consisting of canine distemper virus fusion protein, canine distemper virus hemagglutinin glycoprotein, canine distemper nucleocapsid protein, canine distemper matrix protein, measles virus nucleocapsid protein and measles virus matrix protein.

2. The virus of claim 1 which is vP1028, vP1029, vP1202, vP1294, vP1330, vP1326 or vP1331.

3. A recombinant avipox virus which contains exogenous DNA in a nonessential region of the virus genome, said exogenous DNA encoding at least one antigen selected from the group consisting of canine distemper virus fusion protein, canine distemper virus hemagglutinin glycoprotein, canine distemper nucleocapsid protein, canine distemper matrix protein, measles virus nucleocapsid protein and measles virus matrix protein.

4. The virus of claim 3 wherein said virus is a canarypox virus.

5. The virus of claim 4 wherein the canarypox virus is a Rentschler vaccine strain which was attenuated through more than 200 serial passages on chick embryo fibroblasts, a master seed therefrom was subjected to four successive plaque purifications under agar, from which a plaque clone was amplified through five additional passages.

6. The virus of claim 5 which is an ALVAC recombinant virus.

7. The virus of claim 6 which is vCP184, vCP194, vCP258, vCP317, vCP318, vCP331, vCP333, vCP334, vCP335 or vCP336.

8. A use for inducing an antigenic or immunological response in a dog or other carnivore against canine distemper virus of a composition comprising a virus as claimed in any one of claims 1 to 7 in admixture with a suitable carrier.

9. A composition for inducing an antigenic or immunological response comprising a virus as claimed in any one of claims 1 to 7 in admixture with a suitable carrier.

10. A method for expressing a gene product in a cell cultured in vitro comprising introducing into the cell a virus as claimed in any one of claims 1 to 7.

11. A method for preparing a canine distemper virus antigen by in vitro expression of a virus as claimed in any one of claims 1 to 7.