US9457079B2 - Methods for producing enteroendocrine cells that make and secrete insulin - Google Patents

Methods for producing enteroendocrine cells that make and secrete insulin Download PDF

Info

Publication number
US9457079B2
US9457079B2 US13/697,792 US201113697792A US9457079B2 US 9457079 B2 US9457079 B2 US 9457079B2 US 201113697792 A US201113697792 A US 201113697792A US 9457079 B2 US9457079 B2 US 9457079B2
Authority
US
United States
Prior art keywords
cells
insulin
gut
foxo1
rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US13/697,792
Other languages
English (en)
Other versions
US20130216554A1 (en
Inventor
Chutima Talchai
Domenico ACCILI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Columbia University in the City of New York
Original Assignee
Columbia University in the City of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Columbia University in the City of New York filed Critical Columbia University in the City of New York
Priority to US13/697,792 priority Critical patent/US9457079B2/en
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: COLUMBIA UNIV NEW YORK MORNINGSIDE
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: COLUMBIA UNIV NEW YORK MORNINGSIDE
Publication of US20130216554A1 publication Critical patent/US20130216554A1/en
Assigned to THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK reassignment THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ACCILI, DOMENICO, TALCHAI, CHUTIMA
Application granted granted Critical
Publication of US9457079B2 publication Critical patent/US9457079B2/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/48—Drugs for disorders of the endocrine system of the pancreatic hormones
    • A61P5/50—Drugs for disorders of the endocrine system of the pancreatic hormones for increasing or potentiating the activity of insulin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0676—Pancreatic cells
    • C12N5/0678—Stem cells; Progenitor cells; Precursor cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0679—Cells of the gastro-intestinal tract
    • C12N5/068—Stem cells; Progenitors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5073—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/575—Hormones
    • G01N2333/62—Insulins

Definitions

  • Diabetes mellitus is a family of disorders characterized by chronic hyperglycemia and the development of long-term complications. This family of disorders includes type 1 diabetes, type 2 diabetes, gestational diabetes, and other types of diabetes. Immune-mediated (type 1) diabetes (or insulin dependent diabetes mellitus, IDDM) is a disease of children and adults for which there currently is no adequate means for cure or prevention. Type 1 diabetes represents approximately 10% of all human diabetes.
  • Type 1 diabetes is distinct from non-insulin dependent diabetes (NIDDM) in that only the type 1 form involves specific destruction of the insulin producing beta cells of the pancreatic islets of Langerhans; alpha cells (glucagon producing) or delta cells (somatostatin producing) in pancreatic islet are spared.
  • NIDDM non-insulin dependent diabetes
  • alpha cells glucagon producing
  • delta cells somatostatin producing
  • Type 1 diabetes occurs predominantly in genetically predisposed persons. Although there is a major genetic component in the etiology of type 1 diabetes, environmental or non-germline genetic factors also appear to play important roles.
  • Type 1 diabetes affects 1 in 300 people in the U.S. Incidents of type 1 diabetes are rising at the rate of about 3% to 5% per year.
  • insulin Since 1922, insulin has been the only available therapy for the treatment of type 1 diabetes and other conditions related to lack of or diminished production of insulin; however, it does not prevent the long-term complications of the disease, including damage to blood vessels, nerves, eyes, and kidneys which may affect eyesight, kidney function, heart function and blood pressure and can cause circulatory system complications. This is because insulin treatment cannot replace entirely the missing pancreatic function. Despite decades of research and the advent of pancreatic islet cell transplantation in 1974 and newer claims of success resulting from the Edmonton Protocol for islet cell transplantation, the success of replacing insulin-producing cells has been modest.
  • Difficulties associated with islet or pancreas transplant including obtaining sufficient quantities of tissue and the relatively low rate at which transplanted islets survive and successfully function in the recipient, have not yet been overcome.
  • fewer than 10% of patients who have received islet cell transplants remain insulin independent. Additionally, despite new immune suppression protocols, there is an 18% rate per patient of serious side effects.
  • FIG. 1 Gut insulin—producing cells in NKO mice.
  • A Co-localization of Neurog3-Gfp (red) and Foxo1 (green) in intestines of control and NKO mice crossed with Neurog3-Gfp reporter mice.
  • B Lack of co-localization of Neurog-Gfp with Foxo1 in NKO mice.
  • C Insulin immunohistochemistry (red) in pancreas (outlined) and gut. Original magnification: 200 ⁇ . Specimens were obtained from 1-day-old mice.
  • D Direct fluorescence in pancreata (top) and villi (bottom) of control and NKO mice crossed with Ins2-Gfp knock-in mice.
  • FIG. 2 Gut Ins + cells share essential features with pancreatic beta-cells.
  • Immunofluorescence with A) Glucokinase (Gck), (B) Prohormone convertase 2 (Pc2), (C), Sulfonylurea Receptor 1 (Sur1), (D), Glucose transporter 2 (Glut2), and (E) Synaptophysin.
  • the inset in C indicates an example of a double-positive cell.
  • Original magnification 100 ⁇ (A, C, D, E), and 200 ⁇ (B).
  • FIG. 3 Insulin secretion and bioactivity.
  • C Effects of acid-ethanol extracts from NKO (blue bars) or control mice (black bars) on plasma glucose levels following intraperitoneal injection in 5-day-old mice.
  • FIG. 4 Regeneration of gut Ins + cells following STZ-mediated ablation.
  • C Oral glucose tolerance tests in NKO mice before and after STZ administration, and in WT controls following STZ.
  • FIG. 5 Intestinal Neurog3 localization. Immunohistochemistry with anti-Neurog3 (red) and anti-Gfp (green) in neonatal gut from Neurog3-Gfp transgenic mice. The complete overlap between the two detection methods indicates that Gfp is a faithful marker of Neurog3 localization in the gut. Original magnification: 100 ⁇ .
  • FIG. 6 Foxo1 ablation in enteroendocrine progenitors expands the pool of Neurog3 + cells.
  • A Immunohistochemsitry with anti-Neurog3 antibody (green) in WT and NKO mice.
  • B Immunohistochemistry with anti-Gfp antibody and anti-ChromograninA antibody (green and red, respectively) in Neurog3-Gfp and NKO:Neurog3-Gfp mice. Original magnification: 20 ⁇ in both A and B.
  • D Flow cytometry data from gut epithelial cell preparations isolated from Neurog3-Gfp and NKO:Neurog3-Gfp mice.
  • FIG. 7 Pancreatic hormone producing cells in Foxo1 ablated gut. Fluorescence immunohistochemistry demonstrating Gcg + and Pp + cells (green) in distal ileum and colon from NKO, but not control mice. Original magnification: 200 ⁇ .
  • FIG. 8 Fluorescence immunohistochemistry with anti-insulin antibody (red) demonstrating the presence of Ins + cells in the colon of adult NKO mice at 4 months old. Original magnification: 100 ⁇ .
  • FIG. 10 Generation and analysis of PKO mice.
  • A Foxo1 (green) and Gfp immunochemistry (red) in one-day-old PKO and control mice crossed with Neurog3-Gfp transgenic reporter mice.
  • B Insulin immunostaining (red) in the distal ileum in 9 month-old PKO mice.
  • C Insulin (red) and Gfp immunostaining (green) in the duodenum of one-day-old PKO:Neurog3-Gfp and Neurog3-Gfp control mice.
  • Original magnification 200 ⁇ .
  • FIG. 13 Immunohistochemical analysis of expression of beta-cell transcription factors.
  • A Expression of Pdx1 and
  • B Nkx6.1 (green) in adult colon and distal ileum of NKO mice and WT controls. Insulin immunoreactivity is indicated in red in both panel sets. The cytoplasmic localization of the two transcription factors is likely due to the fixation procedure.
  • FIG. 14 Aes expression in NKO mice.
  • B Immunoreactivity with anti-Insulin (green) and Aes (red) in the colon of adult NKO and WT control mice following STZ administration. Original magnification: 200 ⁇ .
  • C Immunohistochemistry with Pc2 and Aes antibodies (red) in pancreas and gut of NKO:Rosa26eGfp and control mice. Original magnification: 20 ⁇ .
  • FIG. 15 Model of Foxo1 function.
  • N3 prog give rise to all endocrine cell types (orange symbols).
  • gut endocrine cells (orange symbols), some of which are shared in common with the pancreas, and some of which are specific to the gut.
  • Foxo is permissive, i.e., it allows these events to occur.
  • Pancreas-specific cell types including insulin-producing beta cells, glucagon-producing alpha cells, and pancreatic polypeptide-producing cells, are not found in the normal gut.
  • Foxo normally exerts a repressive effect on the generation of these cell types in the gut, and that Foxo inhibition leads to their appearance in the gut.
  • FIG. 16 Live fluorescent micrograph at 100 ⁇ . Crypts were isolated from distal ileum and colon of WT or NKO carrying GFP reporter at Ins2 locus and culture in vitro. Day 3: No conversion of crypt cells to Ins ⁇ GFP cells is seen because there is no green cell in both normal and Neurog3-Foxo1 knockout mice.
  • FIG. 17 Day 6: Conversion of crypt cells to Insulin + GFP cells due to Foxo1 DNA inactivation as evidenced by the green that indicates Insulin + GFP cells.
  • Crypts were isolated from distal ileum and colon of WT or NKO carrying GFP reporter at Ins2 locus and culture in vitro. Isolated gut cells were kept in Medium 1 for 3 days and switched to Medium 2 for 3 days. Live fluorescent micrograph at 100 ⁇ .
  • FIG. 18 Day 6: Increased conversion of crypt cells to Ins + GFP cells in Foxo1 ablated crypts (i.e. NKO mice). Live fluorescent micrograph at 200 ⁇ . Crypts were isolated from distal ileum and colon of WT or NKO carrying GFP reporter at Ins2 locus and culture in vitro. The conversion efficiency is improved as indicated by increased green cells that represent Insulin + GFP cells when Isolated gut cells were kept in Medium 1 for 1 day, Medium 2 for 2 days and switched to Medium 4b for 3 days.
  • FIG. 19 Day 6 Insulin + GFP cells are live cells. Green cells indicate Insulin + GFP cells. Blue indicates dead cells. Crypts were isolated from distal ileum and colon of WT or NKO carrying GFP reporter at Ins2 locus and culture in vitro. Isolated gut cells were kept in Medium 1 for 1 day, Medium 2 for 2 days and switched to Medium 4b for 3 days.
  • FIG. 20 Day 6: Conversion of crypt cells into Ins + GFP is cells due to inhibition of Foxo1 RNA; the green cells indicate insulin + GFP cells.
  • a method for treating or preventing a disease or disorder in an mammal associated with impaired pancreatic function comprising administering to the mammal a therapeutically effective amount of an agent that reduces the expression or biological activity of one or more Foxo proteins or biologically active fragments or variants thereof selected from the group consisting of an isolated shRNA, siRNA, antisense RNA, antisense DNA, Chimeric Antisense DNA/RNA, microRNA, and ribozymes that are sufficiently complementary to either a gene or an mRNA encoding one or more of the Foxo proteins, and antibodies or biologically active fragments or variants thereof that specifically bind to one or more Foxo proteins thereby reducing biological activity of the one or more proteins.
  • an agent that reduces the expression or biological activity of one or more Foxo proteins or biologically active fragments or variants thereof selected from the group consisting of an isolated shRNA, siRNA, antisense RNA, antisense DNA, Chimeric Antisense DNA/RNA, microRNA, and ribozymes that are sufficiently complementary to either a
  • the disease or disorder is selected from the group comprising of diabetes type 1, diabetes type 2, metabolic syndrome, glucose intolerance, hyperglycemia, decreased insulin sensitivity, increased fasting glucose, increased post-prandial glucose and obesity.
  • the therapeutically effective amount is an amount that produces an effect selected from the group consisting of an increase in glucose tolerance, an increase in serum insulin, an increase insulin sensitivity, a decrease in fasting glucose, a decrease in post-prandial glucose, a decrease in weight gain, a decrease in fat mass, an increase in weight loss and the generation of enteroendocrine cells in the gastrointestinal tract that produce and secrete insulin.
  • the agent is administered to the gastrointestinal tract.
  • inventions are directed to a pharmaceutical formulation for treating or preventing a disease or disorder in an mammal associated with impaired pancreatic function, comprising an effective amount of an agent that reduces the expression or biological activity of one or more Foxo proteins or biologically active fragments or variants thereof selected from the group consisting of an isolated shRNA, siRNA, antisense RNA, antisense DNA, Chimeric Antisense DNA/RNA, microRNA, and ribozymes that are sufficiently complementary to either a gene or an mRNA encoding one or more of the Foxo proteins, and antibodies or biologically active fragments or variants thereof that specifically bind to one or more Foxo proteins thereby reducing biological activity of the one or more proteins.
  • an agent that reduces the expression or biological activity of one or more Foxo proteins or biologically active fragments or variants thereof selected from the group consisting of an isolated shRNA, siRNA, antisense RNA, antisense DNA, Chimeric Antisense DNA/RNA, microRNA, and ribozymes that are sufficiently complementary to either a gene or
  • the effective amount is an amount that produces an effect selected from the group consisting of an increase in glucose tolerance, an increase in serum insulin, an increase insulin sensitivity, a decrease in fasting glucose, a decrease in post-prandial glucose, a decrease in weight gain, a decrease in fat mass, an increase in weight loss and the generation of enteroendocrine cells in the gastrointestinal tract that produce and secrete insulin.
  • Another embodiment is directed to a method for producing enteroendocrine cells that make and secrete insulin in a mammal, comprising administering to the mammal an agent that reduces the expression or biological activity of one or more Foxo proteins or biologically active fragments or variants thereof selected from the group consisting of ribosomes and an isolated shRNA, siRNA, antisense RNA, antisense DNA, Chimeric Antisense DNA/RNA, and microRNA that are sufficiently complementary to either a gene or an mRNA encoding one or more of the Foxo proteins, and antibodies or biologically active fragments or variants thereof that specifically bind to one or more Foxo proteins thereby reducing biological activity of the one or more proteins.
  • an agent that reduces the expression or biological activity of one or more Foxo proteins or biologically active fragments or variants thereof selected from the group consisting of ribosomes and an isolated shRNA, siRNA, antisense RNA, antisense DNA, Chimeric Antisense DNA/RNA, and microRNA that are sufficiently complementary to either a gene or
  • the insulin-producing enteroendocrine cells further produce one or more pancreatic hormones selected from the group consisting of glucagon, pancreatic polypeptide, glucokinase, and glut2 in response to administration of the agent.
  • the insulin-producing enteroendocrine cells also produce one or more proteins selected from the group consisting of prohormone-convertase Pc2, Pdx1, MafA, Nkx6.1, Nkx2.2, and Pax4.
  • Another embodiment is a method for increasing glucose tolerance or for increasing insulin sensitivity in an mammal, comprising administering to the mammal a therapeutically effective amount of an agent that reduces the expression or biological activity of one or more Foxo proteins or biologically active fragments or variants thereof selected from the group consisting of ribosomes and an isolated shRNA, siRNA, antisense RNA, antisense DNA, Chimeric Antisense DNA/RNA, and microRNA that are sufficiently complementary to either a gene or an mRNA encoding one or more of the Foxo proteins, and antibodies or biologically active fragments or variants thereof that specifically bind to one or more Foxo proteins thereby reducing biological activity of the one or more proteins.
  • an agent that reduces the expression or biological activity of one or more Foxo proteins or biologically active fragments or variants thereof selected from the group consisting of ribosomes and an isolated shRNA, siRNA, antisense RNA, antisense DNA, Chimeric Antisense DNA/RNA, and microRNA that are sufficiently complementary to either a gene or
  • An embodiment is directed to a method for making insulin producing enteroendocrine cells comprising a. obtaining a population of non-insulin producing enteroendocrine progenitor cells from the mammal, b. contacting the population with an agent that reduces the expression or biological activity of one or more FOXO proteins, or biologically active fragments or variants thereof in an amount and under conditions that permit a significant portion of population to produce insulin, and c. collecting the insulin-producing enteroendocrine cells.
  • Another embodiment is directed to a method for treating or preventing a disease or disorder in a mammal associated impaired pancreatic function, comprising reintroducing the insulin-producing enteroendocrine cells into the mammal in sufficient numbers to treat or prevent the disease or disorder.
  • Another embodiment is directed to the insulin-producing enteroendocrine cells made by the method and to a pharmaceutical formulation comprising the cells.
  • Another embodiment is a medicament for preventing a disease or disorder in a mammal associated with impaired pancreatic function, comprising an agent in a therapeutically effective amount that reduces the expression or biological activity of one or more Foxo proteins or biologically active fragments or variants thereof selected from the group consisting of an isolated shRNA, siRNA, antisense RNA, antisense DNA, Chimeric Antisense DNA/RNA, microRNA, and ribozymes that are sufficiently complementary to either a gene or an mRNA encoding one or more of the Foxo proteins, and antibodies or biologically active fragments or variants thereof that specifically bind to one or more Foxo proteins thereby reducing biological activity of the one or more proteins.
  • an agent in a therapeutically effective amount that reduces the expression or biological activity of one or more Foxo proteins or biologically active fragments or variants thereof selected from the group consisting of an isolated shRNA, siRNA, antisense RNA, antisense DNA, Chimeric Antisense DNA/RNA, microRNA, and ribozymes that are sufficiently complementary
  • Other embodiments are directed to variations of a high-throughput screening cell-based assay for identification of agents that induce mammalian gut noninsulin-producing enteroendocrine progenitor cells to express insulin, comprising a. Isolating a population of cells comprising gut noninsulin-producing enteroendocrine progenitor cells and incubating them under conditions suitable for the production and secretion of insulin, b. providing a control and a test population of noninsulin-producing enteroendocrine progenitor cells, c. contacting the test population with a test agent, d. determining the level of insulin expression in the control and the test population, and e. selecting the test agent if the level of insulin in the test population is significantly higher than the level in the control.
  • the gene encoding insulin in the gut enteroendocrine cells is operatively linked to a protein or peptide that can be visualized.
  • the terms “animal,” “patient,” or “subject” include mammals, e.g., humans, dogs, cows, horses, kangaroos, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals.
  • the preferred animal, patient, or subject is a human.
  • “An enumerated disease or disorder” means a disease or disorder characterized by impaired pancreatic function including inappropriately low insulin levels, diabetes types 1 and 2, metabolic syndrome, obesity, glucose intolerance, hyperglycemia, decreased insulin sensitivity, increased fasting glucose, or increased post-prandial glucose. “Inappropriately low insulin levels” means insulin levels that are low enough to contribute to at least one symptom of the disease or disorder. “Impaired pancreatic function” is one in which the pathology is associated with a diminished capacity in a subject for the pancreas to produce and/or secrete insulin and/or an altered capacity (increased or decreased) to secrete pancreatic peptides such as glucagon, pancreatic polypeptide, somatostatin.
  • disorders associated with impaired pancreatic function include pathologies sometimes referred to as latent autoimmune diabetes of adulthood, pre-diabetes, impaired fasting glucose, impaired glucose tolerance, fasting hyperglycemia, insulin resistant syndrome, and hyperglycemic conditions.
  • Fluorescent tracers for use in the embodiments include GFP and derivatives, Diamidino yellow, Fast blue, Horseradish peroxidase, Cholera toxin B, Pseudorabies virus, Hydroxystilbamidine, Texas Red, Fluorescein isothiocyanate, and any others known in the art.
  • Green fluorescent protein (GFP) was used in the experiments described herein, however there are now many different mutants of GFP [Shaner N, Steinbach P, Tsien R (2005), “A guide to choosing fluorescent proteins,” Nat Methods 2(12): 905-9].
  • an “active agent” means any agent, polypeptide, nucleic acid, or small molecule that causes any enteroendocrine progenitor Ins ⁇ cell to differentiate into an Ins+ cell.
  • Preferred active agents are those that reduce expression or biological activity of a Foxo protein (including by reducing transcription or translation of the gene or mRNA, respectively, or reducing the biological activity).
  • Nucleic acid active agents include siRNA, shRNA and antisense RNA or DNA; polypeptides include antibodies and antibody fragments, and enzymes like COP1.
  • “Stem cells” means undifferentiated cells that can self-renew for unlimited divisions and differentiate into multiple cell types.
  • the PKO mice experiment ( FIG. 4 ) was to knock-out Foxo1 in all gut cells including stem cells, and the results show similar phenotypes to NKO.
  • Progenitor cells in the gut means cells descended from stem cells that are multipotent, but whose self-renewal property is limited.
  • N3 Enteroendocrine Progenitors and “N3 Prog” means a subset of insulin-negative gut progenitor cells expressing neurogenin 3 that give rise to Ins ⁇ enteroendocrine cells. It has been discovered that N3 Prog in the gut, hereafter “Gut N3 Prog,” have the potential to differentiate into cells that make and secrete insulin (“Gut Ins + Cells”), but this fate is restricted by Foxo1 during development. Pancreatic N3 Prog differentiate into pancreatic insulin-producing cells during fetal development, but it remains unclear whether there is pancreatic N3 Prog after birth or whether pancreatic N3 Prog can differentiate postnatally into pancreatic hormone-producing cells under normal or disordered conditions. It should be noted here that enteroendocrine (gut) and pancreas N3 Prog have different features, even though they are commonly referred to as N3 cells.
  • Noninsulin-producing gut progenitor cells or “Ins ⁇ Gut Prog” broadly means any gut progenitor cell that is capable of differentiating into an insulin producing gut cell (Gut Ins + cell), including stem cells and N3 Prog.
  • Enteroendocrine cells means specialized endocrine cells of the gastrointestinal tract, most of which are daughters of N3 Prog cells that no longer produce Neurogenin 3. Enteroendocrine cells are Insulin-negative cells (Gut Ins ⁇ ); they produce various other hormones such as gastrin, ghrelin, neuropeptide Y, peptide YY 3-36 (PYY 3-36 ) serotonin, secretin, somatostatin, motilin, cholecystokinin, gastric inhibitory peptide, neurotensin, vasoactive intestinal peptide, glucose-dependent insulinotropic polypeptide (GIP) and glucagon-like peptide-1.
  • GIP glucose-dependent insulinotropic polypeptide
  • Gut Ins + Cells and “Insulin positive gut cells” mean any enteroendocrine cells that make and secrete insulin descended from Ins ⁇ Gut.
  • the Gut Ins + cells have the insulin positive phenotype (Ins + ) so that they express markers of mature beta-cells, and secrete insulin and C-peptide in response to glucose and sulfonylureas.
  • Gut Ins + Cells arise primarily from N3 Prog and also from gut stem cells. These cells were unexpectedly discovered in NKO (Foxo1 knockout) mice. Unlike pancreatic beta-cells, gut Ins + cells regenerate following ablation by the beta-cell toxin, streptozotocin, reversing hyperglycemia in mice.
  • NKO mice or “Foxo1 Knockout Mice” means transgenic mice that do not express Foxo1 in N3 Prog. Not all enteroendocrine cells in the gut of Foxo1 knockout mice (hereafter “NKO mice”) make and secrete insulin; some are non-insulin producing (hereafter “Ins ⁇ ”).
  • a Foxo protein By “significantly lower in the context of reducing expression or biological activity of a Foxo protein” is meant lowering the level of Foxo proteins enough so that the enteroendocrine or other non-insulin-producing cell acquires an Ins+ phenotype, including expressing insulin.
  • “Significantly higher than the level in the control in an assay” means detectable by commonly employed assays (ELISA or RIA), whereas in the control population insulin cannot be detected by such assays. “Significantly decreased levels of Foxo protein expression” is intended as a decrease that is greater than 50% of the control values.
  • Preventing a disease includes, but is not limited to, preventing the disease from occurring in a subject that may be predisposed to the disease (or disorder), but has not yet been diagnosed as having the disease; inhibiting the disease, for example, arresting the development of the disease; relieving the disease, for example by causing its regression; relieving the condition caused by the disease, for example by reducing its symptoms, and/or delaying disease onset.
  • An example is reducing blood glucose levels in a hyperglycemic subject, and/or maintaining acceptable control of blood glucose levels in the subject.
  • Such treatment, prevention, symptoms and/or conditions can be determined by one skilled in the art and are described in standard textbooks.
  • Treating” a disease, disorder or condition in a patient refers to taking steps to obtain beneficial or desired results, including clinical results.
  • beneficial or desired clinical results include, but are not limited to alleviation or amelioration of one or more symptoms of the disease; diminishing the extent of disease; delaying or slowing disease progression; amelioration and palliation or stabilization of the disease state.
  • symptoms include frequent urination, excessive thirst, extreme hunger, unusual weight loss, increased fatigue, irritability, blurry vision, genital itching, odd aches and pains, dry mouth, dry or itchy skin, impotence, vaginal yeast infections, poor healing of cuts and scrapes, excessive or unusual infections.
  • hyperglycemia excessively elevated sugar concentrations in the blood, i.e.
  • diabetes including microvascular and microvascular disease inclusive but not limited to cerebrovascular impairment with or without, stroke, angina, coronary heart disease, myocardial infarction, peripheral vascular disease, nephropathy, kidney impairment, increased proteinuria, retinopathy, neovascularization of vessels in the retina, neuropathy including central, autonomic and peripheral neuropathy that may lead to loss of sensation of extremities and amputation and/or from neuropathy or diminished vascular flow, skin conditions including but not limited to diabetic dermopathy, necrobiosis lipoidica diabeticorum, bullosis diabeticorum, s
  • Type 1 diabetes may be diagnosed by methods well known to one of ordinary skill in the art. For example, commonly, diabetics have a plasma fasting blood glucose result of greater than 126 mg/dL of glucose. Prediabetes is commonly diagnosed in patients with a blood glucose level between 100 and 125 mg/dL of glucose. Other symptoms may also be used to diagnose diabetes, related diseases and conditions, and diseases and conditions affected by diminished pancreatic function.
  • “Reduction” of a symptom(s) means a decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s).
  • Pantology associated with impaired pancreatic function is one in which the pathology is associated with a diminished capacity in a subject for the pancreas to produce and/or secrete one or more pancreatic hormones including insulin and/or pancreatic peptides such as glucagon, pancreatic polypeptide, or somatostatin.
  • Pathologies that are associated with impaired pancreatic function include type 1 diabetes, and type 2 diabetes. Other pathologies include those sometimes referred to as latent autoimmune diabetes of adulthood, pre-diabetes, impaired fasting glucose, impaired glucose tolerance, fasting hyperglycemia, insulin resistant syndrome, and hyperglycemic conditions.
  • administering or “administration of” a drug or therapeutic pharmaceutical composition to a subject by any method known in the art includes both direct administration, including self-administration (including oral administration or intravenous, subcutaneous, intramuscular or intraperitoneal injections, rectal administration by way of suppositories), local administration directly into or onto a target tissue (such as a region of the gut that has Gut Ins ⁇ Prog, such as Gut N3 Prog), or administration by any route or method that delivers a therapeutically effective amount of the drug or composition to the cells or tissue to which it is targeted.
  • direct administration including self-administration (including oral administration or intravenous, subcutaneous, intramuscular or intraperitoneal injections, rectal administration by way of suppositories), local administration directly into or onto a target tissue (such as a region of the gut that has Gut Ins ⁇ Prog, such as Gut N3 Prog), or administration by any route or method that delivers a therapeutically effective amount of the drug or composition to the cells or tissue to which it is targeted.
  • a “subject” or “patient” is a mammal, typically a human, but optionally a mammalian animal of veterinary importance, including but not limited to horses, cattle, sheep, dogs, and cats.
  • a “therapeutically effective amount” of an active agent or pharmaceutical composition is an amount that achieves the intended therapeutic effect, e.g., alleviation, amelioration, palliation or elimination of one or more manifestations of the disease or condition in the subject.
  • the full therapeutic effect does not necessarily occur by administration of one dose and may occur only after administration of a series of doses.
  • a therapeutically effective amount may be administered in one or more administrations.
  • a “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of the disease or symptoms, or reducing the likelihood of the onset (or reoccurrence) of the disease or symptoms.
  • the full prophylactic effect does not necessarily occur by administration of one dose and may occur only after administration of a series of doses.
  • a prophylactically effective amount may be administered in one or more administrations.
  • a therapeutically effective amount can also be an amount that increases insulin secretion, increases insulin sensitivity, increases glucose tolerance, or decreases weight gain, weight loss, or fat mass.
  • an “effective amount” of an agent is an amount that produces the desired effect.
  • pharmaceutically acceptable is meant that the carrier, diluent or excipient must be compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
  • “Foxo Protein” includes Foxo1, Foxo2, Foxo3 and Foxo4 from mouse; FOXO1, FOXO2, FOXO3 and FOXO4 from human, and Foxo1-4 proteins from any other animal, including variants, orthologs, and biologically active fragments thereof. Note that FOXO2 was discovered independently but turned out to be the same gene as FOXO3. There are two NM numbers but they point to the same genomic location.
  • “Foxo gene” means any gene encoding a Foxo protein, including orthologs, and biologically active fragments thereof.
  • “Foxo mRNA” means any mRNA encoding a Foxo protein, including orthologs, and biologically active fragments thereof.
  • Administration of an agent “in combination with” includes parallel administration of two agents to the patient over a period of time such as administration of a monoclonal Anti-FOXO1, 3 and/or 4 antibody (or anti-Foxo1-4) or antibody against any other ortholog and an agent that reduces FOXO1,3 and/or 4 expression or biological activity over a period of time, co-administration (in which the agents are administered at approximately the same time, e.g., within about a few minutes to a few hours of one another), and co-formulation (in which the agents are combined or compounded into a single dosage form suitable for oral, subcutaneous or parenteral administration).
  • Embodiments of the present invention are based in part on the discovery that somatic ablation of the gene encoding Foxo1 protein in Neurog3-Foxo1 knockout (NKO) mice caused a significant percentage of Gut N3 Prog cells to differentiate into Insulin-positive enteroendocrine cells (Gut Ins + Cells) that make and secrete biologically active insulin and C-peptide, as well as other pancreatic hormones and transcription factors.
  • Gut Ins + cells secreted insulin in a dose-dependent manner in response to glucose, and acid-ethanol extracts from gut of NKO mutant mice had glucose-lowering effects in vivo.
  • Gut N3 Prog have the potential to differentiate into insulin-producing and secreting cells, but this ability is suppressed by Foxo1 gene expression.
  • Some gut stem cells may also differentiate into Ins + cells; therefore the term “Gut Ins ⁇ Prog” is used herein to include any gut progenitor cell that is capable of becoming an Ins + cell.
  • an active agent broadly includes any agent that causes differentiation of Gut Ins ⁇ Prog cells into Gut Ins ⁇ Cells.
  • agents that reduce expression or biological activity of a Foxo protein Screening assays are herein described to identify active agents. While there are precedents in the art that treatment with leptin—a hormone that regulates eating—may result in the appearance of Ins + cells in the gut, this process is unlike the process described here, in that it requires the partial transformation of another gut cell type, the “L” cell, which is a gut endocrine cell. Thus, no one has reported that gut N3 cells can give rise to Gut Ins + cells, nor has anyone reported that Ins + cells following leptin treatment are functionally capable of producing insulin, let alone producing it in a glucose-dose-dependent manner.
  • Gut Ins ⁇ Prog from normal mice have shown that contacting Gut Ins ⁇ Prog with siRNA that is sufficiently complementary to mouse Foxo1 mRNA to reduce Foxo1 expression generated Gut Ins + cells. This shows that the ability of gut enteroendocrine progenitor cells to convert into insulin-producing cells is not limited to the manipulation of the Foxo1 gene (i.e., DNA), but can also be effected through inhibition of Foxo1 mRNA.
  • certain embodiments of the invention are directed to methods for producing mammalian Gut Ins + cells by contacting Gut Ins ⁇ Prog with an agent causes the cells to become Gut Ins + cells.
  • Preferred agents include those that reduce expression of one or more Foxo genes or mRNA encoding one or more Foxo proteins, or reduce the biological activity of one or more Foxo proteins to a level that permits the Gut Ins ⁇ Prog to differentiate into cells having the Gut Ins + cells phenotype.
  • the Gut Ins ⁇ Prog cells can be contacted with the agent in situ in the animal, or enriched populations of Gut Ins ⁇ Prog can be isolated from the gut, or intestinal explants in culture can be used. Some of these methods are described in Example 10.
  • Certain other embodiments are directed to the isolated Gut Ins + cells themselves, and to tissue explants that include Gut Ins + cells, preferably intestinal tissue but artificial tissues are also included. Additional methods include the generation of Ins + cells from cells that have been reprogrammed in vitro to become gut N3 prog—in other words, gut N3 cells that have been obtained indirectly through manipulation of other cell types. For example, others made insulin-producing cells from skin biopsies by “reprogramming” cells. Conceivably, these cells went through a stage of N3 ORIGIN in order to become insulin-producing, even though the authors did not specifically test for it. These methods and others known in the art can be used in the embodiments of the invention. Maehr R, et al., 2009 Proc Natl Sci Acad USA 106(37):15768-73; Epub 2009 Aug. 31, Generation of pluripotent stem cells from patients with type 1 diabetes.
  • Efficacy of the methods of treatment described herein can be monitored by determining whether the methods ameliorate any of the symptoms of the disease being treated. Alternatively, one can monitor the level of serum insulin or C-peptide (a byproduct of insulin secretion and an index of functional Ins+ cells), which levels should increase in response to therapy. Alternatively efficacy can be measured by monitoring glycemia, glucose tolerance, fat mass, weight gain, ketone bodies or other indicia of the enumerated disease or disorder in the subject being treated.
  • impaired pancreatic function includes an altered capacity to produce and/or secrete one or more pancreatic hormones including one or more pancreatic peptides such as glucagon, pancreatic polypeptide, somatostatin, or ghrelin.
  • pancreatic hormones including one or more pancreatic peptides such as glucagon, pancreatic polypeptide, somatostatin, or ghrelin.
  • Well known pathologies that are associated with impaired pancreatic function include type 1 diabetes and type 2 diabetes. Other pathologies include those sometimes referred to as latent autoimmune diabetes of adulthood, pre-diabetes, impaired fasting glucose, impaired glucose tolerance, fasting hyperglycemia, insulin resistant syndrome, and hyperglycemic conditions. All of these come within the meaning of treating and preventing diabetes.
  • inventions are directed to methods for screening, using for example libraries of test agents, to identify those that induce Gut Ins ⁇ Prog to differentiate into Gut Ins + Cells. Some of these methods are described below in the section entitled Screening Assays.
  • the screens can be high throughput in vitro assays.
  • An in vitro system has also been developed to generate Gut Ins + cells in a test tube from noninsulin-producing gut progenitor cells.
  • Certain other embodiments are directed to Gut Ins + cells bioengineered from insulin-negative progenitor cells derived from gut biopsies from a particular diabetic patient or patient at risk of developing diabetes, which cells can then be transplanted back into the patient to provide a source of regulated insulin secretion from autologous Gut Ins + cells.
  • Gut Ins ⁇ Prog can be induced to differentiate into Gut Ins + cells that secrete biologically active insulin in direct proportion to the concentrations of glucose in the environment, and that the Gut Ins + cells can be controlled by diazoxide.
  • certain embodiments of the invention are directed to methods for treating or preventing type 1 or type 2 diabetes, or another of the enumerated diseases or disorders as defined herein that are associated with inappropriately low insulin or impaired pancreatic function in an animal, by administering an therapeutically effective amount of an agent that induces the Gut Ins ⁇ Prog to differentiate into Gut Ins + cells.
  • agents include those that reduce Foxo or FOXO genes or mRNA expression or reduce the biological activity of one or more FOXO proteins to a level that permits the Ins ⁇ Gut Prog to become Gut Ins + cells.
  • these disorders are treated or prevented by administering to an animal in need of such treatment a therapeutically effective amount of Gut Ins + cells, preferably autologous or partial autologous cells.
  • a longstanding goal of regenerative medicine is the identification of genetic, cellular, and biochemical pathways governing the generation of insulin-producing ⁇ cells, with the goal of enlisting them in ongoing cellular replacement in patients with type 1 diabetes.
  • the process by which primitive endodermal precursors adopt an endocrine fate has been examined in detail.
  • Neurogenins are a family of bHLH transcription factors generally involved in specifying neuronal differentiation; Neurogenin-3 (Neurog3 or N3) promotes pancreatic endocrine development.
  • Pancreatic and enteric endocrine cells arise from progenitors characterized by the transient expression of transcription factor Neurog3 (1-3).
  • Neurogenin 3 + endocrine progenitors are not restricted to the pancreas, but are found in the stomach and intestine, where they give rise to most of the cells in the enteroendocrine system, the largest endocrine organ in the body (2-3).
  • pancreatic and Gut N3 Progenitor cells share few if any properties: they give rise to cell types that produce distinct peptide hormones, and have remarkably different developmental fates and lifespan (8).
  • Pancreatic endocrine progenitors are formed during embryonic development, and do not arise again in the adult organ (7) except under special circumstances (24), while Gut N3 Prog are continually renewed from gut stem cells and contribute to repopulating the fast-turnover enteroendocrine cells (3).
  • N3 Prog Neurogenin 3-positive endocrine progenitors
  • Transcription factor Foxo1 regulates multiple aspects of pancreatic beta-cell function (4) and is widely expressed in Neurog3 + pancreatic endocrine progenitors (5).
  • FOXO1 knock-down increases the number of NEUROG3 + (39).
  • Foxo1 is expressed in most Neurog3 + enteroendocrine progenitors, as identified by double immunohistochemistry ( FIGS. 1A and 5 ).
  • FOXO transcription factors integrate hormonal and nutrient cues with the cell's transcriptional response to regulate diverse cellular processes including cell survival, cell cycle progression, DNA repair, and insulin sensitivity (reviewed in Tran et al., 2003).
  • FOXO proteins inhibit terminal differentiation in multiple cell types (31-32).
  • FOXO1 plays an important function to negatively regulate endocrine cell mass (26-28) and to promote the beta cell response to stress (29-30).
  • FOXO1 ablation does not affect the generation of different pancreatic endocrine cell types (28-29).
  • FOXO1 is expressed in different tissues and is a negative regulator of insulin sensitivity in liver, pancreatic beta-cells, and adipocytes.
  • Impaired insulin signaling to FOXO1 provides a unifying mechanism for the metabolic abnormalities of type 2 diabetes.
  • Studies in humans show that FOXO1 is negatively regulated by the human PKB/Akt, a serine/threonine kinase that lies downstream of PI3 kinase in the insulin signaling cascade; this regulation includes a rapid and hierarchic phosphorylation of FOXO1 on three PKB/Akt phosphorylation consensus sites (Tran et al., 2003).
  • Foxo proteins The defining feature of Foxo proteins is the forkhead box or motif, a DNA-binding domain having about 80 to 100 amino acids that and is made up of three helices and two characteristic large loops, or “wings.” Following a standardized nomenclature for these proteins (Kaestner et al., 2000), all uppercase letters are used for human (e.g., FOXO1), and only the first letter is capitalized for mouse (e.g., Foxo1).
  • the FOXO1 gene identified in Genbank NM_002015.3) (previously also FOXO1; FKH1; FKHR; and FOXO1A) is the most abundant FOXO isoform in insulin-responsive tissues such as hepatic, adipose, and pancreatic cells.
  • FOXO4 (aka AFX; AFX1; MLLT7; MGC120490; FOXO4) is set forth in Genbank NM_005938.3); FOXO3 (aka, FOXO2; AF6q21; FKHRL1; FOXO3A; FKHRL1P2; MGC12739; MGC31925; DKFZp781A0677); is set forth in Genbank NM_001455.3. All are incorporated herein by reference. Persons of skill in the art will be able to construct appropriate antisense nucleotides and siRNA using methods known in the art based on this sequence.
  • “Foxo proteins” includes orthologs (analogs in different species) like Foxo1 and biologically active fragments thereof.
  • the desired Gut Ins + phenotype is produced by reducing the expression or activity of one or more Foxo proteins, preferably including Foxo1.
  • reducing other forkhead proteins including FOXO2, FOXO4 and FOXO3 is also expected to change non-insulin-producing cells to insulin-producing cells, either alone or together with FOXO1 reduction.
  • Mus musculus forkhead box O4 (Foxo4), mRNA NCBI Reference Sequence: NM_018789.2 Genomic RefSeqGene, FOXO1 human, NG_023244.1. Foxo1 Mus musculus strain C57BL/6J chromosome 3, MGSCv37 C57BL/6J, NC_000069.5. Foxo1 Rat, NC_005101.2, NW_047625.2. FOXO3 human, NC_00006.11. Foxo3 mouse, NC_000076.5. Foxo3 Rat, NC_005119.2. FOXO4 human, NC_000023.10. Foxo4 mouse, NC_000086.6. Foxo4 rat, NC_005120.2.
  • Antisense and small interfering RNAs for use in reducing expression of Foxo proteins can be made that specifically hybridize to the gene and/or mRNA encoding a Foxo protein and that are sufficiently complementary to block protein expression by blocking either transcription or translation, respectively. Reducing Foxo1 expression will cause Gut Ins ⁇ cells to differentiate into Gut Ins + cells, and that will result in elevated insulin levels compared to pretreatment levels.
  • shRNA was used to reduce Foxo1 expression by targeting the sequence GCACCGACTTTATGAGCAACC SEQ ID NO: 1 of Foxo1 using short-hairpin RNA (from BD Biosciences) as a control siRNA target sequence. Because of the sequence homology, this sequence or a substantially homologous sequence in human FOXO1 may be a good target. Liu et al., Cancer Gene Therapy 14, 945-952 December 2007 also describe using RNA inhibitors in mice to reduce expression of Foxo1 in skeletal muscle. The siRNA used in the experiments described herein is identified in Example 10.
  • FOXO1-antisense TG GGT CAG GCG GTT CA SEQ ID NO: 2
  • FOXO3a-sense CCC AGC CTA ACC AGG GAA GT SEQ ID NO: 3
  • FOXO3a-antisense AGG GAA GT SEQ ID NO: 4
  • FOXO4-sense CCT GCA CAG CAA GTT CAT CAA SEQ ID NO: 5
  • FOXO4-antisense TTC AGC ATC CAC CAA GAG CTT SEQ ID NO: 6
  • inventions of the present invention are directed to the use of antisense nucleic acids or small interfering RNA (siRNA) or shRNA to reduce or inhibit expression and hence the biological activity of the targeted Foxo proteins.
  • siRNA small interfering RNA
  • shRNA small interfering RNA
  • antisense DNA or RNA that are sufficiently complementary to the respective gene or mRNA to turn off or reduce expression can be readily designed and engineered, using methods known in the art.
  • antisense or siRNA molecules for use in the present invention are those that bind under stringent conditions to the targeted mRNA or targeted gene encoding one or more Foxo proteins identified by the Genbank numbers, or to variants or fragments that are substantially homologous to the mRNA or gene encoding one or more Foxo proteins.
  • the antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin.
  • target nucleic acid encompass DNA encoding one or more Foxo proteins and RNA (including pre-mRNA and mRNA) transcribed from such DNA. The specific hybridization of a nucleic acid oligomeric compound with its target nucleic acid interferes with the normal function of the target nucleic acid.
  • This modulation of function of a target nucleic acid by compounds which specifically hybridize to it is generally referred to as “antisense.”
  • the functions of DNA to be interfered with include replication and transcription.
  • the functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, and catalytic activity which may be engaged in or facilitated by the RNA.
  • the overall effect of such interference with target nucleic acid function is modulating or reducing the expression of the protein encoded by the DNA or RNA.
  • “modulation” means reducing or inhibiting in the expression of the gene or mRNA for one or more Foxo proteins.
  • the targeting process includes determination of a site or sites within the target DNA or RNA encoding the Foxo protein for the antisense interaction to occur such that the desired inhibitory effect is achieved.
  • a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the mRNA for the targeted proteins.
  • the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the “AUG codon,” the “start codon” or the “AUG start codon.”
  • a minority of genes have a translation initiation codon having the RNA sequence 5′-GUG, 5′-UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo.
  • the terms “translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine in eukaryotes.
  • start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene. Routine experimentation will determine the optimal sequence of the antisense or siRNA
  • a translation termination codon (or “stop codon”) of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively).
  • start codon region and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon.
  • stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon.
  • Other target regions include the 5′ untranslated region (5′UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3′ untranslated region (3′UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA or corresponding nucleotides on the gene.
  • 5′UTR 5′ untranslated region
  • 3′UTR 3′ untranslated region
  • variants can be produced through the use of alternative signals to start or stop transcription and that pre-mRNAs and mRNAs can possess more that one start codon or stop codon.
  • Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as “alternative start variants” of that pre-mRNA or mRNA.
  • Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre-mRNA or mRNA.
  • One specific type of alternative stop variant is the “polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the “polyA stop signals” by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites.
  • nucleic acids are chosen which are sufficiently complementary to the target; meaning that the nucleic acids will hybridize sufficiently well and with sufficient specificity, to give the desired effect of inhibiting gene expression and transcription or mRNA translation.
  • hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases.
  • adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds.
  • “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of a nucleic acid is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the nucleic acid and the DNA or RNA are considered to be complementary to each other at that position.
  • nucleic acid and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other.
  • “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the nucleic acid and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
  • An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of function, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.
  • antisense nucleic acids are a preferred form of antisense compound
  • the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics.
  • the antisense compounds in accordance with this invention preferably comprise from about 8 to about 50 nucleobases (i.e., from about 8 to about 50 linked nucleosides).
  • Particularly preferred antisense compounds are antisense nucleic acids comprising from about 12 to about 30 nucleobases.
  • Antisense compounds include ribozymes, external guide sequence (EGS) nucleic acids (oligozymes), and other short catalytic RNAs or catalytic nucleic acids which hybridize to the target nucleic acid and modulate its expression.
  • EGS external guide sequence
  • Nucleic acids in the context of this invention include “oligonucleotides,” which refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly.
  • Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
  • Antisense nucleic acids have been employed as therapeutic moieties in the treatment of disease states in animals and man. Antisense nucleic acid drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that nucleic acids can be useful therapeutic modalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans, for example to down-regulate expression of one or more Foxo proteins.
  • the antisense and si RNA compounds of the present invention can be utilized for diagnostics, therapeutics, and prophylaxis and as research reagents and kits.
  • an animal preferably a human, suspected of having a disease or disorder such as diabetes, metabolic syndrome, glucose intolerance, and/or obesity where there is an inappropriately low level of insulin, which can be treated by reducing the expression of one or more Foxo proteins, is treated by administering antisense compounds in accordance with this invention.
  • the compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier.
  • the antisense compounds and methods of the invention are useful prophylactically, e.g., to prevent or delay the appearance of diabetes, glucose intolerance, metabolic syndrome or obesity.
  • the antisense compounds and methods of the invention are also useful to retard the progression of metabolic syndrome, glucose intolerance, diabetes, atherosclerosis or obesity.
  • the present invention also includes pharmaceutical compositions and formulations which include the antisense compounds described herein.
  • RNA interference double-stranded RNA
  • dsRNA double-stranded RNA
  • RNAi RNA interference
  • RNAi RNA interference
  • RNA fragments are the sequence-specific mediators of RNAi (Elbashir et al., 2001). Interference of gene expression by these small interfering RNA (siRNA) is now recognized as a naturally occurring strategy for silencing genes in C.
  • RNA nucleic acids In mammalian cell culture, a siRNA-mediated reduction in gene expression has been accomplished by transfecting cells with synthetic RNA nucleic acids (Caplan et al., 2001; Elbashir et al., 2001).
  • the 2004/0023390 application provides exemplary methods using a viral vector containing an expression cassette containing a pol II promoter operably-linked to a nucleic acid sequence encoding a small interfering RNA molecule (siRNA) targeted against a gene of interest.
  • siRNA small interfering RNA molecule
  • RNAi is the process of RNA interference.
  • a typical mRNA produces approximately 5,000 copies of a protein.
  • RNAi is a process that interferes with or significantly reduces the number of protein copies made by an mRNA.
  • a double-stranded short interfering RNA (siRNA) molecule is engineered to complement and match the protein-encoding nucleotide sequence of the target mRNA to be interfered with.
  • the siRNA molecule associates with an RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • the siRNA-associated RISC binds the target through a base-pairing interaction and degrades it.
  • the RISC remains capable of degrading additional copies of the targeted mRNA.
  • RNA can be used such as short hairpin RNA and longer RNA molecules. Longer molecules cause cell death, for example by instigating apoptosis and inducing an interferon response. Cell death was the major hurdle to achieving RNAi in mammals because dsRNAs longer than 30 nucleotides activated defense mechanisms that resulted in non-specific degradation of RNA transcripts and a general shutdown of the host cell. Using from about 20 to about 29 nucleotide siRNAs to mediate gene-specific suppression in mammalian cells has apparently overcome this obstacle. These siRNAs are long enough to cause gene suppression.
  • Certain embodiments of the invention are directed to the use of shRNA, antisense or siRNA to block expression of FOXO1, 3 and/or 4 or orthologs, analogs and variants thereof in an animal.
  • Antisense nucleotides can be designed using routine skill in the art to target human DNA or mRNA encoding a FOXO protein as is described in more detail below.
  • the antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
  • the invasin (Inv) and listeriolysin O (HlyA) genes Two factors were used to facilitate shRNA transfer: the invasin (Inv) and listeriolysin O (HlyA) genes. They have shown that the recombinant E. coli can be administered orally to deliver an shRNA against Catenin b1 (Ctnnb1) that inhibits expression of this gene in intestinal epithelial cells without demonstrable systemic complications from leaking of bacteria into the bloodstream. Certain embodiments of the invention are directed to using the Transkingdom RNA interference method adapted to siRNA that silences one or more Foxo proteins.
  • Bacteria encoding the Foxo1 shRNA can be purchased from Cequent Technologies, and can be administered inter alia by oral gavage at the recommended concentrations. Doses can be determined using analysis of Foxo1 knock-down in intestinal cells in biopsies, for example, or in test animals.
  • oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly.
  • backbone covalent internucleoside
  • modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
  • Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922.
  • the antisense nucleic acid molecules of the invention are typically administered to a subject or generated in situ such that they hybridize sufficiently with or bind to cellular mRNA and/or genomic DNA encoding the protein of interest to thereby reduce expression of the protein, e.g., by reducing transcription and/or translation.
  • the hybridization can be by conventional nucleotide complementary to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix.
  • An example of a route of administration of antisense nucleic acid molecules of the invention includes direct injection at a tissue site.
  • antisense nucleic acid molecules can be modified to target selected cells and then administered systemically.
  • antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens.
  • the antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.
  • An antisense nucleic acid molecule of the invention can be an alpha-anomeric nucleic acid molecule.
  • An .alpha.-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual .beta.-units, the strands run parallel to each other (Gaultier et al. [1987] Nucleic Acids. Res. 15:6625-6641).
  • the antisense nucleic acid molecule can also comprise a 2′-o -methylribonucleotide (Inoue et al. [1987] Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. [1987] FEBS Lett. 215:327-330). All of the methods described in the above articles regarding antisense technology are incorporated herein by reference.
  • Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
  • ribozymes e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334:585-591)
  • a ribozyme having specificity for a targeted-encoding nucleic acid can be designed based upon the nucleotide sequence of its cDNA.
  • a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in the targeted mRNA.
  • a targeted FOXO mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel and Szostak (1993) Science 261:1411-1418, incorporated herein by reference.
  • nucleic acid refers to both RNA and DNA, including cDNA, genomic DNA, and synthetic (e.g., chemically synthesized) DNA.
  • the nucleic acid can be double-stranded or single-stranded (i.e., a sense or an antisense single strand).
  • isolated nucleic acid refers to a nucleic acid that is separated from other nucleic acid molecules that are present in a mammalian genome, including nucleic acids that normally flank one or both sides of the nucleic acid in a mammalian genome (e.g., nucleic acids that flank an ARPKD gene).
  • isolated as used herein with respect to nucleic acids also includes any non-naturally-occurring nucleic acid sequence, since such non-naturally-occurring sequences are not found in nature and do not have immediately contiguous sequences in a naturally-occurring genome.
  • an isolated nucleic acid can be, for example, a DNA molecule, provided one of the nucleic acid sequences normally found immediately flanking that DNA molecule in a naturally-occurring genome is removed or absent.
  • an isolated nucleic acid includes, without limitation, a DNA molecule that exists as a separate molecule (e.g., a chemically synthesized nucleic acid, or a cDNA or genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, lentivirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote.
  • a virus e.g., a retrovirus, lentivirus, adenovirus, or herpes virus
  • an isolated nucleic acid can include an engineered nucleic acid such as a DNA molecule that is part of a hybrid or fusion nucleic acid.
  • RNA interference is a method of post-transcriptional gene regulation that is conserved throughout many eukaryotic organisms. RNAi is induced by short (i.e., ⁇ 30 nucleotide) double stranded RNA (“dsRNA”) molecules which are present in the cell (Fire A et al. (1998), Nature 391: 806-811). These short, dsRNA molecules, called “short interfering RNA” or “siRNA,” cause the destruction of messenger RNAs (“mRNAs”) which share sequence homology with the siRNA to within one nucleotide resolution (Elbashir S M et al. (2001), Genes Dev, 15: 188-200).
  • mRNAs messenger RNAs
  • siRNA-induced silencing complex or “RISC”, which cleaves the targeted mRNA.
  • RISC RNA-induced silencing complex
  • the siRNA is apparently recycled much like a multiple-turnover enzyme, with 1 siRNA molecule capable of inducing cleavage of approximately 1000 mRNA molecules. siRNA-mediated RNAi degradation of an mRNA is therefore more effective than currently available technologies for inhibiting expression of a target gene.
  • RNA interference double-stranded RNA
  • dsRNA double-stranded RNA
  • RNAi RNA interference
  • mammalian cells dsRNA that is 30 base pairs or longer can induce sequence-nonspecific responses that trigger a shut-down of protein synthesis and even cell death through apoptosis.
  • RNA fragments are the sequence-specific mediators of RNAi (Elbashir et al., 2001).
  • siRNA small interfering RNA
  • RNA nucleic acids In mammalian cell culture, a siRNA-mediated reduction in gene expression has been accomplished by transfecting cells with synthetic RNA nucleic acids (Caplan et al., 2001; Elbashir et al., 2001).
  • the 20040023390 application provides methods using a viral vector containing an expression cassette containing a pol II promoter operably-linked to a nucleic acid sequence encoding a small interfering RNA molecule (siRNA) targeted against a gene of interest.
  • RNAi is the process of RNA interference.
  • a typical mRNA produces approximately 5,000 copies of a protein.
  • RNAi is a process that interferes with or significantly reduces the number of protein copies made by an mRNA.
  • a double-stranded short interfering RNA (siRNA) molecule is engineered to complement and match the protein-encoding nucleotide sequence of the target mRNA to be interfered with.
  • the siRNA molecule associates with an RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • the siRNA-associated RISC binds the target mRNA (such as mRNA encoding a targeted FOXO protein) through a base-pairing interaction and degrades it.
  • RNA remains capable of degrading additional copies of the targeted mRNA.
  • Other forms of RNA can be used such as short hairpin RNA and longer RNA molecules. Longer molecules cause cell death, for example by instigating apoptosis and inducing an interferon response. Cell death was the major hurdle to achieving RNAi in mammals because dsRNAs longer than 30 nucleotides activated defense mechanisms that resulted in non-specific degradation of RNA transcripts and a general shutdown of the host cell. Using from about 20 to about 29 nucleotide siRNAs to mediate gene-specific suppression in mammalian cells has apparently overcome this obstacle. These siRNAs are long enough to cause gene suppression but not of a length that induces an interferon response.
  • a “therapeutically effective amount” of the siRNA is an amount sufficient to cause RNAi-mediated degradation of the target mRNA, or an amount sufficient to inhibit the progression of an enumerated disease in a subject or to change the phenotype of an Insulin ⁇ N3 Prog or Ins ⁇ enteroendocrine cell to an Ins + cell.
  • isolated means altered or removed from the natural state through human intervention.
  • an siRNA naturally present in a living animal is not “isolated,” but a synthetic siRNA, or an siRNA partially or completely separated from the coexisting materials of its natural state is “isolated.”
  • An isolated siRNA can exist in substantially purified form, or can exist in a non-native environment such as, for example, a cell into which the siRNA has been delivered. Unless otherwise indicated, all nucleic acid sequences herein are given in the 5′ to 3′ direction.
  • deoxyribonucleotides in a nucleic acid sequence are represented by capital letters (e.g., deoxythymidine is “T”), and ribonucleotides in a nucleic acid sequence are represented by lower case letters (e.g., uridine is “u”).
  • Agents that reduce the biological activity of a Foxo protein include antibodies (including portions or fragments or variants of antibody fragments or variants of antibodies) that have specific binding affinity for the intended Foxo protein, thereby interfering with its biological activity. These antibodies recognize an epitope in a target protein or biologically active fragment thereof, namely Foxo1, 2, 3 or 4. In certain embodiments the antibodies reduce the ability of Foxo to increase N3 synthesis.
  • an “antibody” refers to an intact immunoglobulin or to an antigen-binding portion (fragment) thereof that competes with the intact antibody for specific binding, and is meant to include bioactive antibody fragments.
  • Therapeutically useful antibodies in treating or preventing an enumerated disease or changing a phenotype as described include any antibody to any FOXO protein or analog, ortholog or variant thereof, preferably FOXO1, 2, 3 or 4 that reduces the biological activity of the respective Foxo protein in a Gut Ins ⁇ Prog cell, such as a Gut N3 Prog cell.
  • antibodies or fragments thereof can be tested for recognition of the target polypeptide by standard immunoassay methods including, for example, enzyme-linked immunosorbent assay (ELISA) or radioimmunoassay assay (RIA).
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay assay
  • epitope refers to an antigenic determinant on an antigen to which an antibody binds. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains, and typically have specific three-dimensional structural characteristics, as well as specific charge characteristics. Epitopes generally have at least five contiguous amino acids.
  • antibody and “antibodies” include polyclonal antibodies, monoclonal antibodies, humanized or chimeric antibodies, single chain Fv antibody fragments, Fab fragments, and F(ab′).sub.2 fragments.
  • Polyclonal antibodies are heterogeneous populations of antibody molecules that are specific for a particular antigen, while monoclonal antibodies are homogeneous populations of antibodies to a particular epitope contained within an antigen. Monoclonal antibodies are particularly useful in the present invention.
  • Antibody fragments that have specific binding affinity for the polypeptide of interest can be generated by known techniques. Such antibody fragments include, but are not limited to, F(ab′).sub.2 fragments that can be produced by pepsin digestion of an antibody molecule, and Fab fragments that can be generated by reducing the disulfide bridges of F(ab′).sub.2 fragments. Alternatively, Fab expression libraries can be constructed. See, for example, Huse et al. (1989) Science 246:1275-1281. Single chain Fv antibody fragments are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge (e.g., 15 to 18 amino acids), resulting in a single chain polypeptide. Single chain Fv antibody fragments can be produced through standard techniques, such as those disclosed in U.S. Pat. No. 4,946,778.
  • isolated antibody is an antibody that (1) is not associated with naturally-associated components, including other naturally-associated antibodies, that accompany it in its native state, (2) is free of other proteins from the same species, (3) is expressed by a cell from a different species, or (4) does not occur in nature.
  • human antibody includes all antibodies that have one or more variable and constant regions derived from human immunoglobulin sequences. In a preferred embodiment, all of the variable and constant domains are derived from human immunoglobulin sequences (a fully human antibody). These antibodies may be prepared in a variety of ways, as described below.
  • a humanized antibody is an antibody that is derived from a non-human species, in which certain amino acids in the framework and constant domains of the heavy and light chains have been mutated so as to avoid or abrogate an immune response in humans.
  • a humanized antibody may be produced by fusing the constant domains from a human antibody to the variable domains of a non-human species. Examples of how to make humanized antibodies may be found in U.S. Pat. Nos. 6,054,297, 5,886,152 and 5,877,293, incorporated herein by reference.
  • chimeric antibody refers to an antibody that contains one or more regions from one antibody and one or more regions from one or more other antibodies.
  • fragments, portions or analogs of antibodies can be readily prepared by those of ordinary skill in the art following the teachings of this specification.
  • Preferred amino- and carboxy-termini of fragments or analogs occur near boundaries of functional domains.
  • Structural and functional domains can be identified by comparison of the nucleotide and/or amino acid sequence data to public or proprietary sequence databases.
  • computerized comparison methods are used to identify sequence motifs or predicted protein conformation domains that occur in other proteins of known structure and/or function. Methods to identify protein sequences that fold into a known three-dimensional structure are known. Bowie et al. Science 253:164 (1991).
  • Certain embodiments comprise the use of ex vivo cultures of intestinal epithelial cells for high-throughput screening assays to identify chemical mimetics of the Foxo1 ablation.
  • a method is provided for a high throughput screening assay that tests an agent's effectiveness in inducing mammalian gut enteroendocrine cells (Gut Ins ⁇ Prog) to express insulin, comprising isolating Gut Ins ⁇ Cells as described and incubating them under conditions that are suitable for the production and secretion of insulin, providing a control and a test population of isolated Gut Ins-Cells contacting the test population of Gut Ins ⁇ Cells with a test agent; determining the level of insulin expression in the control and the test population (or optionally the presence of secreted insulin in the medium) either directly or by way of a reporter marker; and selecting the test agent if the level of insulin in the test population is higher than the level in the control.
  • Active agents so identified can be used in the embodiments of the invention as described.
  • This assay can be done other ways by studying Gut Ins ⁇ Cells alone, for example, to determine the agent's effect on the level of insulin expression.
  • a cell-based method is provided for screening, or assaying, for an active agent that increases the level of insulin expression.
  • the level of insulin expression is measured in a population of cells (e.g.
  • Gut Ins ⁇ Cells comprising (a) removing a population of non-insulin producing Gut Ins ⁇ Prog cells, including Neurogenin 3-positive progenitor cells and/or stem cells from the gastrointestinal tract of a mammal, (b) contacting the population of cells with an agent that reduces FOXO protein (FOXO1, FOXO4 and/or FOXO3) expression or biological activity, or that of a biologically active fragment, ortholog, or variant thereof in the cells (c) determining the level of insulin expression and (d) identifying an agent if the level of insulin expression is higher in the test population than in the control.
  • FOXO protein FOXO1, FOXO4 and/or FOXO3
  • the population of test cells comprises intestinal crypts that are enriched in the Gut Ins ⁇ N3 Prog, and transit amplifying Prog and Gut Stem cells, but that also contain other cell types including other secretory (e.g., Paneth cells), enteroendocrine, stem cells and transit amplifying progenitors.
  • intestinal crypts that are enriched in the Gut Ins ⁇ N3 Prog, and transit amplifying Prog and Gut Stem cells, but that also contain other cell types including other secretory (e.g., Paneth cells), enteroendocrine, stem cells and transit amplifying progenitors.
  • the Insulin-GFP knock-in allele is a sensitive and specific readout for the generation of insulin-positive cells.
  • Various embodiments of the screening assay involve isolating gut epithelial cells from mice bearing the Insulin-GFP knock-in allele, establishing primary cultures that will be subjected to high throughput screens using, for example, a small molecule library.
  • the readout will be represented by the appearance of green cells, and the detection system will be chosen accordingly.
  • An embodiment uses two positive readouts. The first readout will use cells cultured from Foxo1 knockout NKO mice that are spontaneously fluorescent. This will serve the double purpose of providing a positive control and to calibrate the sensitivity of the assay, because the fluorescent cells can be detected amidst the background of negative cells. As a second positive control, cells will be used that have been transduced with Foxo1 siRNA to optimize conditions that recapitulate generation of gut insulin-producing cells in vitro. The cells will turn green when Foxo1 is inhibited. Another embodiment uses cells isolated from late embryonic gut, or cells transduced with a mixture of siRNAs to the three Foxo isoforms (1, 3, and 4).
  • Neurog3-Gfp knock-in mice are used to screen chemical libraries for the ability to increase the number of enteroendocrine progenitor cells.
  • the assays will be patterned according to the methods described above.
  • Other embodiments are directed to methods for determining the ability of a candidate agent to treat or prevent in an animal any of the enumerated diseases or disorders associated with impaired pancreatic function, comprising: (a) providing a test animal that is diabetic due to pancreatic dysfunction, for example KO mice or streptozotocin-treated mice or db/db or ob/ob mice (two animal models of type 2 diabetes and obesity) or a ZDF rat (a rat with a similar mutation to the db/db mouse) or NZO mice (a model of lean type 2 diabetes) or fa/fa rats (a model of obesity and diabetes) or GK rats (a model of rat diabetes) and a control animal, (b) administering the candidate agent to the test animal, (c) comparing the level of insulin expression in the test animal to the level of insulin expression in the control animal, and (d) selecting the candidate agent if the level of insulin expression is higher in the test animal than in the control animal.
  • the level of insulin expression can
  • agent or “exogenous compound” as used herein includes any molecule, e.g., protein, oligopeptide, small organic molecule, polysaccharide, polynucleotide, lipid, etc., or mixtures thereof, with the capability of directly or indirectly inducing Gut Ins ⁇ Prog to differentiate into Gut Ins + cells.
  • a plurality of assay mixtures is run in parallel with different agent concentrations to obtain a differential response to the various concentrations.
  • one of these concentrations serves as a negative control, i.e., at zero concentration or below the level of detection.
  • Test agents for use in screening encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 100 and less than about 2,500 daltons, preferably less than about 500 daltons.
  • Some test agents comprise functional groups that permit them to structurally interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
  • Such agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Test agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
  • ICCB libraries Some other examples of the ICCB libraries are: Chem Bridge DiverSet E (16,320 compounds); Bionet 1 (4,800 compounds); CEREP (4,800 compounds); Maybridge 1 (8,800 compounds); Maybridge 2 (704 compounds); Maybridge HitFinder (14,379 compounds); Peakdale 1 (2,816 compounds); Peakdale 2 (352 compounds); ChemDiv Combilab and International (28,864 compounds); Mixed Commercial Plate 1 (352 compounds); Mixed Commercial Plate 2 (320 compounds); Mixed Commercial Plate 3 (251 compounds); Mixed Commercial Plate 4 (331 compounds); ChemBridge Microformat (50,000 compounds); Commercial Diversity Set1 (5,056 compounds).
  • NCI Collections are: Structural Diversity Set, version 2 (1,900 compounds); Mechanistic Diversity Set (879 compounds); Open Collection 1 (90,000 compounds); Open Collection 2 (10,240 compounds); Known Bioactives Collections: NINDS Custom Collection (1,040 compounds); ICCB Bioactives 1 (489 compounds); SpecPlus Collection (960 compounds); ICCB Discretes Collections.
  • the following ICCB compounds were collected individually from chemists at the ICCB, Harvard, and other collaborating institutions: ICCB1 (190 compounds); ICCB2 (352 compounds); ICCB3 (352 compounds); ICCB4 (352 compounds).
  • Natural Product Extracts NCI Marine Extracts (352 wells); Organic fractions—NCI Plant and Fungal Extracts (1,408 wells); Philippines Plant Extracts 1 (200 wells); ICCB-ICG Diversity Oriented Synthesis (DOS) Collections; DDS1 (DOS Diversity Set) (9600 wells).
  • DOS Diversity Oriented Synthesis
  • Compound libraries are also available from commercial suppliers, such as ActiMol, Albany Molecular, Bachem, Sigma-Aldrich, TimTec, and others.
  • Lipinski rule-of-five not more than 5 hydrogen bond donors (OH and NH groups); not more than 10 hydrogen bond acceptors (notably N and O); molecular weight under 500 g/mol; partition coefficient log P less than 5
  • Veber criteria which are recognized in the pharmaceutical art and relate to properties and structural features that make molecules more or less drug-like.
  • the library may be fully randomized, with no sequence preferences or constants at any position.
  • the library may be biased. That is, some positions within the sequence are either held constant, or are selected from a limited number of possibilities.
  • the nucleotides or amino acid residues are randomized within a defined class, for example, of hydrophobic amino acids, hydrophilic residues, sterically biased (either small or large) residues, towards the creation of cysteines, for cross-linking, prolines for SH-3 domains, serines, threonines, tyrosines or histidines for phosphorylation sites, etc., or to purines, etc.
  • the active is isolated nucleic acid, preferably antisense, siRNA, or cDNA that binds to either the gene encoding the protein of interest, or its mRNA with sufficient complementarity (as described herein) to block gene expression or mRNA translation, respectively.
  • nucleic acid or “oligonucleotide” or grammatical equivalents herein is meant at least two nucleotides covalently linked together.
  • nucleic acids will generally contain phosphodiester bonds, although in some cases, as outlined below, nucleic acid analogs are included that may have alternate backbones, comprising, for example, phosphoramide (Beaucage et al., Tetrahedron 49(10):1925 [1993] and references therein; Letsinger, J. Org. Chem. 35:3800 [1970]; Sblul et al., Eur. J. Biochem. 81:579 [1977]; Letsinger et al., Nucl. Acids Res. 14:3487 [1986]; Sawai et al, Chem. Lett. 805 [1984]; Letsinger et al., J. Am. Chem.
  • nucleic acids include those with positive backbones (Denpcy et al., Proc. Natl. Acad. Sci. USA 92:6097 [1995]); non-ionic backbones (U.S. Pat. Nos. 5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863; Kiedrowshi et al., Angew. Chem. Intl. Ed. English 30:423 [1991]; Letsinger et al., J. Am. Chem. Soc.
  • ribose-phosphate backbone may be done to facilitate the addition of additional moieties such as labels, or to increase the stability and half-life of such molecules in physiological environments.
  • mixtures of naturally occurring acids and analogs can be made.
  • mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.
  • the nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence.
  • the nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxyribo- and ribo-nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxathine, isocytosine, isoguanine, etc.
  • the agents may be obtained from combinatorial chemical libraries, a wide variety of which are available in the literature.
  • combinatorial chemical library herein is meant a collection of diverse chemical compounds generated in a defined or random manner, generally by chemical synthesis. Millions of chemical compounds can be synthesized through combinatorial mixing.
  • the agent may be a protein.
  • protein in this context is meant at least two covalently attached amino acids, which includes proteins, peptides, oligopeptides and peptides.
  • the protein may be made up of naturally occurring amino acids and peptides, or synthetic peptidomimetic structures.
  • amino acid or “peptide residue,” as used herein, means both naturally occurring and synthetic amino acids. For example, homo-phenylalanine, citrulline and noreleucine are considered amino acids for the purposes of the invention.
  • amino acids also includes amino acid residues such as proline and hydroxyproline.
  • the side chains may be in either the (R) or the (S) configuration.
  • the amino acids are in the (S) or L-configuration. If non-naturally occurring side chains are used, non-amino acid substituents may be used, for example to prevent or retard in vivo degradations.
  • the agent may be a naturally occurring protein or fragment or variant of a naturally occurring protein.
  • cellular extracts containing proteins, or random or directed digests of proteinaceous cellular extracts may be used.
  • libraries of prokaryotic and eukaryotic proteins may be made for screening for their ability to induce Gut Ins ⁇ Prog cells to differentiate into Ins + cells.
  • Libraries of bacterial, fungal, viral, and mammalian proteins, with the latter being preferred, and human proteins being especially preferred may be used.
  • Agents may be peptides of from about 5 to about 30 amino acids, with from about 5 to about 20 amino acids being preferred, and from about 7 to about 15 being particularly preferred.
  • the peptides may be digests of naturally occurring proteins as is outlined above, random peptides, or “biased” random peptides.
  • randomized or grammatical equivalents herein is meant that each nucleic acid and peptide consists of essentially random nucleotides and amino acids, respectively. Since generally these random peptides (or nucleic acids, discussed below) are chemically synthesized, they may incorporate any nucleotide or amino acid at any position.
  • the synthetic process can be designed to generate randomized proteins or nucleic acids, to allow the formation of all or most of the possible combinations over the length of the sequence, thus forming a library of randomized agent bioactive proteinaceous agents. Further variations and details are set forth in Karsenty US application 20100190697.
  • biologically active fragments or variants of the therapeutic agents are also within the scope of the present invention.
  • biologically active means increasing at least one effect selected from the group comprising inducing mammalian gut enteroendocrine cells (Gut Ins ⁇ Cells) to express insulin, increasing insulin sensitivity, increasing glucose tolerance, decreasing weight gain, decreasing fat mass, increasing weight loss in animals with impaired pancreatic function i.e. that do not make or secrete normal levels of insulin. Fragments and variants are described below. Fragments can be discrete (not fused to other amino acids or peptides) or can be within a larger peptide. Further, several fragments can be comprised within a single larger peptide.
  • variants of peptides include those that provide useful and novel characteristics for the agent.
  • the variant of a peptide agent may have reduced immunogenicity, increased serum half-life, increased bioavailability and/or increased potency.
  • “Variants of peptide agents” refers to peptides that contain modifications in their amino acid sequences such as one or more amino acid substitutions, additions, deletions and/or insertions but that are still biologically active. In some instances, the antigenic and/or immunogenic properties of the variants are not substantially altered, relative to the corresponding peptide from which the variant was derived.
  • Such modifications may be readily introduced using standard mutagenesis techniques, such as oligonucleotide directed site-specific mutagenesis as taught, for example, by Adelman et al. (DNA, 2:183, 1983) or by chemical synthesis.
  • Variants and fragments are not mutually exclusive terms. Fragments also include peptides that may contain one or more amino acid substitutions, additions, deletions and/or insertions such that the fragments are still biologically active.
  • Fully functional variants typically contain only conservative variation or variation in non-critical residues or in non-critical regions. Functional variants can also contain substitutions of similar amino acids, which results in no change, or an insignificant change, in function. Alternatively, such substitutions may positively or negatively affect function to some degree.
  • the activity of such functional agent variants can be determined using assays such as those described herein.
  • Derivatization is a technique used in chemistry which transforms a chemical compound into a product of similar chemical structure, called derivative.
  • a specific functional group of the compound participates in the derivatization reaction and transforms the educt to a derivate of deviating reactivity, solubility, boiling point, melting point, aggregate state, functional activity, or chemical composition.
  • Resulting new chemical properties can be used for quantification or separation of the educt or can be used to optimize the compound as a therapeutic agent.
  • the well-known techniques for derivatization can be applied to the agents.
  • derivatives of peptide agents described above will contain amino acids that have been chemically modified in some way so that they differ from the natural amino acids.
  • agent mimetics refers to a synthetic chemical compound that has substantially the same structural and functional characteristics of a naturally or non-naturally occurring peptide, and includes, for instance, peptide- and polynucleotide-like polymers having modified backbones, side chains, and/or bases. Peptide mimetics are commonly used in the pharmaceutical industry as non-peptide drugs with properties analogous to those of the template peptide. Generally, mimetics are structurally similar (i.e., have the same shape) to a paradigm peptide that has a biological or pharmacological activity, but one or more peptide linkages are replaced.
  • the mimetic can be either entirely composed of synthetic, non-natural analogues of amino acids, or, is a chimeric molecule of partly natural peptide amino acids and partly non-natural analogs of amino acids.
  • the mimetic can also incorporate any amount of natural amino acid conservative substitutions as long as such substitutions also do not substantially alter the mimetic's structure and/or activity.
  • Certain embodiments of the present invention are directed to pharmaceutical compositions and formulations that include one or more active agents as defined herein, including but not limited to small molecules, polypeptides, antibodies, nucleic acids (including antisense RNA, siRNA, microRNAs, Cop 1 (Caspase recruitment domain-containing protein 16) and ribozymes that reduce the expression and/or biological activity of one or more FOXO proteins in Gut Ins ⁇ Prog cells, especially N3 Prog, thereby causing them to differentiate into Gut Ins + Cells that make and secrete insulin.
  • the pharmaceutical compositions will have one or more of the following effects of increasing insulin secretion and serum insulin, increasing insulin sensitivity, increasing glucose tolerance, decreasing weight gain, decreasing fat mass, and causing weight loss.
  • the therapeutic agents are generally administered in an amount sufficient to treat or prevent diabetes type 1 and 2, metabolic syndrome, and obesity in a subject; or to reduce fat mass.
  • the pharmaceutical compositions of the invention provide an amount of the active agent effective to treat or prevent an enumerated disease or disorder.
  • Biologically active fragments or variants of the therapeutic agents are also within the scope of the present invention.
  • biologically active is meant capable of reducing Foxo protein expression or biological activity.
  • the candidate agent may be chemically modified to facilitate its uptake by Gut Ins ⁇ Cells. For example, it could be fused to a bile acid or fatty acid to facilitate uptake by gut cells; or it may be packaged in liposomes or another lipid-based emulsion system to facilitate its uptake; it may be encoded by bacteria expressing a modified cell surface antigen that promotes its binding to gut epithelial cells, including N3 Prog.cell-permeable peptides was used to improve cellular uptake. (Gratton et al., Nature Medicine 9, 357-362 (2003)).
  • administer is used in its broadest sense and includes any method of introducing the compositions of the present invention into a subject.
  • the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
  • the gut regions that have the highest density of Gut Ins+ cells in NKO mice are located in the distal ileum and colon and duodenum in STZ treated NKO mice. Therefore in some embodiments the pharmaceutical compositions are administered orally or locally to the colon or in formulations that target them for absorption in the duodenum or it can be administered by implanting an osmotic pump, preferably at a site or subcutaneous that is proximal to the duodenum, distal ileum or colon.
  • Administration can also be intravenous, parenteral/intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
  • Suppositories can also be used.
  • a slow release preparation comprising the active agents is formulated.
  • the term “slow release” refers to the release of a drug from a polymeric drug delivery system over a period of time that is more than one day wherein the active agent is formulated in a polymeric drug delivery system that releases effective concentrations of the drug.
  • Certain medications for example resins that prevent bile acid absorption, or inhibitors of sugar breakdown, are used in the treatment of type 2 diabetes and are not absorbed at all in the plasma. Such formulations are useful for the pharmaceutical formulations of the present invention.
  • the pharmaceutical compositions of the present invention comprise about 0.1 mg to 5 g, about 0.5 mg to about 1 g, about 1 mg to about 750 mg, about 5 mg to about 500 mg, or about 10 mg to about 100 mg of therapeutic agent.
  • active agents can be administered as a single treatment or, preferably, can include a series of treatments, that continue at a frequency and for a duration of time that causes one or more symptoms of the enumerated disease to be reduced or ameliorated, or that achieves the desired effect including effects of increasing insulin secretion and serum insulin, increasing insulin sensitivity, increasing glucose tolerance, decreasing weight gain, decreasing fat mass, and causing weight loss.
  • an active agent depends upon a number of factors within the ken of the ordinarily skilled physician, veterinarian, or researcher.
  • the dose(s) vary, for example, depending upon the identity, size, and condition of the subject or sample being treated, further depending upon the route by which the composition is to be administered, and the effect which the practitioner desires the an active agent to have.
  • appropriate doses of an active agent depend upon the potency with respect to the expression or activity to be modulated. Such appropriate doses may be determined using the assays described herein.
  • a relatively low dose may be prescribed at first, with the dose subsequently increased until an appropriate response is obtained.
  • the specific dose level for any particular subject will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated.
  • Type 1 diabetes is usually diagnosed in children and young adults, but can occur at any age, and was previously known as juvenile diabetes. In type 1 diabetes, the body does not produce insulin. Insulin is a hormone that is needed to convert sugar (glucose), starches and other food into energy needed for daily life. Conditions associated with type 1 diabetes include hyperglycemia, hypoglycemia, ketoacidosis and celiac disease.
  • Type 2 diabetes is the most common form of diabetes. In type 2 diabetes, either the body does not produce enough insulin or the cells ignore the insulin. Conditions associated with type 2 diabetes include hyperglycemia and hypoglycemia.
  • Disorders associated with energy metabolism include diabetes, glucose intolerance, decreased insulin sensitivity, decreased pancreatic beta-cell proliferation, decreased insulin secretion, weight gain, increased fat mass and decreased serum adiponectin.
  • the therapeutic agent can be formulated with an acceptable carrier using methods well known in the art.
  • the actual amount of therapeutic agent will necessarily vary according to the particular formulation, route of administration, and dosage of the pharmaceutical composition, the specific nature of the condition to be treated, and possibly the individual subject.
  • the dosage for the pharmaceutical compositions of the present invention can range broadly depending upon the desired effects, the therapeutic indication, and the route of administration, regime, and purity and activity of the composition.
  • a suitable subject can be an individual or animal that is suspected of having, has been diagnosed as having, or is at risk of developing an enumerated disease, and like conditions as can be determined by one knowledgeable in the art.
  • compositions of the present invention can be administered to the subject by a medical device, such as, but not limited to, catheters, balloons, implantable devices, biodegradable implants, prostheses, grafts, sutures, patches, shunts, or stents.
  • a medical device such as, but not limited to, catheters, balloons, implantable devices, biodegradable implants, prostheses, grafts, sutures, patches, shunts, or stents.
  • compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful for oral administration.
  • Active agents may be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
  • Representative United States patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations include, but are not limited to, U.S. Pat. Nos.
  • compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
  • the pharmaceutical formulations of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylene diamine tetra acetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampules, disposable syringes or multiple dose vials made of glass or plastic.
  • compositions suitable for injectable use include sterile aqueous solutions (where the therapeutic agents are water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor EL® (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active agent in the required amount in an appropriate solvent with one or a combination of the ingredients enumerated above, as required, followed by filter sterilization.
  • dispersions are prepared by incorporating the active agent into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. Depending on the specific conditions being treated, pharmaceutical compositions of the present invention for treatment of atherosclerosis or the other elements of metabolic syndrome can be formulated and administered systemically or locally. Techniques for formulation and administration can be found in “Remington: The Science and Practice of Pharmacy” (20th ed., ed. A. Gennaro, Lippincott, Williams & Wilkins, 2000). For oral administration, the agent can be contained in enteric forms to survive the stomach or further coated or mixed to be released in a particular region of the GI tract by known methods.
  • the active agent can be incorporated with excipients and used in the form of tablets, troches, or capsules.
  • Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed.
  • Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, PRIMOGEL®, or corn starch; a lubricant such as magnesium stearate or STEROTES®; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose, a disintegrating agent such as alginic acid, PRIMOGEL®, or corn starch
  • a lubricant such as magnesium stearate or STEROTES®
  • a glidant such as colloidal silicon
  • the compounds are delivered in the form of an aerosol spray from pressured container or dispenser, which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the active agents are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • suppositories e.g., with conventional suppository bases such as cocoa butter and other glycerides
  • retention enemas for rectal delivery.
  • the active agents are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to particular cells with, e.g., monoclonal antibodies) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811
  • Unit dosage form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active agent calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the unit dosage forms of the invention are dictated by and directly dependent on the unique characteristics of the active agent and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active agent for the treatment of individuals.
  • the agent may be administered continuously by pump or frequently during the day for extended periods of time.
  • the agent may be administered at a rate of from about 0.3-100 ng/hour, preferably about 1-75 ng/hour, more preferably about 5-50 ng/hour, and even more preferably about 10-30 ng/hour.
  • the agent may be administered at a rate of from about 0.1-100 pg/hr, preferably about 1-75 micrograms/hr, more preferably about 5-50 micrograms/hr, and even more preferably about 10-30 micrograms/hr
  • the effective dosage of antibody, protein, or polypeptide used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from monitoring the level of insulin and/or monitoring glycemia control in a biological sample, preferably blood or serum.
  • the agent can be delivered by subcutaneous, long-term, automated drug delivery using an osmotic pump to infuse a desired dose of the agent for a desired time.
  • Insulin pumps are widely available and are used by diabetics to automatically deliver insulin over extended periods of time. Such insulin pumps can be adapted to deliver the agent.
  • the delivery rate of the agent to control glucose intolerance, diabetes types 1 or 2 can be readily adjusted through a large range to accommodate changing insulin requirements of an individual (e.g., basal rates and bolus doses).
  • New pumps permit a periodic dosing manner, i.e., liquid is delivered in periodic discrete doses of a small fixed volume rather than in a continuous flow manner.
  • the overall liquid delivery rate for the device is controlled and adjusted by controlling and adjusting the dosing period.
  • the pump can be coupled with a continuous blood glucose monitoring device and remote unit, such as a system described in U.S. Pat. No. 6,560,471, entitled “Analyte Monitoring Device and Methods of Use.”
  • the hand-held remote unit that controls the continuous blood glucose monitoring device could wirelessly communicate with and control both the blood glucose monitoring unit and the fluid delivery device delivering therapeutic agents of the present invention.
  • compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas.
  • the compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media.
  • Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
  • the suspension may also contain stabilizers.
  • Tissue fixation and processing for immunohistochemistry was performed as described (26).
  • Rabbit primary antibodies to Foxo1 and Glucokinase (Santa Cruz), Pdx1 (gift from C. Wright), glucagon (Sigma, Phoenix Peptide), GFP (Invitrogen), ChromograninA, Glut2 (all from Chemicon), PC2 (US Biologicals); guinea pig primary antibodies to insulin (Dako), Pancreatic-peptide (Linco), GFP (Rockland), mouse primary antibody to Synaptophysin (Millipore) and goat primary antibodies to TLE5/Aes, Neurog3 (Santa Cruz), and Pdx1 (from C. Wright).
  • Pdx1-Cre (9), Neurog3-Cre (3), Rosa26-eGfp, and Neurog3-Gfp (7) have been described. These animals were intercrossed them with Foxo1 flox/+ male mice (33) to generate Neurog3-cre:Foxo1 lox/lox (NKO) and Pdx1-cre:Foxo1 lox/lox (PKO).
  • To generate Ins2-Gfp knock-in mice we modified BAC clone RP22-342 (CHORI, Oakland, Calif.) by recombining to replace the Ins2 coding sequence with Gfp.
  • Insulin bioassay Acid-ethanol extracts were prepared from neonatal (P3) gut, liver, and Pancreas (35). Tissue extract or recombinant human Insulin (Humulin R, Eli Lilly)(10U/ml in acid-ethanol) were mixed with either insulin neutralizing antibody (Thermo Scientific) or isotype-matched mouse IgG1 (Ebiosciences) for subcutaneous injections in 50 microliters volume. Glucose was measured immediately prior to and 5 minutes after injections.
  • Insulin secretion Adult intestine was stained in medium containing 0.12 mM Dithizone (DTZ) (10) and selected 5-inches-long DTZ+ fragments from NKO mice or anatomically matched control mice. The intestines were cut open and incubated in glucose-free DMEM supplemented with 10% FBS and 20 mM glucose for 30 min. At the end of the incubation, insulin and C peptide 2 content was measured in the medium by ELISA (Millipore). Collagenase-purified pancreatic islets from 14-week-old WT mice served as controls (5).
  • DTZ Dithizone
  • Intestines were dissected en face, washed with ice-cold PBS (Mg2 + /Ca2 + ) and chopped into 5- to 10 mm-long pieces. Intestinal fragments were incubated in 20 mM EDTA at 37 degrees followed by vigorous resuspension in cold PBS using a 10-ml pipette. We then collected the released epithelial cells for secretion and RNA assays.
  • FCM OPTI-MEM (reduced serum media)
  • GLUTAMAX media
  • hydrocortisone 21 hemisuccinate sodium salt 150 nM (Sigma)
  • RNA procedures Standard techniques for mRNA isolation and quantitative PCR were used. RT-PCR was carried out for 35 cycles. Primer sequences for Pc2, Gck, Kir6.1, Sur1 Neurogenin 3, Pdx1, MafA, Nkx6.1, NeuroD1, Nkx2.2, Arx, Pax4, Tubulin2 (37), Insulin1, Insulin2 (38), Glp132, Math1 and Hes138Hes1 (38) have been described.
  • Foxo1 regulates multiple aspects of pancreatic beta-cell function (4t) and is widely expressed in Neurog3 + pancreatic endocrine progenitors (5).
  • FOXO1 knock-down increases the number of NEUROG3 + cells (6t).
  • Foxo1 is also expressed in most Neurog3 + enteroendocrine progenitors (EEP), as identified by double immunohistochemistry (7t) ( FIGS. 1A and 5 ).
  • Foxo1 expression (a structural and functional ortholog of human FOXO1, 3 and/or 4) in the adult mouse is localized to a subset of cells that, based on morphology and localization, include secretory cells, endocrine and stem cells throughout the gut. Enteroendocrine cells are sub-set of secretory cells. There are 3 secretory cell types: goblet, Paneth, and enteroendocrine cells. Goblet and Paneth cells do not normally produce hormones.
  • mice were generated with a somatic deletion of Foxo1 in Neurog3 + enteroendocrine progenitors (21) (NKO, or Neurog3-driven Foxo1 knockouts).
  • NKO enteroendocrine progenitors
  • Cre-mediated recombination in Neurog3 + cells NKO and Neurog3-Gfp transgenic mice, were intercrossed. Immunohistochemistry showed that Foxo1 was no longer detectable in Gfp-labeled cells, indicating that the deletion occurred efficiently ( FIG. 1B ).
  • Neurog3 + cells The increase of Neurog3 + cells was associated with a similar increase of cells expressing Chromagranin A, a marker of enteroendocrine cell differentiation that is expressed after Neurog3 activation, indicating that Foxo1 ablation expands gut Neurog3 + progenitors and their daughter cells (8) ( FIG. 6 ).
  • FIG. 7 Cells immunoreactive with pancreas-specific hormones glucagon (Gcg + ) or pancreatic polypeptide (Pp + ) ( FIG. 7 ) were also seen, albeit at lower frequencies in both newborn and adult mice.
  • the Ins + cells were present throughout the gut, including in the colon ( FIG. 8 ).
  • RT-PCR analysis confirmed the presence of Ins1 and Ins2 transcripts in RNA extracted from cells in the gut of NKO mice, but not control intestines ( FIG. 9 ).
  • Foxo1 ablation in NKO animals activated a broad pancreatic endocrine expression program in some intestinal enteroendocrine cells that changed their phenotype from non-insulin-producing (Gut Ins ⁇ ) to insulin producing (Gut Ins + cells).
  • mice To investigate the origin of these Ins+ cells and provide independent evidence for their identity, three additional genetic models were generated in mice.
  • the data in NKO mice indicate that Foxo1 ablation in Neurogenin 3 gut endocrine progenitors is sufficient to activate pancreas-like endocrine differentiation, but do not demonstrate that this is a specific property of Neurogenin 3+ cells, as opposed to a general characteristic of uncommitted intestinal progenitor cells, such as stem cells, transit amplifying progenitors, or secretory progenitors 21.
  • Gut Ins+ cells were not affected by Foxo1 function in intestinal stem cells or transient amplifying progenitors.
  • the generalized Foxo1 knockout in intestinal precursors (the cell from which all intestinal epithelial cells will arise, including secretory cells) phenocopied the Foxo1 knockout in enteroendocrine progenitors (the cell form which enteroendocrine cells will arise).
  • Intestinal precursors give rise to all intestinal cell types, including stem cells and transit amplifying progenitors which in turn give rise to N3 progenitors cells.
  • This experiment highlights that knocking out Foxo1 in gut stem cells and Gut N3 Prog and their descendents also results in the formation of enteroendocrine Ins+ cell phenotypes. It is also possible that some existing gut enteroendocrine Ins ⁇ cells can acquire an Ins+ phenotype by reducing FOXO proteins.
  • a mouse with an Insulin2-Gfp knock-in allele was generated by gene targeting to provide a sensitive and specific readout of endogenous Ins2 transcription.
  • Ins2-Gfp allele was introduced into NKO mice (NKO-Insulin2-Gfp)
  • Ins2-Gfp+ cells in the gut of mutant mice were readily detected, while there were no such cells in WT littermates.
  • Ins2-Gfp expression was detected in pancreatic islets of both genotypes ( FIG. 1D ).
  • Double immunohistochemistry with insulin and Gfp antibodies confirmed the identity of Gfp+ cells as Ins+ cells ( FIG. 1E ).
  • Gut Ins + Cells are Terminally Differentiated and have Shared Lineage with Pancreatic Beta Cells
  • Regulated insulin secretion is a critical feature of pancreatic beta-cells that has proved difficult to replicate in ES cell-derived insulin-producing cells (14).
  • Ggut Ins + cells are functionally competent to secrete insulin.
  • NKO intestines released insulin and C-peptide in a glucose dose-dependent manner; thus, incubation in 11 mM glucose resulted in a two-and-one-half-fold increase in insulin secretion, whereas incubation in 22 mM glucose resulted in >7-fold increase in insulin secretion.
  • the sulfonylurea glibenclamide (a K ATP channel blocker) augmented glucose-induced insulin release, while the K ATP channel activator diazoxide blunted it ( FIG. 3A-B ).
  • gut enteroendocrine cells arise from Neurog3+ progenitors throughout life (21). Thus it is possible that Gut Ins+ cells might have greater regenerative capabilities than islet beta-cells in a toxin-induced diabetes model.
  • streptozotocin STZ was administered to NKO and control mice, which resulted in hyperglycemia ( FIG. 4A ).
  • Glucose levels in control mice were kept at about 500 mg/dl by daily insulin administration for 28 days.
  • NKO mice received no insulin, but their glucose levels began to spontaneously decrease nine days post-STZ, and stabilized at about 250 mg/dl in the fed state ( FIG. 4A ).
  • pancreatic insulin content at the end of experiment was nearly undetectable compared to vehicle-treated controls (0.1 ⁇ 0.08 ⁇ g/pancreas post-STZ vs. 26 ⁇ 2.25 ⁇ g/pancreas pre-STZ), thus ruling out a contribution of pancreatic beta-cell regeneration to the observed phenotype (16).
  • Gut Ins+ cells in PKO mice were found at greater frequency compared to pre-STZ treatment.
  • siRNA inhibition of Foxo1 expression resulted in the appearance of Insulin+ cells. This shows that contacting normal WT Gut Ins ⁇ Prog cells with siRNA against Foxo1 causes the cells to convert to the insulin+ enteroendocrine phenotype.
  • siRNA were diluted for final concentration of 50 nM, and transfected in 4b media (briefly Media 2+0% FCS, 100 ng/ml mWnt3a, 50 ng/ml FGF4) using protocol according to manufacture (Trans-It, Mirus ) for 72 hrs.
  • siRNA were assayed for phenotypic changes (# of live green cells) per well in 96 well-plate, and Foxo1 knock-down was confirmed by qPCR. Foxo1 siRNA treated cells gave rise to 2% of green cells per well.
  • Target Sequence GCAAACGGCUUCGGUCAAC ON-TARGETplus SMARTPOOL siRNA J-041127-08, FOXO1 Mol. Wt. 13,384.9 (g/mol) Ext. Coeff. 384,302 (L/mol ⁇ cm) SEQ ID NO. 14 Target Sequence: GGACAACAACAGUAAAUUU
  • Gut Ins + cells with lineage and functional features of insulin-producing, glucose-responsive cells ( FIG. 15 ) comparable to pancreatic beta cells.
  • GIP intestinal gastric inhibitory polypeptide
  • Gut Ins + cells appear to follow the same developmental pathway as endogenous beta-cells, as indicated by the activation of the Ins2-Gfp knock-in allele. This feature might explain the more rapid reversal of STZ diabetes in NKO mice than in mice transplanted with insulin-producing cells derived from embryonic stem cells (14).
  • Gut Ins + cells to secrete insulin in a glucose-dependent and diazoxide-inhibitable fashion allays fears of unregulated insulin secretion that have plagued cellular replacement approaches to type 1 diabetes.
  • plasticity of gut enteroendocrine progenitor cells could play an important role in the protean metabolic functions of the gut (18), including the startling reversal of diabetes following bariatric surgery (19).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Diabetes (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Endocrinology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Epidemiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Toxicology (AREA)
  • Obesity (AREA)
US13/697,792 2010-05-12 2011-05-12 Methods for producing enteroendocrine cells that make and secrete insulin Active US9457079B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/697,792 US9457079B2 (en) 2010-05-12 2011-05-12 Methods for producing enteroendocrine cells that make and secrete insulin

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US33417110P 2010-05-12 2010-05-12
PCT/US2011/036360 WO2011143511A2 (en) 2010-05-12 2011-05-12 Methods for producing enteroendocrine cells that make and secrete insulin
US13/697,792 US9457079B2 (en) 2010-05-12 2011-05-12 Methods for producing enteroendocrine cells that make and secrete insulin

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/036360 A-371-Of-International WO2011143511A2 (en) 2010-05-12 2011-05-12 Methods for producing enteroendocrine cells that make and secrete insulin

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/241,674 Division US10544415B2 (en) 2010-05-12 2016-08-19 Methods for producing enteroendocrine cells that make and secrete insulin

Publications (2)

Publication Number Publication Date
US20130216554A1 US20130216554A1 (en) 2013-08-22
US9457079B2 true US9457079B2 (en) 2016-10-04

Family

ID=44914988

Family Applications (3)

Application Number Title Priority Date Filing Date
US13/697,792 Active US9457079B2 (en) 2010-05-12 2011-05-12 Methods for producing enteroendocrine cells that make and secrete insulin
US15/241,674 Active 2031-09-10 US10544415B2 (en) 2010-05-12 2016-08-19 Methods for producing enteroendocrine cells that make and secrete insulin
US16/704,830 Abandoned US20200095585A1 (en) 2010-05-12 2019-12-05 Methods for Producing Enteroendocrine Cells That Make and Secrete Insulin

Family Applications After (2)

Application Number Title Priority Date Filing Date
US15/241,674 Active 2031-09-10 US10544415B2 (en) 2010-05-12 2016-08-19 Methods for producing enteroendocrine cells that make and secrete insulin
US16/704,830 Abandoned US20200095585A1 (en) 2010-05-12 2019-12-05 Methods for Producing Enteroendocrine Cells That Make and Secrete Insulin

Country Status (7)

Country Link
US (3) US9457079B2 (ja)
EP (1) EP2569430B1 (ja)
JP (2) JP5866106B2 (ja)
CN (2) CN103429739B (ja)
DK (1) DK2569430T3 (ja)
ES (1) ES2705236T3 (ja)
WO (1) WO2011143511A2 (ja)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10487314B2 (en) * 2014-06-26 2019-11-26 The Trustees Of Columbia University In The City Of New York Inhibition of serotonin expression in gut enteroendocrine cells results in conversion to insulin-positive cells

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9457079B2 (en) 2010-05-12 2016-10-04 The Trustees Of Columbia University In The City Of New York Methods for producing enteroendocrine cells that make and secrete insulin
SI2970890T1 (sl) 2013-03-14 2020-10-30 The Brigham And Women's Hospital, Inc. Sestavki in postopki za razmnoževanje in kultiviranje epitelijskih matičnih celic
JP6238319B2 (ja) * 2013-03-27 2017-11-29 国立大学法人 長崎大学 創傷または線維症の治療剤
CN103952410B (zh) * 2014-04-29 2016-02-10 暨南大学 一种有效抑制大鼠FoxO3a基因表达的shRNA及其应用
EP2963108A1 (en) * 2014-06-30 2016-01-06 Universite De Geneve Methods for inducing insulin production and uses thereof
EP3189134A1 (en) 2014-09-03 2017-07-12 The Brigham and Women's Hospital, Inc. Compositions, systems, and methods for generating inner ear hair cells for treatment of hearing loss
WO2016076929A1 (en) * 2014-11-13 2016-05-19 University Of Iowa Research Foundation Methods to generate epithelial cells
EP3313416A4 (en) * 2015-06-26 2019-02-20 The Trustees of Columbia University in the City of New York GENETICALLY MODIFIED IPS CELLS HAVING A MARKER FOR SIGNALING THE EXPRESSION OF NEUROGENIN3, TPH2, FOXO1 AND / OR INSULIN GENES
US11021687B2 (en) 2016-01-08 2021-06-01 The Brigham And Women's Hospital, Inc. Production of differentiated enteroendocrine cells and insulin producing cells
US10201540B2 (en) 2016-03-02 2019-02-12 Frequency Therapeutics, Inc. Solubilized compositions for controlled proliferation of stem cells / generating inner ear hair cells using GSK3 inhibitors: I
US10213511B2 (en) 2016-03-02 2019-02-26 Frequency Therapeutics, Inc. Thermoreversible compositions for administration of therapeutic agents
US11260130B2 (en) 2016-03-02 2022-03-01 Frequency Therapeutics, Inc. Solubilized compositions for controlled proliferation of stem cells / generating inner ear hair cells using a GSK3 inhibitor: IV
SG10201910821XA (en) 2016-12-30 2020-01-30 Frequency Therapeutics Inc 1h-pyrrole-2,5-dione compounds and methods of using them to induce self-renewal of stem/progenitor supporting cells
AU2019321641A1 (en) 2018-08-17 2021-04-15 Frequency Therapeutics, Inc. Compositions and methods for generating hair cells by upregulating Jag-1
WO2020037326A1 (en) 2018-08-17 2020-02-20 Frequency Therapeutics, Inc. Compositions and methods for generating hair cells by downregulating foxo
CN113403310A (zh) * 2021-06-15 2021-09-17 上海市东方医院（同济大学附属东方医院） 一种抑制FOXO1基因表达的特异性siRNA（siFX1）及其应用
CN115466321B (zh) * 2022-09-23 2024-03-22 南方医科大学珠江医院 FOXO3a-DRI肽段、其药物组合物及应用

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030157071A1 (en) 2001-05-31 2003-08-21 Wolfe M. Michael Treatment or replacement therapy using transgenic stem cells delivered to the gut
WO2004031350A2 (en) 2002-09-26 2004-04-15 Amgen, Inc. Modulation of forkhead box o1a expression
US20040214321A1 (en) 2003-03-07 2004-10-28 Hideki Taniguchi Agent for inducing conversion of intestinal cells into insulin-producing cells and antidiabetic drug
WO2005037226A2 (en) 2003-10-17 2005-04-28 Georgia Tech Research Corporation Genetically engineered enteroendocrine cells for treating glucose-related metabolic disorders
WO2007008982A2 (en) 2005-07-11 2007-01-18 Irm Llc Methods and composition for modulating foxo1 activity and insulin signaling
US20070238649A1 (en) 2004-03-04 2007-10-11 Takashi Kadowaki Agents for Regulating Adiponectin Receptor Expression
WO2007149550A2 (en) 2006-06-22 2007-12-27 The Trustees Of Columbia University In The City Of New York Modulation of differentiation and cell function via fox01 and notch signaling
US20080248995A1 (en) 2006-05-31 2008-10-09 Technion Research And Development Foundation Ltd. Modulation of PPARgamma2 gene promoter by FOXO1
US20080260700A1 (en) 2005-08-26 2008-10-23 The Trustees Of Columbia University In The City Of New York Generation of pancreatic endocrine cells from primary duct cell cultures and methods of use for treatment of diabetes

Family Cites Families (68)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4534899A (en) 1981-07-20 1985-08-13 Lipid Specialties, Inc. Synthetic phospholipid compounds
US4426330A (en) 1981-07-20 1984-01-17 Lipid Specialties, Inc. Synthetic phospholipid compounds
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
ATE151286T1 (de) 1983-11-14 1997-04-15 Columbia Lab Inc Bioadhäsive mittel
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
DE3788914T2 (de) 1986-09-08 1994-08-25 Ajinomoto Kk Verbindungen zur Spaltung von RNS an eine spezifische Position, Oligomere, verwendet bei der Herstellung dieser Verbindungen und Ausgangsprodukte für die Synthese dieser Oligomere.
US4987071A (en) 1986-12-03 1991-01-22 University Patents, Inc. RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods
US5116742A (en) 1986-12-03 1992-05-26 University Patents, Inc. RNA ribozyme restriction endoribonucleases and methods
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
WO1989005358A1 (en) 1987-11-30 1989-06-15 University Of Iowa Research Foundation Dna and rna molecules stabilized by modifications of the 3'-terminal phosphodiester linkage and their use as nucleic acid probes and as therapeutic agents to block the expression of specifically targeted genes
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
GB8826116D0 (en) 1988-11-08 1988-12-14 Danbiosyst Ltd Adhesive drug delivery composition
US5354844A (en) 1989-03-16 1994-10-11 Boehringer Ingelheim International Gmbh Protein-polycation conjugates
US5108921A (en) 1989-04-03 1992-04-28 Purdue Research Foundation Method for enhanced transmembrane transport of exogenous molecules
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5227170A (en) 1989-06-22 1993-07-13 Vestar, Inc. Encapsulation process
US5356633A (en) 1989-10-20 1994-10-18 Liposome Technology, Inc. Method of treatment of inflamed tissues
US5527528A (en) 1989-10-20 1996-06-18 Sequus Pharmaceuticals, Inc. Solid-tumor treatment method
US5013556A (en) 1989-10-20 1991-05-07 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5580575A (en) 1989-12-22 1996-12-03 Imarx Pharmaceutical Corp. Therapeutic drug delivery systems
US5469854A (en) 1989-12-22 1995-11-28 Imarx Pharmaceutical Corp. Methods of preparing gas-filled liposomes
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5264618A (en) 1990-04-19 1993-11-23 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
GB9014932D0 (en) 1990-07-05 1990-08-22 Celltech Ltd Recombinant dna product and method
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
JP3220180B2 (ja) 1991-05-23 2001-10-22 三菱化学株式会社 薬剤含有タンパク質結合リポソーム
WO1994004679A1 (en) 1991-06-14 1994-03-03 Genentech, Inc. Method for making humanized antibodies
NZ244306A (en) 1991-09-30 1995-07-26 Boehringer Ingelheim Int Composition for introducing nucleic acid complexes into eucaryotic cells, complex containing nucleic acid and endosomolytic agent, peptide with endosomolytic domain and nucleic acid binding domain and preparation
US5521291A (en) 1991-09-30 1996-05-28 Boehringer Ingelheim International, Gmbh Conjugates for introducing nucleic acid into higher eucaryotic cells
JPH05244982A (ja) 1991-12-06 1993-09-24 Sumitomo Chem Co Ltd 擬人化ｂ−ｂ１０
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
US5644048A (en) 1992-01-10 1997-07-01 Isis Pharmaceuticals, Inc. Process for preparing phosphorothioate oligonucleotides
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5583020A (en) 1992-11-24 1996-12-10 Ribozyme Pharmaceuticals, Inc. Permeability enhancers for negatively charged polynucleotides
JP3351476B2 (ja) 1993-01-22 2002-11-25 三菱化学株式会社 リン脂質誘導体及びそれを含有するリポソーム
US5395619A (en) 1993-03-03 1995-03-07 Liposome Technology, Inc. Lipid-polymer conjugates and liposomes
US5462854A (en) 1993-04-19 1995-10-31 Beckman Instruments, Inc. Inverse linkage oligonucleotides for chemical and enzymatic processes
US5534259A (en) 1993-07-08 1996-07-09 Liposome Technology, Inc. Polymer compound and coated particle composition
US5543158A (en) 1993-07-23 1996-08-06 Massachusetts Institute Of Technology Biodegradable injectable nanoparticles
US5417978A (en) 1993-07-29 1995-05-23 Board Of Regents, The University Of Texas System Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use
CN1048254C (zh) 1993-12-09 2000-01-12 托马斯杰弗逊大学 用于将预定的改变引入靶基因中的化合物
US5595756A (en) 1993-12-22 1997-01-21 Inex Pharmaceuticals Corporation Liposomal compositions for enhanced retention of bioactive agents
US5637684A (en) 1994-02-23 1997-06-10 Isis Pharmaceuticals, Inc. Phosphoramidate and phosphorothioamidate oligomeric compounds
US5543152A (en) 1994-06-20 1996-08-06 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
US5591721A (en) 1994-10-25 1997-01-07 Hybridon, Inc. Method of down-regulating gene expression
US5512295A (en) 1994-11-10 1996-04-30 The Board Of Trustees Of The Leland Stanford Junior University Synthetic liposomes for enhanced uptake and delivery
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
EP1105460B1 (en) 1998-08-10 2009-10-07 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Differentiation of non-insulin producing cells into insulin producing cells by glp-1 or exendin-4 and uses thereof
ATE251449T1 (de) 1999-06-14 2003-10-15 Cosmo Spa Geschmacksmaskierte orale pharmazeutische zusammensetzungen mit kontrollierter abgabe
US20020055479A1 (en) 2000-01-18 2002-05-09 Cowsert Lex M. Antisense modulation of PTP1B expression
US6560471B1 (en) 2001-01-02 2003-05-06 Therasense, Inc. Analyte monitoring device and methods of use
CN1668324A (zh) 2002-05-28 2005-09-14 诺沃塞尔公司 用于胰岛素产生细胞的方法、组合物及生长与分化因子
AU2003250112A1 (en) 2002-07-22 2004-02-09 Bayer Healthcare Ag Regulation of human serotonin receptor
US20040023390A1 (en) 2002-08-05 2004-02-05 Davidson Beverly L. SiRNA-mediated gene silencing with viral vectors
JP4219676B2 (ja) * 2002-12-25 2009-02-04 独立行政法人科学技術振興機構 糖尿病改善薬をスクリーニングする方法
US20060148079A1 (en) 2005-01-03 2006-07-06 Virgil Paunescu Isolation and purification of human insulin producing cells for the treatment of insulin dependent diabetes
WO2008033518A2 (en) 2006-09-13 2008-03-20 The Trustees Of Columbia University In The City Of New York Undercarboxylated/uncarboxylated osteocalcin increases beta-cell proliferation, insulin secretion, insulin sensitivity, glucose tolerance and decreases fat mass
DE102008009991A1 (de) 2008-02-19 2009-08-27 Ast Security Equipment Gmbh Verbindungsmittel zum Verbindung von Einbauteilen mit einer Fahrzeugzelle und Fahrzeug mit einem solchen Verbindungsmittel
HUE034551T2 (en) 2009-01-12 2018-02-28 Biokier Inc Preparation and method of treating diabetes
US9457079B2 (en) 2010-05-12 2016-10-04 The Trustees Of Columbia University In The City Of New York Methods for producing enteroendocrine cells that make and secrete insulin
MX2015007550A (es) 2012-12-12 2017-02-02 Broad Inst Inc Suministro, modificación y optimización de sistemas, métodos y composiciones para la manipulación de secuencias y aplicaciones terapéuticas.
WO2014153620A1 (en) 2013-03-28 2014-10-02 The University Of Western Australia METHOD FOR GENERATING MATURE β-LIKE CELLS

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030157071A1 (en) 2001-05-31 2003-08-21 Wolfe M. Michael Treatment or replacement therapy using transgenic stem cells delivered to the gut
WO2004031350A2 (en) 2002-09-26 2004-04-15 Amgen, Inc. Modulation of forkhead box o1a expression
US20080153767A1 (en) * 2002-09-26 2008-06-26 Dobie Kenneth W Modulation of forkhead box o1a expression
US20040214321A1 (en) 2003-03-07 2004-10-28 Hideki Taniguchi Agent for inducing conversion of intestinal cells into insulin-producing cells and antidiabetic drug
WO2005037226A2 (en) 2003-10-17 2005-04-28 Georgia Tech Research Corporation Genetically engineered enteroendocrine cells for treating glucose-related metabolic disorders
US20070238649A1 (en) 2004-03-04 2007-10-11 Takashi Kadowaki Agents for Regulating Adiponectin Receptor Expression
WO2007008982A2 (en) 2005-07-11 2007-01-18 Irm Llc Methods and composition for modulating foxo1 activity and insulin signaling
US20080260700A1 (en) 2005-08-26 2008-10-23 The Trustees Of Columbia University In The City Of New York Generation of pancreatic endocrine cells from primary duct cell cultures and methods of use for treatment of diabetes
US20080248995A1 (en) 2006-05-31 2008-10-09 Technion Research And Development Foundation Ltd. Modulation of PPARgamma2 gene promoter by FOXO1
WO2007149550A2 (en) 2006-06-22 2007-12-27 The Trustees Of Columbia University In The City Of New York Modulation of differentiation and cell function via fox01 and notch signaling

Non-Patent Citations (43)

* Cited by examiner, † Cited by third party
Title
Aagaard et al (Advanced Drug Delivery Reviews 59 (2007) 75-86). *
Accili, D., et al., "FoxOs at the crossroads of cellular metabolism, differentiation, and transformation.", "Cell", 2004, pp. 421-426, vol. 117, No. 4, Publisher: Cell Press, Published in: http://www.cell.com/abstract/S0092-8674(04)00452-0.
Alilkhani et al. "Functions as a Master Switch That Regulates Gene Expression Necessary for Tumor Necrosis Factor-induced Fibroblast Apoptosis" Jan. 4, 2005, pp. 12096-12102.
Al-Masri M., et al., "Effect of forkhead box O1 (FOXO1) on beta cell development in the human fetal pancrease.", "Diabetologia", 2010, pp. 699-711, vol. 53, No. 4, Publisher: Springer-Verlag, Published in: http://link.springer.com/article/10.1007%2Fs00125-009-1632-0.
Behl, Y., et al., "Fox01 Plays an Important Role in Enhanced Microvascular Cell Apoptosis and Microvascular Cell Loss Type 1 and Type 2 Diabetic Rats.", Jan. 23, 2009, pp. 917-925, vol. 58, No. 4, Publisher: Diabetes, Published in: http://diabetes.diabetesjournals.org/content/58/4/917.
Brown et al. (J Immunol. May 1996;156(9):3285-91 at 3290 and Tables 1 and 2). *
Chutima, Talchai, et al., "Generation of Functional Insulin-Producing Cells in the Gut by Fox01 Ablation", Jan. 1, 2012, pp. 406-412, vol. 44, No. 4, Publisher: Nature Genetics, Published in: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3315609/.
Dorsett et al. "siRNAs: Applications in Functional Genomics and Potential as Therapeutics", Apr. 2004, pp. 318-329.
Fujita, Y., et al., "Harnessing the gut to treat diabetes.", "Pediatric Diabetes", 2004, pp. 57-69, vol. 5, No. 2, Publisher: John Wiley & Sons, Published in: http://www.ncbi.nlm.nih.gov/pubmed/15601375.
Glauser, D A, et al., "Fox0 Proteins in Pancreatic [beta]-cells as Potential Therapeutic Targets in Diabetes", Mar. 1, 2008, pp. 175-185, vol. 3, No. 2, Publisher: Expert Review of Endocrinology & Metabolism, Future Drugs LTD, Published in: http://informahealthcare.com/doi/abs/10.1586/17446651.3.2.175.
Haeusler, R.A., et al., "FoxOs function synergistically to promote glucose production.", "Journal of Biological Chemistry", 2010, pp. 35245-35248, vol. 285, No. 46, Publisher: The American Society for Biochemistry and Molecular Biology, Inc., Published in: http://www.jbc.org/content/285/46/35245.full.
ISA/US, "International Search Report and Written Opinion for the corresponding PCT application #2011/036360", Nov. 10, 2011.
J. Dig, "Gastrointestinal Stem Cells Research Status and Application Prospects, Int'l.", 2006, pp. 183-186 vol. 26, No. 3, Published in: http://www.cqvip.com/.
Jaeseok Han et al., "Engineered Enteroendocrine Cells Secrete Insulin in Response to Glucose and Reverse Hyperglycemia in Diabetic Mice", "Molecular Therapy", 2007, pp. 1195-1120, vol. 15, No. 6, Publisher: The American Society of Gene Therapy, Published in: http://www.nature.com/mt/journal/v15/n6/pdf/6300117a.pdf.
Kamagate, A, et al, "Fox0 Mediates Insulin-Dependent Regulation of Hepatic VLDL production in Mice", Jan. 1, 2008, pp. 2347-2364, vol. 118, No. 6, Publisher: Journal of Clinical Investigation, Published in: http://www.jci.org/articles/view/32914.
Kawamori, D. et al., "The forkhead transcription factor Foxo1 bridges the JNK pathway and the transcription factor PDX-1 through its intracell", "The Journal of Biological Chemistry", 2006, pp. 1091-1098, vol. 281, No. 2, Publisher: American Society for Biochemistry and Molecular Biology, Published in: http://www.jbc.org/content/281/2/1091.short.
Kim, M.S., et al., "Role of hypothalmic Foxo1 in the regulation of food intake and energy homeostasis.", "Nature Neuroscience", 2006, pp. 901-906, vol. 9, Publisher: The Nature Publishing Group, Published in: http://www.nature.com/neuro/journal/v9/n7/full/nn1731.html.
Kitamura et al. "A Foxo/Notch Pathway Controls Myogenic Differentiation and Fiber Type Specification" Sep. 2007, 2477-2485.
Kitamura T., et al., "Forkhead protein FoxO1 mediates Agrp-dependent effects of leptin on food intake.", "Nature Medicine", 2006, pp. 534-540, vol. 12, Publisher: Nature Publishing Group, Published in: http://www.nature.com/nm/journal/v12/n5/full/nm1392.html.
Kitamura T., et al., "Regulation of pancreatic juxtaductal endocrine cell formation by FoxO1.", "Molecular and Cellular Biology", Aug. 2009, pp. 4417-4430, vol. 29, No. 16, Publisher: American Society for Microbiology, Published in: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2725741/.
Kitamura, T., et al., "The forkhead transcription factor Foxo1 links insulin signaling to Pdx1 regulation of pancreatic beta cell growth.", "Journal of Clinical Investigation", Dec. 2002, pp. 1839-1847, vol. 110, No. 12, Publisher: American Society for Clinical Investigation, Published in: http://www.jci.org/articles/view/16857.
Kitamura, Y.I., et al., "FoxO1 protects against pancreatic beta cell failure through NeuroD and MafA induction.", "Cell Metabolism", 2005, pp. 153-163, vol. 2, No. 3, Publisher: Elsevier Inc., Published in: http://www.cell.com/cell-metabolism/retrieve/pii/S1550413105002329.
Konner, A.C., et al., "Insulin Action in AgRP-Expressing Neurons Is Required for Suppression of Hepatic Glucose Production.", "Cell Metabolism", 2007, pp. 438-449, vol. 5, No. 6, Publisher: Cell Press, Published in: http://www.cell.com/cell-metabolisulretrieve/pii/S1550413107001313.
Lee, C.S., et al., "Neurogenin 3 is essential for the proper specification of gastric enteroendocrine cells and the maintenance of gastric e", "Genes Dev", Jun. 15, 2002, pp. 1488-1497, vol. 16, No. 12, Publisher: CSHL Press, Published in: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC186338/.
Ma (Modern Drug Discovery 2004, 7(6)). *
Matsumoto2007, "Impaired regulation of hepatic glucose production in mice lacking the forkhead transcription factor Foxo1 in liver.", "Cell Metabolism", 2007, pp. 208-216, vol. 6, No. 3, Publisher: Cell Press, Published in: http://www.cell.com/cell-metabolism/abstract/S1550-4131(07)00228-8.
Nakae, J., et al., "Regulation of insulin action and pancreatic beta-cell function by mutated alleles of the gene encoding forkhead transcri", "Nature Genetics", 2002, pp. 245-253, vol. 32, No. 2, Publisher: Nature Publishing Group, Published in: http://www.nature.com/ng/journal/v32/n2/abs/ng890.html.
Okamoto, H. et al., "Role of the forkhead protein FoxO1 in beta cell compensation to insulin resistance.", "Journal of Clinical Investigation", 2006, pp. 775-782, vol. 116, No. 3, Publisher: American Society for Clinical Investigation, Published in: http://www.jci.org/articles/view/24967/pdf.
Pajvani, U.B., et al., "Inhibition of Notch signaling amerliorates insuin resistance in a FoxO1-dependent manner.", "Nature Medicine", 2011, pp. 961-967, vol. 17, Publisher: Nature Publishing Group, Published in: http://www.nature.com/nm/journal/v17/n8/abs/nm.2378.html.
Plum, L., et al., "The obesity susceptibility gene Cpe links FoxO1 signaling in hypothalamic pro-opiomelanocortin neurons with regulation o", "Nature Medicine", 2009, pp. 1195-1201, vol. 15, Publisher: Nature Publishing Group, Published in: http://www.nature.com/nm/journal/v15/n10/abs/nm.2026.html.
Qian, S., et al., "Neither agouti-related protein nor neuropeptide Y is critically required for the regulation of energy homeostasis in mic", "Molecular and Cellular Biology", 2002, pp. 5027-5032, vol. 22, No. 14, Publisher: American Society for Microbiology, Published in: http://mcb.asm.org/content/22/14/5027.abstract.
Ropelle et al., "Inhibition of Hypothalamic Foxo1 Expression Reduced Food Intake in Diet-Induced Obesity Rats", 2009, pp. 2341-2351 vol. 587, No. 10, Published in: http://www.ncbi.nlm.nih.gov/pubmed/19332486.
Samuel et al (Diabetes. Jul. 2006;55(7):2042-50.). *
Samuel, V T, et al., "Targeting Foxo1 in Mice Using Antisense Oligonucleotide Improves Hepatic and Peripheral Insulin Action", Jul. 1, 2006, pp. 2042-2050, vol. 55, Publisher: Diabetes, Published in: http://diabetes.diabetesjournals.org/content/55/7/2042.long.
Schonhoff, S.E, et al., "Neurogenin 3-Expressing Progenitor Cells in the Gastrointestinal Tract Differentiate Into Both Endocrine and Non-Endocri", "Developmental Biology", Jun. 15, 2004, pp. 443-454, vol. 270, No. 2, Publisher: Elsevier Science, Published in: http://www.sciencedirect.com/science/article/pii/S0012160604002015.
Takahashi, K.A., et al., "Fasting induces a large, leptin-dependent increase in the intrinsic action potential ferequency of orexigenic arcuate nu", "Endocrinology", 2005, pp. 1043-1047, vol. 146, No. 3, Publisher: Endocrine Society, Published in: http://endo.endojournals.org/content/146/3/1043.long.
Talchai, C., et al., "Genetic and biochemical pathways of beta-cell failure in type 2 diabetes.", "Diabetes, Obesity, and Metabolism", Nov. 2009, pp. 38-45, vol. 11, No. 4, Publisher: Blackwell Publishing Ltd, Published in: http://onlinelibrary.wiley.com/doi/10.1111/j.1463-1326.2009.01115.x/abstract.
Thaler, JP et al., "Minireview: Hormonal and metabolic mechanisms of diabetes remission after gastrointestinal surgery.", "Endocrinoogy", Jun. 1 2009, pp. 2518-2525, vol. 150, No. 6, Publisher: The Endocrine Society, Published in: http://endo.endojournals.org/content/150/6/2518.long.
Vajdos et al. (J Mol Biol. Jul. 5, 2002;320(2):415-28 at 416). *
Varman T. Samuel et al., "Targeting Foxo1 in Mice Using Antisense Oligonucleotide Improves Hepatic and Peripheral Insulin Action", "Diabetes", 2006, pp. 2042-2050, vol. 55, No. 7, Publisher: American Diabetes Association, Published in: http://diabetes.diabetesjournals.org/content/55/7/2042.full.pdf+html?sid=7ab067b3-93a2-4193-a576-d00abfc2cdea.
Warzocha et al (Leukemia and Lymphoma, Val. 24. pp. 267-281). *
Wideman, Rhonda D., et al., "Insulin-expressing engineered cell lines and primary cells: surrogate [beta] cells from liver, gut, and other sources", "Current Opinion in Organ Transplantation", 2007, pp. 67-72, vol. 12, No. 1, Publisher: Wolters Kuwer Lippincot: Williams & Wilkins, Published in: http://journals.lww.com/co-transplantation/Abstract/2007/02000/Insulin-expressing-engineered-cell-lines-and.13.aspx.
Ziegler, TR et al., "A comparison of rat small intestinal insulin and insulin-like growth factor I receptors during fasting and refeeding", "Endocrinology", 1995, pp. 5148-5154, vol. 136, Publisher: The Endocrine Society, Published in: http://www.ncbi.nlm.nih.gov/pubmed/7588253.

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10487314B2 (en) * 2014-06-26 2019-11-26 The Trustees Of Columbia University In The City Of New York Inhibition of serotonin expression in gut enteroendocrine cells results in conversion to insulin-positive cells
US11060063B2 (en) 2014-06-26 2021-07-13 The Trustees Of Columbia University In The City Of New York Inhibition of serotonin expression in gut enteroendocrine cells results in conversion to insulin-positive cells

Also Published As

Publication number Publication date
EP2569430B1 (en) 2018-10-17
EP2569430A4 (en) 2015-04-15
CN103429739A (zh) 2013-12-04
US20200095585A1 (en) 2020-03-26
WO2011143511A3 (en) 2012-01-05
WO2011143511A2 (en) 2011-11-17
DK2569430T3 (en) 2019-02-04
ES2705236T3 (es) 2019-03-22
JP5866106B2 (ja) 2016-02-17
US20170044532A1 (en) 2017-02-16
CN103429739B (zh) 2018-11-13
EP2569430A2 (en) 2013-03-20
US20130216554A1 (en) 2013-08-22
CN109593814A (zh) 2019-04-09
JP6195891B2 (ja) 2017-09-13
US10544415B2 (en) 2020-01-28
JP2013534514A (ja) 2013-09-05
JP2016127830A (ja) 2016-07-14

Similar Documents

Publication Publication Date Title
US10544415B2 (en) Methods for producing enteroendocrine cells that make and secrete insulin
US11060063B2 (en) Inhibition of serotonin expression in gut enteroendocrine cells results in conversion to insulin-positive cells
US20070190056A1 (en) Muscle regeneration compositions and uses therefor
US20090136481A1 (en) Use of Myostatin (GDF-8) Antagonists for Treatment of Sarcopenia (Age-Related Muscle-Wasting)
US20170157110A1 (en) Methods for inducing insulin production and uses thereof
US20160067212A1 (en) Use of insulin signaling antagonists, optionally in combination of transfection of non-beta cells, for inducing insulin production
JP2014523871A (ja) 膵臓ベータ細胞増殖の調整
Taylor-Fishwick et al. Islet neogenesis associated protein transgenic mice are resistant to hyperglycemia induced by streptozotocin
Wang et al. Overexpression of Pref-1 in pancreatic islet β-cells in mice causes hyperinsulinemia with increased islet mass and insulin secretion
KR101652957B1 (ko) ATF3 유전자 발현을 억제하는 신규 siRNA 및 이의 용도
US20220088010A1 (en) Co-Administration of inhibitors to produce insulin producing gut cells
JP6825910B2 (ja) Ｆｌａｔｔｏｐ（Ｆｌｔｐ）はβ細胞成熟についての新規のバイオマーカーである
Neumann The metabolic effects of leptin therapy and glucagon suppression therapy in mouse models of diabetes
Armour Investigating the role of the transducin-like enhancer of split proteins in maintenance of pancreatic beta cell phenotype
Hyslop Prolactin as an Adjunct to Anti-CD3 Type I Diabetes Therapy

Legal Events

Date Code Title Description
AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:COLUMBIA UNIV NEW YORK MORNINGSIDE;REEL/FRAME:028502/0946

Effective date: 20120625

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:COLUMBIA UNIV NEW YORK MORNINGSIDE;REEL/FRAME:029597/0342

Effective date: 20130107

AS Assignment

Owner name: THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TALCHAI, CHUTIMA;ACCILI, DOMENICO;REEL/FRAME:034936/0568

Effective date: 20110803

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 4

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2552); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 8