US20220409696A1 - Heparin-Associated Polypeptides and Uses Thereof - Google Patents

Heparin-Associated Polypeptides and Uses Thereof Download PDF

Info

Publication number
US20220409696A1
US20220409696A1 US17/837,920 US202217837920A US2022409696A1 US 20220409696 A1 US20220409696 A1 US 20220409696A1 US 202217837920 A US202217837920 A US 202217837920A US 2022409696 A1 US2022409696 A1 US 2022409696A1
Authority
US
United States
Prior art keywords
igf2
muscle
amino acid
certain embodiments
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
US17/837,920
Other languages
English (en)
Inventor
Hanadie Yousef
Jeremy O'CONNELL
Thach MAI
Zhihua Li
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Juvena Therapeutics Inc
Original Assignee
Juvena Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Juvena Therapeutics Inc filed Critical Juvena Therapeutics Inc
Priority to US17/837,920 priority Critical patent/US20220409696A1/en
Publication of US20220409696A1 publication Critical patent/US20220409696A1/en
Assigned to JUVENA THERAPEUTICS, INC. reassignment JUVENA THERAPEUTICS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: O'CONNELL, Jeremy, YOUSEF, HANADIE, LI, ZHIHUA, MAI, Thach
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1825—Fibroblast growth factor [FGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/30—Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/39—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin, cold insoluble globulin [CIG]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/643—Albumins, e.g. HSA, BSA, ovalbumin or a Keyhole Limpet Hemocyanin [KHL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/65—Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/76—Albumins
    • C07K14/765—Serum albumin, e.g. HSA
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin

Definitions

  • tissue progenitor cells lose their regenerative potential.
  • polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide useful for the treatment of soft-tissue and muscle diseases, disorders, and injuries. Also described herein mutations within the IGF2 amino acid sequence improved the stability of the molecule by reducing backbone cleavage. Also described herein are mutations within IGF2 sequences that block cleavage of its peptide backbone. Also described are methods of treating muscle and soft-tissue diseases comprising administering the polypeptides and/or synergistic compositions.
  • FIG. 1 A depicts purified IGF2-hFcm promoted differentiation of human myoblast cells
  • FIG. 1 B depicts purified IGF2-LhFc4 promoted differentiation of human myoblast cells
  • FIG. 2 A purified HSA-L-IGF2R61A promoted differentiation of human myoblast cells.
  • FIG. 2 B depicts IGF2 and IGF2 receptors were expressed in human myoblast
  • FIG. 2 C depicts IGF2 and IGF2 receptors were expressed in human myoblast
  • FIG. 3 A depicts sodium butyrate enhanced muscle fusion
  • FIG. 3 B depicts sodium butyrate enhanced IGF2 activity
  • FIG. 3 C depicts sodium butyrate enhanced IGF2 activity
  • FIG. 4 A depicts the change in percent area of eMyHC positive cells treated with additional doses of vehicle, IGF2, sodium butyrate, or IGF2 and sodium butyrate
  • FIG. 4 B depict the change in percent area of eMyHC positive cells treated with additional doses of vehicle, IGF2, sodium butyrate, or IGF2 and sodium butyrate
  • FIG. 5 A depicts IGF2 enhances MYOG expression in DM1 human myoblast cells.
  • FIG. 6 A depicts IGF2 Receptor was expressed on chondrocyte and osteocytes
  • FIG. 7 A depicts IGF2 treatment promoted proliferation in DM1 human myoblast (32 year old caucasian female) cells
  • FIG. 7 B depicts IGF2 treatment promoted fusion in DM1 human myoblast (32 year old caucasian female) cells
  • FIG. 8 A depicts IGF2 enhanced MYH3 and CKM expression in DM1 human myoblast (32 year old caucasian female) cells
  • FIG. 8 B depicts IGF2 enhanced ATP1B1 expression in DM1 human myoblast (32 year old caucasian female) cells
  • FIG. 9 A depicts systemic administration of IGF2/sodium butyrate protected against aging induced muscle dysfunction
  • FIG. 9 B depicts an experimental overview of systemic administration of IGF2/NaB protected against aging induced muscle dysfunction as measured by grip strength force
  • FIG. 9 C depicts systemic administration of IGF2/sodium butyrate protected against aging induced muscle dysfunction as measured by both limb grip strength force
  • FIG. 9 D depicts systemic administration of IGF2/sodium butyrate protected against aging induced muscle dysfunction as measured by forelimb force
  • FIG. 9 E depicts systemic administration of IGF2/sodium butyrate protected against aging induced muscle dysfunction as measured by treadmill performance
  • FIG. 9 F depicts systemic administration of IGF2/sodium butyrate protected against aging induced muscle dysfunction as measured by running time to exhaustion
  • FIG. 9 G depicts systemic administration of IGF2/sodium butyrate protected against aging induced muscle dysfunction as measured by maximum running speed
  • FIG. 10 A depicts experimental overview for demonstrating chronic, systemic administration of IGF2/sodium butyrate was safe for liver, kidney and pancreas function
  • FIG. 10 B depicts systemic administration of IGF2/sodium butyrate had no adverse effects on white blood cell count, Albumin concentration ( FIG. 10 C ), Creatinine concentration ( FIG. 10 D ) and Calcium concentration ( FIG. 10 E )
  • FIG. 11 A depicts an experimental overview of systemic administration of IGF2 and sodium butyrate protecting against Dexamethasone induced muscle atrophy.
  • FIG. 11 B depicts systemic administration of IGF2 and sodium butyrate protected against Dexamethasone induced muscle atrophy as measured by bothlimb force
  • FIG. 11 C depicts systemic administration of IGF2 and sodium butyrate protected against Dexamethasone induced muscle atrophy as measured by specific bothlimb force
  • FIG. 11 D depicts systemic administration of IGF2 and sodium Butyrate protected against Dexamethasone induced muscle atrophy as measured by forelimb force
  • FIG. 11 E depicts systemic administration of IGF2 and sodium Butyrate protected against Dexamethasone induced muscle atrophy as measured by specific bothlimb force calculated as the ratio of bothlimb force in mN over the weight
  • FIG. 11 F depicts systemic administration of IGF2 and sodium butyrate protected against Dexamethasone induced muscle atrophy as measured by muscle fiber cross sectional area
  • FIG. 12 A depicts systemic administration of IGF2 and sodium butyrate regenerates and enhances muscle health in the D2-mdx model Duchenne's muscular dystrophy model improving tibialis anterior muscle weight relative to vehicle treatment
  • FIG. 12 B depicts systemic administration of IGF2 and sodium butyrate regenerates and enhances muscle function in the D2-mdx model Duchenne's muscular dystrophy model improving forelimb grip strength relative to vehicle treatment
  • FIG. 12 C depicts systemic administration of IGF2 and sodium butyrate protected against regenerates and enhances muscle function in the D2-mdx model Duchenne's muscular dystrophy model improving both limb grip strength relative to vehicle treatment
  • FIG. 12 D depicts systemic administration of IGF2 and sodium butyrate regenerates and enhances muscle function in the D2-mdx model Duchenne's muscular dystrophy model improving distance run on a treadmill relative to vehicle treatment
  • FIG. 12 E depicts systemic administration of IGF2 and sodium butyrate regenerates and enhances muscle function in the D2-mdx model Duchenne's muscular dystrophy model improving distance run on a treadmill relative to vehicle treatment
  • FIG. 12 F depicts systemic administration of IGF2 and sodium butyrate regenerates and enhances muscle function in the D2-mdx model Duchenne's muscular dystrophy model improving distance run on a treadmill relative to vehicle treatment
  • FIG. 13 A depicts HSA-L-IGF2 is cleaved when expressed from CHO cells as visualized on a reducing SDS-PAGE
  • FIG. 13 B depicts that HSA-L-IGF2 is cleaved when expressed from CHO cells as visualized on a reducing SDS-PAGE followed by Western blotting to detect 6 ⁇ HIS tag, and depicts cleavage of IGF2 as confirmed by double tagged IGF2 as visualized on a reducing SDS-PAGE followed by Western blotting to detect 6 ⁇ HIS tag and the antibody constant region, hFc4, tag
  • FIG. 14 depicts IGF2 cleavage with the amino acid sequence tagged on each end (HSA and hFc4) as visualized on a reducing SDS-PAGE followed by Western blotting to detect 6 ⁇ HIS tag and the hFc4 tag
  • FIG. 15 A depicts double tagged (HSA and hFc4) IGF2 cleavage was blocked by mutations as visualized on a reducing SDS-PAGE
  • FIG. 15 B depicts double tagged (HSA and hFc4) IGF2 cleavage was blocked by mutations as visualized on a reducing SDS-PAGE followed by Western blotting to detect 6 ⁇ HIS tag and hFc4 tags
  • FIG. 16 A depicts in vitro myogenesis assay results demonstrates HSA-IGF2R61A mutant sequences retain equal activity relative to IGF2 in human DM1 muscle precursors from 32-year-old female
  • FIG. 16 B depicts in vitro myogenesis assay results demonstrates IGF2 displays equal activity relative to HSA-IGF2R61A in human DM1 muscle precursors from 32-year-old female
  • FIG. 17 A depicts in vitro myogenesis assay results demonstrates HSA-IGF2R61A mutant sequences retain equal activity relative to IGF2 in healthy human muscle precursors from 32-year-old female
  • FIG. 17 B depicts in vitro myogenesis assay results demonstrates IGF2 displays equal activity relative to an equimolar amount of HSA-IGF2R61A in healthy human muscle precursors from 32-year-old female
  • FIG. 18 A depicts Non-Compartment Analysis fit of pharmacodynamics data for intravenous administration of the HSA-IGF2R61 in mice which demonstrates significantly improved serum half-life compared to the natural sequence of IGF2
  • FIG. 18 B depicts Non-Compartment Analysis fit of pharmacodynamics data for intravenous administration of the IGF2 in mice which demonstrates significantly improved serum half-life compared to the natural sequence of HSA-IGF2R61
  • FIG. 19 depicts HSA-IGF2R61A interacts with rhIGFBP3 as demonstrated by mass shifts in size exclusion chromatography by HPLC
  • FIG. 20 depicts a mutant sequence HSA-IGF2R61A retains equal or increased activity to HSA-IGF2 at equimolar concentrations
  • FIG. 21 A-F shows results from an acute injury mouse model.
  • FIG. 21 A shows the fatigue index for mice receiving 6HIS-HSA-IGF2R61A or mice receiving control (vehicle).
  • FIG. 21 B shows the force production as measured by specific force frequency for mice receiving 6HIS-HSA-IGF2R61A or mice receiving control (vehicle).
  • FIG. 21 C shows the force production as measured by max contraction rate for mice receiving 6HIS-HSA-IGF2R61A or mice receiving control (vehicle).
  • FIG. 21 D shows the relation rates of mice receiving 6HIS-HSA-IGF2R61A compared mice receiving control (vehicle).
  • FIG. 21 E shows the regenerative index measured as the number of new muscle fibers per square millimeter for mice receiving 6HIS-HSA-IGF2R61A or mice receiving control (vehicle).
  • FIG. 21 F shows the muscle mass of mice receiving 6HIS-HSA-IGF2R61A compared mice receiving control (vehicle).
  • FIG. 22 A-E shows results from a sarcopenia mouse model.
  • FIG. 22 A shows blood glucose normalized to a baseline level for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • FIG. 22 B shows force generation measured by both limb grip strength (normalized for body weight) for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • FIG. 22 A shows blood glucose normalized to a baseline level for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • FIG. 22 C shows force generation measured by forelimb grip strength (normalized for body weight) for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • FIG. 22 D shows recovery of muscle force production for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • FIG. 22 E shows force frequency, normalized for body weight, for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • FIG. 23 A-B shows results from a sarcopenia mouse model.
  • FIG. 23 A shows fiber type distribution for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • FIG. 23 B shows cross sectional areas (CSA) for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • CSA cross sectional areas
  • FIG. 24 A-D shows results from a muscle dystrophy (DM1) mouse model.
  • FIG. 24 A shows muscle fiber distribution for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • FIG. 24 B shows cross sectional areas (CSA) for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • FIG. 24 A shows muscle fiber distribution for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • CSA cross sectional areas
  • FIG. 24 C shows change in twitch from baseline for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • FIG. 24 D shows change in novel object recognition for mice receiving 6 mg/kg 6HIS-HSA-IGF2R61A and 0.3 g/kg of sodium butyrate (NaB) or mice receiving control (vehicle).
  • a therapeutically active protein or polypeptide sequence or derivative or fragment thereof that enhances progenitor cell growth or regeneration or function through activation of a cell surface receptor, and one or more of: a secretion signal a multimerizing component, or a stabilizing component.
  • a secretion signal a multimerizing component, or a stabilizing component.
  • a method of treating individuals with acute and chronic muscle wasting diseases or conditions such as sarcopenia, cachexia, muscular dystrophies, and muscle injury.
  • a polypeptide comprising an IGF2 amino acid sequence and a heterologous polypeptide amino acid sequence, wherein the heterologous polypeptide amino acid sequence increases the stability or biological function of the IGF2 amino acid sequence.
  • a composition comprising an IGF1R agonist and a short fatty acid chain.
  • the secretion signal sequence can either be one naturally occurring with a therapeutically active protein or polypeptide sequence or a different one selected, modified, or created to optimize expression yield through secretion efficiency, processing kinetics, or cell line specific processing Further examples and SEQ IDs are found in the Table of Sequences at the end of this disclosure.
  • the polypeptide may comprise a secretory signal peptide.
  • the secretory signal peptide is SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO:14, SEQ ID NO: 15, or SEQ ID NO: 16.
  • Fusion polypeptides herein in heterologous production systems may result in imprecise cleavage of the signal sequence of the fusion polypeptide or non-specific early truncation at the C-terminal end of the fusion polypeptide.
  • Processing of the secretory sequence or N- or C-terminal processing may result in loss of amino acids from either the N- or the C-terminus of the polypeptide.
  • Multimerizing components join two or more other protein components.
  • a multimerizing component can take the form of a linker sequence of amino acids that joins other components tandemly into a single consecutive amino acid sequence.
  • multimerizing components can take the form of proteins or protein domains that dimerize, resulting in covalent disulfide linking or non-covalent associations driving dimerization. Examples are disclosed in the Table of Sequences at the end of this disclosure.
  • Stabilizing components can reduce degradation rate, increase translational or post-translation folding, reduce unfolding rates, or increase circulating half-life.
  • Examples can include abundant, circulating proteins or fragments thereof such as albumin or the fragment crystallizable (Fc) region from a human antibody. Further examples are disclosed in the Table of Sequences at the end of this disclosure.
  • the terms “individual,” “patient,” or “subject” are used interchangeably and refer to individuals diagnosed with, suspected of being afflicted with, or at-risk of developing at least one disease for which the described compositions and method are useful for treating.
  • the individual is a mammal.
  • the mammal is a mouse, rat, rabbit, dog, cat, horse, cow, sheep, pig, goat, llama, alpaca, or yak.
  • the individual is a human.
  • treat refers to interventions to a physiological or disease state of an individual designed or intended to ameliorate at least one sign or symptom associated with said physiological or disease state.
  • the skilled artisan will recognize that given a heterogeneous population of individuals afflicted with a disease, not all individuals will respond equally, or at all, to a given treatment.
  • heterologous refers to a nucleotide or amino acid sequence that is from a different source (e.g., gene, polypeptide, or organism) compared to the amino acid or nucleotide sequence to which it refers to as being heterologous.
  • Heterologous includes biological sequences derived from different organisms or to sequences derived from different sources (e.g., genes or proteins) of the same organism.
  • Heterologous sequences include recombinant DNA molecules comprising nucleotide sequences from different sources, fusion proteins comprising amino acid sequences from different sources, and epitope or purification tags of natural or synthetic origin.
  • muscle refers to skeletal muscle, and does not refer to smooth muscle or cardiac muscle.
  • soft tissue refers to connective tissues, including without limitations, tendons, ligaments, and cartilage.
  • mitogenic activity refers to an activity that induces cell division or proliferation.
  • fusion promoting activity refers to activity that promotes the fusion of cells into multinucleated cells, such as the fusion of myocytes into multinucleated myofibers, or advances the differentiation of a terminal differentiating stem or progenitor cells toward a committed cell lineage type, such as the progression of myoblasts into myocytes or the increase in cell size of expanding myofibers.
  • polypeptide and “protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length.
  • Polypeptides including the provided antibodies and antibody chains and other peptides, e.g., linkers and binding peptides, may include amino acid residues including natural and/or non-natural amino acid residues.
  • the terms also include post-expression modifications of the polypeptide, for example, glycosylation, sialylation, acetylation, phosphorylation, and the like.
  • the polypeptides may contain modifications with respect to a native or natural sequence, as long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.
  • Percent (%) sequence identity with respect to a reference polypeptide sequence is the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are known for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Appropriate parameters for aligning sequences are able to be determined, including algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • % amino acid sequence identity values are generated using the sequence comparison computer program ALIGN-2.
  • the ALIGN-2 sequence comparison computer program was authored by Genentech, Inc., and the source code has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087.
  • the ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, Calif., or may be compiled from the source code.
  • the ALIGN-2 program should be compiled for use on a UNIX operating system, including digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
  • the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows: 100 times the fraction X/Y, where X is the number of amino acid residues scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the total number of amino acid residues in B.
  • the polypeptides described herein can be encoded by a nucleic acid.
  • a nucleic acid is a type of polynucleotide comprising two or more nucleotide bases.
  • the nucleic acid is a component of a vector that can be used to transfer the polypeptide encoding polynucleotide into a cell.
  • the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • One type of vector is a genomic integrated vector, or “integrated vector,” which can become integrated into the chromosomal DNA of the host cell.
  • vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as “expression vectors.”
  • Suitable vectors comprise plasmids, bacterial artificial chromosomes, yeast artificial chromosomes, viral vectors and the like.
  • regulatory elements such as promoters, enhancers, polyadenylation signals for use in controlling transcription can be derived from mammalian, microbial, viral or insect genes. The ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants may additionally be incorporated.
  • Plasmid vectors can be linearized for integration into a chromosomal location. Vectors can comprise sequences that direct site-specific integration into a defined location or restricted set of sites in the genome (e.g., AttP-AttB recombination). Additionally, vectors can comprise sequences derived from transposable elements.
  • IGF Insulin-like growth factor
  • IGF2 Insulin-like growth factor ligands IGF1 and IGF2 are involved in many cell signaling and developmental processes. IGF2 is one of the major embryonic growth factors in humans, with minimal expression in adults, transient bursts are localized to skeletal muscle cells transitioning through cell states. Further complexity in its regulation stems from its genomic imprinting, with IGF2 being one of the few proteins that are expressed only from the paternal copy. Its effects are differentially mediated by binding cell surface receptors: insulin receptor, insulin-like growth factor receptor 1 (IGF1R) and insulin-like growth factor receptor 2 (IGF2R). IGF1R activates many signaling including pathways involved in cell proliferation, cell differentiation, and cell survival. IGF2R is involved in attenuating the signaling response.
  • IGF1R insulin-like growth factor receptor 1
  • IGF2R insulin-like growth factor receptor 2
  • IGF2 polypeptides including IGF2 fusion polypeptides that promote in vivo stability and function of the IGF2 comprising polypeptides, or combinations of IGF2 or IGF2 fusion proteins with IGF binding proteins (IGFBP) such as IGFBP1, IGFBP2, IGFBP3, IGFBP4, IGFBP5, or IGFBP6.
  • IGFBP IGF binding proteins
  • IGF receptor ligand polypeptides In certain aspects described herein are IGF2 polypeptides. In certain aspects, described herein, are IGF2 polypeptides, that comprise an IGF2 amino acid sequence. In certain embodiments, the IGF2 amino acid sequence is that of a human IGF2 polypeptide. In certain embodiments, the human IGF2 polypeptide comprises amino acids 25 to 91 of SEQ ID NO. 32 (i.e. SEQ ID NO. 29). In certain embodiments, the IGF2 amino acid sequence is at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 29. In certain embodiments, the IGF2 amino acid sequence is 100% identical to SEQ ID NO. 29.
  • the IGF2 amino acid sequence comprises an amino acid sequence at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 29, but with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids deleted from the N- or C-terminus.
  • the IGF2 amino acid sequence is at least about 90%, 95%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 29 and 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids are deleted from the N- or C-terminus of the polypeptide.
  • the IGF2 fusion polypeptide amino acid sequence is at least about 90%, 95%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 32 and 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids are deleted from the N- or C-terminus of the polypeptide.
  • the IGF2 fusion polypeptide amino acid sequence is at least about 90%, 95%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 34 and 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids are deleted from the N- or C-terminus of the polypeptide. In certain embodiments, the IGF2 amino acid sequence is at least about 90%, 95%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 39 and 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids are deleted from the N- or C-terminus of the polypeptide.
  • IGF2 polypeptides described herein are fusion proteins or polypeptides that may comprise additional heterologous (non-IGF2) amino acid sequences that enhance the expression, stability or function of the IGF2 polypeptide compared to a polypeptide not comprising the heterologous amino acid sequence.
  • heterologous amino acid sequences may increase the expression of the IGF2 fusion polypeptide from a cell system (e.g., CHO cells or other suitable cell system for bulk production) by 10%, 20%, 25%, 30%, 40%, 50%, 75%, 100%, 150%, 200%, 200%, 400%, 500%, 1,000% or more compared to a polypeptide not comprising the heterologous amino acid sequence.
  • heterologous amino acid sequences may increase the bioavailability (e.g., increasing the T 1/2 ) of the IGF2 polypeptide in vivo by 10%, 20%, 25%, 30%, 40%, 50%, 75%, 100%, 150%, 200%, 200%, 400%, 500%, 1,000% or more compared to a polypeptide not comprising the heterologous amino acid sequence.
  • These heterologous amino acid sequences may increase the function (e.g., signaling through an IGF receptor) of the IGF2 polypeptide in vivo by 10%, 20%, 25%, 30%, 40%, 50%, 75%, 100%, 150%, 200%, 200%, 400%, 500%, 1,000% or more compared to a polypeptide not comprising the heterologous amino acid sequence.
  • IGF receptor ligand fusion polypeptides or polypeptides that comprise an amino acid sequence heterologous to IGF2.
  • the IGF receptor ligand fusion is to a heterologous amino acid sequence that promotes the stability or function of the IGF receptor ligand.
  • the IGF2 amino acid sequence of the IGF2-heterologous polypeptide fusion protein is at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 29.
  • the IGF2 amino acid sequence of the fusion protein is 100% identical to SEQ ID NO. 29.
  • the IGF2 amino acid sequence of the fusion protein is at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 33. In certain embodiments, the IGF2 amino acid sequence of the fusion protein is 100% identical to SEQ ID NO. 33. In certain embodiments, the IGF2 amino acid sequence of the fusion protein is at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 41. In certain embodiments, the IGF2 amino acid sequence of the fusion protein is 100% identical to SEQ ID NO. 41. Additional representative sequences can be found in the Table of Sequences at the end of this disclosure.
  • the fusion polypeptide may comprise a secretory signal peptide.
  • the secretory signal peptide is any well known mammalian secretory signal peptide.
  • Production of the fusion polypeptides herein in heterologous production systems e.g., bacteria or yeast
  • heterologous production systems e.g., bacteria or yeast
  • Processing of the secretory sequence or N- or C-terminal processing may result in loss of amino acids from either the N or the C terminus of the polypeptide.
  • Multimerizing components join two or more other protein components.
  • a multimerizing component may comprise a linker sequence of amino acids that joins other components that are identical or different into a single consecutive amino acid sequence. Suitable linkers include polypeptide linkers such as a Gly-Ser linker or spacer described herein.
  • a multimerizing component can take the form of proteins or protein domains that multimerize or dimerize, resulting in covalent disulfide linking (e.g., through the addition of one or more de novo cysteine residues) or non-covalent associations driving dimerization (e.g., a leucine zipper).
  • the multimerizing components may link or multimerize a plurality of IGF2 amino acid sequences.
  • the multimerizing components may link or multimerize two IGF2 amino acid sequences.
  • the two IGF2 amino acid sequences may be the same, or different, and selected from any of the IGF2 sequences described herein.
  • the multimerizing components may link or multimerize two, three, four, five or more IGF2 amino acid sequences.
  • the multimerizing components may link or multimerize an IGF2 amino acid sequence with another polypeptide that provides fusion promoting or proliferation promoting function or increased plasma half-life.
  • the IGF2 amino acid sequence may comprise functional fragments, mutated sequences, or modified polypeptides thereof.
  • the Table of Sequences lists some exemplary fragments, polypeptides and modified polypeptides.
  • the IGF2 sequence is N-, C-, or O-linked glycosylated.
  • the IGF2 sequence is glycosylated at one amino acid.
  • the IGF2 sequence is glycosylated at a site corresponding to Thr96, Thr99, or Thr163.
  • IGF family proteins are substrates for a number of proteases for processing during maturation and degrading intracellularly and extracellularly.
  • the M16A family zinc metalloprotease, known as Insulin Degrading Enzyme (IDE) have a high affinity ( ⁇ 100 nM) for IGF2 as a substrate, rapidly degrading it (Malito et al. Cell Mol Life Sci. 2008; 65:2574-85).
  • IDE Insulin Degrading Enzyme
  • mutations are specific to altering positively charged amino acids, such as arginine or lysine, to other amino acids.
  • the mutations are the arginine 61 or arginine 64, as SEQ ID NO. 35 or SEQ ID NO. 37.
  • the mutations alter the positively charged amino acids to other amino acids with lower molecular weights.
  • the mutations mutate the amino acid sequence into one or more alanines, as SEQ ID NO. 34 or SEQ ID NO. 36.
  • the IGF2 receptor ligand polypeptides and receptor ligand fusion polypeptides described herein may be encoded by nucleic acids to facilitate production of the receptor ligand polypeptide or fusion polypeptide.
  • nucleic acids can be compatible with bacterial, yeast, insect, or mammalian expression systems. They may comprise promoters/enhancers (either constructive or inducible), polyadenylation signals, selectable markers (such as antibiotic resistance), origins of replication or other accessory nucleic acid sequences.
  • IGF2 sequences can be used from many organisms.
  • the IGF2 sequence comprises a human IGF2 amino acid sequence.
  • the IGF2 sequence comprises a cat, dog or a horse IGF2 sequence.
  • the IGF2 sequence comprises a mouse, rat, rabbit, dog, cat, horse, cow, sheep, pig, goat, llama, alpaca, yak, or monkey sequence.
  • the IGF2 nucleic acid sequence is at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 17. In certain embodiments, the IGF2 nucleic acid sequence is 100% identical to SEQ ID NO. 17. In certain embodiments, the IGF2 nucleic acid sequence is at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 21. In certain embodiments, the IGF2 nucleic acid sequence is 100% identical to SEQ ID NO. 21. In certain embodiments, the IGF2 nucleic acid sequence is at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 23.
  • the IGF2 nucleic acid sequence is 100% identical to SEQ ID NO. 23. In certain embodiments, the IGF2 amino acid sequence is at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 32. In certain embodiments, the IGF2 amino acid sequence is 100% identical to SEQ ID NO. 32.
  • heterologous polypeptide that comprises part of the fusion proteins described herein may comprise, consist, or consist essentially of a fragment of an immunoglobulin molecule, an albumin molecule, a transferrin molecule, an XTEN sequence, a proline-alanine-serine polymer, a homo-amino acid polymer, a glycine-rich sequence, a gelatin-like polymer, an elastin-like peptide, a carboxy-terminal peptide, or combinations thereof.
  • the therapeutic polypeptide is IGF receptor ligand polypeptide or an IGF2 polypeptide.
  • the therapeutic polypeptide fused to a heterologous polypeptide amino acid sequence, either directly or through a linker, wherein the heterologous amino acid sequence imparts increased function or stability to the therapeutic polypeptide.
  • the heterologous peptide increases the stability or biological function of the therapeutic amino acid sequence.
  • the heterologous sequence may be fused to the therapeutic amino acid sequence at the C-terminus or at the N-terminus of the therapeutic amino acid sequence.
  • the therapeutic amino acid sequence is fused to a heterologous sequence at the N-terminus.
  • the therapeutic amino acid sequence is fused to a heterologous sequence at the C-terminus.
  • a flexible linker is used between the therapeutic amino acid sequence and the heterologous sequence at the N terminus.
  • a flexible linker is used between the therapeutic amino acid sequence and the heterologous sequence at the C terminus.
  • a spacer is used between the therapeutic amino acid sequence and the heterologous sequence at the N terminus.
  • a spacer is used between the therapeutic amino acid sequence and the heterologous sequence at the C terminus.
  • Heterologous peptides may be used to increase the stability or the biological function of the IGF2 amino acid sequence. Fusion proteins can be used to improve the pharmacokinetics of the biologically active molecules, such as by prolonging the half-life, as discussed in Strohl, “Fusion Proteins for Half-Life Extension of Biologics as a Strategy to Make Biobetters,” BioDrugs (2015) 29:215-239. Fusing a polypeptide to a molecule or a fragment of a molecule with a long half-life, such as an immunoglobulin, an albumin, or a transferrin increases the half-life of the polypeptide.
  • Fusion proteins can be used to improve the pharmacokinetics of the biologically active molecules, such as by prolonging the half-life, as discussed in Strohl, “Fusion Proteins for Half-Life Extension of Biologics as a Strategy to Make Biobetters,” BioDrugs (2015) 29:215-239. Fusing a polypeptide to a molecule or a fragment of a molecule
  • An XTEN sequence is a repeating amino acid polymer containing the amino acid residues A, E, G, P, S, and T which when fused to a peptide is capable of extending the half-lives of the peptides, while being otherwise inert. Fusing small repeating sequences such as proline-alanine-serine polymers (repeats of proline, alanine and serine), a homo-amino acid polymer sequence such as glycine-rich sequences (G-G-G-S), gelatin-like proteins, and elastin-like sequences (V-P-G-x-G, where x is any amino acid except proline) can also extend the half-life of a polypeptide.
  • proline-alanine-serine polymers peats of proline, alanine and serine
  • G-G-G-S homo-amino acid polymer sequence
  • gelatin-like proteins gelatin-like proteins
  • elastin-like sequences
  • the heterologous polypeptide comprises a fragment of an immunoglobulin molecule, an albumin molecule, a transferrin molecule, an XTEN sequence, a proline-alanine-serine polymer, a homo-amino acid polymer, a glycine-rich sequence, a gelatin-like polymer, an elastin-like peptide, a carboxy-terminal peptide, or combinations thereof.
  • heterologous peptides improving the pharmacokinetics of the biologically active molecule are genetically encoded to produce a fusion protein. In certain embodiments the heterologous peptides improving the pharmacokinetics of the biologically active molecule are covalently or non-covalently associated with the biologically active molecule post translationally. In certain embodiments, that non-covalent association may be driven by a genetically or covalent modified portion of the biologically active molecule.
  • Immunoglobulins are large effector molecules produced by the immune system. IgG immunoglobulins possess a plasma half-life of approximately 21 days. When an immunoglobulin fragment is fused to a second polypeptide, this can increase the half-life of the second polypeptide.
  • the fragment of the immunoglobulin molecule comprises the hinge domain of an IgG, the CH2 domain of an IgG, the CH3 domain of an IgG, or any combination thereof.
  • the fragment of the immunoglobulin molecule comprises the hinge domain of IgG1, the CH2 domain of IgG1, the CH3 domain of IgG1, or any combination thereof.
  • the fragment of the immunoglobulin molecule comprises the hinge domain of IgG4, the CH2 domain of IgG4, the CH3 domain of IgG4, or any combination thereof.
  • mutations of the immunoglobulin molecule or fragment may increase the half-life or stability of the immunoglobulin molecule or fragment.
  • the fragment of the immunoglobulin molecule comprises the hinge domain of IgG1, the CH2 domain of IgG1, the CH3 domain of IgG1, or any combination thereof with one or more of the following amino acid mutations in the immunoglobulin molecule: P329G, L234A and L235A.
  • the fragment of the immunoglobulin molecule comprises an IgG4 molecule.
  • the fragment of the immunoglobulin molecule comprises an IgG4 molecule with at least one of the following amino acid mutations in the immunoglobulin molecule: N434A, N434H, T307A/E380A/N434A, M252Y/S254T/T256E, 433K/434F/436H, T250Q, T250F, M428L, M428F, T250Q/M428L, N434S, V308W, V308Y, V308F, M252Y/M428L, D2591/V308F, M428L/V308F, Q311V/N434S, T307Q/N434A, E258F/V427T, S228P, L235E, S228P/L235E/R409K, S228P/L235E, K370Q, K370E, deletion of G446, deletion of K447, and combinations thereof of IgG
  • Secretory signal sequences are sequence motifs that target proteins to the secretory pathway in the cell. Secretory sequences may be cleaved from the protein to produce the mature, secreted protein.
  • the polypeptide comprises a secretory signal sequence.
  • the polypeptide comprises human IGF2 secretory sequence (SEQ ID NO 9, SEQ ID NO 11, SEQ ID NO 12).
  • the polypeptide comprises a secretory signal that is SEQ ID NO. 10, SEQ ID. NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, or SEQ ID NO. 16.
  • Linkers or spacers are short amino acid sequences that separate different domains in a single protein, or domains between fusion proteins.
  • linkers can either be rigid or flexible. Rigid linkers may prevent unwanted interactions between different domains. Proline-rich linkers tend to be more rigid, while glycine rich linkers tend to be more flexible. Flexible linkers may allow domains within a single protein to interact. Another use for flexible linkers is to covalently bond protein complexes and binding partners to generate stable protein complexes. Flexible linkers may also be used to promote dimerization. Linkers and spacers are reviewed in Chichili et al, Linkers in the Structural biology of protein-protein interactions, Protein Sci. February 2013. 22(2): 153-167.
  • the fusion polypeptides described herein may further comprise a linker or a spacer amino acid sequence that separate the therapeutics polypeptide and the heterologous polypeptide.
  • the linker or spacer is a peptide linker or spacer.
  • the linker or spacer is a flexible linker or spacer.
  • the linker is three alanines (AAA).
  • the peptide linker is a glycine-serine linker.
  • the linker is (in one-letter amino acid code): GGGGS (4GS) or multimers of the 4GS linker, such as repeats of 2, 3, 4, or 5 4GS linkers.
  • the glycine-serine linker comprises the amino acid sequence set forth in SEQ ID NO: 43 or 44, or 2, 3, 4, 5, or repeats of SEQ ID NO: 43 or 44.
  • the linker comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 amino acids derived from neither the polypeptide sequences in the Table of Sequences nor the heterologous polypeptide amino acid sequences of Table of Sequences.
  • the linker or spacers can be a single amino acid residue or greater in length.
  • the peptide linker is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 amino acids in length.
  • the peptide linker has at least one amino acid residue but is no more than 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acid residues in length.
  • composition comprising an IGF1R agonist and a short fatty acid chain.
  • IGF1R signaling activates downstream pathways including pathways involved in cell proliferation, cell differentiation, and cell survival.
  • the two IGF ligands, IGF1 and IGF2, activate IGF1R signaling.
  • Additional peptides that activate IGF1R signaling are INS.
  • Other agonists of IGF1R include, without limitations, demethylasterriquinone B1, Ginsenoside Rg5, and the human antimicrobial peptide LL-37.
  • the IGF1R agonist comprises an IGF1R agonistic antibody, an IGF polypeptide or a functional fragment thereof, IGF2 or a functional fragment thereof, insulin, demethylasterriquinone B1, Ginsenoside Rg5, LL-37, or combinations thereof.
  • These compositions comprise an unexpected synergistic effect and are useful for treating the muscle and/or soft-tissue conditions or disorders. This synergistic effect may also be promoted by methods comprising separate administration of an IGF1R agonist and a short fatty acid chain.
  • the IGF2R agonist is an IGF ligand. In certain embodiments, the IGF1R agonist is IGF2. In certain embodiments, the IGF2 polypeptide is at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 29. In certain embodiments, the IGF2 polypeptide is 100% identical to SEQ ID NO. 29. In certain embodiments, the IGF2 polypeptide is at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 33. In certain embodiments, the IGF2 polypeptide is 100% identical to SEQ ID NO. 33.
  • the IGF2 polypeptide is at least about 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO. 34. In certain embodiments, the IGF2 polypeptide is 100% identical to SEQ ID NO. 34.
  • the composition comprises an IGF1R agonist and a short fatty acid chain.
  • Short fatty acid chains include, without limitations, butyrates, a phenylbutyrate, valproic acid, propionic acid, methanoic acid, ethanoic acid, 2-methylpropanoic acid, 3-methylbutanoic acid, pentanoic acid, and a multimerized version thereof such as tributyrin.
  • Butyrates include, without limitations, butyric acids, sodium butyrate, methyl butyrate, ethyl butyrate, butyl butyrate, pentyl butyrate, or sodium butyrate.
  • the short chain fatty acid is a butyrate.
  • the butyrate is butyric acid. In some embodiments, the butyrate is sodium butyrate. In some embodiment, that short chain fatty acid is a phenylbutyrate, valproic acid, propionic acid, methanoic acid, ethanoic acid, 2-methylpropanoic acid, 3-methylbutanoic acid, pentanoic acid, or a multimerized version thereof such as tributyrin.
  • Also described herein are methods comprising administering an IGF1R agonist and a short fatty acid chain.
  • the administration can be in the same composition, separate formulations. When separate formulations are administered, they can be administered effectively simultaneously (e.g., during the same treatment) or separately with an interval of at least 1 hour, 12 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, or more.
  • the fusion polypeptides comprising an IGF ligand amino acid sequence and a heterologous polypeptide, compositions comprising an IGF1R agonist and a short fatty acid chain, and the methods described herein, are useful for treating diseases and disorders that involve soft-tissue injury, degradation, or destruction, or for use in treating an individual with an aging disorder, a muscle wasting disorder, a muscle injury, an injury to a connective tissue, or an injury to a non-muscle soft-tissue, or any combination thereof.
  • Aging disorders that result in the deterioration and loss of muscle tissue are such disorders.
  • Sarcopenia for example, is the degenerative loss of skeletal muscle mass quality, and strength and can be associated with aging. Injuries that result in acute muscle damage are other muscle disorders, which are treatable by the polypeptides, compositions and methods described herein.
  • the disorders include muscle ruptures, strains, and contusions. A rupture is a separating of the muscle tissues.
  • Muscle strains are contraction-induced injuries in which muscle fibers tear due to extensive mechanical stress, and can be classified as a grade I, II, or III.
  • Muscle contusions are muscle hematomas. Muscle injury can also be caused by non-mechanical stresses such as cachexia.
  • Cachexia may be caused by malnutrition, cancer, AIDS, coeliac disease, chronic obstructive pulmonary disease, multiple sclerosis, rheumatoid arthritis, congestive heart failure, tuberculosis, familial amyloid polyneuropathy, mercury poisoning (acrodynia), Crohn's disease, untreated/severe type 1 diabetes mellitus, anorexia nervosa, chemotherapy, muscular dystrophy or other genetic diseases which cause immobility, and hormonal deficiencies. Certain disorders that are weaknesses of specific muscles such as dysphagia or facioscapulohumeral muscular dystrophy may also be treated by the polypeptides described herein.
  • Additional soft-tissues disorders that may be treated using the polypeptides comprising an IGF ligand amino acid sequence and compositions comprising an IGF1R agonist and a short fatty acid chain described herein are those that inflict injury to the tendons, ligaments or cartilage.
  • the muscle wasting disease is a muscular dystrophy.
  • the muscular dystrophy comprises a myotonic muscular dystrophy, Duchenne muscular dystrophy, Becker muscular dystrophy, Limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital, muscular dystrophy, oculopharyngeal muscular dystrophy, or distal muscular dystrophy.
  • the muscular dystrophy is myotonic dystrophy.
  • the aging disorder is sarcopenia.
  • the muscle wasting disorder is cachexia.
  • the cachexia is a result of a cancer, AIDS, end stage kidney disease, or cardiovascular disease.
  • the injury is a muscle injury.
  • the muscle wasting is atrophy due to limb immobilization or disuse.
  • the muscle injury is a strain or a tear.
  • the muscle injury is a Grade III strain.
  • sarcopenia contributes to the incidence of the muscle injury.
  • the injury is ligament damage.
  • the ligament damage is a rupture or a tear.
  • the injury is tendon damage.
  • the tendon damage is a rupture or a tear.
  • the injury is cartilage damage.
  • compositions described herein are for use in a method of treating myositis.
  • the myositis comprises dermatomyositis, polymyositis, necrotizing myopathy (also called necrotizing autoimmune myopathy or immune-mediated necrotizing myopathy), juvenile myositis, or sporadic inclusion-body myositis.
  • the compositions described herein are for use in a method of treating cartilage related-disorders.
  • the cartilage related disorder may be due to tears, injuries, or wear.
  • the cartilage-associated disease may be osteoarthritis, osteochondritis dissecans, achondroplasia, or degenerative cartilage lesions.
  • compositions described herein are for use in a method of increasing proliferation or promoting survival of a cell associated with soft-tissue damage.
  • the polypeptides comprising an IGF ligand amino acid sequence and compositions comprising an IGF1R agonist and a short fatty acid chain described herein are useful in a method of increasing proliferation or promoting survival of any one or more of a muscle cell, a muscle precursor cell, a tenocyte, a tenocyte precursor cell, a chondrocyte, a chondrocyte precursor cell, a mesenchymal stem cell, or a fibroblast.
  • Muscle fibrosis is an excessive accumulation of extracellular matrix components, including collagen. Muscle fibrosis impairs muscle function, negatively affects muscle regeneration after injury, and increases muscle susceptibility to re-injury.
  • the compositions described herein are for use in a method of reducing muscle fibrosis.
  • the fibrosis is associated with aging, muscular dystrophy, or an injury.
  • the IGF ligand is IGF2.
  • the fusion polypeptides comprising an IGF ligand amino acid sequence and a heterologous polypeptide, compositions comprising an IGF1R agonist and a short fatty acid chain, and the methods described herein are for use in a method of increasing myoblast fusion.
  • the IGF ligand is IGF2.
  • the fusion polypeptides comprising an IGF ligand amino acid sequence and a heterologous polypeptide, compositions comprising an IGF1R agonist and a short fatty acid chain, and the methods described herein are for use in a method of increasing muscle mass.
  • muscle mass is increased by at least about 1%, 2.5%, 5%, 10%, 20%, 30%, 40%, 50% or more than 50%.
  • the IGF ligand is IGF2.
  • the fusion polypeptides comprising an IGF ligand amino acid sequence and a heterologous polypeptide, compositions comprising an IGF1R agonist and a short fatty acid chain, and the methods described herein are for use in a method of increasing grip strength.
  • grip strength is increased by at least about 1%, 2.5%, 5%, 10%, 20%, 30%, 40%, 50% or more than 50%.
  • the IGF ligand is IGF2.
  • the fusion polypeptides comprising an IGF ligand amino acid sequence and a heterologous polypeptide, compositions comprising an IGF1R agonist and a short fatty acid chain, and the methods described herein are for use in a method of increasing muscle endurance.
  • muscle endurance is increased by at least about 1%, 2.5%, 5%, 10%, 20%, 30%, 40%, 50% or more than 50%.
  • the IGF ligand is IGF2.
  • a method of treating an individual with a disorder comprising administering an IGF1R agonist and a short fatty acid chain to the individual.
  • the IGF1R agonist and the short fatty acid chain are administered in separate formulations.
  • the IGF1R agonist and the short fatty acid chain are administered simultaneously.
  • the IGF1R agonist and the short fatty acid chain are administered at different times.
  • a method of treating an individual with a disorder comprising administering a polypeptide comprising an IGF ligand amino acid sequence and a butyrate to the individual the disorder.
  • the polypeptide comprising the IGF ligand amino acid sequence and the butyrate are administered in separate formulations.
  • the polypeptide comprising the IGF ligand amino acid sequence and the butyrate are administered simultaneously.
  • the polypeptide comprising the IGF ligand amino acid sequence and the butyrate are administered at different times.
  • a method of treating an individual with a disorder comprising administering a polypeptide comprising an IGF2 amino acid sequence and a short fatty acid chain to the individual the disorder.
  • the polypeptide comprising the IGF ligand amino acid sequence and the short fatty acid chain are administered in separate formulations.
  • the polypeptide comprising the IGF2 amino acid sequence and the short fatty acid chain are administered simultaneously.
  • the polypeptide comprising the IGF2 amino acid sequence and the short fatty acid chain are administered at different times.
  • a method of treating an individual with a disorder comprising administering a polypeptide comprising an IGF2 amino acid sequence and a butyrate to the individual the disorder.
  • the polypeptide comprising the IGF2 amino acid sequence and the butyrate are administered in separate formulations.
  • the polypeptide comprising the IGF2 amino acid sequence and the butyrate are administered simultaneously.
  • the polypeptide comprising the IGF2 amino acid sequence and the butyrate are administered at different times.
  • the treatment can be administered by any suitable route such as, for example, subcutaneous, intravenous, or intramuscular.
  • the treatment is administered on a suitable dosage schedule, for example, weekly, twice weekly, monthly, twice monthly, once every three weeks, or once every four weeks.
  • the treatment can be administered in any therapeutically effective amount.
  • the therapeutically effective amount is about 0.001 mg/kg to about 1 mg/kg.
  • the therapeutically effective amount is about 0.001 mg/kg to about 0.002 mg/kg, about 0.001 mg/kg to about 0.005 mg/kg, about 0.001 mg/kg to about 0.01 mg/kg, about 0.001 mg/kg to about 0.02 mg/kg, about 0.001 mg/kg to about 0.05 mg/kg, about 0.001 mg/kg to about 0.1 mg/kg, about 0.001 mg/kg to about 0.2 mg/kg, about 0.001 mg/kg to about 0.5 mg/kg, about 0.001 mg/kg to about 1 mg/kg, about 0.002 mg/kg to about 0.005 mg/kg, about 0.002 mg/kg to about 0.01 mg/kg, about 0.002 mg/kg to about 0.02 mg/kg, about 0.002 mg/kg to about 0.05 mg/kg, about 0.002 mg/kg to about 0.1 mg/kg, about 0.002 mg/kg to about 0.2 mg/kg, about 0.002 mg/kg to about 0.5 mg/kg, about 0.001 mg/
  • the therapeutically effective amount is about 0.001 mg/kg, about 0.002 mg/kg, about 0.005 mg/kg, about 0.01 mg/kg, about 0.02 mg/kg, about 0.05 mg/kg, about 0.1 mg/kg, about 0.2 mg/kg, about 0.5 mg/kg, or about 1 mg/kg. In certain embodiments, the therapeutically effective amount is at least about 0.001 mg/kg, about 0.002 mg/kg, about 0.005 mg/kg, about 0.01 mg/kg, about 0.02 mg/kg, about 0.05 mg/kg, about 0.1 mg/kg, about 0.2 mg/kg, or about 0.5 mg/kg.
  • the therapeutically effective amount is at most about 0.002 mg/kg, about 0.005 mg/kg, about 0.01 mg/kg, about 0.02 mg/kg, about 0.05 mg/kg, about 0.1 mg/kg, about 0.2 mg/kg, about 0.5 mg/kg, or about 1 mg/kg. In certain embodiments, the therapeutically effective amount is about 0.1 mg/kg to about 50 mg/kg.
  • the therapeutically effective amount is about 0.1 mg/kg to about 0.2 mg/kg, about 0.1 mg/kg to about 0.5 mg/kg, about 0.1 mg/kg to about 1 mg/kg, about 0.1 mg/kg to about 2 mg/kg, about 0.1 mg/kg to about 5 mg/kg, about 0.1 mg/kg to about 10 mg/kg, about 0.1 mg/kg to about 20 mg/kg, about 0.1 mg/kg to about 50 mg/kg, about 0.2 mg/kg to about 0.5 mg/kg, about 0.2 mg/kg to about 1 mg/kg, about 0.2 mg/kg to about 2 mg/kg, about 0.2 mg/kg to about 5 mg/kg, about 0.2 mg/kg to about 10 mg/kg, about 0.2 mg/kg to about 20 mg/kg, about 0.2 mg/kg to about 50 mg/kg, about 0.5 mg/kg to about 1 mg/kg, about 0.5 mg/kg to about 2 mg/kg, about 0.5 mg/kg to about 5 mg/kg, about 0.2 mg/kg to about 10 mg/
  • the therapeutically effective amount is about 0.1 mg/kg, about 0.2 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 5 mg/kg, about 10 mg/kg, about 20 mg/kg, or about 50 mg/kg. In certain embodiments, the therapeutically effective amount is at least about 0.1 mg/kg, about 0.2 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 5 mg/kg, about 10 mg/kg, or about 20 mg/kg.
  • the therapeutically effective amount is at most about 0.2 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 5 mg/kg, about 10 mg/kg, about 20 mg/kg, or about 50 mg/kg.
  • the individual treated is a mammal.
  • the mammal is a mouse, rat, rabbit, dog, cat, horse, cow, sheep, pig, goat, llama, alpaca, or yak.
  • the individual is a dog, cat, or a horse.
  • the individual to be treated is a human.
  • Ther polypeptide comprising an IGF2 ligand amino acid sequence can be purified or synthesized in any suitable manner.
  • a nucleic acid encoding the polypeptide can be cloned into a suitable vector and expressed in a suitable cellular system.
  • the cellular system is a prokaryotic cell system.
  • the cellular system is a eukaryotic cell system.
  • the cellular system is a mammalian cell system.
  • the polypeptide may be expressed from Escherichia coli .
  • the polypeptide may be expressed from a yeast cell, including without limitations, Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces lactis, Hansenula polymorpha , or Yarrowia lipolytica .
  • the polypeptide may be expressed from a mouse myeloma cell, including without limitations, NS0, Sp2/0, and FO.
  • the polypeptide may be expressed from a chinese hamster ovary (CHO) cell.
  • the polypeptide may be expressed by a mammalian cell, including without limitations, a COS cell, a Vero cell, or a BHK cell.
  • the polypeptide may be expressed from a human cell, including without limitations a HeLa cell, a HEK-293 cell, a CAP cell, a CAP-T cell, a PER.C6® cell
  • the supernatants from such an expression system can be subjected to one or more purification steps involving centrifugation, ultracentrifugation, filtration, diafiltration, tangential-flow filtration, dialysis, chromatography (e.g., cation exchange, ion exchange, hydrophobic interaction, reverse phase, affinity, or size exclusion).
  • the polypeptides can be purified to an extent suitable for human administration. Additionally, polypeptides can be synthesized for inclusion in a formulation to be administered to a human individual. In certain embodiments, the polypeptides can be produced by a suitable peptide synthesis method, such as solid-phase synthesis.
  • the mammalian expression vector pmax Cloning is used to make C— In certain embodiments, the mammalian expression vector pmax Cloning is used to make C-terminally 6 ⁇ His-tagged, StrepII-tagged, and human IgG1 Fc-tagged vectors.
  • the DNA fragments encoding the secreted myogenic factors are amplified by PCR from human open reading frame (ORF) clones, and subsequently inserted into the tagged vectors by In-Fusion cloning technology (Takara Bio Inc.).
  • the expression vectors carrying the secreted myogenic factors are transiently transfected into ExpiCHO-S cells at a density of 6 ⁇ 10 6 per ml by using ExpiFectamine CHO transfection kit (Thermo Scientific).
  • the polypeptide comprises an Fc region.
  • a matrix or resin comprising Protein A, Protein G, protein L or any combination thereof can be used.
  • the matrix or resin may suitably be loaded onto a column for ease in batch purification.
  • the heterologous sequence may comprise an immunoglobulin or a fragment thereof.
  • the polypeptide may be purified by means of protein A, G, or L affinity.
  • Protein A and G are cell surface proteins found in Staphylococcus aureus . They have the property of binding the Fc region of a mammalian antibody, in particular of IgG class antibodies.
  • protein A or G affinity chromatography protein A or G is coupled to a solid matrix such as crosslinked, uncharged agarose (Sepharose, freed from charged fraction of natural agarose), trisacryl, crosslinked dextran or silica-based materials.
  • Protein A binds with high affinity and high specificity to the Fc portion of IgG, that is the C ⁇ 2-C ⁇ 3 interface region of IgG as described in Langone et al., 1982, supra. In particular, it binds strongly to the human allotypes or subclasses IgG1, IgG2, IgG3 and the mouse allotypes or subclasses IgG2a, IgG2b, IgG3.
  • the bound fraction can be eluted and passed over or through an additional resin or matrix comprising one or more ion exchange columns.
  • the first ion exchanger is generally an anion exchanger resin.
  • the pH of buffer used for loading and running the first ion exchanger is set as to put opposing total change on the Fc comprising fusion polypeptide and the protein A to be separated by means of the ion exchanger in a flow-through mode according to the present invention, taking the pI's of the Fc comprising fusion polypeptide and protein A into account.
  • the mode of operation of a first anion exchanger requires buffer exchange of the acidic or neutralized eluate from the protein A affinity chromatography step with the equilibrium buffer of the first anion exchanger.
  • the Fc comprising fusion polypeptide is ready for use in applications or may be deemed to require further polishing by customary purification methods.
  • the first ion exchange step is followed by a second ion exchange step in which second step the antibody is loaded and bound by the second ion exchange medium and is eluted with a buffer other than the loading buffer, by means of increased salt and/or pH, as an essentially monomeric, non-aggregated antibody.
  • At least 70%, 80%, or 90% of the Fc comprising fusion polypeptide loaded onto the first ion exchanger can be recovered in the flow-through of the ion-exchanger.
  • disregarding glycoforms and eventual processing variants of the same Fc comprising fusion polypeptide there is only one type of species of Fc comprising fusion polypeptide present in the mixture.
  • a master cell bank comprising a cell that comprises a nucleic acid encoding one or more IGF ligand or IGF2 fusion polypeptides integrated into its genome creating a transgenic cell-line.
  • the master cell bank comprises a plurality of cells that each comprise a nucleic acid encoding an IGF ligand or IGF2 fusion polypeptide.
  • the nucleic acid is maintained extrachromosomally on a plasmid or yeast artificial chromosome.
  • the nucleic acid is integrated into a chromosomal location.
  • the cell is a yeast cell.
  • the yeast is Pichia pastoris or Saccharomyces cerevisiae .
  • the cell is a mammalian cell.
  • the mammalian cell is a 293T cell or derivative thereof (e.g., 293T-Rex).
  • the cell is a bacterial cell.
  • the transgenic mammalian, yeast, or bacterial cell is a master cell bank that comprises a cryopreservative suitable for freezing to at least about ⁇ 80° or below.
  • the master cell bank comprises glycerol or DMSO at between about 10 and about 30%, and is suitable for long-term storage at about ⁇ 80° or below.
  • the master cell bank can preserve a transgenic mammalian, yeast, or bacterial strain for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more years.
  • the polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide described herein can be administered in a pharmaceutical composition that comprises one or more pharmaceutically acceptable excipients, carriers, or diluents.
  • the exact components can differ based upon the preferred route of administration.
  • the excipients used in a pharmaceutical composition can provide additional function to the polypeptide by making the polypeptide suitable for a particular route of administration (e.g., intravenous, topical, subcutaneous, or intramuscular), increasing polypeptide stability, increasing penetration of a desired tissue (e.g., muscle or skin), increasing residence time at particular site, increasing solubility, enhancing the efficacy of the polypeptide, and/or reducing inflammatory reactions coincident with administration.
  • the compositions are included in a pharmaceutical composition with a solubilizing emulsifying, or dispersing agent.
  • the solubilizing agent can allow high-concentration solutions of fusion polypeptides that exceed at least about 2 mg/mL, 5 mg/mL, 10 mg/mL, 15 mg/mL, or 20 mg/mL.
  • Carbomers in an aqueous pharmaceutical composition serve as emulsifying agents and viscosity modifying agents.
  • the pharmaceutically acceptable excipient comprises or consists of a carbomer.
  • the carbomer comprises or consists of carbomer 910, carbomer 934, carbomer 934P, carbomer 940, carbomer 941, carbomer 1342, or combinations thereof.
  • Cyclodextrins in an aqueous pharmaceutical composition serve as solubilizing and stabilizing agents.
  • the pharmaceutically acceptable excipient comprises or consists of a cyclodextrin.
  • the cyclodextrin comprises or consists of alpha cyclodextrin, beta cyclodextrin, gamma cyclodextrin, or combinations thereof.
  • Lecithin in a pharmaceutical composition may serve as a solubilizing agent.
  • the solubilizing agent comprises or consists of lecithin.
  • Poloxamers in a pharmaceutical composition serve as emulsifying agents, solubilizing agents, and dispersing agents.
  • the pharmaceutically acceptable excipient comprises or consists of a poloxamer.
  • the poloxamer comprises or consists of poloxamer 124, poloxamer 188, poloxamer 237, poloxamer 338, poloxamer 407, or combinations thereof.
  • Polyoxyethylene sorbitan fatty acid esters in a pharmaceutical composition serve as emulsifying agents, solubilizing agents, surfactants, and dispersing agents.
  • the pharmaceutically acceptable excipient comprises or consists of a polyoxyethylene sorbitan fatty acid ester.
  • the polyoxyethylene sorbitan fatty acid ester comprises or consists of polysorbate 20, polysorbate 21, polysorbate 40, polysorbate 60, polysorbate 61, polysorbate 65, polysorbate 80, polysorbate 81, polysorbate 85, polysorbate 120, or combinations thereof.
  • Polyoxyethylene stearates in a pharmaceutical composition serve as emulsifying agents, solubilizing agents, surfactants, and dispersing agents.
  • the pharmaceutically acceptable excipient comprises or consists of a polyoxyethylene stearate.
  • the polyoxyethylene stearate comprises or consists of polyoxyl 2 stearate, polyoxyl 4 stearate, polyoxyl 6 stearate, polyoxyl 8 stearate, polyoxyl 12 stearate, polyoxyl 20 stearate, polyoxyl 30 stearate, polyoxyl 40 stearate, polyoxyl 50 stearate, polyoxyl 100 stearate, polyoxyl 150 stearate, polyoxyl 4 distearate, polyoxyl 8 distearate, polyoxyl 12 distearate, polyoxyl 32 distearate, polyoxyl 150 distearate, or combinations thereof.
  • Sorbitan esters in a pharmaceutical composition serve as emulsifying agents, solubilizing agents, and non-ionic surfactants, and dispersing agents.
  • the pharmaceutically acceptable excipient comprises or consists of a sorbitan ester.
  • the sorbitan ester comprises or consists of sorbitan laurate, sorbitan oleate, sorbitan palmitate, sorbitan stearate, sorbitan trioleate, sorbitan sesquioleate, or combinations thereof.
  • solubility can be achieved with a protein carrier.
  • the protein carrier comprises recombinant human albumin.
  • the polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide described herein are formulated to increase stability.
  • Polypeptides in aqueous formulations may require stabilization to prevent degradation.
  • the stabilizer comprises pH buffers, salts, amino acids, polyols/disaccharides/polysaccharides, liposomes, surfactants, antioxidants, reducing agents, or chelating agents.
  • the stabilizer comprises or consists of a polyol/non-reducing sugar.
  • the non-reducing sugar comprises or consists of sucrose, mannitol, trehalose, raffinose, stachyose, xylitol, starch, verbascose, or combinations thereof.
  • Polypeptides can be encapsulated in liposomes to increase stability.
  • the stabilizer comprises or consists of liposomes.
  • the liposomes comprise or consists of ipalmitoylphosphatidylcholine (DPPC) liposomes, phosphatidylcholine:cholesterol (PC:Chol) (70:30) liposomes, or dipalmitoylphosphatidylcholine:dipalmitoylphosphatidylserine (DPPC:DPPS) liposomes (70:30).
  • DPPC phosphatidylcholine
  • PC:Chol dipalmitoylphosphatidylcholine:dipalmitoylphosphatidylserine
  • Non-ionic surfactants can increase the stability of a polypeptide.
  • the stabilizer comprises or consists of a non-ionic surfactant.
  • the non-ionic surfactant comprises or consists of polysorbates (e.g., poly sorbate 80, poly sorbate 20), alkylsaccharides alkyl ethers and alkyl glyceryl ethers, polyoxyethelene (4) lauryl ether; polyoxyethylene cetyl ethers, polyoxyethylene stearyl ethers, sorbitan fatty acid esters, polyoxyethylene fatty acid esters, or combinations thereof.
  • the polypeptide is formulated with a protein surfactant, such as recombinant human serum albumin as a stabilizer. Antioxidants or reducing agents can increase the stability of a polypeptide.
  • the stabilizer comprises or consists of an antioxidant or reducing agent.
  • the reducing agent comprises or consists of dithiothreitol, ethylenediaminetetraacetic acid, 2-Mercaptoethanol, Tris(2-carboxyethyl)phosphine hydrochloride, Tris(hydroxypropyl)phosphine, or combinations thereof.
  • the antioxidant comprises or consists of methionine, ascorbic acid, citric acid, alpha tocopherol, sodium bisulfite, ascorbyl palmitate, erythorbic acid, or combinations thereof. Chelating agents can stabilize polypeptides by reducing the activity of proteases.
  • the stabilizer comprises or consists of a chelating agent.
  • the chelating agent comprises or consists of ethylenediaminetetraacetic acid (EDTA), ethylene glycol-bis( ⁇ -aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), metal complexes (e.g. Zn-protein complexes), or combinations thereof.
  • Buffer agents can stabilize polypeptides by reducing the acid hydrolysis of polypeptides.
  • the stabilizer comprises or consists of a buffer agent.
  • the buffer agent comprises or consists sucrose octa-sulfate, ammonium carbonate, ammonium phosphate, boric acid, sodium citrate, potassium citrate, lactic acid, 3-(N-morpholino)propanesulfonic acid (MOPS), 2-(N-morpholino)ethanesulfonic acid (MES), hydroxymethylaminomethane (Tris), calcium carbonate, calcium phosphate or combinations thereof.
  • MOPS 3-(N-morpholino)propanesulfonic acid
  • MES 2-(N-morpholino)ethanesulfonic acid
  • Tris hydroxymethylaminomethane
  • polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide described herein also may be entrapped in or associated with microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization (for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively), in colloidal delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules), or in macroemulsions.
  • colloidal delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide described herein may be formulated or delivered with an anti-inflammatory agent.
  • the anti-inflammatory agent comprises or consists of a corticosteroid.
  • the corticosteroid comprises or consists of hydrocortisone, cortisone, ethamethasoneb (Celestone), prednisone (Prednisone Intensol), prednisolone (Orapred, Prelone), triamcinolone (Aristospan Intra-Articular, Aristospan Intralesional, Kenalog), methylprednisolone (Medrol, Depo-Medrol, Solu-Medrol), or dexamethasone (Dexamethasone Intensol).
  • the anti-inflammatory comprises or consists of a non-steroidal anti-inflammatory (NSAID).
  • the NSAID comprises or consists of aspirin, celecoxib, diclofenac, diflunisal, etodolac, ibuprofen, indomethacin, ketoprofen, ketorolac, nabumetone, naproxen, oxaprozin, piroxicam, salsalate, sulindac, or tolmetin.
  • the polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide described herein are included in a pharmaceutical composition suitable for intravenous administration comprising one or more pharmaceutically acceptable excipients, carriers, and diluents.
  • the polypeptides of the current disclosure are administered suspended in a sterile solution.
  • the solution is one commonly used for administration of biological formulations, and comprises, for example, about 0.9% NaCl or about 5% dextrose.
  • the solution further comprises one or more of: buffers, for example, acetate, citrate, histidine, succinate, phosphate, potassium phosphate, bicarbonate and hydroxymethylaminomethane (Tris); surfactants, for example, polysorbate 80 (Tween 80), polysorbate 20 (Tween 20), and poloxamer 188; polyol/disaccharide/polysaccharides, for example, glucose, dextrose, mannose, mannitol, sorbitol, sucrose, trehalose, and dextran 40; amino acids, for example, glycine, histidine, leucine, or arginine; antioxidants, for example, ascorbic acid, methionine; or chelating agents, for example, EDTA, or EGTA.
  • buffers for example, acetate, citrate, histidine, succinate, phosphate, potassium phosphate, bicarbonate and hydroxymethylaminomethane (Tris)
  • the polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide described herein are included in a pharmaceutical composition suitable for intramuscular or subcutaneous administration comprising one or more pharmaceutically acceptable excipients, carriers, and diluents.
  • a pharmaceutical composition suitable for intramuscular or subcutaneous injection can include physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions.
  • aqueous and non-aqueous carriers examples include ethanol, polyols (inositol, propyleneglycol, polyethylene-glycol, glycerol, cremophor and the like) and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate.
  • ethanol polyols (inositol, propyleneglycol, polyethylene-glycol, glycerol, cremophor and the like) and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate.
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity is maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • Formulations suitable for subcutaneous injection also contain optional additives
  • polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide described herein are formulated for topical administration as a cream, gel, paste, ointment, or emulsion.
  • Excipients in a cream, gel, paste, ointment, or emulsion can comprise gelatin, casein, lecithin, gum acacia, cholesterol, tragacanth, stearic acid, benzalkonium chloride, calcium stearate, glyceryl monostearate, cetostearyl alcohol, cetomacrogol emulsifying wax, sorbitan esters, polyoxyethylene alkyl ethers, polyoxyethylene castor oil derivatives, polyoxyethylene sorbitan fatty acid esters, polyethylene glycols, polyoxyethylene stearates, colloidol silicon dioxide, phosphates, sodium dodecyl sulfate, carboxymethylcellulose calcium, carboxymethylcellulose sodium, methylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose phthalate, noncrystalline cellulose, magnesium aluminum silicate, triethanolamine, polyvinyl alcohol, polyvinylpyrrolidone, sugars,
  • a highly concentrated fusion polypeptide(s) comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 20, 25, 40, 45, 50 or more milligrams per milliliter.
  • the polypeptides and/or compositions of the current disclosure are shipped/stored lyophilized and reconstituted before administration.
  • lyophilized ligand fusion polypeptide formulations comprise a bulking agent such as, mannitol, sorbitol, sucrose, trehalose, and dextran 40.
  • the lyophilized formulation can be contained in a vial comprised of glass.
  • the fusion polypeptides when formulated, whether reconstituted or not, can be buffered at a certain pH, generally less than 7.0.
  • the pH can be between 4.5 and 6.5, 4.5 and 6.0, 4.5 and 5.5, 4.5 and 5.0, or 5.0 and 6.0.
  • kits comprising one or more of the polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide described herein in a suitable container and one or more additional components selected from: instructions for use; a diluent, an excipient, a carrier, and a device for administration.
  • described herein is a method of preparing a soft tissue or muscle disease or disorder treatment comprising admixing one or more pharmaceutically acceptable excipients, carriers, or diluents and polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide described herein. In certain embodiments, described herein is a method of preparing a soft tissue or muscle disease or disorder treatment for storage or shipping comprising lyophilizing one or more antibodies of the current disclosure.
  • Mammalian expression plasmids carrying genes with different tags were transiently transfected into CHO cells. The genes were expressed to produce proteins that were subsequently secreted into the culture medium. The proteins in the culture medium were visualized on polyacrylamide gels and their activities were measured by in vitro functional assays. Then the recombinant proteins in the culture medium were affinity purified. The purified proteins were visualized on polyacrylamide gels to evaluate the purity and assayed by in vitro functional assays to determine their biological activities.
  • Mammalian expression vector pmax Cloning was used to make C-terminally 6 ⁇ His-tagged, StrepII-tagged, and human IgG1 and IgG4 Fc-tagged vectors.
  • the DNA fragments encoding the secreted myogenic factors were amplified by PCR from human open reading frame (ORF) clones, and subsequently inserted into the tagged vectors by In-Fusion cloning technology (Takara Bio Inc.).
  • the expression vectors carrying the secreted myogenic factors were transiently transfected into ExpiCHO-S cells at a density of 6 ⁇ 10 6 per ml by using ExpiFectamine CHO transfection kit (Thermo Scientific). After 18-22 hours, CHO feed and enhancer were added into the transfected culture. Then the expressed proteins were monitored by SDS-PAGE every 24 hours to achieve maximal expression level. In most of the cases, cell culture was collected at day 4, and cells were spun down. The supernatant was spun down again to get rid of cellular debris. The clarified culture supernatant containing the secreted myogenic factors was stored at ⁇ 80° C. or immediately processed for use.
  • Measuring expression level of secreted myogenic polypeptides To measure the improved expression level of the secreted myogenic factors, three protein analytical techniques were applied: sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), Western blotting, and enzyme-linked immunosorbent assay (ELISA). Western Blots were performed to identify the myogenic factors. ELISAs were used to measure the absolute amount of myogenic factors in the culture supernatant.
  • Isolation of engineered myogenic polypeptides The expressed myogenic factors with different tags in the culture supernatants were affinity-purified by using different purification media.
  • Fc-fusion factors either Protein A magnetic beads (GenScript) or Protein A membrane column (Takara Bio Inc.) were used to specifically bind to the Fc-fusion factors.
  • NTA-magnetics beads NAB were used to isolate the factor.
  • FIG. 1 A The suspension CHO cells were transiently transfected with the IGF2-hFcm encoding plasmid.
  • IGF2-hFcm was affinity-purified by Protein A membrane column.
  • the purified IGF2-hFcm was added into the culture of human myoblast cells for 96 hours.
  • Myosin heavy chain (MyHC) was immunostained and imaged by a fluorescence microscope.
  • FIG. 1 B The suspension CHO cells were transiently transfected with the IGF2-LhFc4 encoding plasmid.
  • IGF2-LhFc4 was affinity-purified by Protein A membrane column.
  • the purified IGF2-LhFc4 was added into the culture of human myoblast cells for 96 hours with daily media change.
  • Myosin heavy chain (MyHC) was immunostained and imaged by a fluorescence microscope.
  • FIG. 2 A The suspension CHO cells were transiently transfected with the HSA-L-IGF2R61A encoding plasmid.
  • HSA-L-IGF2R61A was affinity-purified by Protein A membrane column.
  • the purified HSA-L-IGF2R61A was added into the culture of human myoblast cells for 96 hours with daily media change.
  • Myosin heavy chain (MyHC) was immunostained and imaged by a fluorescence microscope.
  • FIG. 2 B Bar graph and quantitation table of IGF2 ( FIG. 2 B ) and IGF2 receptor ( FIG. 2 C ) RNASeq expression in young (17-21 year old caucasian males) and aged human myoblast (68-69 year old caucasian males) cell lines.
  • Mouse myoblasts were treated with PBS or sodium butyrate at concentrations 0.1 nM, 1 nM, and 10 nM. Myoblasts were cultured for 48 hours, with fresh media added every 24 hours. Cells were pulsed for 2-5 hours with EdU (30 uM), ethanol fixed, stained with Hoescht 3342, immunostained for proliferation—as measured by the percent of cells staining positive for EdU (% EdU)-, and immunostained for differentiation—as measured by the increase in cellular area staining positive for embryonic myosin heavy chain (% eMyHC) relative to the negative controls, which received media and vehicle only.
  • Human myoblast cells were treated with either PBS (vehicle), IGF2 (15 ng/mL), sodium butyrate, or IGF2 and sodium butyrate. Fresh media was added every 24 hours. After 96 hours, cells were pulsed for 2-5 hours with EdU (30 uM), ethanol fixed, stained with Hoescht 3342, immunostained for proliferation—as measured by the percent of cells staining positive for EdU (% EdU)-, and immunostained for differentiation—as measured by the increase in cellular area staining positive for embryonic myosin heavy chain (% eMyHC) relative to the negative controls, which received media and vehicle only. The total area of eMyHc positive cells was analyzed, and treated cells were compared to cells treated with the vehicle alone.
  • FIG. 3 B Bar graph of fusion index of mouse myoblast in response to sodium butyrate (NaBut) compared to vehicle.
  • Human myoblast cells were treated with either PBS (vehicle), IGF2 (15 ng/mL), sodium butyrate, or IGF2 and sodium butyrate. Fresh media was added every 24 hours. After 48 hours, cells were pulsed for 2-5 hours with EdU (30 uM), ethanol fixed, stained with Hoescht 3342, immunostained for proliferation 13 as measured by the percent of cells staining positive for EdU (% EdU)-, and immunostained for differentiation—as measured by the increase in cellular area staining positive for embryonic myosin heavy chain (% eMyHC) relative to the negative controls, which received media and vehicle only.
  • PBS vehicle
  • IGF2 15 ng/mL
  • sodium butyrate sodium butyrate
  • IGF2 and sodium butyrate Fresh media was added every 24 hours. After 48 hours, cells were pulsed for 2-5 hours with EdU (30 uM), ethanol fixed, stained with Hoescht 3342, immunostained for proliferation 13 as measured by the percent of cells staining positive
  • the total area of eMyHc positive cells was analyzed, and treated cells were compared to cells treated with the vehicle alone, as seen in FIG. 4 A .
  • Myoblasts that had been treated with either 0.03 ug/mL of IGF2 or with IGF2 in combination with sodium butyrate showed a significant increase in the eMyHC+ area when compared to cells cultured with the vehicle alone.
  • the myoblasts that had been treated with a combination of IGF2 and sodium butyrate were compared to the cells treated with IGF2 alone. There was a significant increase in all cells treated with the combination compared to cells treated with IGF2 alone, as depicted in FIG. 4 B and Table. Significance was determined by a p-value less than 0.05 by the one-way ANOVA Tukey Honest Significant Difference test.
  • FIG. 6 A Bar graph showing IGF2 receptors are expressed on cartilage-associated cells. Data is derived from Ramilowsky et al., Nature 2015.
  • RNA Expression Cell Type IGF2R Preadipocyte (Subcutaneous) 27.083 Chondrocyte 47.63 Osteocyte 83.96 Tenocyte 23.12
  • Example 11 IGF2 Treatment Promotes Proliferation and Fusion in DM1 Human Myoblast (32 Year Old Caucasian Female) Cells
  • FIG. 7 A Bar graph of % EdU+ human myoblast (32 year old caucasian female) and FIG. 7 B % area MyHC in response to IGF2.
  • Myoblast were cultured 72 h for proliferation and 96 h for fusion in the presence of indicated factor.
  • Example 12 IGF2 Enhances MYH3, CKM, and ATP1B1 Expression in DM1 Human Myoblast (32 Year Old Caucasian Female) Cells
  • FIG. 8 A Bar graph of MYH3 and CKM expression fold change in DM1 human myoblast (32 year old caucasian female) in response to indicated treatment compared to vehicle. Myoblasts were cultured 96 h in the presence of factors (IGF2 200 ng/mL). Mean ⁇ S.D. Significant p-values (MYH3: Vehicle ⁇ IGF2: 1.13E-03, CKM: Vehicle ⁇ IGF2: 7.67E-03)
  • FIG. 9 A Subcutaneous injection of IGF2(50 ug/kg) or NaB (1.2 g/kg), IGF2/NaB (150 ug/kg; 1.2 g/kg) or vehicle (PBS) were administered to 21-24M old mice for 14 days. Muscle function was assessed at days 13 and 14.
  • FIG. 10 A Subcutaneous injection of vehicle or IGF2/NaB were administered to 21M old mice for 14 days, blood and serum were collected to assess complete blood count and a metabolic panel for liver, kidney and pancreas function.
  • Example 15 Systemic Administration of IGF2/but Protects Against Dexamethasone Induced Muscle Atrophy
  • FIG. 11 D Grip strength force assessed at day 13, graphs showing FIG. 11 D ) forelimb force and FIG.
  • tissue progenitor cells Reduced regeneration from an individual's tissue progenitor cells is a hallmark of age or disease related dysfunction, therefore assays that measure mitogenic capacity in tissue progenitor cells serve as a read-out for potential success of a treatment. Measuring the increased proliferation rate, degree of differentiation, and cellular survival of treated mouse or human muscle progenitor cells will provide good basis for potentially therapeutic regenerative factors for treating individuals who have suffered illness, injury, or who possess genetic or developmental defects leading to premature tissue loss, wasting, or weakening.
  • Mouse muscle progenitor cells (early passage myoblasts) were cultured and expanded in mouse growth medium: Ham's F-10 (Gibco), 20% Bovine Growth Serum (Hyclone), 5 ng/mL FGF2 and 1% penicillin-streptomycin on Matrigel coated plates (1:300 matrigel: PBS), at 37° C. and 5% CO2.
  • mouse growth medium Ham's F-10 (Gibco)
  • Hyclone Bovine Growth Serum
  • FGF2 ng/mL FGF2
  • penicillin-streptomycin Matrigel coated plates (1:300 matrigel: PBS), at 37° C. and 5% CO2.
  • cells were plated at 40,000 cells/well on Matrigel coated 8-well chamber slides in 250-500 ⁇ L medium per well (1:100 matrigel: PBS) in mouse fusion medium: DMEM (Gibco)+2% horse serum (Hyclone).
  • mouse myoblasts were treated with 50% respective media: Mouse myoblasts were cultured for 24 hours in the above conditions, at 37° C. in 10% CO2 incubator. BrdU (300 ⁇ M) in DMSO was added for 2 hours prior to fixation with cold 70% ethanol and stored at 4° C. until staining.
  • Human muscle progenitor cells (early passage myoblasts) were cultured and expanded in growth medium: Ham's F-10 (Gibco), 20% Bovine Growth Serum (Hyclone), 5 ng/mL FGF2 and 1% penicillin-streptomycin on Matrigel coated plates (1:300 matrigel: PBS), at 37° C. and 5% CO2.
  • growth medium Ham's F-10 (Gibco)
  • Bovine Growth Serum Hyclone
  • FGF2 ng/mL FGF2
  • penicillin-streptomycin Matrigel coated plates (1:300 matrigel: PBS), at 37° C. and 5% CO2.
  • cells were plated at 40,000 cells/well on Matrigel coated 8-well chamber slides in 250-500 ⁇ L medium per well (1:100 matrigel: PBS) in human fusion medium: DMEM (Gibco)+2% horse serum (Hyclone).
  • Mouse myoblasts were cultured for 24 hours in the above conditions, at 37° C. in 10% CO2 incubator.
  • BrdU 300 ⁇ M
  • DMSO DMSO
  • Pax7, Myf5, Myod1, and Myog are key indicators of the functional status of muscle progenitor cells.
  • Factors upregulating of Pax7 and Myf5 indicate rejuvenation of proliferative progenitor cells whereas upregulation of Myod1 and Myog are indicative of muscle myofiber regeneration.
  • a read-out of these gene expressions will provide potential success for any given polypeptide comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide or combinations of an Insulin-like Growth Factor 1 Receptor (IGF1R) agonist and a short chain fatty acid described herein.
  • IGF1R Insulin-like Growth Factor 1 Receptor
  • Measuring myogenic genes in mouse or human muscle progenitor cells treated with factors will provide a good characterization of the therapeutic effect for treating individuals who have suffered injury, or who possess genetic or developmental defects leading to premature tissue loss, wasting, or weakening.
  • the assay will also be performed on proteins purified from differentiated cells, which result in no in myoblast proliferation, cultured in medium conditioned by differentiated cells, or purified heparin-associated fractions.
  • Aged human myoblasts were cultured in well plates. Culturing the cells with the different medias resulted in differential induction of myogenic gene expression. All factors resulted in changes in at least one myogenic receptor gene at 48 hours and 72 hours when compared to cells cultured in fusion media, as depicted in the Table below. Cells that had been cultured with IGF2 had increases in levels of MYOG at 48 hours and levels of MYOD at 72 hours.
  • Human or mouse muscle progenitor cells will be plated and cultured as described above for myogenic activity testing. One hour after plating, myoblasts will be treated with respective factors. Myoblasts are analyzed for expression of Pax7, Myf5, Myod1, and Myog to characterize the regenerative effect of treatment with polypeptides comprising an IGF2 amino acid sequence and will be tested to characterize the effects an amino acid sequence from a heterologous polypeptide or combinations of an Insulin-like Growth Factor 1 Receptor (IGF1R) agonist and a short chain fatty acid.
  • IGF1R Insulin-like Growth Factor 1 Receptor
  • This design will be used to test any single factor identified and validated in in vitro assays or polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide or combinations of an Insulin-like Growth Factor 1 Receptor (IGF1R) agonist and a short chain fatty acid.
  • IGF1R Insulin-like Growth Factor 1 Receptor
  • mice On Day 0, mice will be weighed and undergo muscle injury with focal injection of barium chloride (BaCl 2 , 10 ⁇ L, 1.2% w/v in saline, Sigma-Aldrich) in the Tibialis anterior (TA; Day 0) of both the right and left hindlegs. Injections of vehicle or factor A (0.1 mg/kg) will be co-administered intramuscularly (i.m) following the BaCl 2 into the TA injured hindleg sites, and again 48 hours later on day 2 (i.m.) into the TA injured hindleg sites.
  • barium chloride BaCl 2 , 10 ⁇ L, 1.2% w/v in saline, Sigma-Aldrich
  • BaCl 2 (Ctx; 10 ⁇ L, 1.2% w/v in saline, Sigma-Aldrich) was injected into the Gastrocnemius (GA, Day 2, i.m.) muscles of both right and left hind legs. Injections of vehicle or a factor will be sequentially administered (i.m.) following the BaCl2 into the TA hindleg sites post-injury, and again 48 hours later on day 4 (i.m.) into the GA injured hind leg sites. Bromodeoxyuridine (BrdU) will be administered (100 mg/kg, i.p.) once daily for 3 days, day 2-4, before sacrifice to label proliferating cells.
  • Muscle tissue composition from new skeletal muscle fibers, fibrotic tissue, and adipose (fat), will be measured.
  • Muscle regeneration as defined as the number of new myofibers with centrally located nuclei per millimeter, fibrosis as defined as the area of fibrotic scarring, size of the fibers, as defined as the width and area, adipose tissue, as defined by the amount of fat surrounding the muscle, will be measured to assess level of regeneration.
  • This design can be used to test any single factor identified and validated in in vitro assays or complex mixtures of 2 or more factors or synergistic small molecules.
  • mice On Day 0, mice will have the following in vivo healthspan measurements will be performed over 1 day as a baseline for age-based parameters: Weight, running wheel performance, grip strength, and horizontal bar. Each assay should be run for 4 trials per assay per animal. These healthspan assays will be repeated on day ⁇ 1. After one day of rest on day ⁇ 9, mice will begin 1 ⁇ daily injections (0.1 mg/kg) of vehicle or factor A for the remainder of the experiment until sacrifice (days ⁇ 8 to +5, 13 days of dosing). On day ⁇ 4, 6 days after dosing begins, mice will undergo a repeat of the healthspan assays.
  • mice will undergo muscle injury with focal injection of cardiotoxin (Ctx; 10 ⁇ g, Sigma-Aldrich) in the Tibialis anterior (TA; day 0) of the right hindleg only.
  • the Gastrocnemius (GA; day 2) muscle of the right hind leg will then receive cardiotoxin (Ctx; 10 ⁇ g, Sigma-Aldrich).
  • BrdU will be administered (100 mg/kg, i.p.) once daily for 3 days, day 2-4, before sacrifice.
  • the animals will have an in vivo incapacitance assay run. On day+5, animals will be sacrificed, and animal weight recorded.
  • Muscle tissue composition from new skeletal muscle fibers, fibrotic tissue, and adipose (fat), will be measured.
  • Muscle regeneration as defined as the number of number of new myofibers with centrally located nuclei per millimeter, fibrosis, as defined as the area of fibrotic scarring, size of the fibers, as defined as the width and area, adipose tissue, as defined by the amount of fat surrounding the muscle, will be measured to assess level of regeneration.
  • Weights of the animals during the duration of treatment, as well as healthspan assays including performance on a running wheel (speed, distance, duration), grip strength, and performance on a horizontal bar will take into account the phenotypic outcomes of treatment of the aged animals systemically with the polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide or combinations of an Insulin-like Growth Factor 1 Receptor (IGF1R) agonist and a short chain fatty acid.
  • IGF1R Insulin-like Growth Factor 1 Receptor
  • a 300-mm metal wire, 2 mm in diameter was secured between two posts 320 mm above a padded surface.
  • the mouse will be allowed to grip the center of the wire and the time to fall or reach the side was recorded, and after 2 minutes the test was stopped.
  • Crossing the bar in x seconds will be scored as 240-x, remaining on the bar will be scored as 120, and falling off the bar after y seconds will be recorded as the value of y.
  • the test will be repeated three times as a practice run followed by a 10-min rest prior to three tests where the score was recorded.
  • Animals will also have better healthspan outcomes: reduced weight, fat composition, scar tissue around muscles, increased running speed, duration, and distance, increased grip strength, and enhanced performance on the horizontal bar test.
  • mice Genetically obese (ob/ob) mice will be injected with BaCl2 on day 0 in the TA muscle. 3 mice will be treated with vehicle only, 3 mice will be injected with the hPSC factors and 3 mice will be treated with FGF19 (positive control) on day 0 and day 2. On day 5, the mice will be euthanized, the TA muscles perfused with PBS, and dissected. Muscles will be then analyzed for regenerative index and fibrotic index.
  • Forelimb and Both limb grip strength test After 30 min acclimation, the mice are introduced to the grip strength meter. For forelimb grip strength, the mice held by the tail are allowed to grasp the grip bar with only its forelimbs. For both limb measurements the mice are placed on the grid and allowed to grasp the grid with both limbs. The force generated by each mouse is calculated as the average of 5-6 measurements.
  • Limb endurance test Mice are allowed to discover and acclimate the rodent treadmill environment through 2 training sessions of 10 minutes each at 10 m/min on separate days prior to the endurance test. For the endurance test, mice are placed in the individual lanes of the rodent treadmill. The speed is gradually increased at 2 m/min until exhaustion is reached. Exhaustion is defined as a mouse staying on a grill electrified to deliver a shock of 2 Hz, intensity 5 for 3-5 seconds.
  • In vivo tetanic force measurement Mice are under anesthesia using regulated delivery of isoflurane during the whole process. Following anesthetization, the animal is placed onto a heated chamber with the foot secured on the foot pedal of an Aurora force transducer. The 2 electrodes are placed specifically to stimulate the sciatic nerve. The force generated by the ankle torsion of the animal's hind limb, as opposed to direct force is measured in response to a series of stimulation that includes 50, 100, 150 and 200 Hz.
  • In situ tetanic force measurement This experiment is performed using Aurora force measurement. Mice are under anesthesia during the whole process. A small incision in the skin around the Anterior Tibialis exposes the Achilles tendon which is connected via surgical suture to the Aurora force transducer through a hook. The force generated by the muscle in response to a series of stimulation that includes 50, 100, 150 and 200 Hz by 2 electrodes placed on the anterior tibialis is recorded.
  • the bioavailability of the therapeutic polypeptides will be assessed in the target tissues in young mice (10-12 weeks old) and old mice (78 weeks old).
  • 4 mice from each cohort will be euthanized after 30 minutes, 1 hour, 1.5 hours, 2 hours, or 4 hours.
  • blood will be collected by heart puncture followed by harvesting select tissues, such as the tibialis anterior, gastrocnemius, quadriceps, heart and diaphragm.
  • select tissues such as the tibialis anterior, gastrocnemius, quadriceps, heart and diaphragm.
  • the detection and quantitation of the administered therapeutic polypeptides will be detected by enzyme-linked immunosorbent assay (ELISA).
  • ELISA enzyme-linked immunosorbent assay
  • the level of therapeutic polypeptides will be compared to the samples collected from mice injected with vehicle to determine tissue level bioavailability.
  • Murine pharmacokinetics represents the absorption, distribution, metabolism, and elimination of drugs from the body.
  • the pharmacokinetic profile of the therapeutic polypeptides were determined in mice (10-12 weeks old). Mice were fed ad libitum and housed under controlled conditions of lighting (12-hour light/12-hour dark) and temperature (22-24° C.). Mice were allowed to acclimate for 3 days prior to the initiation of the experiment. Intravenous (IV) injection in 10-12 weeks old mice. Engineered mitogenic polypeptides concentrations in the samples were measured by ELISA. Various pharmacokinetics will be calculated as well as the absorption/elimination dynamics following different routes of administration.
  • FIG. 18 A Non-Compartment Analysis fit of pharmacodynamics data for intravenous administration of the HSA-IGF2R6 (Seq. ID 81) FIG. 18 A in mice which demonstrates significantly improved serum half-life compared to the natural sequence of IGF2 (Seq. ID 76) FIG. 18 B .
  • HSA-IGF2R61A demonstrated increased stability compared to IGF2 Molecule Half-life Dose HSA-IGF2R61A 20.81 hr 10 mg/kg IGF2 2.85 hr 600 ug/kg
  • Suspension CHO cells were transiently transfected with the IGF2-hFcm encoding plasmid. After four days, the culture supernatants were collected and IGF2-hFcm was affinity-purified by Protein A membrane column. The purified IGF2-hFcm was added into the culture of human myoblast cells. Myosin heavy chain (MyHC) was immunostained and imaged by a fluorescent microscope. After quantification of the stained MyHC, the percentage area of MyHC was calculated as the percent of pixels within the field that are illuminated above background in the stained channel.
  • MyHC Myosin heavy chain
  • the percentage of EdU of mouse myoblasts treated with the purified IGF2-hFcm is significantly higher than the percentage of EdU of mouse myoblasts treated with the culture supernatant of CHO cells expressing the empty control vector. Significance was determined by a p-value less than 0.05 by the one-way ANOVA Tukey Honest Significant Difference test.
  • the IGF2-fusion protein was able to induce cell proliferation.
  • the IGF2-fusion protein shares in vitro properties with the HAPs, which is suggestive of shared in vivo properties.
  • Example 21 Modelling Treatment of a Muscular Dystrophy with an IGF2 Composition In Vitro
  • Muscular dystrophies encompass a variety of muscular degeneration diseases typically due to genetic mutations in genes encoding proteins responsible for forming and stabilizing skeletal muscle. The phenotypic consequence of these genetic mutations is the progressive loss of muscle mass and strength over time, similar to sarcopenia but with different underlying causes. As HAPs provided phenotypic improvements on sarcopenic muscle, we tested for similar improvements in a model for MD.
  • IGF2 was tested individually for its ability to promote proliferation and/or fusion of human muscle progenitor cells from an individual with myotonic dystrophy type 1 (hMD)—a muscular dystrophy caused by mutations in the DMPK1 gene.
  • hMD myotonic dystrophy type 1
  • the effect of IGF2 on myogenic activity was assayed in biological triplicate across a range of concentrations centered around expected physiological levels by adding each factor to hMD myoblasts for 72 hours with daily media changes (DMEM+2% horse serum) and a second pulse of factors at the first media change.
  • FIGS. 1-10 show that cells were pulsed for 2-5 hours with EdU (30 uM), ethanol fixed, stained with Hoescht 3342, immunostained for proliferation—as measured by the percent of cells staining positive for EdU (% EdU)-, and immunostained for differentiation—as measured by the increase in cellular area staining positive for embryonic myosin heavy chain (% eMyHC) relative to the negative controls, which received media and vehicle only.
  • Wells were imaged on a Keyence BZ-100 at 4 ⁇ , the images quantified in Cell Profiler, and the statistics were computed in R. Additionally, RNA was extracted from myoblast and select transcript abundances quantified by qPCR.
  • FIGS. 7 A and 7 B depicts IGF2 treatment promoted proliferation and differentiation respectively in DM1 human myoblast (32 year old caucasian female) cells.
  • a daily subcutaneous injection of therapeutic polypeptides or vehicle only is administered to 78 week old mice for 14 days.
  • IGF2 is injected at a concentration of 100-1000 ⁇ g/kg.
  • treatment groups receive a single therapeutic factor while in other experiments, treatment groups receive a combination of factors.
  • muscle function is assessed using forelimb grip strength and both grip strength.
  • groups 1 and 2 are injected with BrdU intraperitoneally.
  • all mice are assessed for grip strength and an endurance test to determine max distance and max speed and tetanic force.
  • mice in groups 1 and 2 are euthanized and the muscles are analyzed for markers of proliferation and fibrosis.
  • an intramuscular injection of 1.2% of BaCl 2 (7 ul/TA) is used to generate chemical injury in the TAs of group 3 and group 4.
  • Mice from groups 3 and 4 continue to receive a therapeutic polypeptide injected subcutaneously on days 15-21. They also receive BrdU injections intraperitoneally on days 19, 20, and 21.
  • the TA muscles are tested for in situ tetanic force. The TA muscles are dissected and assessed for signs of proliferation and fibrosis.
  • mice 12-week-old mice are divided into 3 treatment groups: group 1 which receives injections only of the vehicle, group 2 which receives injections of dexamethasone, and group 3 which receives injections of dexamethasone and IGF2 fusion polypeptide.
  • Dexamethasone 25 mg/kg i.p.
  • IGF2 fusion polypeptide a subcutaneous injection of IGF2 fusion polypeptide.
  • mice are assessed for forelimb and both limb grip strength.
  • mice are assessed for grip strength, in vivo tetanic force, and undergo a treadmill endurance test to determine max speed and max distance.
  • mice Thirteen-week old genetically obese mice (ob ob) will be injected subcutaneously with an IGF2 fusion polypeptide for 14 days. At day 7, forelimb and both grip strength will be measured. BrdU is injected on days 12, 13 and 14. On days 13, 14 and 15, forelimb and both limb grip strength and in vivo tetanic force will be tested, and an endurance test to determine max distance and max speed is performed. At 14 days, the mice will be euthanized, and the TA muscles dissected. Muscle weight and proliferation will be analyzed.
  • Another class of human myopathies in need of treatment are the genetic abnormality induced muscular dystrophies, among which Duchenne muscular dystrophy is a rare but fatal case.
  • Old genetically dystrophic (mdx) mice (>15 month old) show similar features to the human Duchenne muscular dystrophy (DMD), notably, a decrease in muscle regeneration leading to muscle wasting.
  • IGF2 fusion polypeptide can reverse the dystrophic features of old mdx mice.
  • the weight, Forelimb and both limb grip strength as well as in vivo tetanic force will be assessed to determine the baseline strength of each mouse.
  • mice 70 week dystrophic mice (mdx) are injected with the IGF2 fusion polypeptide subcutaneously for 14 days. At day 7, forelimb and both grip strength are measured. BrdU is injected on days 12, 13 and 14. On days 13, 14, and 15, forelimb and both limb grip strength and in vivo tetanic force are tested, and an endurance test to determine max distance and max speed is performed. The right tibialis anterior and gastrocnemius will be collected, immersed in Tissue-TEK OCT and then flash frozen in chilled isopentane bath precooled in liquid nitrogen and stored at ⁇ 80° C.
  • Tissue will be sectioned and stained for Laminin to determine the cross sectional area (CSA) of muscle fibers, for eMyHC to measure new fiber formation and for BrdU to assess the proliferation rate.
  • the left anterior tibialis and gastrocnemius will be collected and flash frozen in liquid nitrogen for molecular analysis that include qPCR and western blot.
  • IGF2 is predicted to be effective at a concentration of 10-200 ug/kg.
  • mice undergoes severe necrosis followed by an increase in the activation of satellite cells to promote muscle regeneration.
  • Treatment with IGF2 fusion polypeptide described herein can improve the regeneration process and therefore muscle health.
  • Mice were fed ad libitum and housed under controlled conditions of lighting (12-hour light/12-hour dark) and temperature (22-24° C.). Mice were allowed to acclimate for 3 days prior to the initiation of the experiment. During the acclimation period, the weight, forelimb and both limb grip strength as well as in vivo tetanic force were assessed to determine the baseline strength of each mouse.
  • mice 10 week old dystrophic mice (mdx) were injected with the IGF2 fusion polypeptide with sodium butyrate subcutaneously for 14 days. At day 7, forelimb and both grip strength are measured as described in Example 4. BrdU was injected on days 12, 13 and 14. On days 13, 14 and 15, forelimb and both limb grip strength and in vivo tetanic force were tested, and an endurance test to determine max distance and max speed was performed using methods described in Example 4.
  • mice were euthanized.
  • the right tibialis anterior and gastrocnemius were collected, immersed in Tissue-TEK OCT and then flash frozen in a chilled isopentane bath precooled in liquid nitrogen and stored at ⁇ 80° C.
  • Tissue was sectioned and stained for Laminin to determine the cross sectional area (CSA) of muscle fibers, for eMyHC to measure new fiber formation and for BrdU to assess the proliferation rate.
  • the left anterior tibialis and gastrocnemius were collected and flash frozen in liquid nitrogen for molecular analysis that include qPCR and western blot.
  • the amino acid backbone of IGF2 is cleaved when expressed from Chinese Hamster Ovary (CHO) cells ( FIG. 13 A ) as visualized on a reducing SDS-PAGE and Western blot ( FIG. 13 B ).
  • the CHO cells were grown in a 37° C. incubator with a humidified atmosphere of 8% CO2 on an orbital shaker platform with a shaking speed 125 rpm to reach 4E6 cells/mL, followed by transferring the calculated volume of cells to fresh, pre-warmed ExpiCHOTM Expression Medium in a shake flask. Incubated flasks in a 37° C.
  • IGF2 The cleavage of IGF2 was confirmed by expression of a construct a of double tagged IGF2, n-terminus tagged with human serum albumin, HSA, and c-terminus tagged with human immunoglobulin heavy chain 4, hFc4, FIG. 14 .
  • the sequence of IGF2 was engineered to prevent cleavage by mutation one or more arginines as confirmed by visualization on a reducing SDS-PAGE followed by Western blotting to detect 6 ⁇ HIS tag FIG. 15 B in and in following purification with mini Protein A columns as visualized on a reducing SDS-PAGE FIG. 15 A .
  • IGF2 will bind IGF binding proteins (IGFBPs).
  • IGFBPs IGF binding proteins
  • the purpose of this study was to determine if mutant sequences of IGF2 interact with IGFBPs. Retention time across a size exclusions chromatography column is proportional to the size of the molecule. Thus molecular interactions can be ascertained by a corresponding change in retention time on a size exclusions chromatography column. Measuring the retention of HSA-IGF2R61A and rhIGFBP3 separately and as a 1:1 stoichiometric mixture demonstrated evidence of preserved affinity as demonstrated by mass shifts in size exclusion chromatography by HPLC ( FIG. 19 ).
  • the purpose of this study is to determine the safety, tolerability, and pharmacokinetics of repeat dosing with multiple dose levels of polypeptides comprising an IGF2 amino acid sequence and an amino acid sequence from a heterologous polypeptide in healthy individuals or individuals diagnosed with sarcopenia, a muscular dystrophy, or recovery from surgery.
  • the muscular dystrophy is myotonic dystrophy.
  • this study will generate data on the physical function, skeletal muscle mass and strength resulting from treatment with IGF2 fusion polypeptides in such individuals. Individuals will be administered placebo or IGF2 fusion polypeptide compositions and monitored for 25 weeks of study. The following primary and secondary outcome measures will be assessed:
  • Plasma Pharmacokinetics (Cmax, Tmax, AUC) [Plasma at 0.5, 1, 1.5, 2, 4, 6, 8, 12 and 24 hrs after dosing.]
  • SPPB Short Physical Performance Battery
  • Patients will be i.v-administered placebo (5% dextrose solution) or treatment article (in 5% dextrose). Starting on day 1, week 1 and repeated every week (day one of weeks 1 through 25). At the end of week 13 and 25 patients will be assessed by the above methods for improvement. Doses will be selected from a traditional 3+3 design, and selected as the top two-doses that lack dose-limiting toxicity.
  • Example 30 administering 6HIS-HSA-L-IGF2R61A Enhances Myogenic Activation, Fusion and Maturation in an Acute Injury Model
  • Example 18 The acute injury model of Example 18 was used. Brown female C57/BL6 (NIA) mice (20 months of age) were injected intramuscularly (IM) in each tibialis anterior with cardiotoxin at day one (10 ug/20 uL) and from day two the mice were given IM injections every other day with 0.4 ug/20 uL of 6HIS-HSA-IGF2R61A (SEQ ID NO: 34) or vehicle (0.4 ug/20 uL of HSA).
  • IM intramuscularly
  • mice receiving 6HIS-HSA-IGF2R61A showed reduced muscle fatigue compared to control treatment (vehicle) as measured by specific fatigue index. These results are shown in FIG. 21 A . Mice receiving the 6HIS-HSA-IGF2R61A showed increased force production relative to control treatment (vehicle) as measured by specific force-frequency. These results are shown in FIG. 21 B . Mice receiving 6HIS-HSA-IGF2R61A showed increased force production comparted to control treatment (vehicle) as measured by max contraction rate index. These results are shown in FIG. 21 C . Mice receiving 6HIS-HSA-IGF2R61A showed improved relation rates relative to control treatment (vehicle) index. These results are shown in FIG. 21 D .
  • mice receiving 6HIS-HSA-IGF2R61A showed increased regenerative index compared to control treatment (vehicle) as measured by number of new fibers per square millimeter. These results are shown in FIG. 21 E . Mice receiving 6HIS-HSA-IGF2R61A showed increased muscle mass relative to control treated (vehicle) mice. These results are shown in FIG. 21 F .
  • Example 31 administering 6HIS-HSA-L-IGF2R61A and Sodium Butyrate Preserved Muscle Function and Fiber Size in a Sarcopenia Model
  • Example 18 The sarcopenia model of Example 18 was used. Brown male C57/BL6 (NIA) mice (83-86 weeks of age) were injected every other day with 6 mg/kg of 6HIS-HSA-IGF2R61A (SEQ ID NO: 34) and 0.3 g/kg of sodium butyrate (NaB), or vehicle for 4 weeks to measure muscle regeneration and functional changes.
  • NIA Brown male C57/BL6 mice
  • 6HIS-HSA-IGF2R61A SEQ ID NO: 34
  • NaB sodium butyrate
  • Limb Grip strength was measured in both groups and normalized by body weight within each mouse to determine specific force generation.
  • Treatment with 6HIS-HSA-IGF2R61A and NaB increased specific force generation relative to mice treated with control (vehicle).
  • FIG. 22 B Forelimb Grip strength was measured in both groups and normalized by body weight within each mouse to determine specific force generation.
  • Treatment with 6HIS-HSA-IGF2R61A and NaB increased specific force generation relative to mice treated with control (vehicle). These results are shown in FIG. 22 C . Recovery of muscle force production was measured in both groups.
  • Example 32 administering 6HIS-HSA-L-IGF2R61A and Sodium Butyrate Preserved Muscle Function and Fiber Size in a Sarcopenia Model
  • Example 18 The sarcopenia model of Example 18 was used. Brown male C57/BL6 (NIA) mice (23 months of age) were injected daily with 6 mg/kg of HSA-IGF2R61A (SEQ ID NO: 34) and 0.3 g/kg of sodium butyrate(NaB), or vehicle for 2 weeks to measure muscle regeneration and functional changes.
  • NIA Brown male C57/BL6 mice
  • HSA-IGF2R61A SEQ ID NO: 34
  • NaB sodium butyrate
  • the fiber type distribution was measured in both groups.
  • the fiber type 2A was lower and type 2B higher in the 6HIS-HSA-IGF2R61A and NaB treated mice compared to the mice treated with control (vehicle). These results are shown in FIG. 23 A .
  • the cross-sectional areas (CSA) were measured and plotted by group.
  • the mice treated with 6HIS-HSA-IGF2R61A and NaB showed an increase in muscle tissue with larger CSA values compared to mice treated with control (vehicle). These results are shown in FIG. 23 B .
  • Example 33 administering 6HIS-HSA-L-IGF2R61A and Sodium Butyrate Restored Muscle Function, Fiber Size, and Fiber Composition in a Myotonic Dystrophy (DM1) Mouse Model
  • mice Brown male TRED960I(+/+)/M2rtTA(+/ ⁇ ) mice were fed doxycycline chow from birth, and muscle wasting phenotype was observed by weeks 12-14. Mice were injected daily with 6 mg/kg of 6HIS-HSA-IGF2R61A (SEQ ID NO: 34) and 0.3 g/kg of sodium butyrate(NaB) or vehicle for 2 weeks to measure muscle regeneration and functional changes, and post-mortem histology analysis.
  • 6HIS-HSA-IGF2R61A SEQ ID NO: 34
  • NaB sodium butyrate
  • the fiber type distribution was measured in both groups.
  • the fiber types 2A and 2B were significantly different (P-value ⁇ 0.05) in the two groups with 2A being decreased and 2B increased in mice treated with 6HIS-HSA-IGF2R61A and NaB compared to mice treated with control (vehicle). These results are shown in FIG. 24 A .
  • the cross-sectional areas (CSA) were measured and plotted by group. The mice treated with 6HIS-HSA-IGF2R61A and NaB showed an increase in muscle tissue with larger CSA values compared to mice treated with control (vehicle). These results are shown in FIG. 24 B .
  • Sequence 1 spFGF-17 Human FGF-17 ATGGGAGCCGCCCGCCTGCTGCCCAACCTCACTCTGTGCTTA secretory signal CAGCTGCTGATTCTCTGCTGTCAA peptide nucleotide sequence 2 spTHBSI Human THBS1 ATGGGGCTGGCCTGGGGACTAGGCGTCCTGTTCCTGATGCAT secretory signal GTGTGTGGCACC peptide nucleotide sequence 3 spIGF-2 Human IGF-2 ATGGGAATCCCAATGGGGAAGTCGATGCTGGTGCTTCTCACC secretory signal TTCTTGGCCTTCGCCTCGTGCTGCATTGCT peptide nucleotide sequence 4 spBMP-7 Human BMP-7 ATGCACGTGCGCTCACTGCGAGCTGCGGCGCCGCACAGCTT secretory signal CGTGGCGCTCTGGGCACCCCTGTTCCTGCTGCGCTCCGCCCT peptide GGCC nucleotide sequence 5 spBMP-7 Human BMP-7 ATGCACGT

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Diabetes (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • Endocrinology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Neurology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Dermatology (AREA)
  • Biomedical Technology (AREA)
  • Emergency Medicine (AREA)
  • Child & Adolescent Psychology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
US17/837,920 2021-06-21 2022-06-10 Heparin-Associated Polypeptides and Uses Thereof Pending US20220409696A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/837,920 US20220409696A1 (en) 2021-06-21 2022-06-10 Heparin-Associated Polypeptides and Uses Thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163259088P 2021-06-21 2021-06-21
US17/837,920 US20220409696A1 (en) 2021-06-21 2022-06-10 Heparin-Associated Polypeptides and Uses Thereof

Publications (1)

Publication Number Publication Date
US20220409696A1 true US20220409696A1 (en) 2022-12-29

Family

ID=84543438

Family Applications (2)

Application Number Title Priority Date Filing Date
US17/837,920 Pending US20220409696A1 (en) 2021-06-21 2022-06-10 Heparin-Associated Polypeptides and Uses Thereof
US18/662,443 Active US12329801B2 (en) 2021-06-21 2024-05-13 Regenerative polypeptides and uses thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
US18/662,443 Active US12329801B2 (en) 2021-06-21 2024-05-13 Regenerative polypeptides and uses thereof

Country Status (10)

Country Link
US (2) US20220409696A1 (https=)
EP (1) EP4359425A4 (https=)
JP (1) JP2024525213A (https=)
KR (1) KR20240029031A (https=)
CN (1) CN117999278A (https=)
AU (1) AU2022298470A1 (https=)
CA (1) CA3223707A1 (https=)
IL (1) IL309562A (https=)
MX (1) MX2024000233A (https=)
WO (1) WO2022271466A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12329801B2 (en) 2021-06-21 2025-06-17 Juvena Therapeutics, Inc. Regenerative polypeptides and uses thereof
US12358963B2 (en) 2019-12-24 2025-07-15 Juvena Therapeutics, Inc. Regenerative polypeptides and uses thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025054521A1 (en) * 2023-09-07 2025-03-13 Juvena Therapeutics, Inc. Igf2 fusion protein formulations and therapeutic uses thereof

Family Cites Families (61)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1985000831A1 (en) 1983-08-10 1985-02-28 Amgen Microbial expression of insulin-like growth factor
EP0394827A1 (en) 1989-04-26 1990-10-31 F. Hoffmann-La Roche Ag Chimaeric CD4-immunoglobulin polypeptides
US5155038A (en) 1990-02-22 1992-10-13 W. R. Grace & Co.-Conn. Use of thrombospondin to promote wound healing
WO1991014438A1 (en) 1990-03-20 1991-10-03 The Trustees Of Columbia University In The City Of New York Chimeric antibodies with receptor binding ligands in place of their constant region
US5061620A (en) 1990-03-30 1991-10-29 Systemix, Inc. Human hematopoietic stem cell
SE9101840L (sv) 1991-06-14 1992-12-15 Kabi Pharmacia Ny medicinsk anvaendning
AU2368892A (en) 1991-07-29 1993-03-02 British Bio-Technology Limited Igf-ii analogues
FR2686899B1 (fr) 1992-01-31 1995-09-01 Rhone Poulenc Rorer Sa Nouveaux polypeptides biologiquement actifs, leur preparation et compositions pharmaceutiques les contenant.
DK0661990T3 (da) 1992-08-26 2002-06-17 Celtrix Pharma Fremgangsmåde til systemisk behandling af kataboliske tilstande og systemisk vævsbeskadigelse
US5843780A (en) 1995-01-20 1998-12-01 Wisconsin Alumni Research Foundation Primate embryonic stem cells
US5622932A (en) 1995-05-05 1997-04-22 Eli Lilly And Company IGF-1 superagonists
GB9608130D0 (en) 1996-04-19 1996-06-26 Univ Sheffield Adam proteins and uses thereof
EP2213743A1 (en) 2000-04-12 2010-08-04 Human Genome Sciences, Inc. Albumin fusion proteins
TWI233361B (en) 2001-04-13 2005-06-01 Gen Hospital Corp Methods of preventing UVB-induced skin damage
US20030072761A1 (en) 2001-10-16 2003-04-17 Lebowitz Jonathan Methods and compositions for targeting proteins across the blood brain barrier
CN101172091B (zh) 2007-09-25 2011-04-27 北京美福源生物医药科技有限公司 含人血清白蛋白与皮肤细胞生长因子的融合蛋白护肤产品制备工艺和用途
US7355018B2 (en) 2003-09-30 2008-04-08 Regeneron Pharmaceuticals, Inc. Modified IGF1 polypeptides with increased stability and potency
US7837993B2 (en) 2004-03-19 2010-11-23 The Board Of Trustees Of The Leland Stanford Junior University Methods and compositions for regeneration of aged skeletal muscle tissues
JP4988599B2 (ja) 2005-01-07 2012-08-01 リジェネロン・ファーマシューティカルズ・インコーポレイテッド Ｉｇｆ−１融合ポリペプチドおよびその治療的使用
DE602006017071D1 (de) 2005-01-25 2010-11-04 Five Prime Therapeutics Inc Zusammensetzungen und verfahren zur behandlung von herzkrankheiten
US7521211B2 (en) 2005-04-05 2009-04-21 Regeneron Pharmaceuticals, Inc IGF-1 and IGF-2 chimeric polypeptides and therapeutic uses thereof
WO2007146038A2 (en) * 2006-06-07 2007-12-21 Human Genome Sciences, Inc. Albumin fusion proteins
US9226965B2 (en) 2007-10-05 2016-01-05 U.S. Department Of Veterans Affairs Method and composition for treating heart failure
JP5627571B2 (ja) 2008-05-07 2014-11-19 バイオマリン ファーマシューティカル インコーポレイテッド リソソーム標的化ペプチドおよびその使用
KR20100119437A (ko) 2009-04-30 2010-11-09 충북대학교 산학협력단 인슐린 유사 성장 인자 ⅱ를 이용하여 세포 분화를 조절하는 방법
WO2011028952A1 (en) * 2009-09-02 2011-03-10 Xencor, Inc. Compositions and methods for simultaneous bivalent and monovalent co-engagement of antigens
PT3103469T (pt) 2010-06-25 2021-03-04 Shire Human Genetic Therapies Administração de agentes terapêuticos no snc
WO2012037687A1 (en) 2010-09-23 2012-03-29 Angiochem Inc. Therapeutic polypeptides and uses thereof
WO2012140650A2 (en) 2011-04-12 2012-10-18 Hepacore Ltd. Conjugates of carboxy polysaccharides with fibroblast growth factors and variants thereof
CN110947002A (zh) 2012-05-01 2020-04-03 约翰霍普金斯大学 治疗或预防骨关节炎的组合物和方法
EP2851429B1 (en) 2012-05-18 2019-07-24 Adda Biotech Inc. Protein and protein conjugate for diabetes treatment, and applications thereof
WO2014082080A2 (en) 2012-11-26 2014-05-30 Callidus Biopharma, Inc. Methods for coupling targeting peptides onto recombinant lysosomal enzymes for improved treatments of lysosomal storage diseases
ES2729997T3 (es) 2012-11-27 2019-11-07 Biomarin Pharm Inc Proteínas de fusión terapéuticas dirigidas de enzima lisosómica y usos de las mismas
PL2935320T3 (pl) 2012-12-18 2020-03-31 Novartis Ag Stabilizowane polipeptydy insulinopodobnego czynnika wzrostu
US9605084B2 (en) * 2013-03-15 2017-03-28 Xencor, Inc. Heterodimeric proteins
WO2014152440A2 (en) 2013-03-15 2014-09-25 Trustees Of Boston University Polymorphism of thrombospondin-1 as a biomarker for susceptibility to dry eye
US9758763B2 (en) 2013-05-29 2017-09-12 The Regents Of The University Of California Methods and compositions for somatic cell proliferation and viability
US20160271265A1 (en) 2013-10-02 2016-09-22 Novartis Ag Insulin-like growth factor mimetics for use in therapy
US10265372B2 (en) 2014-08-12 2019-04-23 The Regents Of The University Of California Molecular composition for enhancing and rejuvenating maintenance and repair of mammalian tissues
CA2964857A1 (en) 2014-10-20 2016-04-28 Nestec S.A. Methods for prediction of anti-tnf alpha drug levels and autoantibody formation
CA3183289A1 (en) 2015-09-08 2017-03-16 Jcr Pharmaceuticals Co., Ltd. Novel human serum albumin mutant
CN108367048B (zh) 2015-10-02 2022-08-12 银溪制药股份有限公司 用于组织修复的双特异性治疗性蛋白质
CN115491373A (zh) * 2015-10-30 2022-12-20 爱迪塔斯医药公司 治疗单纯疱疹病毒的crispr/cas相关方法及组合物
TWI767915B (zh) 2016-06-27 2022-06-21 加州大學董事會 Ror-1與btk拮抗劑的組合
CN106317226B (zh) 2016-08-19 2017-09-05 安源医药科技（上海）有限公司 用于构建融合蛋白的连接肽
GB201620119D0 (en) 2016-11-29 2017-01-11 Pharmafox Therapeutics Ag Compounds
WO2018189661A2 (en) 2017-04-10 2018-10-18 Palti Yoram Prof Methods and compounds for treating diabetes
JP7308151B2 (ja) 2017-04-27 2023-07-13 イーライ リリー アンド カンパニー ヒトｂｍｐ７タンパク質のバリアント
US20190240156A1 (en) 2018-02-06 2019-08-08 Agency For Science, Technology And Research (A*Star) Therapeutic Compositions Comprising Mesenchymal Stem Cell Particles And Related Methods
BR112020021962A2 (pt) 2018-04-30 2021-01-26 Amicus Therapeutics, Inc. construtos para terapia gênica e métodos de uso
EP4606428A3 (en) 2018-06-27 2025-11-05 Juvena Therapeutics, Inc. Heparin-associated polypeptides and uses thereof
AU2019404061A1 (en) 2018-12-19 2021-07-22 The Board Of Trustees Of The Leland Stanford Junior University Bifunctional molecules for lysosomal targeting and related compositions and methods
KR20220077921A (ko) 2019-10-10 2022-06-09 아미쿠스 세라퓨틱스, 인코포레이티드 변이체 igf2 작제물
US20240189397A1 (en) 2019-12-24 2024-06-13 Juvena Therapeutics, Inc. Heparin-Associated Polypeptides and Uses Thereof
CN115379850A (zh) 2019-12-24 2022-11-22 裘美娜治疗公司 再生性多肽及其用途
EP4171658A4 (en) 2020-06-24 2025-04-09 Lycia Therapeutics, Inc. Modified viral compositions for viral transduction
US20220031812A1 (en) 2020-07-30 2022-02-03 Silver Creek Pharmaceuticals, Inc. Chimeric Proteins and Methods of Use for Treatment of Central Nervous System Disorders
GEAP202416351A (en) 2021-02-17 2024-02-12 Dr Falk Pharma Gmbh Anti-cd30l antibodies and uses thereof
WO2022271466A1 (en) 2021-06-21 2022-12-29 Juvena Therapeutics, Inc. Regenerative polypeptides and uses thereof
WO2022271981A2 (en) 2021-06-23 2022-12-29 Lycia Therapeutics, Inc. Bifunctional compounds containing igf-2 polypeptides
US20230405089A1 (en) 2022-06-17 2023-12-21 Juvena Therapeutics, Inc. Heparin-Associated Polypeptides and Uses Thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Baral et al. (2019) PLoS ONE 14(6): e0219155; //doi.org/10.1371/journal.pone.0219155 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12358963B2 (en) 2019-12-24 2025-07-15 Juvena Therapeutics, Inc. Regenerative polypeptides and uses thereof
US12329801B2 (en) 2021-06-21 2025-06-17 Juvena Therapeutics, Inc. Regenerative polypeptides and uses thereof

Also Published As

Publication number Publication date
EP4359425A1 (en) 2024-05-01
US20240294597A1 (en) 2024-09-05
MX2024000233A (es) 2024-03-14
JP2024525213A (ja) 2024-07-10
EP4359425A4 (en) 2025-04-09
US12329801B2 (en) 2025-06-17
CN117999278A (zh) 2024-05-07
CA3223707A1 (en) 2022-12-29
AU2022298470A1 (en) 2024-02-01
KR20240029031A (ko) 2024-03-05
IL309562A (en) 2024-02-01
WO2022271466A1 (en) 2022-12-29

Similar Documents

Publication Publication Date Title
US12329801B2 (en) Regenerative polypeptides and uses thereof
US10869909B2 (en) Compositions and methods of use for treating metabolic disorders
US20240043484A1 (en) Regenerative polypeptides and uses thereof
KR101993714B1 (ko) 대사 장애를 치료하는데 이용하기 위한 조성물과 방법
JP6809789B2 (ja) 疾患の治療または予防に用いるためのファクター１およびファクター２タンパク質、およびその阻害剤
CN110267674A (zh) 包含瘦素的融合蛋白及其生产和使用方法
BR112015021269B1 (pt) Polipeptídeo isolado, seu uso e composição farmacêutica
US10010588B2 (en) Methods of using pegylated interleukin-10 for treating hyperlipidemia
CN104619727A (zh) 靶向治疗
BR112020003736A2 (pt) polipeptídeos de fusão de glp-2 e usos para tratar e prevenir condições gastrointestinais
KR102404717B1 (ko) Tgf-베타 슈퍼패밀리의 ab6 패밀리 디자이너 리간드
US20230103583A1 (en) Method of enhancing aqueous humor outflow and reducing intraocular pressure
HK1206260B (en) Compositions and methods of use for treating metabolic disorders

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION RETURNED BACK TO PREEXAM

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

AS Assignment

Owner name: JUVENA THERAPEUTICS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:YOUSEF, HANADIE;O'CONNELL, JEREMY;MAI, THACH;AND OTHERS;SIGNING DATES FROM 20231218 TO 20231219;REEL/FRAME:066123/0485

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION COUNTED, NOT YET MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED