USRE45968E1 - Vector for efficient selection and/or maturation of an antibody and uses thereof - Google Patents
Vector for efficient selection and/or maturation of an antibody and uses thereof Download PDFInfo
- Publication number
- USRE45968E1 USRE45968E1 US13/831,258 US200613831258A USRE45968E US RE45968 E1 USRE45968 E1 US RE45968E1 US 200613831258 A US200613831258 A US 200613831258A US RE45968 E USRE45968 E US RE45968E
- Authority
- US
- United States
- Prior art keywords
- antibody
- antibodies
- recombinant antibody
- vector
- phage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/005—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
- C07K16/3007—Carcino-embryonic Antigens
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
- C07K16/3015—Breast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
Definitions
- the present invention relates to a method of improving the antibody selection capacity in phage-display library, in which said improvement is obtained through the reduction of the expression levels of the antibodies produced in said library.
- Recombinant DNA technology provides a cheap and useful alternative to monoclonal antibody production.
- Display of recombinant antibodies on bacteriophage capsid, known as phage-display not only allows generation of human antibody libraries for selection of specific binders, providing antibodies useful for therapy not inducing a harmful immune response in patients, but also facilitates affinity maturation of antibodies through construction of mutant antibody libraries, giving clones with a higher affinity.
- lymphoid tissues from immunized or non-immunized donors such as peripheral blood lymphocytes, spleen and bone marrow and even metastasized or drained lymph node tissue from individuals affected by tumors may serve as a source of specific antibody repertoire.
- TIL-B tumor-infiltrating B lymphocyte
- TIL-B tumor-infiltrated B lymphocytes
- Applicant performed a screening of recombinant antibody phage-display libraries derived from TIL-B by utilizing novel phagemid vector pKM19 and demonstrated efficient selection of tumor-specific antibodies against desirable tumor antigens as well as against living breast carcinoma cells.
- Prior art vectors are, i.e., phagemid vectors as in “Antibody Engineering—A practical approach (McCafferty, J. Hoogenboom, H. & Chiswell D., eds), pp. 325, Oxford University Press, 1996)”.
- a vector suitable for efficient selection and/or maturation of a recombinant antibody, characterized in that it contains at least one element able to reduce the expression level and/or has an improved efficiency of display of said recombinant antibody.
- a recombinant antibody includes: ScFv, active fragments of Abs, or any other derivatives of Abs known in the art, including humanized sequences of Abs.
- the vector of the invention may be a plasmid, a phagemid, a phage, or any other vectors known to the skilled in the art.
- the element able to reduce the expression level of the recombinant antibody belongs to the group of: a) a suppressed stop codon inside either the leader peptide or the antibody coding sequence; b) a low-efficient promoter driving transcription of said antibody coding sequence; c) an inhibitor of the promoter driving transcription of said antibody coding sequence.
- the improved efficiency of display of said recombinant antibody is obtained by: a) fusing the recombinant, antibody coding sequence to a sequence coding for the carboxy-terminal part of the pIII protein; and/or b) using as leader peptide of the recombinant antibody the leader peptide of the alkaline phosphatase of E. coli; and/or c) eliminating any amber codon between the recombinant antibody coding sequence and the pIII coding sequence.
- phagemid vector having the nucleotide sequence of SEQ ID NO: 1.
- This vector is designed for the display of recombinant antibodies in single-chain format on the surface of filamentous phage.
- a phage display-antibody library obtained by cloning cDNAs into the vector of the invention.
- the library is obtained by cloning in the vector of the invention cDNAs from antibody producing cells, more preferably Tumor Infiltrating Lymphocytes (TILs) or Peripheral Blood Lymphocytes (PBLs).
- TILs Tumor Infiltrating Lymphocytes
- PBLs Peripheral Blood Lymphocytes
- antibody producing cells are isolated from a tumor affected subject, preferably from a breast cancer affected subject.
- the library consists of synthetic or semi-synthetic antibody libraries, also mutated for affinity maturation of antibodies.
- an antibody selected from the library of the invention and method for selecting the same, able to recognize an antigen or a complex multi-component biological structure, preferably a cell or a cell membrane, more preferably selected from the group comprising: MUC1 tumor antigen, CEA (carcino-embrionic antigen), MCF7 breast carcinoma cells.
- Said antibodies may be in single or double-format.
- the MUC1 tumor antigen antibody is the MB5 scFv antibody consisting essentially of the amino acid sequence of SEQ ID NO: 3, preferably coded by the nucleotide sequence of SEQ ID NO: 2.
- the MUC1 tumor antigen antibody is the MB5/C′1 scFv antibody, consisting essentially of the amino acid sequence of SEQ ID NO: 5, preferably coded by the nucleotide sequence of SEQ ID NO: 4.
- the MUC1 tumor antigen antibody is the MB5/C′3 scFv antibody, consisting essentially of the amino acid sequence of SEQ ID NO: 7, preferably coded by the nucleotide sequence of SEQ ID NO: 6.
- the CEA tumor antigen antibody is the CB37 scFv antibody consisting essentially of the amino acid sequence of SEQ ID NO: 9, preferably coded by the nucleotide sequence of SEQ ID NO: 8.
- the CEA tumor antigen antibody is the CB37/9C scFv antibody, consisting essentially of the amino acid sequence of SEQ ID NO:13, preferably coded by the nucleotide sequence of SEQ ID NO:12.
- the MUC1 tumor antigen antibody is the CB37/3B scFv antibody, consisting essentially of the amino acid sequence of SEQ ID NO:11, preferably coded by the nucleotide sequence of SEQ ID NO:10.
- the MCF7 breast carcinoma cells antibody is the B96/11L scFv antibody consisting essentially of the amino acid sequence of SEQ ID NO: 15, preferably coded by the nucleotide sequence of SEQ ID NO: 14.
- the MCF7 breast carcinoma cells antibody is the mix7 scFv antibody, consisting essentially of the amino acid sequence of SEQ ID NO: 17, preferably coded by the nucleotide sequence of SEQ ID NO: 16.
- the MCF7 breast carcinoma cells antibody is the mix17 scFv antibody, consisting essentially of the amino acid sequence of SEQ ID NO: 19, preferably coded by the nucleotide sequence of SEQ ID NO: 18.
- the MCF7 breast carcinoma cells antibody is the mix39 scFv antibody, consisting essentially of the amino acid sequence of SEQ ID NO: 21, preferably coded by the nucleotide sequence of SEQ ID NO: 20.
- the antibodies selected from the libraries of the invention may be advantageously utilized for therapeutic, diagnostic, immunogenic or research purposes. Conveniently they may be utilized for preparing suitable pharmaceutical compositions comprising as active ingredient one or more recombinant antibody of the invention and optionally one or more excipients or diluents pharmaceutically acceptable and known in the art.
- the antibodies of the invention may be also utilized for obtaining so-called maturation libraries wherein single Variable Heavy chains (VH) coding sequences are co-transfected with Variable Light chain (VL) coding sequences, and recombinant antibodies selected for affinity.
- VH Variable Heavy chains
- VL Variable Light chain
- Tumor surface antigens can be selected by using novel anti-tumor antibodies recognizing tumor cells through: (i) immunoprecipitation of unknown target proteins from tumor cell extracts (Antibodies. A laboratory manual. Ed Harlow, David Lane, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 1988); or (ii) developing the immunoreactions with tumor cell extract, separated by two-dimensional PAGE (Proteins and proteomics: A laboratory manual. Richard J. Simpson, pp. 705, Science 2002) and transferred onto nitrocellulose membrane (Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989);
- Such recombinant and/or synthetic peptides able to mimic the native antigen so obtained may be utilized for producing vaccines, diagnostic reagents or in the research field. Conveniently they may be utilized for preparing suitable pharmaceutical compositions comprising as active ingredient one or more disease-specific antigen above mentioned, and optionally one or more excipients or diluents pharmaceutically acceptable and known in the art.
- nucleic acid encoding for the recombinant antibody obtained by the library of the invention.
- the nucleic acid encodes for a MUC1 tumor antigen antibody, more it has the nucleotide sequence of SEQ ID NO: 2. Alternatively it has the nucleotide sequence of SEQ ID NO: 4. Alternatively it has the nucleotide sequence of SEQ ID NO: 6.
- the nucleic acid encodes for a CEA tumor antigen antibody, more preferably it has the nucleotide sequence of SEQ ID NO: 8. Alternatively it has the nucleotide sequence of SEQ ID NO: 10. Alternatively it has the nucleotide sequence of SEQ ID NO: 12.
- the nucleic acid encodes for a MCF7 breast carcinoma cells antibody, more preferably it has the nucleotide sequence of SEQ ID NO: 14. Alternatively it has the nucleotide sequence of SEQ ID NO: 16. Alternatively it has the nucleotide sequence of SEQ ID NO: 18. Alternatively it has the nucleotide sequence of SEQ ID NO: 20.
- It is another object of the invention a method for improving the selection and/or maturation of a recombinant antibody comprising the step of using as cloning and expression vector the vector of the invention as above described.
- FIG. 1 It is schematically described the essential elements of pKM16 plasmid useful for the production of soluble antibodies in scFv format and the essential elements of pKM17, pKM18 and pKM19 plasmids useful for production of phage-displayed antibodies. These plasmids direct antibody expression under control of pLac promoter. The unique NcoI and NotI cloning sites allow insertion of an antibody gene to express single-chain antibodies with a leader peptide of the bacterial periplasmic enzyme, alkaline phosphatase (PhoA leader).
- PhoA leader alkaline phosphatase
- Plasmid pKM17 encodes the entire protein pIII (406 aa) and plasmids pKM18 and pKM19 encode the carboxy-terminal part of pIII (197 aa). Plasmid pKM19 contains amber codon in PhoA leader.
- FIGS. 2a, 2b, 2c It is described the detailed structure of pKM19 phagemid vector (SEQ ID NO: 1). The specific modification made are reported in the figure and described in the text.
- FIG. 3 Soluble scFv production by using pKM16 plasmid.
- Periplasmic protein fractions were purified from bacteria by freeze and thaw method. The protein size marker is included.
- Western blot membrane was developed with an anti-FLAG AP-conjugated secondary antibody. Bands corresponding to soluble scFv antibodies (expected molecular weight 26 kDa) migrate between 24.5 and 35.9 kDa bands.
- FIG. 4 Display efficiency of pKM17, pKM18 and pKM19 plasmids in comparison with a classic phagemid system.
- Anti-CEA scFv antibodies displayed by the three different plasmids were assayed by ELISA against CEA protein and compared with MA39 phage (anti-CEA/pDN322).
- the helper phage, M13K07, that does not display antibody fragments was included as negative control. Data reported are the average values of assays performed in duplicate.
- the highest phage concentration, labeled by asterisk corresponds to the 10 11 TU for all phages and 3 ⁇ 10 10 TU for anti-CEA/pKM17.
- the ELISA was performed by using the anti-M13 (panel A), or alternatively, the anti-FLAG secondary antibody (panel B).
- FIG. 5 Filtration of phage samples. About 2 ⁇ 10 11 TU/well of each preparation or the corresponding quantity of filtrate samples were tested in ELISA and developed either with anti-M13 (panel A) or anti-FLAG (panel B) secondary antibodies. Data reported are the average values of assays performed in duplicate. The data show reactivity of filtrates against CEA as percentage of original reactivity of non-filtrated samples (100%).
- FIG. 6 Competition with soluble anti-CEA scFv.
- Freshly prepared supernatants of MA39 (10 ⁇ L) and anti-CEA/pKM19 (5 ⁇ L) phages competed with various amounts of the purified soluble anti-CEA antibody. The data are expressed as percentage of reactivity of the supernatants without competitors.
- the irrelevant soluble anti-SP2 scFv was used as negative control.
- FIG. 7 Competition with phage supernatant filtrates. Freshly prepared supernatants of MA39 (10 ⁇ L) and anti-CEA/pKM19 (5 ⁇ L) phages were competed with 10 ⁇ L or 50 ⁇ L of filtrates of the same phage supernatants. The data are expressed as percentage of reactivity of the supernatants without competitors.
- FIG. 8 Western blot of PEG-purified recombinant phages. Protein extracts from about 5 ⁇ 10 9 PFU of phages MA39, anti-CEA/pKM18 and anti-CEA/pKM19, and 1 ⁇ 10 9 PFU of anti-CEA/pKM17 were fractionated by SDS-PAGE and transferred onto a nitrocellulose membrane. The membrane strips were developed with an anti-FLAG AP-conjugated antibody. The protein size marker is included (last strip).
- scFv-pIII (66.1 kDa) and scFv- ⁇ pIII (45.2 kDa) proteins migrate as higher molecular weight bands because of an anomalous moiety of the pIII protein described earlier (Goldsmith and Konigsberg, 1977).
- FIG. 9 Selection against SP2-GST protein. Reactivity of the phage pools derived from first and second rounds of panning of the scFvEC23 library is shown. GST (glutathione S-transferase), milk and streptavidin, present in the selection system, are included as negative controls. Data reported are the average values of assays performed in duplicate. Phage input was normalized since 3 ⁇ 10 9 TU per single well of each preparation were tested in ELISA.
- FIG. 10 Affinity selection of maturated anti-CEA gene from a maturation library.
- positive immunoreactions were developed by an anti-FLAG AP-conjugated secondary antibody, in order to moderate positive signals and make visible the increasing reactivity during the selection process.
- FIG. 11 ELISA reactivity of soluble maturated scFvs.
- Various amounts of soluble antibodies were assayed on CEA-coated plates. Bound scFvs were developed by using an anti-FLAG secondary antibody. Data reported are the average values of assays performed in duplicate. The irrelevant anti-SP2 antibody and maturated anti-CEA ES antibody, obtained earlier (Pavoni et al., 2006), were included as controls.
- FIG. 12 Specificity of maturated clones. About 250 ng per well of original and maturated antibodies in soluble form were assayed with CEA and various irrelevant proteins. The irrelevant anti-SP2 antibody was included as negative control. Data reported are the average values of assays performed in duplicate.
- FIG. 13 V(D)J analysis of TIL-derived antibody genes.
- A SMART cDNAs derived from 10 different tumor samples (patients B84, B85, B87, B89, B90, B91, B92, B93, B95, B96), from normal breast, normal testis and lymphocytes from four healthy donors (L1, L2, L3, L4), were used, as template for amplification of V(D)J antibody regions. Samples of the cDNAs were normalized by amplification of ⁇ -actin housekeeping gene. V(D)J fragments were amplified well from all templates excluding normal testis cDNA. B. The same PCR products were fractionated by PAGE giving a higher resolution for DNA bands.
- FIG. 14 Antibody subclass distributions. PCR-amplified normal breast and B84 cDNA samples, not showing oligoclonal bands in the V(D)J test, have prevalence of IgA bands in comparison to IgG1 and IgG2 (left panel), while three samples, showing strong oligoclonal bands in previous test (B91, B92 and B93), have IgG1 or both IgG1 and IgG2 bands prevalence in comparison with IgA (right panel).
- FIG. 15 Amino acid sequences of variable regions of 30 random clones obtained by cloning ⁇ -chain antibody genes derived from B92 (SEQ ID NO: 54 to SEQ ID NO:64) and B93 (SEQ ID NO: 65 to SEQ ID NO: 77) cDNAs. Peptide sequence is reported in single-letter code. Identical amino acids a in similar clones are represented by a dash.
- FIG. 16 Selection on ED-B, MUC1 and CEA proteins. Reactivity of phage pools derived from second and third rounds of panning in comparison with original libraries were tested. GST is included as a negative control. Additional negative control, protein D possessing 6His tail as a target protein used in the selection was used in case of ED-B panning. Data reported are the average values of assays performed in duplicate.
- Library ScFvEC23 derives from PBL.
- MixTIL is a mixture of 4 TIL-derived libraries (ScFvB87, ScFvB95, ScFvB96 and ScFvmix) as indicated in table 1.
- FIG. 17 ELISA reactivity of single phage clones displayed scFv antibodies. Reactivity of single phage clones selected against ED-B (clones EDE1, EDE3, EDE5, EDB5, table 5), MUC1 (clones ME 1, ME2, MB5, table 5) and CEA (clones CB3, CB37, CB40, CB41, CB53, CB60, table 5) after third round of selection was tested using respective proteins. Data reported are the average values of assays performed in duplicate. Several irrelevant proteins and an anti-SP2 irrelevant phage antibody are included as negative controls.
- FIG. 18 Cell-based panning reactivity against fixed breast carcinoma (MCF7) and human fibroblast (HFF) cells of phage pools derived from fourth and fifth rounds of panning in comparison with original libraries, were tested. Data reported are the average values of assays performed in triplicate. Libraries scFvB96 and mixLIB are defined in Table 2.
- FIG. 19 Cell-ELISA reactivity against fixed cells of single phage clones. Data reported are the average values of assays performed in triplicate. Cell developing with irrelevant anti-SP2 antibody is included as negative control.
- MCF7 and MDA-MB-468 fixed breast carcinoma cells; HFF: human fibroblast and MCF10-2A: normal breast epithelium cells.
- FIG. 20 Origin of anti-MCF7 scFv antibodies.
- One ⁇ L of each scFv phage library was amplified by PCR by using oligonucleotide primers specific for analyzed antibody genes.
- Corresponding PEG-purified phage was used as positive control (last line).
- Anti-MUC1 MB5 antibody and anti-CEA CB37 antibody were selected from mixture of TIL-derived libraries.
- Mix 11, mix 12, mix17 and mix39 antibodies were selected from mixture of TIL-derived and PBL-derived libraries Antibodies are defined in Table 5.
- FIG. 21 Fluorescent staining of non-permealized breast carcinoma MCF7 and normal breast epithelium MCF10-2A fixed cells by phage-displayed scFv antibodies (mix17 (A), mix7 (B)).
- FIG. 22 A. Fluorescent staining of breast carcinoma cells MCF7, SkBr3 expressing MUC1 tumor antigen and normal breast epithelium cells MCF 10-2A by using phage-displayed anti-MUC1 MB5 scFv antibody; B. Staining of colorectal adenocarcinoma cells LoVo expressing CEA by phage-displayed anti-CEA CB37 scFv antibody. Staining of negative control MCF10-2A cells is included.
- This work describes construction of a novel pKM19 phagemid vector for the display of single-chain antibodies on filamentous phage. This vector is characterized by several differences compared to canonical systems.
- the classic phagemids contain an amber codon between the scFv and gpIII genes, thus directing production of free scFvs and scFv-pIII fusion antibodies in suppressor bacteria, such as TG1, or DH5 ⁇ F′, or XL1-Blue, generally used for phage amplification.
- suppressor bacteria such as TG1, or DH5 ⁇ F′, or XL1-Blue, generally used for phage amplification.
- These bacterial strains, carrying the supE mutation are glutamine-inserting suppressors with suppression efficiency dependent on the codon following the TAG (J. Mol. Biol. 1983 164(1):59-71; Mol. Gen. Genet. 1987 207(2-3):517-518).
- the produced free soluble scFv antibodies are secreted into the periplasm and then leak from the periplasm into the medium.
- the free scFv antibodies are co-precipitated with phage particles.
- the concentration of free antibodies in phage suspension may be five to ten times higher than the concentration of scFv-pIII-fused proteins assembled in the phage particle.
- the abundant free antibodies compete with phage-displayed antibodies for target binding. This interferes with panning efficiency and delays the selection process, specially:
- antigen concentration when antigen concentration is limited (e.g. biopanning on living cells, ex-vivo cells),
- the pKM19 vector allows the cloning of scFv fragments as amino terminal fusion of the deleted gene III protein.
- phage display vectors for scFv lead to incorporation into the phage particles of the entire pIII fused to the antibody fragment (in Antibody Engineering—A practical approach: McCafferty, J. Hoogenboom, H. & Chiswell D., eds, pp. 325, Oxford University Press, 1996), while in the case of pComb3 plasmid utilized for Fab display (Proc. Natl. Acad. Sci. USA 1991 88(18):7978-7982), the antibody fragment is fused to the carboxy terminal half of the pIII. Infectivity of such recombinant phages is obtained during their propagation, since superinfection with a helper phage provides the native gene III protein.
- fusion of the single-chain antibody to the C-terminal part of pIII improves phage production and display efficiency of an antibody in comparison with wt pIII protein fusion.
- These data are in agreement with Kretzschmar's earlier data (Gene 1995 155(1):61-65).
- the improved display efficiency in combination with elimination of free scFv antibodies from the incubation mixture facilitates affinity selection and results in faster enrichment of the phage pools for specific clones. This may also contribute to reduction of stop codons in selected clones since a lower number of panning/amplification rounds are necessary to complete selection. Rapidly growing defective clones have less chance of being isolated.
- the PhoA leader peptide is cleaved off by leader peptidase upon membrane translocation, and scFv-pIII is assembled into the phage particle.
- the entire cleavage site of the alkaline phosphatase a genuine periplasmic protein of E. coli, is preserved to guarantee efficient and correct processing and antibody assembly.
- the mature protein contains two additional amino acids at the N-terminus of scFv.
- the combination of relatively low expression of displayed antibodies by introducing the amber codon before antibody gene with improved display efficiency makes the novel pKM19 phagemid useful both for selection of the recombinant scFv antibodies against desired targets from large libraries, as for their affinity maturation.
- the plasmid guarantees efficient display and allows reduction of biological bias against “difficult” antibodies in the delicate initial selection step.
- this vector is particularly useful for the affinity maturation of antibodies, since high expression levels may increase avidity of phage particles displaying Ab, leading to selection of antibodies with only modest affinity.
- Bacterial strain DH5 ⁇ F′ (supE44 ⁇ lacU169 (100 lacZ ⁇ M15) hsdR17 recA1 endA1 gyrA96 thi-1 re1A1 F′ [traD36 proAB + lacI q lacZ ⁇ M15]) was used for soluble and phage antibody production.
- Helper phage M13 KO7 (Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989) was used for phage preparation.
- the anti-CEA phage antibody, MA39 (BMC Cancer 2006 6: 41), in pDN322 plasmid (J. Biol. Chem. 1998 273(34): 21169-21776) was used as source of anti-CEA antibody gene.
- the pC89 plasmid (J. Mol. Biol. 1991 222(2): 301-310) was amplified by inverse PCR with the KM161, I(M162 oligonucleotides, containing HindIII and NotI sites (underlined) (KM161 5′-GAGG AAGCTT CCATTAAACGGGTAAAATAC-3′ (SEQ ID 78); KM162 5′-TGCAATG GCGGCCGC TAATATTGTTCTGGATATTACCAGC-3′ [SEQ ID 79]).
- inverse PCR a Taq polymerase mixture with Pfu DNA polymerase was used to increase fidelity of DNA synthesis.
- KM163-KM164 oligonucleotide duplex encoding FLAG peptide and His-tail (KM163 5′-AGCTTCCTC ATG TAG GCG GCC GCA GGA GAC TAC AAA GAC GAC GAC GAC AAA CAC CAC CAT CAC CAC CAT TAA-3′ [SEQ ID 80]; KM164 5′-GGCC TTA ATG GTG GTG ATG GTG GTG TTT GTC GTC GTC GTC GTC TTT GTA GTC TCC TGC GGC CGC CTA CAT GAGGA-3′ [SEQ ID 81]).
- the cloned DNA duplex contained an internal NotI site, upstream of FLAG peptide encoding sequence, while the NotI site, used for cloning of the duplex, was not restored.
- the resulting pKM15 plasmid was newly digested with HindIII, NotI endonucleases and ligated with KM175-KM176 duplex encoding the leader sequence and the first two amino acids of the PhoA bacterial protein, containing the NcoI cloning site (KM175 5′-AGC TTA TAA AGG AGG AAA TCC TCA TGA AAC AGA GCA CCA TCG CAC TGG CAC TGT TAC CGT TAC TGT TCA CCC CGG TTA CCA AAG CAC GTA CCA TGG TTT CCC TTGC-3′ [SEQ ID 82]; KM176 5′-GGC CGC AAG GGA AAC CAT GGT ACG TGC TTT GGT AAC CGG GGT GAA CAG TAA
- the plasmid pKM16 was amplified by inverse PCR with the KM181, KM182 oligonucleotides, presenting EcoRI and BamHI restriction sites, respectively (KM181 5′-GTG GTG ATG GAATTC TTT GTC GTC GTC GTC TTT GTA GTC-3′ [SEQ ID 84]; KM182 5′-CAC CAT TAA GGATCC TAA TAT TGT TCT GGA TAT TAC CAG C-3′ [SEQ ID 85]).
- the full-length gene III (Accession number V00604) and the 3′ part of the gene encoding the last 197 aa of the pIII were amplified by using the oligonucleotides KM183-KM185 or KM184-KM185 containing BamHI and EcoRI sites (underlined) and ligated into digested pKM16, giving the new plasmids pKM17 and pKM18, respectively (KM183 5′-TC TAT TCT GAATTC GCT GAA ACT GTT GAA AGT TGT TTA GC-3′ [SEQ ID 86]; KM184 5′-GC CAA TCG GAA TTC CTG CCT CAA CCT CCT GTC AAT GCT-3′ [SEQ ID 87]; KM185 5′-GAA CTG GGA TCC TTA AGA CTC CTT ATT ACG CAG TAT G-3′ [SEQ ID 88]).
- a short fragment of the pKM18 plasmid encoding the leader sequence was PCR-amplified with KM186-KM180 primers, introducing an amber mutation in PhoA leader peptide gene (KM186 5′-ACC CGT AAG CTT ATA AAG GAG GAA ATC CTC ATG AAA TAG AGC ACC ATC GC-3′ [SEQ ID 89]; KM180 5′-TAG CCC CCT TAT TAG CGT TTG-3′ [SEQ ID 90]).
- the resulting PCR product was digested with HindIII and NotI and cloned into pKM18, digested with HindIII and NotI and purified from agarose, to construct the pKM19 plasmid.
- the lymphocytes were isolated from 10 mL of fresh peripheral blood from patient EC23 (with advanced stage of breast cancer) with an anticoagulant using Ficoll-Paque Plus (Amersham Pharmacia Biotech, Sweden) according to manufacturer's instructions.
- mRNA was isolated from lymphocytes by using Dynabeads mRNA DIRECT Kit (Dynal, Norway).
- the mRNA was isolated from lymphocytes by using Dynabeads mRNA DIRECT Kit (Dynal, Oslo, Norway).
- One ⁇ g of the poly(A) + RNA from the lymphocytes was used to synthesize full-length cDNA by using SMART cDNA Library Construction Kit (Clontech, Palo Alto, Calif.).
- the antibody gene repertoire was amplified using a set of primers designed for amplification of VH and VL antibody domains, while entire scFv fragments were assembled in vitro as it was described in [Pope, A. R., Embleton, M. J. & Mernaugh R. (1996) Construction and use of antibody gene repertoires. In: Antibody Engineering—A practical approach (McCafferty, J., Hoogenboom, H. & Chiswell D., eds), pp. 325, Oxford University Press]. The latter were then amplified by PCR with appropriate extension primers, incorporating NcoI, NotI restriction sites, and allowing the cloning of scFv genes into a pKM19 vector.
- the resulting PCR products were purified on 1% low-melting agarose gel (NuSieve 3:1 agarose, Rockland, Me.), cut with NcoI/NotI and inserted into digested plasmid.
- the transformed library scFvEC23 contained 1.77 ⁇ 10 7 independent clones with full-length scFv insert.
- the scFvEC23 library derives from PBL obtained from a single patient EC23 with advanced stage of breast cancer.
- mutated scFv gene fragments were generated by PCR amplification with primers: KM144-KM143 (KM143, 5′-GTCATCGTCGGAATCGTCATCTGC-3′ [SEQ ID 91]; KM144, 5′-TGTGCGAAA AGTAATGAGTTTCTT TTTGACTACTGGGGC-3′ [SEQ ID 92]) and KM148-KM145 (KM148, 5′-CTATTGCCTACGGCAGCCGCTGGA-3′ [SEQ ID 93]; KM145, 5′-TCCGCCGAATACCAC ATAGGGCAACCACGGATAAGAGGAGTT ACAGTAATAGT CAGCC-3′ [SEQ ID 94]) introducing random mutations in CDR3 regions of heavy or light chains with low frequency.
- the resulting product was utilized to amplify the entire gene with external primers KM148, KM143.
- the final DNA fragment was agarose-purified, digested with restriction enzymes NcoI and NotI, and ligated with the digested plasmid pKM19.
- the resulting library contained 2.2 ⁇ 10 6 mutated antibody clones.
- ELISA plates were coated, blocked and washed as above.
- Various quantities of anti-CEA soluble antibody MA39 (BMC Cancer 2006 6: 41) in 100 ⁇ L of blocking buffer were added to the wells and incubated for 30 min at 37° C. Then, 10 ⁇ L (4.5 ⁇ 10 9 TU) of MA39 phage supernatant or 5 ⁇ L (3 ⁇ 10 8 TU) of anti-CEA/pKM19 supernatant were added to the wells and incubated for another 1 h at 37° C. The plates were washed and the bound phage detected by an anti-M13 HRP-conjugated antibody.
- Phage was purified according to standard PEG/NaCl precipitation (Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989). Protein extracts from phage samples were fractionated by SDS-PAGE and transferred onto a nitrocellulose membrane. The membrane strips were developed with an anti-FLAG AP-conjugated antibody.
- Multiwell plates (Immunoplate Maxisorb, Nunc, Roskilde, Denmark) were coated ON at 4° C. with a protein solution at a concentration of 10 mg/mL in 50 mM NaHCO3, pH 9.6. After discarding coating solution, plates were blocked for 1 h at 37° C. with ELISA blocking buffer (5% non-fat dry milk, 0.05% Tween-20 in PBS). Plates were washed several times with washing buffer (0.05% Tween-20 in PBS). PEG-purified phage in blocking buffer (1:1) was added to each well and incubated for 1 h at 37° C.
- ELISA blocking buffer 5% non-fat dry milk, 0.05% Tween-20 in PBS
- the plates were washed and the bound phage was detected by an anti-M13 HRP-conjugated (27-9421-01, Amersham Biosciences, Uppsala, Sweden), or anti-FLAG HRP-conjugated (A9044, Sigma, St. Louis, Mo.), or anti-FLAG AP-conjugated (A9469, Sigma) secondary antibody.
- HRP-conjugates the immunoreaction was developed by incubation with TMB liquid substrate (Sigma) for 15 min and stopped by the addition of 25 ⁇ L 2 M H 2 SO 4 . The results were expressed as the difference between absorbances at 450 and 620 nm, determined by an automated ELISA reader.
- the AP-conjugated antibody was detected by incubation with 1 mg/mL solution of p-nitrophenyl phosphate in substrate buffer (10% diethanolamine buffer, 0.5 mM MgCl2, pH 9.8) for 60 min. The results were expressed as the difference between absorbances at 405 and 620 nm.
- Antibodies are defined in table 5.
- the pKM16 plasmid ( FIG. 1 ) used for production of soluble antibodies in scFv configuration is constructed as described above. This plasmid directs protein expression under the control of lacP promoter.
- the unique NcoI and NotI cloning sites allow insertion of an antibody gene able to express single-chain antibodies with a leader peptide of the bacterial periplasmic enzyme, alkaline phosphatase (AP), and with the first two amino acids of the mature AP protein, at the antibody's amino-terminus; and FLAG/His-tail at carboxyl-terminus of antibody.
- AP alkaline phosphatase
- a classic phagemid (pDN322) displaying the anti-CEA single-chain antibody, MA39, was compared with pKM17, pKM18 and pKM19 vectors displaying the same antibody, for phage particle production and display efficiency.
- the pKM17 and pKM18 plasmids ( FIG. 1 ) allow display of antibody fragments on a phage particle by fusion to, respectively, the entire pIII (1-406 aa) or the carboxy terminal domain only (210-406 aa) of the protein.
- the pKM19 plasmid, derivative of pKM18 harbors an amber codon in leader sequence, thus leading to lower production of scFv-pIII fusion proteins as compared to pKM18.
- the authors performed functional tests by cloning the anti-CEA single-chain antibody gene into the three novel plasmids and confronting them with the original MA39 clone (anti-CEA in pDN322).
- Phage Clone Titer Phage Clone Titer MA39 1 1.5 ⁇ 10 11 anti- 1 2.52 ⁇ 10 11 CEA/pKM18 2 2.55 ⁇ 10 11 2 2.5 ⁇ 10 11 3 5.1 ⁇ 10 11 3 1.75 ⁇ 10 11 anti- 1 6 ⁇ 10 10 anti- 1 3 ⁇ 10 11 CEA/pKM17 CEA/pKM19 2 4.1 ⁇ 10 10 2 1.8 ⁇ 10 11 3 1.95 ⁇ 10 10 3 2.8 ⁇ 10 11
- Phage preparations were tested in ELISA, where developing was performed by using the anti-M13, or alternatively, the anti-FLAG secondary antibody. Applying different amounts of the phage per ELISA well, the authors demonstrated higher display efficiency for pKM18 and pKM19 phages in comparison with pKM17 and much higher as compared to MA39 ( FIG. 4 ). It is interesting that the MA39 clone, which produces a higher level of antibodies than anti-CEA/pKM17, as shown by developing with anti-FLAG antibody ( FIG. 4B ), has a weaker signal when ELISA is developed with the anti-M13 secondary antibody ( FIG. 4A ).
- the level of free antibodies in the anti-CEA/pKM19 sample is markedly lower.
- the free antibodies in this sample are the result of antibody shedding, inevitable during phage preparation and which might increase as a result of contact with components of the filtration system; while the free antibodies in MA39 samples are the result of free antibody expression and leakage into medium together with shedding.
- the pKM19 plasmid a derivative of pKM18, harboring amber codon in leader sequence was used for generation of scFv library to study whether low production of fused antibodies allows efficient selection of a specific antibody against a target molecule.
- scFv antibody library was constructed from human peripheral blood lymphocytes as described in Materials and Methods. The library was selected against GST fusion of a 168 aa-long SP2 Streptoccocus pneumoniae polypeptide (FEMS Microbiol. Lett. 2006 262(1):14-21), which was reactive with the blood sample utilized for the scFv library construction.
- a selection procedure was designed to create a high concentration of the target protein in small incubation volume, by using biotinylated protein for panning and streptavidin-coated Dynabeads for isolation of bound phage, as described in Example 2.
- biotinylated protein for panning and streptavidin-coated Dynabeads for isolation of bound phage, as described in Example 2.
- the phage pool after the second round of affinity selection, was highly reactive with the fusion protein and negative with irrelevant proteins, such as GST, milk and streptavidin, which presented either as protein carrier or components of the selection system and all used as negative controls in ELISA, thus indicating successive selection of specific antibodies.
- FIG. 11 confirms the higher affinity of the maturated antibodies.
- lymph node-derived and between 18-68% of TIL-derived heavy chain antibody sequences belong to clonal groups (Cancer Immunol. Immunother. 2003 52(12):715-738). This indicates both tumor-draining lymph nodes and tumor-infiltrating lymphocytes are promising sources of tumor-specific antibodies.
- the authors showed, by PCR amplification of specific antibody gene regions deriving from ten primary breast tumors (none being of the rare MBC histological type) of patients aged between 49-79 years, that 7 of 10 of these samples (70%), have a prominence of IgG antibody expression, as compared with IgA subclass, which correlates with the oligoclonality of the hypervariable region of heavy chain antibodies, suggesting a specific immune response to tumor-expressed antigens. Clonality of tumor-derived antibodies was confirmed by sequencing analysis.
- TIL-B very restricted naturally occurring antibody repertoire provided by TIL-B
- antibody selection from a mixture of PBL and TIL-derived libraries clearly shows the latter libraries to be more efficient in cell-based panning.
- all isolated anti-MCF7 single-chain antibodies appeared to be derived from tumor-infiltrating lymphocytes.
- TIL-derived libraries gave good results in all performed selections, providing a panel of human tumor-specific antibodies, which recognize tumor cell-surface antigens useful for therapy and diagnosis of cancer.
- investigation of the protein targets eliciting production of tumor cell-specific antibodies in a tumor microenvironment may (i) provide important details about individual immunoreactivity of a given patient, affording a prognostic value; (ii) open a large perspective for discovery of novel tumor-specific antigens.
- Specimens of breast carcinoma and fresh peripheral blood from breast cancer patients (B81-B96, EC23) were obtained from M. G. Vannini Hospital, Rome. All the human biological samples were obtained through informed consent.
- the breast carcinoma cell lines MCF-7 (ATCC Number: HTB-22), MDA-MB-468 (ATCC Number: HTB-132) and SkBr3 (ATCC Number: HTB-30), and colon adenocarcinoma cell line LoVo (ATCC Number: CCL-229) were maintained according to manufacturer's instructions.
- Human foreskin fibroblasts (HFF) were cultivated in DMEM supplemented with 10% FBS and 1% L-glutamine.
- Immortal breast epithelial cells MCF10-2A (ATCC number CRL-10781) [Cancer Res. 1990 50(18):6075-86] were propagated according to manufacturer's instructions, and used as negative controls in ELISA tests.
- Human CEA protein purified from colon carcinoma and liver metastases, was purchased from USBiological (#C1300-16, United States Biological, Swampscott, Mass.).
- Biotinylated recombinant ED-B domain of fibronectin was obtained from Sigma-Tau S.p.A. (Pomezia, Rome).
- Recombinant MUC1 protein was obtained in several steps.
- lymphocytes were isolated from 10 mL of fresh peripheral blood mixed with anticoagulant by using Ficoll-Paque Plus (Amersham Pharmacia Biotech, Sweden) according to manufacturer's instructions. mRNA was isolated from lymphocytes by using Dynabeads mRNA DIRECT Kit (Dynal, Norway).
- RNA samples of about 200 mg from breast carcinoma patients were obtained as surgical discard samples and immediately frozen in liquid nitrogen.
- Total RNA was prepared by Total RNA Isolation System (Promega, Madison, Wis.) and purified to poly A + RNA using PolyATract mRNA Isolation Systems (Promega). Five hundred ng of poly(A) + RNA from breast carcinomas or 1 ⁇ g of the poly(A) + RNA from the lymphocytes were used to synthesize full-length cDNAs by using SMART cDNA library construction kit (Clontech, Palo Alto, Calif.).
- the hypervariable V(D)J antibody region was amplified by PCR from cDNA templates by using site-specific primers 5′-GGACACGGCT(G/C)TGTATTACTG-3′ [SEQ ID 101] and 5′-GCTGAGGAGACGGTGACC-3′ [SEQ ID 102] designed in designed in a study by Hansen and colleagues [Proc Natl Acad Sci USA 2001 98(22):12659-64]. IgG1, IgG2 and IgA subclass determination was done as described in [J Immunol.
- Antibody gene repertoire was amplified using set of primers designed for amplification of VH and VL antibody domains [Pope, A. R., Embleton, M. J. & Memaugh R. (1996) Construction and use of antibody gene repertoires.
- Antibody Engineering A practical approach (McCafferty, J., Hoogenboom, H. & Chiswell D., eds), pp. 325, Oxford University Press] and scFv fragments were assembled in vitro as described earlier [Pope A Ret al., 1996].
- the scFv fragments were then amplified by PCR with appropriate extension primers, incorporating NcoI, NotI restriction sites, permitting the cloning of the scFv genes into pKM19 vector.
- the resulting PCR products were purified on a 1% low-melting agarose gel (NuSieve 3:1 agarose, Rockland, Me.).
- the DNA fragments were digested with NcoI/NotI and inserted into pKM19 vector.
- the ligated DNA was used to transform competent bacterial cells DH5 ⁇ F′ (supE44 ⁇ lacU169 ( ⁇ 80 lacZ ⁇ M15) hsdR17 recA1 endA1gyrA96 thi-1 re1A1 F′ [traD36proAB + lacI q lacZ ⁇ M15]) by electroporation.
- the transformed cells were plated on 20 agar dishes ( ⁇ 15 cm), containing LB agar, 100 ⁇ g/mL ampicillin and 1% glucose. After overnight incubation at 37° C., bacterial colonies were scraped from the plates and resuspended in LB, containing 10% of glycerol. Aliquots of this cell suspension were stored at ⁇ 80° C. and used for phage amplification.
- MCF-7 semi-confluent cells (about 2 ⁇ 10 7 ) were rinsed 3 times with PBS buffer and incubated with 2 mL of 2 mM EDTA in PBS for 15 min at 37° C.
- Ten mL of PBS containing 10 mM MgCl 2 were added to the cells, they were accurately removed by pipetting.
- the cells were collected by centrifuging, washed once with 10 mL of PBS/MgCl 2 and finally resuspended in 1 mL of freshly prepared blocking buffer: 4% non-fat dry milk, 0.05% Tween 20, 5 ⁇ 10 11 pfu of f1 UV-killed phage.
- the cells were blocked for 30 min at RT on rotating wheel, then collected and incubated for 1 h at 37° C. on the wheel with about 5 ⁇ 10 11 TU of freshly amplified scFv antibody library in 1 mL of blocking buffer.
- the cells were washed 5 times with PBS/Tween.
- the bound phage was eluted by adding 400 ⁇ L of 0.1 M HCl, pH 2.2 (adjusted by glycine).
- Cell suspension was incubated with elution solution for 10 min at RT, neutralized by 40 ⁇ L of 2M Tris-HCl, pH 9.6 and used for infection of bacterial cells.
- the bacteria were plated on two LB agar dishes ( ⁇ 15 cm), containing 100 ⁇ g/mL ampicillin and 1% glucose. Scraped bacteria were used for phage amplification.
- CEA and MUC1 were biotinylated as described in [Harlow E. & Lane D. Antibody: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1988]. About 5 ⁇ 10 11 TU of freshly amplified scFv antibody libraries were preincubated with 50 ⁇ L of AD202 bacterial extract in blocking buffer for 30 min at 37° C. Twenty ⁇ of a biotinylated protein were added to the reaction mixture and incubated for another h at 37° C. under gentle agitation.
- the bound phage was captured by using streptavidin-coated Dynabeads M-280 (112.05, Dynal, Oslo, Norway) according to manufacturer's instructions, washed 5-10 times with PBS/Tween, then, eluted and amplified as above.
- the cells were grown in 96-well plate until almost confluent. After discarding the growth medium, 100 ⁇ L of freshly prepared 4% paraformadehyde (#15710, Electron Microscopy Science, Hatfield, Pa.) in PBS were rapidly added for 10 min. The fixing solution was removed by pipetting and cells were incubated with blocking buffer (5% milk, 0.05% Tween 20 in PBS) for 30 min at RT. PEG purified phage in blocking buffer (1:1) was added to cells and incubated for 1 h at 37° C. under gentle agitation. The cells were washed 3 times and an anti-M13 HRP-conjugated antibody (Pharmacia) was used for developing the reaction. All assays were done in triplicate.
- the cells were grown in a 24-well plate for cell culture (Nunc, Roskilde, Denmark), fixed as above and blocked with 3% BSA in PBS for 1 h at room temperature. PEG-purified phage in 1% BSA/PBS was added to the cells and incubated for 1 h under gentle agitation at 37° C. The cells were washed three times with 1% BSA/PBS and incubated with an anti-M13 mouse monoclonal antibody (27-9420-01, Amersham Biosciences) for 30 min at 37° C.
- the cells were washed as above and then incubated with an FITC-conjugated anti-mouse goat polyclonal antibody (554001, BD Biosciences Pharmingen, San Jose, Calif.) at a concentration of 5 ⁇ g/mL for 30.1 min at 37° C. under gentle agitation. After the last incubation, cells were washed five times, dried in the dark, mounted with Vectashield medium (Vector Laboratories, Inc. Burlingame, Calif.) and cover glasses, and analyzed using an inverted fluorescence microscope.
- an FITC-conjugated anti-mouse goat polyclonal antibody 554001, BD Biosciences Pharmingen, San Jose, Calif.
- the expression patterns of the antibody fragment genes was analyzed by semi-quantitative PCR from SMART cDNA template.
- the panel of cDNAs from ten breast carcinomas, from samples of normal breast, normal testis and peripheral blood lymphocytes from healthy donors were normalized by PCR amplification of a housekeeping gene, ⁇ -actin and are shown in FIG. 13A .
- Hypervariable heavy chain antibody regions (V(D)J) were amplified as described in Materials and Methods. After analysis by agarose gel electrophoresis, the same PCR products were fractionated by high resolving 10% PAGE ( FIG. 13B ). In applying this technique, the authors observe that 7 out of 10 tumor-deriving samples contain various numbers of discrete bands, characterizing oligoclonality of the immune response in these patients, while the well-amplified normal breast and peripheral lymphocyte DNA fragments do not contain intensive bands and form a smear, consisting of the bands of different length. The observed oligoclonality of the immunoglobulins does not correlate with the age of the patients.
- More frequently isolated antibodies (B92-A and B93-A1) contained V(D)J regions of the exact length corresponding to the strong bands earlier observed in FIG. 13B (lines with B92 and B93 samples) ( FIG. 15 ), thus indicating that both PCR amplification with variable heavy chain primers and the cloning step do not introduce any particular bias interfering with heavy chain frequencies in the constructed library.
- scFv antibody libraries were constructed using seven cDNAs as template, characterized by oligoclonality of the immune response (see list of libraries in Table 2). Only library scFvEC23 (described in Example 1) was constructed from peripheral blood lymphocytes, obtained from a single patient with advanced stage of breast cancer.
- FIG. 17 represents ELISA of single scFv-phages selected on purified antigens.
- the analyzed single clones strongly bind respective antigens and does not react with irrelevant proteins. This result indicates the pKM19 vector is a suitable tool for selection of anti-tumor antibodies from TIL and PBL-derived libraries.
- scFvB96 TIL-derived library
- Four or five selection rounds on MCF-7 cells were necessary for mixLIB or scFvB96 libraries, respectively, in order to enrich the phage pools for specific cell binders ( FIG. 18 ). Then, randomly picked clones were analyzed for entire scFv antibody presence.
- Mix11, mix12, mix17, mix23 and mix39 scFv antibodies (Table 4) were selected from a mixture of PBL and TIL-derived libraries. The authors investigated the origin of these antibodies in order to see which type of library works better in equal selection conditions.
- One ⁇ L of each amplified library was used as template for PCR amplification with pair of oligonucleotide primers specific for each antibody ( FIG. 20 ).
- This analysis shows that the 5 tested scFv antibodies, isolated from a mixture of libraries, belong to TIL-derived antibodies.
- Antibody genes of mix7 and mix25 antibodies (having the same heavy chain as mix12, table 5), and mix8 (similar to mix39, table 5) are believed to have a similar origin.
- Anti-MUC1 MB5 and anti-CEA CB37 antibodies which were selected from the mixture of four TIL-derived libraries (mixTIL) were shown to derive from the scFvmix and the scFvB96 libraries, respectively.
- Binding specificities of several clones including mix17, mix7 ( FIG. 21 ), anti-Muc1 antibody MB5 and anti-CEA CB37 ( FIG. 22 ) were assayed by immunofluorescent staining of tumor cells directly with scFvs antibodies displayed on the phage.
- Mix17 scFv recognizes major part of non-permealized MCF7 breast carcinoma cells in this experiment ( FIG. 21A ), while mix7 stains a low percentage of cells, probably apoptotic cells.
- MB5 antibody intensively stains MCF7 cells, known for high MUC1 expression, and reacts well also with another breast carcinoma cell line, SkBr3( FIG. 22 ).
- CB37 antibody stains LoVo cells. No background staining for normal breast epithelium was observed for both MB5 and C1337 antibodies.
- CB37 and MB5 To increase affinity of tumor specific antibodies CB37 and MB5 we performed affinity maturation of the antibodies in vitro.
- the new maturation libraries were created by combination of genes of single VH chains derived from CB37 and MB5, respectively, with various genes of VL chains derived from TIL and PBL of tumor patients.
- the libraries were constructed as described in Example 1 and 2.
- the affinity selection was performed by using biotinylated proteins as described in Example 2, with the difference that for first round of affinity selection we used 10 ⁇ g of the protein and for second only 50 ng.
- Clones found positive in ELISA were screened by PCR and fingerprinting with restriction enzymes AluI and HaeIII to identify different clones. The DNA sequence of the clones were determined.
- the antibody genes from clones having reactivity against target proteins higher than original antibodies were cloned in pKM16 to produce scFvs in soluble form as described in Example 1.
- the maturated antibody fragments were characterized for antigen binding.
- MixTIL and MixLIB are mixture of libraries defined in table 2.
- Library Anti- Anti- used for body gen selection Nucleotide/Amino acid sequence EDE1 ED-B scFvEC23 CAGGTGCAGCTGCAGGAGTCTGGGGCTGAGGTGAAGAAG CCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGA TACACCTTCACCGGCTACTATATGCACTGGGTGCGACAG GCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAAC CCTAACAGTGGTGGCACAAACTATGCACAGAAGTTTCAG GGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACA GCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACG GCCGTGTATTACTGTGCGAGAGATTCGCCACAAAATTGT ACTAATGGTGTATGCCACCGGGGGAGTCATGTCCACTAC TACGGTATGTATGCCACCGGGGGAGTCATGTCCACTAC TACGGTATGTATGCCACCGGGG
- Table 6 reports the kinetic values of the parental and affinity-maturated scFvs.
- the maturated antiMUC1 antibodies MB5/C′1 and MB5/C′3 have over 42 times and 17 times higher affinity to the antigen, compared to MB5, respectively.
- the maturated anti-CEA antibodies CB37/3B and CB37/9C have nanomolar affinity. Moreover, the maturated antibodies are more stable than original CB37, which was not reactive in soluble form.
- ORGANISM Escherichia coli
- acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc aattaatgtg agttagctca 120
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Crystallography & Structural Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Communicable Diseases (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Indexing, Searching, Synchronizing, And The Amount Of Synchronization Travel Of Record Carriers (AREA)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US13/831,258 USRE45968E1 (en) | 2005-12-27 | 2006-12-27 | Vector for efficient selection and/or maturation of an antibody and uses thereof |
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP05028501A EP1803814A1 (en) | 2005-12-27 | 2005-12-27 | Method of improving the antibody selection capacity in phage-display library |
EP05028501 | 2005-12-27 | ||
PCT/IT2006/000876 WO2007074496A2 (en) | 2005-12-27 | 2006-12-27 | Vector for efficient selection and/or maturation of an antibody and uses thereof |
US12/097,876 US8003383B2 (en) | 2005-12-27 | 2006-12-27 | Vector for efficient selection and/or maturation of an antibody and uses thereof |
US13/831,258 USRE45968E1 (en) | 2005-12-27 | 2006-12-27 | Vector for efficient selection and/or maturation of an antibody and uses thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
USRE45968E1 true USRE45968E1 (en) | 2016-04-12 |
Family
ID=36177357
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US13/831,258 Active USRE45968E1 (en) | 2005-12-27 | 2006-12-27 | Vector for efficient selection and/or maturation of an antibody and uses thereof |
US12/097,876 Ceased US8003383B2 (en) | 2005-12-27 | 2006-12-27 | Vector for efficient selection and/or maturation of an antibody and uses thereof |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/097,876 Ceased US8003383B2 (en) | 2005-12-27 | 2006-12-27 | Vector for efficient selection and/or maturation of an antibody and uses thereof |
Country Status (17)
Country | Link |
---|---|
US (2) | USRE45968E1 (ja) |
EP (2) | EP1803814A1 (ja) |
JP (1) | JP5435956B2 (ja) |
AT (1) | ATE506435T1 (ja) |
AU (1) | AU2006329517B2 (ja) |
CA (1) | CA2634962C (ja) |
CY (1) | CY1111505T1 (ja) |
DE (1) | DE602006021476D1 (ja) |
DK (1) | DK1966375T3 (ja) |
ES (1) | ES2362120T3 (ja) |
HR (1) | HRP20110369T1 (ja) |
IL (1) | IL191633A (ja) |
PL (1) | PL1966375T3 (ja) |
PT (1) | PT1966375E (ja) |
RS (1) | RS51866B (ja) |
SI (1) | SI1966375T1 (ja) |
WO (1) | WO2007074496A2 (ja) |
Families Citing this family (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1803814A1 (en) | 2005-12-27 | 2007-07-04 | SIGMA-TAU Industrie Farmaceutiche Riunite S.p.A. | Method of improving the antibody selection capacity in phage-display library |
WO2009109572A2 (en) * | 2008-03-03 | 2009-09-11 | Ablynx Nv | Monovalent phage display of single variable domains |
WO2013115425A1 (en) * | 2012-01-31 | 2013-08-08 | Scripps Korea Antibody Institute | Methods for screening an antibody by one-cycle panning |
WO2014096672A1 (fr) | 2012-12-17 | 2014-06-26 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Utilisation d'anticorps monoclonaux pour le traitement de l'inflammation et d'infections bacteriennes |
MA56416A (fr) | 2015-05-12 | 2022-05-04 | Regeneron Pharma | Détermination de la pureté de protéines multimériques |
AR106991A1 (es) | 2015-12-15 | 2018-03-07 | Gilead Sciences Inc | Anticuerpos neutralizantes del virus de inmunodeficiencia humana |
JP7083820B2 (ja) | 2016-09-30 | 2022-06-13 | セントレ ナショナル デ ラ レセルシュ シャンティフィク | 膜マーカー |
EP3642229A1 (en) | 2017-06-21 | 2020-04-29 | Gilead Sciences, Inc. | Multispecific antibodies that target hiv gp120 and cd3 |
CN111196857B (zh) * | 2020-02-05 | 2023-07-21 | 杭州贤至生物科技有限公司 | 一种新型冠状病毒多表位重组抗原及其制备方法 |
KR20230007470A (ko) * | 2020-05-06 | 2023-01-12 | 소렌토 쎄라퓨틱스, 인코포레이티드 | Sars-cov-2 s 단백질에 결합하는 중화 항체 |
US20230416343A1 (en) * | 2020-08-07 | 2023-12-28 | Sorrento Therapeutics, Inc. | Neutralizing Antibodies that Bind the SARS-COV-2 S Protein |
WO2022053188A1 (en) | 2020-09-11 | 2022-03-17 | Alfasigma S.P.A. | NOVEL DNA SEQUENCES ENCODING HUMAN SCFVs ANTIBODIES WITH NEUTRALIZING ACTIVITY AGAINST SARS-CORONAVIRUS-2 AND USES THEREOF |
Citations (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3663684A (en) | 1970-06-01 | 1972-05-16 | Hoffmann La Roche | Carcinoembryonic antigen and diagnostic method using radioactive iodine |
WO1990011092A1 (en) | 1989-03-21 | 1990-10-04 | Vical, Inc. | Expression of exogenous polynucleotide sequences in a vertebrate |
WO1992001047A1 (en) | 1990-07-10 | 1992-01-23 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
WO1993011236A1 (en) | 1991-12-02 | 1993-06-10 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
WO1997045544A1 (en) | 1996-05-24 | 1997-12-04 | Philogen S.R.L. | Antibodies to the ed-b domain of fibronectin, their construction and uses |
CA2286301A1 (en) | 1999-11-01 | 2001-05-01 | Michael Bruce Zwick | The filamentous phage as a multivalent scaffold for coupling synthetic peptides for immunization |
WO2001036433A2 (en) | 1999-11-15 | 2001-05-25 | Biomira, Inc. | Synthetic lipid-a analogs and uses thereof |
JP2002532058A (ja) | 1998-08-20 | 2002-10-02 | セル ジェネシス インコーポレイテッド | 組換え遺伝子産物の産生の間の細胞傷害性を調節するためのサプレッサーtRNAの使用 |
EP1452599A1 (en) | 1991-03-01 | 2004-09-01 | Dyax Corp. | Improved epitope displaying phage |
US6856208B2 (en) | 2002-01-21 | 2005-02-15 | National Chung Cheng University | Multi-phase oscillator and multi-phase oscillation signal generation method |
WO2005042578A2 (en) | 2003-10-30 | 2005-05-12 | The Arizona Board Of Regents On Behalf Of The University Of Arizona | Antibody fab fragment specific for breast cancer |
WO2005118647A2 (en) | 2004-05-18 | 2005-12-15 | Genentech, Inc. | M13 virus major coat protein variants for c-terminal and bi-terminal display of a heterologous protein |
EP1803814A1 (en) | 2005-12-27 | 2007-07-04 | SIGMA-TAU Industrie Farmaceutiche Riunite S.p.A. | Method of improving the antibody selection capacity in phage-display library |
US20080241169A1 (en) | 1999-09-03 | 2008-10-02 | Ramot At Tel-Aviv University, Ltd. | Immunization against amyloid plaques using display technology |
WO2012001004A1 (en) | 2010-07-02 | 2012-01-05 | Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. | Fimh vaccine against urinary tract infections (uti) |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH0482266A (ja) * | 1990-07-24 | 1992-03-16 | Seiko Epson Corp | 半導体装置、及びその製造方法 |
-
2005
- 2005-12-27 EP EP05028501A patent/EP1803814A1/en not_active Withdrawn
-
2006
- 2006-12-27 AU AU2006329517A patent/AU2006329517B2/en not_active Ceased
- 2006-12-27 EP EP06842807A patent/EP1966375B1/en active Active
- 2006-12-27 WO PCT/IT2006/000876 patent/WO2007074496A2/en active Application Filing
- 2006-12-27 PL PL06842807T patent/PL1966375T3/pl unknown
- 2006-12-27 ES ES06842807T patent/ES2362120T3/es active Active
- 2006-12-27 AT AT06842807T patent/ATE506435T1/de active
- 2006-12-27 PT PT06842807T patent/PT1966375E/pt unknown
- 2006-12-27 US US13/831,258 patent/USRE45968E1/en active Active
- 2006-12-27 RS RS20110218A patent/RS51866B/en unknown
- 2006-12-27 SI SI200631020T patent/SI1966375T1/sl unknown
- 2006-12-27 CA CA2634962A patent/CA2634962C/en active Active
- 2006-12-27 US US12/097,876 patent/US8003383B2/en not_active Ceased
- 2006-12-27 JP JP2008548090A patent/JP5435956B2/ja active Active
- 2006-12-27 DE DE602006021476T patent/DE602006021476D1/de active Active
- 2006-12-27 DK DK06842807.7T patent/DK1966375T3/da active
-
2008
- 2008-05-22 IL IL191633A patent/IL191633A/en active IP Right Grant
-
2011
- 2011-05-18 HR HR20110369T patent/HRP20110369T1/hr unknown
- 2011-05-27 CY CY20111100518T patent/CY1111505T1/el unknown
Patent Citations (18)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3663684A (en) | 1970-06-01 | 1972-05-16 | Hoffmann La Roche | Carcinoembryonic antigen and diagnostic method using radioactive iodine |
WO1990011092A1 (en) | 1989-03-21 | 1990-10-04 | Vical, Inc. | Expression of exogenous polynucleotide sequences in a vertebrate |
WO1992001047A1 (en) | 1990-07-10 | 1992-01-23 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
EP1452599A1 (en) | 1991-03-01 | 2004-09-01 | Dyax Corp. | Improved epitope displaying phage |
WO1993011236A1 (en) | 1991-12-02 | 1993-06-10 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
WO1997045544A1 (en) | 1996-05-24 | 1997-12-04 | Philogen S.R.L. | Antibodies to the ed-b domain of fibronectin, their construction and uses |
JP2002532058A (ja) | 1998-08-20 | 2002-10-02 | セル ジェネシス インコーポレイテッド | 組換え遺伝子産物の産生の間の細胞傷害性を調節するためのサプレッサーtRNAの使用 |
US20080241169A1 (en) | 1999-09-03 | 2008-10-02 | Ramot At Tel-Aviv University, Ltd. | Immunization against amyloid plaques using display technology |
CA2286301A1 (en) | 1999-11-01 | 2001-05-01 | Michael Bruce Zwick | The filamentous phage as a multivalent scaffold for coupling synthetic peptides for immunization |
WO2001036433A2 (en) | 1999-11-15 | 2001-05-25 | Biomira, Inc. | Synthetic lipid-a analogs and uses thereof |
US6856208B2 (en) | 2002-01-21 | 2005-02-15 | National Chung Cheng University | Multi-phase oscillator and multi-phase oscillation signal generation method |
WO2005042578A2 (en) | 2003-10-30 | 2005-05-12 | The Arizona Board Of Regents On Behalf Of The University Of Arizona | Antibody fab fragment specific for breast cancer |
WO2005118647A2 (en) | 2004-05-18 | 2005-12-15 | Genentech, Inc. | M13 virus major coat protein variants for c-terminal and bi-terminal display of a heterologous protein |
EP1803814A1 (en) | 2005-12-27 | 2007-07-04 | SIGMA-TAU Industrie Farmaceutiche Riunite S.p.A. | Method of improving the antibody selection capacity in phage-display library |
WO2007074496A2 (en) | 2005-12-27 | 2007-07-05 | Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. | Vector for efficient selection and/or maturation of an antibody and uses thereof |
US20080286274A1 (en) * | 2005-12-27 | 2008-11-20 | Olga Minenkova | Vector for Efficient Selection and/or Maturation of an Antibody and Uses Thereof |
US8003383B2 (en) | 2005-12-27 | 2011-08-23 | Sigma Tau Industrie Farmaceutiche Riunite S.pA. | Vector for efficient selection and/or maturation of an antibody and uses thereof |
WO2012001004A1 (en) | 2010-07-02 | 2012-01-05 | Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. | Fimh vaccine against urinary tract infections (uti) |
Non-Patent Citations (164)
Title |
---|
A. Rothe et al. "Construction of phage display libraries from reactive lymph nodes of breast carcinoma patients and selection for specifically binding human single chain Fv on cell lines", International Journal of Molecular Medicine 14, pp. 729-735 (2004). |
A. Rothe et al. "Construction of phage display libraries from reactive lymph nodes of breast carcinoma patients and selection for specifically binding human single chain Fv on cell lines", International Journal of Molecular Medicine, vol. 14, pp. 729-735 (2004). |
Alessandro Pini et al. "Design and use of a phage display library", The Journal of Biological Chemistry, vol. 273, pp. 21769-21776 (1998). |
Barbas III, CF., et al., Phage Display: A Laboratory Manual 2001, Cold Spring Harbor Laboratory Press, New York, pp. IV-XVI, 1.1. |
Barbas, C.F. III et al., Phage-display vectors in Phage Display: A Laboratory Manual Cold Spring Harbor Laboratory Press, 2001, pp. 2.1-2.19, ISSN: 0-87969-546-3. |
Barbas, CF., et al., Phage Display: A Laboratory Manual 2001, Cold Spring Harbor Laboratory Press, New York, pp. IV-XVI, 1.1. |
Barbas, CF., et al., Phage Display: A Laboratory Manual 2001, Cold Spring Harbor Laboratory Press, New York, pp. IV-XVI, 1.1;. |
Beatrix Kotlan et al., "Novel ganglioside antigen identified by B cells in human medullary breast carcinomas: The proof of principle concerning tumor infiltrating B lymphocytes", The Journal of Immunology 175, pp. 2278-2285 (2005). |
Beatrix Kotlan et al., "Novel gangoslide antigen identified by B cells in human medullary breast carcinomas: The proof of principle concerning tumor infiltrating B lymphocytes", The Journal of Immunology 175, pp. 2278-2285 (2005). |
Beekwilder, J. et al., A phagemid vector using the E. coli phage shock promoter facilitates phage display of toxic proteins, Gene, vol. 228 1999, pp. 23-31. |
Bernstein et al., Defective humoral immunity in pediatric immune deficiency syndrome acquired, J. Pediatrics 1985, 107: 352-357. |
Bowie, J.U. et al. "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions." Science, New Series. vol. 247 (4948). Mar. 1990, pp. 1306-1310. |
Brigitte Sanzey, "Modulation of Gene Expression by Drugs Affecting Deoxyribonucleic Acid Gyrase", Journal of Bacteriology vol. 138, No. 1, pp. 40-47 (Apr. 1979). |
Brigitte Sanzey, "Modulation of Gene Expresssion by Drugs Affecting Deoxyribonucleic Acid Gyrase", Journal of Bacteriology vol. 138, No. 1, pp. 40-47 (Apr. 1979). |
C.K. Garofalo et al, "Escherichia coli from urine of female patients with urinary tract infections is competent for intracellular bacterial community formation." Infect Immun. Jan. 2007; 75(1):52-60. |
C.M. Bearden et al., "Rituximab inhibits the in vivo primary and secondary antibody response to a neoantigen, bacteriophage phiX174." Am J Transplant. Jan. 2005;5(1 ):50-7. |
C.S. Reigstad et al., "Functional genomic studies of uropathogenic Escherichia coli and host urothelial cells when intracellular bacterial communities are assembled." J Biol Chem. Jul. 20, 2007; 282(29):21259-67. |
Carlos F. Barbas et al. "Assembly of combinatorial antibody libraries on phage surfaces: The gene III site", Proc Natl. Acad. Sci. USA vol. 88, pp. 7978-7982 (Sep. 1991). |
Carlos F. Barbas et al. "Assembly of combinatorial antibody libraries on phage surfaces: The gene III site", Proc. Natl. Acad. Sci. USA vol. 88, pp. 7978-7982 (Sep. 1991). |
Clark et al., Bacterial Pathogenesis Part B: Interaction of Pathogenic Bacteria with Host Cells, Methods in Enzymology 1994, 236: 211-231. |
Clark et al., Bacterial viruses as human vaccines, Expert Rev. Vaccines 2004, 3: 463-476. |
Cornelis J. A. Punt et al. "Anti-tumor antibody produced by human tumor-infiltrating and peripheral blood B lymphocytes", Cancer Immunol Immunother 38, pp. 225-232 (1994). |
Crissman, J., et al., Gene-III protein of filamentous phages: evidence for a carboxyl-terminal domain with a role in morphogenesis, Virology 1984, 132: 445-455. |
D. O'Connell et al. "Phage versus Phagemid Libraries for Generation of Human Monoclonal Antibodies" in J. Molec. Biol., 2002, vol. 321, No. 1, pp. 49-56. |
Das, P., Vaginal vaccine for recurrent urinary-tract infections, The Lancet 2002, 2: 68. |
Dente et al., Monoclonal antibodies that recognize filamentous phage: tools for phage: display technology, Gene 1994, 148: 7-13. |
Dickson, R., et al., Genetic Regulation: the lac control region, Science 1975, 187: 27-35. |
Donald B. Smith et al. "Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase", Gene 67, pp. 31-40 (1988). |
Donald B. Smith et al. "Single-step purification of polypeptides expressed in Eschericia coli as fusions with glutathione S-transferase", GENE 67, pp. 31-40 (1988). |
E.F. Fynan et al., "DNA vaccines: Protective immunizations by parenteral, mucosal, and gene-gun inoculations", Proc. Natl. Acad. Sci. USA, vol. 90, pp. 11478-11482, 1993. |
Elisa Beghetto et al. "Discovery of novel Streptococcus pneumonia antigens by screening a whole genome-display library", FEMS Microbial Lett. 262, pp. 14-21 (2006). |
Emilian Pavoni et al., "New display vector reduces biological bias for expression of antibodies in E. coli", GENE 391, pp. 120-129 (2007). |
Emilian Pavoni et al., "Selection, affinity maturation, and characterization of human scFv antibody against CEA protein", BMC Cancer 6:41 (2006). |
Emiliano Pavoni et al., "Identification of a panel of tumor-associated antigens from breast carcinoma cell lines, solid tumors and testis cDNA libraries displayed on lambda phage" in BMC Cancer, 4:78; Nov. 12, 2004. |
Emiliano Pavoni et al., "Identification of a panel of tumor-associated antigens from breast carcinoma cell lines, solid tumors and testis cDNA libraries displayed on lambda phage" in BMC Cancer, p. 78; Nov. 12, 2004. |
Emiliano Pavoni et al., "New display vector reduces biological bias for expression of antibodies in E. coli" in Gene, vol. 391, No. 1-2, pp. 120-129, Apr. 15, 2007. |
Erik S. Kass et al., "Carcinoembryonic antigen as a target for specific antitumor immunotherapy of head and neck cancer", Cancer Research 62, pp. 5049-5057 (Sep. 1, 2002). |
Erik S. Kass et al., "Carcinoembryonic antigen as a target for specific antitumor immunotherapy of head and neck cancer", Cancer Research 62, pp. 5049-5457 (Sep. 1, 2001). |
Esposito et al., Immunogenicity and therapeutic efficacy of phage-displayed beta-amyloid epitopes, Mol. Immuno. 2008, 45: 1056-1062. |
European Search Opinion issued for European Application No. EP05028501.4 filed Dec. 27, 2005 in the name of SIGMA-TAU. |
European Search Report issued for European Application No. EP05028501.4 filed Dec. 27, 2005 in the name of Sigma-Tau. Mailed Aug. 18, 2006. |
Final Office Action issued for U.S. Appl. No. 12/097,876, filed Jun. 17, 2008, in the name of Olga Minenkova et al., mailed on Jan. 18, 2011. |
Final Office Action issued for U.S. Appl. No. 13/806,609, filed Jan. 30, 2013 in the name of Rita De Santis et al. Mail date: Oct. 23, 2014. |
Franco Felici, "Selection of antibody ligands from a large library of oligopeptides expressed on a multivalent exposition vector", J. Mol. Bio. 222, pp. 301-310 (1991). |
Franco Felici, et al. "Selection of antibody ligands from a large library of oligopeptides expressed on a multivalent exposition vector", J. Mol. Bio. 222, pp. 301-310 (1991). |
Gabriella Garufi et al., "Display libraries on bacteriophage iambda capsid" in Biotechnology Annual Review; vol. 11, pp. 153-190, Oct. 7, 2005. |
Germaine Fuh et al., "Efficient phage display of polypeptides fused to the carboxy-terminus of the M13 gene-3 minor coat protein" in FEBS Letters, vol. 480 No. 2-3; Sep. 1, 2000. |
Germaine Fuh et al., "Efficient phage display of polypeptides fused to the carboxy-terminus of the M13 gene-3 minor coat protein" in FEBS Letters, vol. 480, pp. 231-234; 2000. |
Goldsmith, M.E. And Konigsberg, W.H. "Adsorption Protein of the Bacteriophage fd: Isolation, Molecular Properties, and Location in the Virus." Biochemistry, vol. 16, No. 12, pp. 2686-2694. 1977. |
Greenspan, N.S. et al. "Defining epitopes: It's not as easy as it seems." Nature Biotechnology. vol. 17. Oct. 1999, pp. 936-937. |
Gregory A. Weiss et al. "Design and evolution of artifical M13 coat proteins" in Journal of Molecular Biology, London, vol. 300, No. 1, pp. 213-219, Jun. 30, 2000. |
Gregory A. Weiss et al. "Design and evolution of artificial M13 coat proteins" in Journal of Molecular Biology, vol. 300, No. 1, pp. 213-219, Jun. 30, 2000. |
H.D. Ochs et al., "Immunologic responses to bacteriophage phi-X 174 in immunodeficiency diseases." J Clin Invest. Dec. 1971; 50(12):2559-68. |
Hansen, M.H. et al., The tumor-infiltrating B cell response in medullary breast cancer is oligoclonal and directed against the autoantigen actin exposed on the surface of apoptotic cancer cells, PNAS vol. 98, No. 22, pp. 12659-12664 (Oct. 23, 2001). |
Hawkins et al., Selection of phage antibodies by binding affinity mimicking affinity maturation, J. Mol. Biol. 1992, 226: 889-896. |
Heike A. Held et al., "Comprehensive mutational analysis of the M13 major coat protein: improved scaffolds for C-terminal phage display" in Journal of Molecular Biology, London, vol. 340, No. 3, pp. 587-597, Jul. 9, 2004. |
Heike A. Held et al., "Comprehensive mutational analysis of the M13 major coat protein: improved scaffolds for C-terminal phage display" in Journal of Molecular Biology, vol. 340, No. 3, pp. 587-597, Jul. 9, 2004. |
Herbert D. Soule et al. "Isolation and characterization of a spontaneously immortalized human epithelial cell line, MCF-10", Cancer Research 50, pp. 6075-6086 (Sep. 15, 1990). |
Herbert Soule et al. "Isolation and characterization of a spontaneously immortalized human epithelial cell line, MCF-10", Cancer Research 50, pp. 6075-6086 (Sep. 15, 1990). |
Herren Wu et al., "Cloning, isolation and characterization of human tumor in situ monoclonal antibodies", Cancer Immunol Immunother 51, pp. 79-90 (2002). |
Hooton et al., Diagnosis and treatment of uncomplicated urinary tract infection, Infectious Disease Clinics of North America 1997, 11: 551-581. |
Hopkins et al., Induction of Urinary Tract Infection by Intraurethral Inoculation with Escherichia coli: Refining the Murine Model, JID 1995, 171: 462-465. |
Hopkins et al., Vaginal Mucosal Vaccine for Recurrent Urinary Tract Infections in Women: Results of a Phase 2 Clinical Trial, J. Urology 2007, 177: 1349-1353. |
Hu Zhang et al. "A human monoclonal antimelanoma single-chain Fv derived from tumor-infiltrating lymphocytes", Cancer Research 55, pp. 3584-3591 (Aug. 15, 1995). |
Hua Zhang et al. "A human monoclonal antimelanoma single-chain Fv derived from tumor-infiltrating lymphocytes", Cancer Research 55, pp. 3584-3591 (Aug. 15, 1995). |
I.U. Mysorekar, et al., "Mechanisms of uropathogenic Escherichia coli persistence and eradication from the urinary tract." Proc Natl Acad Sci US A. Sep. 19, 2006; 103(38):14170-5. |
International Preliminary Report on Patentability issued on Jul. 1, 2008, for PCT Application No. PCT/IT2006/000876 filed Dec. 27, 2006 in the name of Sigma-Tau. |
International Search Report for PCT Application PCT/EP2011/060839 filed on Jun. 28, 2011 in the name of Sigma-Tau Industrie Farmaceutiche Riunite S.p.A. Mail date: Aug. 12, 2011. |
J. Beekwilder et al. "A phagemid vector using the E. coli phage shock promoter facilitates phage display of toxic proteins", GENE 228, pp. 23-31 (1999). |
J. Clark et al., "Bacteriophages and biotechnology: vaccines, gene therapy and antibacterials." Trends in Biotechnology, May 2006, LNKd-PUBMED:16567009, vol. 24, No. 5; pp. 212-218. |
J. McCafferty et al., "Antibody Engineering: A Practical Approach" (soft cover) Oxford University Press, 1996, ISBN 0-19-963592-7. |
J. O. Drife et al. "Immunoglobin synthesis in the "resting" breast", British Medical Journal 2, pp. 503-506 (1976). |
Jamie K. Scott et al., "Phage-display vectors" in Phage Diaplay: A Laboratory Manual Cold Spring Harbor Laboratory Press; pp. 2.1-2.19, 2001 ISSN: 0-87969-546-3. |
Jamie K. Scott et al., "Phage-display vectors" in Phage Display: A Laboratory Manual Cold Spring Harbor Laboratory Press; pp. 2.1-2.19, 2001 ISSN: 0-87969-546-3. |
Japanese Office Action for Japanese Patent Application No. 2008-548090 filed in the name of Sigma-Tau Industrie Farmaceutiche Riunite S.p.A. Mail date: Apr. 26, 2013 (English Translation & Japanese Original). |
Jeffrey H. Miller et al. "Effects of Surrounding Sequence on the Suppression of nonsense codons", J. Mol. Bio. 164, pp. 59-71 (1983). |
John A. Thompson et al. "Cancinoembryonic antigen gene family: Molecular biology and clinical perspectives", Journal of Clinical Laboratory Analysis 5, pp. 244-366 (1991). |
John A. Thompson et al. "Carcinoembryonic antigen gene family: Molecular biology and clinical perspectives", Journal of Clinical Laboratory Analysis 5, pp. 344-366 (1991). |
John B. B. Ridgway et al. "Identification of a Human Anti-CD55 Single-Chain Fv by Subtractive Panning of a Phage Library Using Tumor and Nontumor Cell Lines", Cancer Research 59, pp. 2718-2723 (Jun. 1, 1999). |
John B. B. Ridgway et al. "Identification of a human anti-CD55 Single-chin Fv by substractive panning of a phage library using tumor and nontumor cell lines", Cancer Research 59, pp. 2718-2723 (Jun. 1, 1999). |
Julia A. Coronella et al. "Antigen-driven oligoclonal expansion of tumor-infiltrating B cells in infiltrating ductal carcinoma of the breast", The Journal of Immunology 169, pp. 1829-1836 (2002). |
Julia A. Coronella et al. "Evidence for an antigen-driven humoral immune response in medullary ductal breast cancer", Cancer Research 61, pp. 7889-7899 (Nov. 1, 2001). |
Julia A. Coronella-Wood et al. "Naturally occurring B-cell responses to breast cancer", Cancer Immunol Immunother 52, pp. 715-738 (2003). |
K. Sikora et al. "Human hybridomas from malignant gliomas", The Lancet vol. 1, Issue 8262, pp. 11-14(1982). |
K. Sikora et al. "Human hybridomas from malignant gliomas", The Lancet vol. 1, Issue 8262, pp. 1-14(1982). |
K. Sikora et al. "Human hybridomas from patients with malignant disease", Br. J. Cancer 47, pp. 135-145 (1983). |
K. Thankavel et al. "Localization of a domain in the FimH adhesin of Escherichia coli type 1 fimbriae capable of receptor recognition and use of a domain-specific antibody to confer protection against experimental urinary tract infection." J Clin Invest. Sep. 1, 1997;100(5): 1123-36. |
K.G. Naber et al., "Immunoactive prophylaxis of recurrent urinary tract infections: a meta-analysis." Int J Antimicrob Agents. Feb. 2009; 33(2): 111-9. |
Katherine P. Topping et al., "Isolation of human colorectal tumor reactive antibodies using phage display technology", International Journal of Oncology 16, pp. 187-195 (2000). |
Kimata, K., et al., cAMP receptor protein-cAMP palys a crucial role in glucose-lactose diauxie by activating the major glucose transporter gene in Escherichia coli, PNAS 1997, 94: 12914-12919. |
Kimata, K., et al., cAMP receptor protein-cAMP plays a crucial role in glucose-lactose diauxie by activating the major glucose transporter gene in Escherichia coli, PNAS 1997, 94: 12914-12919. |
Kotlan, B. et al. A scFv phage display mini library generated from the immunoglobulin repertoire of breast medullary carcinoma infiltrating B lymphocytes. Disease Markers, vol. 16, 2000, pp. 25-27. |
Krebber, A. et al., Inclusion of an upstream transcriptional terminator in phage display vectors abolishes background expression of toxic fusions with coat protein g3p, Gene, vol. 178 1996, pp. 71-74. |
Krieg, A., Lymphocyte activation by CpG dinucleotide motifs in prokaryotic DNA, Trends in Microbiol. 1996, 4: 73-77. |
Langermann et al., Prevention of Mucosal Escherichia coli Infection by FimH-Adhesin-Based Systemic Vaccination, Science 1997, 276: 607-611. |
Lidqvist et al., Phage display for site-specific immunization and characterization of high-risk human papillomavirus specific E7 monoclonal antibodies, J. Immunol. Methods 2008, 337: 88-96. |
Luciano Zardi et al., "Transformed human cells produce a new fribonectin isoform by preferential alternative splicing of a previously unobserved exon." The EMBO Journal vol. 6, No. 8, pp. 2337-2342 (1987). |
Luciano Zardi et al., "Transformed human cells produce a new fribronectin isoform by preferential alternative splicing of a previously unobserved exon." The EMBO Journal vol. 6, No. 8, pp. 2337-2342 (1987). |
Lucien Perey et al., "Effects of Differentiating Agents on Cell Surface Expression of the Breast Carcinoma-Associated DF3-P Epitope", Cancer Research 52, pp. 6365-6370 (Nov. 15, 1992). |
Lucien Perey et al., "Effects of differentiating agents on cell surface expression of the breast carcinoma-associated DF3-P epitope", Cancer Research 52, pp. 6367-6370 (Nov. 15, 1992). |
M. A. Clark et al. "Isolation of human anti-c-erbB-2 Fabs from a lymph node-derived phage display library", Clin. Exp. Immunol 109, pp. 166-174 (1997). |
M.J. McCluskie et al., "CpG DNA is a potent enhancer of systemic and mucosal immune responses against hepatitis B surface antigen with intranasal administration to mice." J Immunol. Nov. 1, 1998; 161(9):4463-6. |
Manabu Yasuda et al. "Tumor-infiltrating B lymphocytes as a potential source of identifying tumor antigen in human lung cancer", Cancer Research 62, pp. 1751-1756 (Mar. 15, 2002). |
Marciano, D.K. et al. "An Aqueous Channel for Filamentous Phage Export." Science, vol. 284, pp. 1516-1519. May 1999. |
Margit H. Hansen et al. "The tumor-infiltrating B cell response in medullary breast cancer is oligoclonal and directed against the autoantigen actin exposed on the surface of apoptotic cancer cells", PNAS vol. 98, No. 22, pp. 12659-12664 (Oct. 23, 2001). |
Margit H. Hansen et al. "Translocation of an intracellular antigen to the surface of medullary breast cancer cells early in apoptosis allows for antigen-driven antibody response elicited by tumor-infiltrating B Cells", The Journal of Immunology 169, pp. 2701-2711 (2002). |
Margit H. Hansen, "Translocation of an intracellular antigen to the surface of medullay breast cancer cells early in apoptosis allows for antigen-driven antibody response elicited by tumor-infiltrating B Cells", The Journal of Immunology 169, pp. 2701-2711 (2002). |
Marvin, D.A., X-Ray Diffraction and Electron Microscope Studies on the Structure of the Small Filamentous Bacteriophage fd, J. Mol. Biol. 1966, 15: 8-17. |
Michael A. McGuckin et al. "Prognostic Significance of MUC1 Epithelial Mucin Expression in Breast Cancer", Human Pathology vol. 26, No. 4 pp. 432-439 (1995). |
Ming-Yan Xu et al., "Production of a human signle chain-variable fragment antibody against esophageal carcinoma", World J. Gastroenterol 10(18), pp. 2619-2623 (2004). |
Ming-Yanh Xu et al., "Production of a human signle chain-variable fragment antibody against esophageal carcinoma", World J. Gastroenterol 10(18), pp. 2619-2623 (2004). |
Mohsen Shadid et al., "An Anti-leukemic single chain Fv antibody selected from a synthetic human phage antibody library", Biochemical and Biophysical Research Communications 280, pp. 548-552 (2001). |
Mohsen Shadidi et al., "An Anti-leukemic single chain Fv antibody selected from a synthetic human phage antibody library", Biochemical and Biophysical Research Communications 280, pp. 548-552 (2001). |
Non-Final Office Action issued for U.S. Appl. No. 12/097,876, filed Jun. 17, 2008, in the name of Olga Minenkova et al., mailed on Jun. 3, 2010. |
Non-Final Office Action issued for U.S. Appl. No. 13/806,609, filed Jan. 30, 2013 in the name of Rita De Santis et al. Mail date: Dec. 27, 2013. |
Non-Final Office Action mailed on Jun. 14, 2013 for U.S. Appl. No. 13/806,609, filed Jan. 30, 2013 in the name of Rita De Santis et al. |
Notice of Allowance issued for U.S. Appl. No. 12/097,876, filed Jun. 17, 2008, in the name of Olga Minenkova et al., mailed on May 13, 2011. |
O.O. Minenkova, et al., "Design of specific immunogens using filamentous phage as the carrier." Gene. 1993; 128(1):85-8. |
O'Connell et al. (J. Molec. Biol. Aug. 2, 2002; 321(1):49-56). * |
O'Connor, C., et al., Highly repressible expression system for cloning genes that specify potentially toxic proteins, Journal of Bacteriology 1987, 169: 4457-4462. |
O'Connor, C., et al., Highly repressible expression system for cloning genes that specify potentially toxic proteins, Journal of Bacteriology 1987, 169:4457-4462. |
Olga Minenkova et al., "Identification of tumor-associated antigens by screening phage-displayed human cDNA libraries with sera from tumor patients" in International Journal of Cancer, vol. 106, No. 4, pp. 534-544, Sep. 10, 2003. |
Olga Minenkova et al., "Identification of Tumor-Associated Antigens by Screening Phage-Displayed Human cDNA Libraries with Sera From Tumor Patients", Int. J. Cancer, 2003, vol. 106, pp. 534-544. |
Park et al. (Biochem. Biophys. Res. Commun. Aug. 28, 2000;275(2):553-7; Abstract). * |
Parker, J., Errors and alternatives in reading the universal genetic code, Microbiological reviews 1989, 53: 273-298. |
Parr et al., Immunity to vaginal infection by herpes simplex virus type 2 in adult mice: characterization of the immunoglobulins in vaginal mucus, J. Reproductive Immunology 1998, 38: 15-30. |
Pat Edelmann et al. "Nonsense suppression context effects in Escherichia coli bacteriophage T4", Mol. Gen. Genet. 207, pp. 517-518 (1987). |
PCT International Search Report for PCT/IT2006/000876 filed on Dec. 27, 2006 in the name of Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. et al. |
PCT International Search Report for PCT/IT2006/000876 filed on Dec. 27, 2006 in the name of Sigma-Tau Industrie Farmaceutiche Riunite S.p.A. et al. Mailed Nov. 13, 2007. |
Philippa M. O'Brien, "Immunoglobulin genes expressed by B-lymphocytes infiltrating cervical carcinomas show evidence of antigen-driven selection", Cancer Immunol Immunother 50, pp. 523-532 (2001). |
R.S. Williams et al., "Introduction of foreign genes into tissues of living mice by DNA-coated microprojectiles", Proc. Natl. Acad. Sci. USA, vol. 88, pp. 2726-2730, 1991. |
Restriction Requirement issued for U.S. Appl. No. 12/097,876, filed Jun. 17, 2008, in the name of Olga Minenkova et al., mailed on Oct. 28, 2009. |
Restriction Requirement mailed on Jun. 14, 2013 for U.S. Appl. No. 13/806,609, filed Jan. 30, 2013 in the name of Rita De Santis et al. |
Richard J. Simpson, Chapter title "Characterization of protein complexes" in Proteins and proteomics: A Laboratory Manual, 2002, pp. 705. |
Rob C. Foovers et al. "Evidence for a bias toward intracellular antigens in the local humoral anti-tumor immune response of a colorectal cancer patient revealed by phage display", Int. J. Cancer 93, pp. 832-840 (2001). |
Rob C. Roovers et al. "Evidence for a bias toward intracellular antigens in the local humoral antitumor immune response of a colorectal cancer patient revealed by phage display", Int. J. Cancer 93, pp. 832-840 (2001). |
Roy et al., Oral gene delivery with chitosan-DNA nanoparticles generates immunologic protection in a murine model of peanut allergy, Nat. Med. 1999, 4: 387-39. |
S. B. Brown et al. "Catalatic activity of iron (III)-centered catalysts", Biochem J. 117, pp. 741-744 (1970). |
S. Langermann et al, "Vaccination utilizing the FimCH complex as a strategy to prevent Escherichia coli urinary tract infections." The Journal of Infectious Diseases, Mar. 1, 2001, LNKD- PUBMED:11171023, vol. 183 Suppl 1, pp. S84-S86. |
S. Thirion et al., "Mono-and bispecific single-chain antibody fragments for cancer therapy" in European Journal of Cancer Prevention, vol. 5, No. 6, pp. 507-511, Dec. 1996. |
S.G. Park et al. "Affinity maturation of natural antibody using a chain shuffling technique and the expression of recombinant antibodies in Escherichia coli" in Biochem. Biophys. Res. Commun., 2000, vol. 275, No. 2, pp. 553-557; (Abstract). |
Sambrook et al., Molecular Cloning: A Laboratory Manual 1989, Cold Spring Harbor Lab Press, pp. 1-3. |
Sambrook J. et al. Molecular cloning: A laboratory manual, vol. 1, 2nd edition. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1989: 4.17. |
Sato et al., Immunostimulatory Dna sequences necessary for effective intradermal gene immunization, Science 1996, 273: 352-354. |
Satoru Imahayashi et al., "Tumor Infiltrating B-Cell-Derived IgG Recognizes Tumor Components in Human Lung Cancer", Cancer Investigation 18(6), pp. 530-536 (2000). |
Satoru Imahayashi et al., "Tumor infiltrating C-cell-derived IgG recognizes tumor components in human ling cancer", Cancer Investigation 18(6), pp. 530-536 (2000). |
Schimmele, B. et al. Ribosome dislay of mammalian receptor domains. Protein Engineering Design & Selection, vol. 18 (6), 2005, pp. 285-294. |
Schulman et al., Oral immunotherapy of recurrent urinary tract infections: A double-blind placebo-controlled multicenter study, J. Urology 1993, 150: 917-921. |
Scott et al. (Phage Display: A Laboratory Manual, Cold Spring Harbor Lab. Press, p. 2.1-2.19 (2001)). * |
Scott, J.K. et al. et al., "Phage-display vectors" in Phage Display: A Laboratory Manual, Cold Spring Harbor Press; pp. 2.1-2.19, 2001. |
Simpson, Characterization of protein complexes, Science 2002, 705. |
Sletta, H. et al. Broad-host-range plasmid pJB658 can be used for Industrial-Level Production of a Secreted Host-Toxic Single-Chain Antibody Fragment in Escherichia coli. Applied and Environmental Microbiology, Vol., vol. 70 (12), Dec. 2004, pp. 7033-7039. |
Stamm, W., Urinary tract infections, Infectious Disease Clinics of North America 2003, xiii-xiv. |
Sten Hammarstrom, "The carcinoembryonic antigen (CEA) family" Cancer Biology, vol. 9, pp. 67-81 (1999). |
Sten Hammarstrom, "The carcinoembryonic antigen (CEA) family: structures, suggested functions and expression in normal and malignant tissues," Seminars in Cancer Biology, vol. 9, pp. 67-81 (1999). |
T.V. Poggio et al., "Intranasal immunization with a recombinant truncated FimH adhesin adjuvanted with CpG oligodeoxynucleotides protects mice against uropathogenic Escherichia coli challenge." Can J Micro biol. 2006; 52(11):1093-102. |
Titus Kretzschmar et al., "Evaluation of antibodies fused to minor coat protein III and major coat protein VIII of bacteriophage M13", GENE 155, pp. 61-65 (1995). |
V. Tchesnokova et al., "Integrin-like allosteric properties of the catch bond-forming FimH adhesin of Escherichia coli." J Biol Chem. Mar. 21, 2008;283(12):7823-33. Epub Jan. 3, 2008. |
Vieira et al., Production of Single-stranded Plasmid DNA, Methods in Enzymology 1987, 1253: 3-11. |
Viti, F., et al., Design and use of phage display libraries for the selection of antibodies and enymes, Methods in Enzymology 2000, 326: 480-505. |
Wedgwood et al., The recognition and classification of immunodeficiency disease with phiX 174, Birth Defects: Original Article Series 1975, XI: 331-338. |
Wedgwood et al., The recognition and classification of immunodeficiency disease with φX 174, Birth Defects: Original Article Series 1975, XI: 331-338. |
Willis et al., Immunological properties of foreign peptides in multiple display on a filamentous bacteriophage, Gene 1993, 128: 79-83. |
Written Opinion for PCT Application PCT/EP2011/060839 filed on Jun. 28, 2011 in the name of Sigma-Tau Industrie Farmaceutiche Riunite S.p.A. Mail date: Aug. 12, 2011. |
Also Published As
Publication number | Publication date |
---|---|
IL191633A (en) | 2012-04-30 |
PL1966375T3 (pl) | 2011-08-31 |
ATE506435T1 (de) | 2011-05-15 |
CA2634962C (en) | 2015-03-31 |
RS51866B (en) | 2012-02-29 |
AU2006329517A1 (en) | 2007-07-05 |
WO2007074496A3 (en) | 2008-01-10 |
US20080286274A1 (en) | 2008-11-20 |
SI1966375T1 (sl) | 2011-07-29 |
CA2634962A1 (en) | 2007-07-05 |
US8003383B2 (en) | 2011-08-23 |
EP1803814A1 (en) | 2007-07-04 |
CY1111505T1 (el) | 2015-08-05 |
EP1966375A2 (en) | 2008-09-10 |
AU2006329517B2 (en) | 2012-09-06 |
DK1966375T3 (da) | 2011-06-20 |
DE602006021476D1 (de) | 2011-06-01 |
IL191633A0 (en) | 2008-12-29 |
EP1966375B1 (en) | 2011-04-20 |
ES2362120T3 (es) | 2011-06-28 |
HRP20110369T1 (hr) | 2011-06-30 |
JP5435956B2 (ja) | 2014-03-05 |
JP2009521241A (ja) | 2009-06-04 |
WO2007074496A2 (en) | 2007-07-05 |
PT1966375E (pt) | 2011-06-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
USRE45968E1 (en) | Vector for efficient selection and/or maturation of an antibody and uses thereof | |
Ahmad et al. | scFv antibody: principles and clinical application | |
EP3288973B1 (en) | Method for mass humanization of rabbit antibodies | |
EP0934526B1 (en) | Methods and means for selecting peptides and proteins having specific affinity for a target | |
CA2380443C (en) | Single-domain antigen-binding antibody fragments derived from llama antibodies | |
JP5783703B2 (ja) | 還元環境下において安定な、規定されたフレームワークを有するイントラボディーおよびそれらの用途 | |
US20100240100A1 (en) | Human antibodies that have mn binding and cell adhesion-neutralizing activity | |
KR101740030B1 (ko) | ScFv 항체 라이브러리, 이의 제조방법 및 이를 이용한 ScFv 항체 스크리닝 방법 | |
CA2784251A1 (en) | Focused libraries of genetic packages | |
CA2386926A1 (en) | Antibody to human gastrointestinal epithelial tumor antigen related to alpha 6 beta 4 integrin | |
Pavoni et al. | Tumor-infiltrating B lymphocytes as an efficient source of highly specific immunoglobulins recognizing tumor cells | |
CN108164600B (zh) | 一种抗gpc3抗体及其制备方法和用途 | |
EP1592792A1 (en) | Proteomic screen to identify disease-related biological molecules and inhibitors thereto | |
CN112028997A (zh) | 抗ceacam5纳米抗体 | |
EP2499163B1 (en) | Single-chain variable fragment (scfv) able to recognize and bind cd99 human protein | |
Pavoni et al. | New display vector reduces biological bias for expression of antibodies in E. coli | |
KR20020079888A (ko) | 결장 암에 대해 특이성을 가지는 신규한 항체 | |
Bao et al. | Isolating human antibody against human hepatocellular carcinoma by guided-selection | |
JP2024513871A (ja) | 機能性抗原結合タンパク質のスクリーニングに用いられるベクターおよび方法 | |
Ayat et al. | Construction of human recombinant ScFv phage libraries from the advanced stages of breast carcinoma patients | |
TIAN et al. | Production and characterization of a human single2chain Fv to collagenase IV3 | |
AU2002349969A1 (en) | Human antibodies that have MN binding and cell adhesion-neutralizing activity | |
MXPA00010434A (en) | Methods of selecting internalizing antibodies |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: ALFASIGMA S.P.A., ITALY Free format text: MERGER;ASSIGNOR:SIGMA-TAU INDUSTRIE FARMACEUTICHE RIUNITE S.P.A.;REEL/FRAME:044760/0906 Effective date: 20170801 |
|
MAFP | Maintenance fee payment |
Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY Year of fee payment: 8 |
|
AS | Assignment |
Owner name: ALFASIGMA S.P.A., ITALY Free format text: CHANGE OF ADDRESS;ASSIGNOR:ALFASIGMA S.P.A.;REEL/FRAME:050727/0652 Effective date: 20180504 |
|
MAFP | Maintenance fee payment |
Free format text: PAYMENT OF MAINTENANCE FEE, 12TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1553); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY Year of fee payment: 12 |