US20220160617A1 - Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes - Google Patents
Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes Download PDFInfo
- Publication number
- US20220160617A1 US20220160617A1 US17/602,708 US202017602708A US2022160617A1 US 20220160617 A1 US20220160617 A1 US 20220160617A1 US 202017602708 A US202017602708 A US 202017602708A US 2022160617 A1 US2022160617 A1 US 2022160617A1
- Authority
- US
- United States
- Prior art keywords
- composition
- seq
- human
- pharmaceutical composition
- janthinobacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
- A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
- A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
- A61K31/404—Indoles, e.g. pindolol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/49—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
- A61K8/4906—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with one nitrogen as the only hetero atom
- A61K8/4913—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with one nitrogen as the only hetero atom having five membered rings, e.g. pyrrolidone carboxylic acid
- A61K8/492—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with one nitrogen as the only hetero atom having five membered rings, e.g. pyrrolidone carboxylic acid having condensed rings, e.g. indol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/99—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0014—Skin, i.e. galenical aspects of topical compositions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q11/00—Preparations for care of the teeth, of the oral cavity or of dentures; Dentifrices, e.g. toothpastes; Mouth rinses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q17/00—Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings
- A61Q17/04—Topical preparations for affording protection against sunlight or other radiation; Topical sun tanning preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q5/00—Preparations for care of the hair
- A61Q5/02—Preparations for cleaning the hair
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
Definitions
- This invention provides beneficial compositions and methods for the improvement of skin health and the inhibition, treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes or microorganisms using human-derived Janthinobacterium lividum , the metabolites, the cell lysate or postbiotic of human-derived Janthinobacterium lividum , and Janthinobacterium lividum containing compositions, formulations and products, for cosmetic and consumer uses.
- infections such as bacterial, viral, yeast and/or fungal infections
- Potentially pathogenic fungi include yeasts (e.g., Candida albicans ) and dermatophytes. Dermatophytes are molds that require keratin for nutrition and must live on stratum corneum, hair, or nails to survive.
- Human infections are caused by Trichophyton, Microsporum and Epidermophyton species. Trichophyton rubrum is responsible for approximately 46% to 72% of cutaneous and nail mycoses worldwide.
- compositions comprising at least one human-isolated Janthinobacterium lividum in an amount effective for use in the inhibition, treatment or prevention of topical pathogenic microorganisms. Also disclosed herein are pharmaceutical compositions comprising one or more metabolite of human-derived Janthinobacterium lividum in an amount effective for use in the inhibition, treatment or prevention of a topical pathogenic microorganism. Also disclosed herein are pharmaceutical compositions comprising cell lysate of human-derived Janthinobacterium lividum in an amount effective for use in the inhibition, treatment or prevention of a topical pathogenic microorganism.
- compositions comprising an excipient and human-derived Janthinobacterium lividum , and/or materials originating from human-derived Janthinobacterium lividum , in an amount effective for use in the inhibition, treatment or prevention of a topical pathogenic microorganism; and methods for using these pharmaceutical compositions to inhibit, treat or prevent pathogenic microorganisms.
- These pharmaceutical compositions can be formulated for application to the skin, mucosa, hair, and/or nails.
- the additional isolated microbe is selected from a Lactobacillus species, a Lactococcus species, a benign fungal species typically found on human skin, or a Propionibacterium species.
- the composition is formulated for administration with additional antifungal or antibacterial compounds.
- the pharmaceutical composition is formulated for topical administration to the skin or mucosa.
- the compositions are part of a delivery device for mucosa cavities.
- the human-derived Janthinobacterium lividum nucleic acid sequence is identified by SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7.
- the human-derived Janthinobacterium lividum comprises a nucleic acid sequence at least 90% identical to SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7; or at least 93% identical to, or at least 95%, or at least 97%, or at least 98%, or at least 99%, or 100% identical to SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7 at the 16s rRNA gene sequence.
- the pharmaceutical composition is used to treat a bacterium pathogenic microorganism, such as Staphylococcus, Pseudomonas, Enterococcus and S. aureus .
- a virus pathogenic microorganism such as poliovirus, herpes simplex virus, hepatitis A virus, rotavirus, adenovirus, SARS-CoV-2 and influenza type A virus.
- the human-derived Janthinobacterium lividum produces an antimicrobial metabolite, selected from violacein, indole-3-carboxaldehyde, prodigiosin, salicylate, 2,4-diamabutyrate and one or more lantibiotics, at a level higher than an other non-human Janthinobacterium lividum reference strain.
- the pharmaceutical composition comprising the human-derived Janthinobacterium lividum is anhydrous, frozen at ⁇ 20° C., or frozen at ⁇ 80° C., before reconstitution with a separately-stored sterile liquid.
- the liquid for reconstitution is selected from eye lubricant, glycerol, sucrose, mannitol, 2-Hydroxyethylstarch (HES), Noveon AA-1 polycarbophil, Methocel F4M (HPMC), carboxymethyl cellulose, and/or including ⁇ -Carrageenan.
- the pharmaceutical, synthetic, cosmetic and probiotic compositions of this invention contain at least 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 10 , 10 20 colonizing forming units (CFUs) per a milliliter or milligram of human-derived Janthinobacterium lividum.
- CFUs colonizing forming units
- kits comprising at least one vial of stabilized human-derived Janthinobacterium lividum and at least one optional vial of liquid for reconstitution of stabilized human-derived Janthinobacterium lividum , instructions for mixing and application, and optionally one or more implements of mixing and application.
- implements of mixing and application are included and comprise one or more elements selected from a syringe, an empty sterile container, and an atomizer or mister.
- FIG. 1 shows representative examples of Janthinobacterium lividum isolated from a human heel, a human forehead, and a radish, all grown on petri dishes.
- FIG. 5 shows Janthinobacterium lividum strains are sensitive to 10 antibiotics using BD BBL Sensi-Discs.
- FIG. 7 shows Janthinobacterium lividum viability counts in CFU/ml from F107 (A) and F108 (B) Fermenter samples plated directly at harvest (WPI) and directly after centrifugation and resuspension in the cryoprotectant vehicle (Tufts).
- FIG. 10 shows representative results from a S. aureus antibiosis assay. Detailed methods are described in Example 4.
- compositions comprising the probiotic bacterium human-derived Janthinobacterium lividum which have antimicrobial and other beneficial properties.
- the human-derived Janthinobacterium lividum is adapted to the human host, ensuring that it is safe for human application and is equipped to survive on a human host at least long enough to be therapeutically effective.
- a preferred composition is a pharmaceutical composition comprising at least one human-derived Janthinobacterium lividum in an amount effective to treat, inhibit or prevent a topical pathogenic microorganism.
- Another preferred composition is a synthetic composition comprising the probiotic human-derived Janthinobacterium lividum formulated for topical application to modulated the microbiome of the object of application.
- the composition of human-derived Janthinobacterium lividum , metabolite, postbiotic and/or cell lysate is formulated for administration to the skin.
- the composition of human-derived Janthinobacterium lividum , metabolite, postbiotic and/or cell lysate is formulated for administration to the mucosa.
- probiotic refers to a live microorganism, microbe or living culture (including bacterium or yeasts for example) which, provided in sufficient numbers, beneficially affects the host organism, i.e. by conferring one or more demonstrable health benefits on the host organism.
- a “probiotic bacterium” or “probiotic microorganism” or “probiotic microbe” or “probiotic culture” or “probiotic bacteria” is a bacterium, microorganism, microbe, culture or bacteria which, provided in sufficient numbers, beneficially affects the host organism, i.e. by conferring one or more demonstrable health benefits on the host organism.
- acetic, propionic and butyric acid microbial cell fractions, functional proteins, extracellular polysaccharides (EPS), cell lysates, teichoic acid, phenyllactic acid, volatile organic compounds (VOCs), B-vitamin synthesis (biotin, cobalamin, folates, nicotinic acid, pantothenic acid, pyridoxine, riboflavin, and thiamine), peptidoglycan-derived muropeptides, antimicrobial peptides (AMP) and pili-type structures.
- EPS extracellular polysaccharides
- VOCs volatile organic compounds
- B-vitamin synthesis biotin, cobalamin, folates, nicotinic acid, pantothenic acid, pyridoxine, riboflavin, and thiamine
- AMP antimicrobial peptides
- Probiotic bacterium suitable for use in the present invention include, but are not limited to, human-derived Janthinobacterium and any additional non-pathogenic microbe such as, Bifidobacterium, Brevibacterium, Propionibacterium, Lactococcus, Streptococcus, Lactobacillus (e.g., L. acidophilus ), Enterococcus, Pediococcus, Leuconostoc , and/or Oenococcus.
- Cell lysates for use in the present invention include, but are not limited to, cell lysates from human-derived Janthinobacterium and any additional non-pathogenic microbe such as, Bifidobacterium, Brevibacterium, Propionibacterium, Lactococcus, Streptococcus, Lactobacillus (e.g., L. acidophilus ), Enterococcus, Pediococcus, Leuconostoc , and/or Oenococcus.
- any additional non-pathogenic microbe such as, Bifidobacterium, Brevibacterium, Propionibacterium, Lactococcus, Streptococcus, Lactobacillus (e.g., L. acidophilus ), Enterococcus, Pediococcus, Leuconostoc , and/or Oenococcus.
- ameliorating refers to any therapeutically beneficial result in the treatment of a disease state, e.g., a metabolic disease state, including prophylaxis, lessening in the severity or progression, remission, or cure thereof.
- in vivo refers to processes that occur in a living organism.
- mammal as used herein includes both humans and non-humans and includes but is not limited to humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.
- the term “derived from” includes microbes, microorganisms or other living culture immediately taken from an environmental sample and also microbes, microorganisms or other living culture isolated from an environmental source and subsequently grown in a pure culture or isolate.
- strain is defined as any nucleic acid sequence that is 97% or greater identical to a defined 16s rRNA nucleic acid sequence. More preferred embodiments of strain is a nucleic acid sequence that is greater than 98%, greater than 99% identical to a defined 16s rRNA nucleic acid sequence.
- Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).
- BLAST algorithm One example of an algorithm that is suitable for determining percent sequence identical and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
- sufficient amount means an amount sufficient to produce a desired effect, e.g., an amount sufficient to alter the microbial content of a subject's microbiota.
- therapeutic amount is an amount of an anti-microbial, for example an anti-fungal or anti-bacterial, compound that is prescribed. Concentrations below those typically prescribed are termed “sub-therapeutic” amounts.
- therapeutically effective amount is an amount that is effective to ameliorate a symptom of a disease.
- a therapeutically effective amount can be a “prophylactically effective amount” as prophylaxis can be considered therapy.
- method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
- the term “inhibit”, “inhibiting” or “inhibition” includes stopping the progression of a condition or growth, substantially preventing a condition or growth or substantially treating a condition or undesired growth.
- treat includes abrogating, inhibiting substantially, slowing, or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition.
- the term “preventing” or “prevention” includes completely or substantially reducing the likelihood or occurrence or the severity of initial clinical or aesthetical symptoms of a condition.
- the term “pathogen” refers to the disease, disorder or condition and to the microorganism associated with the disease or infection.
- Tinea barbae is a dermatophyte infection of the beard area most often caused by Trichophyton mentagrophytes or T. verrucosum. verrucosum .
- Tinea capitis is a dermatophytosis caused by Trichophyton tonsurans, Microsporum canis and M. audouinii ; other Trichophyton species (e.g., T. schoenleinii, T. violaceum ).
- Tinea corporis is a dermatophyte infection of the face, trunk, and extremities commonly caused by causes are Trichophyton mentagrophytes, T. rubrum , and Microsporum canis .
- Tinea cruris is a dermatophytosis that is commonly caused by Trichophyton rubrum or T. mentagrophytes .
- Tinea pedis is a dermatophyte infection of the feet commonly caused by T. rubrum .
- Dermatophytid (identity or id) reactions are protean; they are not related to localized growth of the fungus but rather are an inflammatory reaction to a dermatophytosis elsewhere on the body.
- Other disease, disorder, or conditions related to, but not limited, atopic dermatitis, impetigo, skin and soft tissue infections, are often caused gram positive bacterium and Staphylococcus.
- the term “about” includes variation of up to approximately +/ ⁇ 10% and that allows for functional equivalence in the product.
- colony-forming unit or “CFU” is an individual cell that is able to clone itself into an entire colony of identical cells.
- derived from includes material isolated from the recited source, and materials obtained using the isolated materials (e.g., cultures of microorganisms made from microorganisms isolated from the recited source).
- subject refers to any animal subject including humans, laboratory animals (e.g., primates, rats, mice), livestock (e.g., cows, sheep, goats, pigs, turkeys, and chickens), and household pets (e.g., dogs, cats, and rodents).
- the subject may be suffering from a dysbiosis, including, but not limited to, an infection due to a pathogenic microorganism or may be at risk of developing or transmitting to others an infection due to a pathogenic microorganism.
- colonization of a host organism includes the non-transitory residence of a bacterium or other microscopic organism.
- reducing colonization of a host subject's skin (or any other microbial niche) by a pathogenic bacterium includes a reduction in the residence time of the pathogen on the skin as well as a reduction in the number (or concentration) of the pathogen on the skin or adhered to the skin. Measuring reductions of adherent pathogens may be demonstrated, e.g., by a biopsy sample, by swabbing the skin, or reductions may be measured indirectly.
- a “combination” of two or more bacterium includes the physical co-existence of the two bacteria, either in the same material or product or in physically connected products, as well as the temporal co-administration or co-localization of the two bacteria.
- deiccate refers to dehydration or to dehydrate, typically by being lyophilized, freeze dried, or spray dried.
- Janthinobacterium is genus of Gram negative, betaproteobacteria that are commonly found in many environmental niches, including the human body. Janthinobacterium lividum was identified for its ability to protect amphibians from fungal infection.
- the strain of Janthinobacterium lividum is isolated from an environmental source.
- the strain of Janthinobacterium lividum is originally derived from a human source.
- a human-derived Janthinobacterium lividum strain demonstrates superior persistence on human skin compared to a reference strain.
- Indole-3-carboxaldehye has a role as a plant metabolite, a human xenobiotic metabolite, a bacterial metabolite and a marine metabolite. It is a heteroarene carbaldehyde, an indole alkaloid and a member of indoles.
- Prodigiosin is an alkaloid, red-pigmented, secondary metabolite, often associated with Serratia species.
- Prodigiosin molecules are identified by their common pyrrolyl pyrromethene skeleton, and have been shown to have a variety of biological activities, including antimicrobial activity.
- Lantibiotics a subset of bacteriocins, are genetically-encoded peptides containing intramolecular ring structures, many of which have been shown to have antimicrobial properties. Lantibiotic peptides are modified post-translationally to create their characteristic ring structures.
- One of the most well-known lantibiotic is nisin.
- a human-derived Janthinobacterium lividum or an isolated human-derived Janthinobacterium lividum over produces or over expresses its compounds (e.g., metabolites, e.g., violacein, indole-3-carboxaldehyde, prodigiosin, salicylate, 2,4-diamabutyrate and one or more lantibiotics) relative to other strains (e.g., a reference strain).
- metabolites e.g., violacein, indole-3-carboxaldehyde, prodigiosin, salicylate, 2,4-diamabutyrate and one or more lantibiotics
- the terms “over produce” and “over express” refer to at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 1.5-fold, 2-fold, 2.5-fold, or 3-fold more production or more expression (respectively) relative to other strains (e.g., a reference strain).
- a reference Janthinobacterium lividum strain may be a strain isolated from a different environmental niche, such as salamander skin, produce, or the like.
- the term “over produce” refers to the production of the compounds (e.g., metabolites) by the organism, and the term “over expresses” refers to the expression of a gene that produces the compounds (e.g., metabolites).
- Prebiotics in accordance with the teachings of this invention, comprise compositions that promote the growth of beneficial bacteria.
- Prebiotic substances can be consumed by a relevant probiotic, or otherwise assist in keeping the relevant probiotic alive or stimulate its growth.
- prebiotics When applied or consumed in an effective amount, prebiotics also beneficially affect a subject's naturally-occurring microbiome and thereby impart health benefits.
- Prebiotic foods enter the colon and serve as substrate for the endogenous bacteria, thereby indirectly providing the host with energy, metabolic substrates, and essential micronutrients.
- Prebiotics can also be added to any probiotic composition to enhance effectiveness or longevity of the probiotic strains.
- Prebiotics help probiotics flourish in their environment, and accordingly, their health benefits are largely indirect. For example, metabolites generated by colonic fermentation by intestinal microflora, such as short-chain fatty acids, can play important functional roles in the health of the host. Prebiotics can be useful agents for enhancing the ability of human microflora to provide benefits to their host.
- Prebiotics include, without limitation, amino acids, glycerol, mucopolysaccharides, oligosaccharides, polysaccharides, amino acids, vitamins, nutrient precursors, proteins, and combinations thereof.
- compositions comprise a prebiotic comprising, without limitation, amino acids, glycerol, polysaccharides and oligosaccharides.
- a prebiotic comprising, without limitation, amino acids, glycerol, polysaccharides and oligosaccharides.
- compositions comprise a prebiotic comprising an amino acid.
- a prebiotic is added that additionally serves as a cryoprotectant.
- Preferred embodiments are prebiotics that improve the growth of human-derived Janthinobacterium lividum such as those selected from D-Mannitol, Tween 20, Tween 40 and Cytidine
- Preferred embodiments are prebiotics that enhance the function of human-derived Janthinobacterium lividum such as those selected from the Table 1.
- compositions that comprise at least one strain of human-derived Janthinobacterium lividum disclosed herein, wherein the compositions are formulated for administration to a subject in need thereof.
- the subject is a human afflicted with a topical pathogenic microorganism infection of the skin and/or mucosa.
- the compositions are formulated for topical administration to a subject in need thereof.
- the compositions are formulated for topical administration to the skin of the subject.
- the compositions are formulated for topical administration to the scalp of the subject.
- the compositions are formulated for application to mucosa surfaces.
- a composition is formulated for oral administration. In some embodiments, a composition is formulated for transdermal administration. In some embodiments, a composition is formulated for injectable administration. In certain embodiments, the composition is a formulation selected from a gel, ointment, lotion, emulsion, paste, cream, foam, mousse, liquid, douche, garage, spray, suspension, dispersion, nasal spray and aerosol. In certain embodiments, the formulation comprises one or more excipients to provide a desired form and a desired viscosity, flow or other physical or chemical characteristic for effective application, coverage and adhesion to skin.
- the human-derived Janthinobacterium lividum of this invention is desiccated or dehydrated. Desiccation may be accomplished by standard methods of practice and can be select from such methods as lyophilization, spray drying, or freeze drying. Rehydration of the desiccated human-derived Janthinobacterium lividum produces at least 20% viable bacterium, at least 30%, at least 50% viable bacterium.
- compositions disclosed herein are compositions, wherein the composition is at least 30% viable at room temperature for at least thirty days. Also disclosed are compositions that are at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 50% viable for at least 30, 60, 90, 120, 150, 180 or at least 360 days.
- compositions are pharmaceutical compositions. In some embodiments the compositions are synthetic compositions. In some embodiments the compositions are cosmetic compositions. In some embodiments the compositions are probiotic compositions.
- compositions disclosed herein may be presented in a formulation that includes one or more excipients to improve any one or more of shelf-life, application, skin penetration, and therapeutic effect.
- the excipient is necessary to improve any one or more of shelf-life, application, skin penetration, and therapeutic effect.
- compositions disclosed herein may be in a topical dosage form, wherein the topical dosage form provides easy application to a surface, such as skin, nails, hair, and/or mucosa.
- the surface may be a surface that comes in contact with a subject.
- the Janthinobacterium probiotic compositions described herein are formulated for oral ingestion.
- the oral ingestion form may be a pill, tablet, capsule, paste, liquid suspension, colloid, or mixed with various foods such as candies, chews, yogurt, milk, cottage cheese or non-dairy based or lactose reduced substitutes.
- the formulation may contain additional non-active ingredients that improve flavor, smell, or texture of the edible composition.
- the formulation may also include binding agents, encapsulating films, or excipients that preserve shelf-life and bioavailability.
- An emulsion may be described as a preparation of one liquid distributed in small globules throughout the body of a second liquid.
- the dispersed liquid is the discontinuous phase
- the dispersion medium is the continuous phase.
- oil is the dispersed liquid and an aqueous solution is the continuous phase
- water or aqueous solution is the dispersed phase and oil or oleaginous substance is the continuous phase
- water-in-oil emulsion water-in-oil emulsion.
- the oil phase may consist at least in part of a propellant, such as an HFA propellant.
- Either or both of the oil phase and the aqueous phase may contain one or more surfactants, emulsifiers, emulsion stabilizers, buffers, and other excipients.
- Preferred excipients include surfactants, especially non-ionic surfactants; emulsifying agents, especially emulsifying waxes; and liquid non-volatile non-aqueous materials, particularly glycols such as propylene glycol.
- the oil phase may contain other oily pharmaceutically approved excipients. For example, materials such as hydroxylated castor oil or sesame oil may be used in the oil phase as surfactants or emulsifiers.
- a cream may be described as a viscous liquid or semi-solid emulsion of either the “oil-in-water” or “water-in-oil type”.
- Creams may contain emulsifying agents and/or other stabilizing agents.
- the formulation is in the form of a cream having a viscosity of greater than 1000 centistokes, typically in the range of 20,000-50,000 centistokes. Creams are often time preferred over ointments as they are generally easier to spread and easier to remove.
- Creams are typically thicker than lotions, may have various uses and often one uses more varied oils/butters, depending upon the desired effect upon the skin.
- the water-base percentage is about 60-75% and the oil-base is about 20-30% of the total, with the other percentages being the emulsifier agent, preservatives and additives for a total of 100%.
- a gel may be described as a semisolid system containing dispersions of small or large molecules in a liquid vehicle that is rendered semisolid by the action of a thickening agent or polymeric material dissolved or suspended in the liquid vehicle.
- the liquid may include a lipophilic component, an aqueous component or both.
- Some emulsions may be gels or otherwise include a gel component.
- Some gels, however, are not emulsions because they do not contain a homogenized blend of immiscible components.
- Suitable gelling agents include, but are not limited to, modified celluloses, such as hydroxypropyl cellulose and hydroxyethyl cellulose; Carbopol homopolymers and copolymers; and combinations thereof.
- Suitable solvents in the liquid vehicle include, but are not limited to, diglycol monoethyl ether; alkene glycols, such as propylene glycol; dimethyl isosorbide; alcohols, such as isopropyl alcohol and ethanol.
- the solvents are typically selected for their ability to dissolve the drug.
- Other additives, which improve the skin feel and/or emolliency of the formulation, may also be incorporated. Examples of such additives include, but are not limited, isopropyl myristate, ethyl acetate, C12-C15 alkyl benzoates, mineral oil, squalane, cyclomethicone, capric/caprylic triglycerides, and combinations thereof.
- Foams may be described as an emulsion in combination with a gaseous propellant.
- the gaseous propellant consists primarily of hydrofluoroalkanes (HFAs).
- HFAs hydrofluoroalkanes
- Suitable propellants include HFAs such as 1,1,1,2-tetrafluoroethane (HFA 134a) and 1,1,1,2,3,3,3-heptafluoropropane (HFA 227), but mixtures and admixtures of these and other HFAs that are currently approved or may become approved for medical use are suitable.
- the propellants preferably are not hydrocarbon propellant gases which can produce flammable or explosive vapors during spraying.
- the compositions preferably contain no volatile alcohols, which can produce flammable or explosive vapors during use.
- Emollients may be described as externally applied agents that soften or soothe skin and are generally known in the art and listed in compendia, such as the “Handbook of Pharmaceutical Excipients”, 4th Ed., Pharmaceutical Press, 2003.
- the emollients are almond oil, castor oil, ceratonia extract, cetostearoyl alcohol, cetyl alcohol, cetyl esters wax, cholesterol, cottonseed oil, cyclomethicone, ethylene glycol palmitostearate, glycerin, glycerin monostearate, glyceryl monooleate, isopropyl myristate, isopropyl palmitate, lanolin, lecithin, light mineral oil, medium-chain triglycerides, mineral oil and lanolin alcohols, petrolatum, petrolatum and lanolin alcohols, soybean oil, starch, stearyl alcohol, sunflower oil, xylitol and combinations thereof.
- the emollients are e
- Emulsifiers are surface active substances which promote the suspension of one liquid in another and promote the formation of a stable mixture, or emulsion, of oil and water.
- the emulsifiers are metallic soaps, certain animal and vegetable oils, and various polar compounds.
- Suitable emulsifiers include acacia, anionic emulsifying wax, calcium stearate, carbomers, cetostearyl alcohol, cetyl alcohol, cholesterol, diethanolamine, ethylene glycol palmitostearate, glycerin monostearate, glyceryl monooleate, hydroxpropyl cellulose, hypromellose, lanolin, hydrous, lanolin alcohols, lecithin, medium-chain triglycerides, methylcellulose, mineral oil and lanolin alcohols, monobasic sodium phosphate, monoethanolamine, nonionic emulsifying wax, oleic acid, poloxamer, poloxamers, polyoxyethylene alkyl ethers, polyoxyethylene castor oil derivatives, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearates, propylene glycol alginate, self-emulsifying glyceryl monostearate, sodium citrate dehydrate, sodium lauryl sulf
- compositions disclosed herein are formulated to be applied to a subject's scalp.
- the composition is formulated to be used as a product selected from a shampoo, a conditioner, a mousse, a gel, and a spray.
- Such compositions would be useful for the treatment of seborrheic dermatitis. Treatment of seborrheic dermatitis with such compositions may result in the reduction of a symptom selected from dandruff and cradle cap.
- compositions disclosed herein may be used to treat seborrheic dermatitis at other areas of the body besides the scalp. Non-limiting examples of other areas include the chest, stomach, skin folds, arms, legs, groin area and under breasts.
- compositions disclosed herein comprise a buffer, wherein the buffer controls a pH of the composition.
- the buffers maintain the composition from a pH of about 4 to a pH of about 7.5, from a pH of about 4 to a pH of about 7, and from a pH of about 5 to a pH of about 7.
- compositions disclosed herein are formulated to provide or maintain a desirable skin pH.
- the desirable skin pH is between about 4.5 and about 6.5.
- the desirable skin pH is between about 5 and about 6.
- the desirable skin pH is about 5.5.
- compositions disclosed herein are formulated with a skin pH modulating agent.
- pH modulating agents include salicylic acid, glycolic acid, trichloroacetic acid, azeilic acid, lactic acid, aspartic acid, hydrochloride, stearic acid, glyceryl stearate, cetyl palmitate, urea phosphate, and tocopheryl acetate.
- compositions disclosed herein are formulated to provide more oxygen to the skin. In some embodiments, compositions disclosed herein are formulated to provide more oxygen exposure to the skin. In some embodiments, compositions disclosed herein are formulated to provide more oxygen diffusion into the skin. In some embodiments, compositions disclosed herein are formulated to provide more oxygen diffusion through the skin. In some embodiments, compositions disclosed herein are formulated with an agent that provides more oxygen to the skin. In some embodiments, compositions disclosed herein are used with an agent that provides more oxygen to the skin. In some embodiments, compositions disclosed herein are used before use of an agent that provides more oxygen to the skin. In some embodiments, compositions disclosed herein are used after use of an agent that provides more oxygen to the skin. A non-limiting example of an agent that provides oxygen to the skin is chlorophyll.
- Preservatives can be used to prevent the growth of fungi and microorganisms.
- Suitable antifungal and antimicrobial agents include, but are not limited to, benzoic acid, butylparaben, ethyl paraben, methyl paraben, propylparaben, sodium benzoate, sodium propionate, benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, and thimerosal.
- a concentration of a preservative that is effective to prevent fungal growth is selected, without affecting the effectiveness of the composition for its intended purposed upon topical application.
- compositions disclosed herein are formulated with glycerol.
- a strain of bacterium in the composition ferments the glycerol, thereby producing short chain fatty acids.
- short-chain fatty acids include acetic acid, lactic acid, and propionic acid.
- human-derived Janthinobacterium lividum grown in the presence of glycerol enhances the production of violacein or one or more antimicrobial metabolites.
- a composition intended to be administered topically comprises at least 1 ⁇ 10 ⁇ circumflex over ( ) ⁇ 3, 1 ⁇ 10 ⁇ circumflex over ( ) ⁇ 4, 1 ⁇ 10 ⁇ circumflex over ( ) ⁇ 5, 1 ⁇ 10 ⁇ circumflex over ( ) ⁇ 6, 1 ⁇ 10 ⁇ circumflex over ( ) ⁇ 7, 1 ⁇ 10 ⁇ circumflex over ( ) ⁇ 8, 1 ⁇ 10 ⁇ circumflex over ( ) ⁇ 9, 1 ⁇ 10 ⁇ circumflex over ( ) ⁇ 10 microorganisms per gram of carrier, or at equivalent doses calculated for inactive or dead microorganisms or for bacterial fractions or for metabolites produced.
- compositions disclosed herein are formulated in order to deliver at least 10 ⁇ circumflex over ( ) ⁇ 6 microbes per square cm of skin. In certain embodiments, the composition is formulated in order to deliver at least 10 ⁇ circumflex over ( ) ⁇ 7 microbes per square cm of skin. In certain embodiments, the composition is formulated in order to deliver at least 10 ⁇ circumflex over ( ) ⁇ 8 microbes per square cm of skin. In certain embodiments, the composition is formulated in order to deliver at least 10 ⁇ circumflex over ( ) ⁇ 9 microbes per square cm of skin. In certain embodiments, the composition is formulated in order to deliver less than 10 ⁇ circumflex over ( ) ⁇ 9 microbes per square cm of skin.
- the composition is formulated in order to deliver less than 10 ⁇ circumflex over ( ) ⁇ 8 microbes per square cm of skin. In certain embodiments, the composition is formulated in order to deliver less than 10 ⁇ circumflex over ( ) ⁇ 7 microbes per square cm of skin. In certain embodiments, the composition is formulated in order to deliver between about 10 ⁇ circumflex over ( ) ⁇ 7 and 10 ⁇ circumflex over ( ) ⁇ 8 microbes per square cm of skin. In certain embodiments, the composition is formulated in order to deliver between about 10 ⁇ circumflex over ( ) ⁇ 6 microbes per square cm of skin and about 10 ⁇ circumflex over ( ) ⁇ 10 microbes per square cm of skin.
- compositions disclosed herein are formulated at a concentration of about 10 ⁇ circumflex over ( ) ⁇ 5 microbes per milliliter to about 10 ⁇ circumflex over ( ) ⁇ 12 microbes per milliliter. In certain embodiments, compositions disclosed herein are formulated at a concentration of about 10 ⁇ circumflex over ( ) ⁇ 6 microbes per milliliter. In certain embodiments, compositions disclosed herein are formulated at a concentration of about 10 ⁇ circumflex over ( ) ⁇ 7 microbes per milliliter. In certain embodiments, compositions disclosed herein are formulated at a concentration of about 10 ⁇ circumflex over ( ) ⁇ 8 microbes per milliliter.
- compositions disclosed herein for topical or oral use contain biologic stability compounds including but not limited to carbohydrates such as trehalose, mannose, fructose, glucose, sucrose, lactose, raffinose, stachyose, melezitose, dextran, and sugar alcohols; and/or cryopreservatives such as glycerol, bovine-free media, (e.g., tryptic soy broth), whey protein, NaCl, phosphate buffer, MgCl, lyophilized bacteria, or other inactive/killed bacteria.
- biologic stability compounds including but not limited to carbohydrates such as trehalose, mannose, fructose, glucose, sucrose, lactose, raffinose, stachyose, melezitose, dextran, and sugar alcohols; and/or cryopreservatives such as glycerol, bovine-free media, (e.g., tryptic soy broth), whey protein, NaCl,
- the kit may also include one or more complementary products, such as soaps, body washes or moisturizing lotions with certain pH, lotions or creams.
- the complementary product is a probiotic.
- the complementary product may include any compound beneficial to the activity of the original product and enhance its activity for lasting efficacy.
- Another contemplated packaging is one wherein the population of selected, transformed, or engineered bacterium is maintained as a layer on a bandage or film that is combined with a second layer of bandage/film that will allow activation of the bacteria, and that optionally may also limit reproduction/growth factors.
- the final product is stored refrigerated, with the bacterium being in their active state.
- the bacterium are stored in a small bead of water-soluble cellulose.
- the beads can be mixed in any solution such as sunscreen, moisturizer, body wash or soap.
- the Janthinobacterium probiotic composition is co-formulated with one or more additional active agents.
- the probiotic composition can be co-formulated with one or more additional antimicrobial agents, as detailed in the combination section.
- the additional antimicrobial agent can be an antifungal agent, an antibacterial agent, an anti-parasitic agent, or a combination of any of those agents.
- the Janthinobacterium probiotic composition is co-formulated with one or more additional active agents that confer additional benefits, such as an agent to relieve itching, pain, discoloration or other undesirable effect.
- the Janthinobacterium cosmetic composition is in the form of an emulsion composition according to the invention is especially effective.
- the emulsion may be in the form of an oil-in-water emulsion, a water-in-oil emulsion, a water-in-oil-in-water emulsion or an oil-in-water-in-oil emulsion.
- the cosmetic composition of the invention may also be used in the form of a nonaqueous composition.
- the form of the nonaqueous composition is exemplified by solid, semisolid, pressed, mousse, powder and stick forms.
- “nonaqueous composition” refers to compositions that are not formulated with water.
- the human-derived Janthinobacterium lividum compositions of this invention can be administered with other agents in a combination therapy mode, including anti-microbial agents, probiotics, postbiotics, and prebiotics. Administration can be sequential, over a period of hours or days, or simultaneous.
- Anti-bacterial agents can include cephalosporin antibiotics (cephalexin, cefuroxime, cefadroxil, cefazolin, cephalothin, cefaclor, cefamandole, cefoxitin, cefprozil, and ceftobiprole); fluoroquinolone antibiotics (cipro, Levaquin, floxin, tequin, avelox, and norflox); tetracycline antibiotics (tetracycline, minocycline, oxytetracycline, and doxycycline); penicillin antibiotics (amoxicillin, ampicillin, penicillin V, dicloxacillin, carbenicillin, vancomycin, and methicillin); and carbapenem antibiotics (ertapenem, doripenem, imipenem/cilastatin, and meropenem).
- cephalosporin antibiotics cephalexin, cefuroxime, cefadroxil, cefazolin, cephalothin
- Anti-viral agents can include Abacavir, Acyclovir, Adefovir, Amprenavir, Atazanavir, Cidofovir, Darunavir, Delavirdine, Didanosine, Docosanol, Efavirenz, Elvitegravir, Emtricitabine, Enfuvirtide, Etravirine, Famciclovir, Foscarnet, Fomivirsen, Ganciclovir, Indinavir, Idoxuridine, Lamivudine, Lopinavir Maraviroc, MK-2048, Nelfinavir, Nevirapine, Penciclovir, Raltegravir, Rilpivirine, Ritonavir, Saquinavir, Stavudine, Tenofovir Trifluridine, Valaciclovir, Valganciclovir, Vidarabine, Ibacitabine, Amantadine, Oseltamivir, Rimantidine, Tipranavir, Zalcitabine,
- antifungal compounds include, but are not limited to polyene antifungals such as natamycin, rimocidin, filipin, nystatin, amphotericin B, candicin, and hamycin; imidazole antifungals such as miconazole, ketoconazole, clotrimazole, econazole, omoconazole, bifonazole, butoconazole, fenticonazole, isoconazole, oxiconazole, sertaconazole, sulconazole, and tioconazole; triazole antifungals such as fluconazole, itraconazole, isavuconazole, ravuconazole, posaconazole, voriconazole, terconazole, and albaconazole; thiazole antifungals such as abafungin; allylamine antifungals such as terbinafine, naftifine, and butena
- Other compounds that have antifungal properties include, but are not limited to polygodial, benzoic acid, ciclopirox, tolnaftate, undecylenic acid, flucytosine or 5-fluorocytosine, griseofulvin, and haloprogin.
- the bacterial compositions are included in combination therapy with one or more corticosteroids, mesalazine, mesalamine, sulfasalazine, sulfasalazine derivatives, immunosuppressive drugs, cyclosporin A, mercaptopurine, azathiopurine, prednisone, methotrexate, antihistamines, glucocorticoids, epinephrine, theophylline, cromolyn sodium, anti-leukotrienes, anti-cholinergic drugs for rhinitis, anti-cholinergic decongestants, mast-cell stabilizers, monoclonal anti-IgE antibodies, vaccines, and combinations thereof.
- corticosteroids mesalazine, mesalamine, sulfasalazine, sulfasalazine derivatives
- immunosuppressive drugs cyclosporin A, mercaptopurine, azathio
- the methods and compositions described herein can be used to treat and or prevent infections resulting from growth of parasitic microorganisms susceptible to metabolites produced by human-derived Janthinobacteria lividum .
- These microbes can be bacteria, viruses, yeast or fungi.
- the infection is an onychomycosis. In an embodiment, the infection is Tinea pedis. In an embodiment, the infection is atopic dermatitis. In an embodiment, the infection is impetigo. In an embodiment, the infection is of the skin or soft tissue.
- the infection is caused by a dermatophyte. In an embodiment, the infection is caused by a Malassezia species. In an embodiment, the infection is caused by a Trichophyton species. In an embodiment, the infection is caused by Staphylococcus species. In an embodiment, the infection is caused by Trichophyton rubrum . In an embodiment, the infection is caused by Staphylococcus aureus . In an embodiment, the infection is caused by a gram positive bacteria.
- the subject or patient may optionally have a pretreatment protocol to prepare the skin to receive the bacterial composition.
- the pretreatment protocol is advisable, such as when a patient has an acute infection with a highly resilient pathogen.
- the pretreatment protocol is entirely optional, such as when the pathogen causing the infection is not resilient, or the patient has had an acute infection that has been successfully treated but where the physician is concerned that the infection may recur.
- the pretreatment protocol may enhance the ability of the bacterial composition to affect the patient's microbiome.
- At least one antibiotic or antifungal may be administered to alter the microbes on the patient. This may be applied orally or topically.
- the antibiotic should be stopped in sufficient time to allow the antibiotic to be substantially reduced in concentration on the skin before the bacterial composition is administered.
- the antibiotic may be discontinued 1, 2, or 3 days before the administration of the bacterial composition.
- the antibiotic may be discontinued 3, 4, 5, 6, or 7 antibiotic half-lives before administration of the bacterial composition.
- the antibiotic may be chosen so the constituents in the bacterial composition have an MIC50 that is higher than the concentration of the antibiotic on the skin.
- MIC50 of a bacterial composition or the elements in the composition may be determined by methods well known in the art Reller et al., Antimicrobial Susceptibility Testing: A Review of General Principles and Contemporary Practices, Clinical Infectious Diseases 49(11):1749-1755 (2009). In such an embodiment, the additional time between antibiotic administration and administration of the bacterial composition is not necessary. If the pretreatment protocol is part of treatment of an acute infection, the antibiotic may be chosen so that the infection is sensitive to the antibiotic, but the constituents in the bacterial composition are not sensitive to the antibiotic.
- the Janthinobacterium probiotic is pretreated with a substance to increase production of a beneficial metabolite.
- the probiotic is incubated in the presence of a prebiotic to increase production of violacein, such as glycerol or tryptophan.
- compositions described herein may contain bacterial strains in any form, for example in an aqueous form, such as a solution or a suspension, embedded in a semi-solid form, in a powdered form or freeze dried form.
- the composition or the bacterial strains of the composition are lyophilized.
- a subset of the bacterial strains in a composition is lyophilized.
- the bacterial strains of the composition can be manufactured using fermentation techniques well known in the art.
- the active ingredients are manufactured using anaerobic fermenters, which can support the rapid growth of anaerobic bacterial species.
- the anaerobic fermenters may be, for example, stirred tank reactors or disposable wave bioreactors.
- Culture media such as BL media and EG media, or similar versions of these media devoid of animal components, can be used to support the growth of the bacterial species.
- the bacterial product can be purified and concentrated from the fermentation broth by traditional techniques, such as centrifugation and filtration, and can optionally be dried and lyophilized by techniques well known in the art.
- the composition of bacterial strains may be formulated for administration as a pharmaceutical composition.
- pharmaceutical composition as used herein means a product that results from the mixing or combining of at least one active ingredient, such as any two or more purified bacterial strains described herein, and one or more inactive ingredients, which may include one or more pharmaceutically acceptable excipient.
- excipients include sterile water, physiological saline, solvent, a base material, an emulsifier, a suspending agent, a surfactant, a stabilizer, a flavoring agent, an aromatic, an excipient, a vehicle, a preservative, a binder, a diluent, a tonicity adjusting agent, a soothing agent, a bulking agent, a disintegrating agent, a buffer agent, a coating agent, a lubricant, a colorant, a sweetener, a thickening agent, and a solubilizer.
- compositions can be used orally, nasally or parenterally, for instance, in the form of capsules, tablets, pills, sachets, liquids, powders, granules, fine granules, film-coated preparations, pellets, troches, sublingual preparations, chewables, buccal preparations, pastes, syrups, suspensions, elixirs, emulsions, liniments, ointments, plasters, cataplasms, transdermal absorption systems, lotions, inhalations, aerosols, injections, suppositories, and the like.
- the human-derived Janthinobacterium lividum is formulated into an article of manufacture, for example a substance impregnated with the human-derived Janthinobacterium lividum or postbiotics, or lysates, or metabolites of the human-derived Janthinobacterium lividum.
- the human-derived Janthinobacterium lividum is associated with yarn.
- Yarn generally refers to a long, thin spun flexible material that is suitable for knitting or weaving. Yarn can be made of, e.g., wool, cotton, polyester, and blends thereof.
- the human-derived Janthinobacterium lividum is associated with thread.
- Thread generally refers to a long, thin spun flexible material that is suitable for sewing. Thread generally has a thinner diameter than yarn. Thread can be made of, e.g., cotton, polyester, nylon, silk, and blends thereof.
- the present disclosure provides a wearable article comprising a human-derived Janthinobacterium lividum as described herein.
- a wearable article may be a light article that can be closely associated with a user's body, in a way that does not impede ambulation. Examples of wearable articles include a wristwatch, wristband, headband, hair elastic, hair nets, shower caps, hats, hairpieces, and jewelry.
- the Human-derived Janthinobacterium lividum is associated with a product intended to contact the hair, for example, a brush, comb, shampoo, conditioner, headband, hair elastic, hair nets, shower caps, hats, and hairpieces.
- a product intended to contact the hair for example, a brush, comb, shampoo, conditioner, headband, hair elastic, hair nets, shower caps, hats, and hairpieces.
- Articles contacting the surface of a human subject, such as a diaper may be associated with the Janthinobacterium of this invention.
- the human-derived Janthinobacterium lividum is associated with a household item, which may otherwise function as a reservoir for a human skin pathogen.
- a shower curtain, bathmat, shower mat, or drainage tile is impregnated with Janthinobacterium or postbiotics, or lysates, or metabolites of the human-derived Janthinobacterium lividum.
- the product comprising the Human-derived Janthinobacterium lividum is packaged.
- the packaging may serve to compact the product or protect it from damage, dirt, or degradation.
- the packaging may comprise, e.g., plastic, paper, cardboard, or wood.
- the packaging is impermeable to bacteria.
- the packaging is permeable to oxygen and/or carbon dioxide.
- Samples were sourced and collected from various sources. Skin microbiome samples were collected from 18-25 year old young healthy adult subjects following standard scrubbing/swabbing procedures using eSwab tubes (Fisher, Cat. No. 23-600-900). Samples were collected from scalp, forehead, nose, antecubital fossa, palm, heel, and toe web space for each subject.
- Human skin samples were either processed directly or stored at ⁇ 80° C. with DMSO as cryoprotectant and thawed at room temperature for processing. Skin samples were plated onto BHI and R2A agar plates supplied with 1% glycerol following standard microbial practice after being diluted to the extent of 100-300 colonies per plate. Plates were incubated at ambient temperature for 3-5 days and visually checked for bacterial colonies with purple pigment.
- Shotgun sequencing analysis also showed that Janthinobacterium lividum was detected on multiple anatomical sites and on multiple sample collection visits, indicating that Janthinobacterium lividum , aside from being identified in soil, amphibians, and plants, is ubiquitously present on human skin.
- Janthinobacterium lividum was performed using SensiFAST SYBR No-ROX kit (Bioline) in a 10 ⁇ l reaction in duplicates on a CFX real-time PCR detection system (BioRad) following instructions.
- the screenings were carried out sequentially using two set of primer pairs, Janthinobacterium -specific (Janthino2F2, GCACGGAAGTGACCAAAAA and Janthino2R2, ACATGGAGACTTGGGCTTTG) and violacein-specific (JlivF, TACCACGAATTGCTGTGCCAGTTG and JlivR, ACACGCTCCAGGTATACGTCTTCA).
- Shotgun sequencing library for each Janthinobacterium lividum strain was generated using the Nextera Flex kit manufactured by Illumina according to the instructions.
- the shotgun libraries were pooled and sequenced in a HiSeq X platform.
- the sequencing reads were automatically demultiplexed into individual FASTA files, run through DermBiont's bioinformatic analysis pipeline yielding a genome assembled from cleaned sequencing reads.
- JL001, JL002, JL004, JL005, and JL007 Genome sequences of 5 Janthinobacterium lividum strains (JL001, JL002, JL004, JL005, and JL007), along with several published Janthinobacterium lividum genomes, were run through Average Nucleotide Identify (ANI, https://img.jgi.doe.gov/docs/docs/ANI.pdf) analyses to determine the similarity and genetic diversity.
- ANI Average Nucleotide Identify
- Janthinobacterium lividum In further evaluate the prevalence and abundance of Janthinobacterium lividum in skin microbiome samples, metagenomic shotgun sequencing of a total of 127 skin microbiome samples from 9 young healthy subjects across 7 anatomical sites in 3 sample collection visits was performed. Owing to the high sensitivity of shotgun sequencing approach, a higher percentage of Janthinobacterium lividum positive samples than qPCR screening were anticipated. Indeed, and not surprisingly, all 9 subjects have Janthinobacterium lividum on their skin samples in multiple anatomical sites or multiple sampling visits ( FIG. 2 ). On average, Janthinobacterium lividum DNA accounts for 0.4% of overall skin microbial DNA with a high abundance in antecubital fossa and palm and very low abundance in foot area ( FIG. 2 ).
- ANI estimates the average nucleotide identity using both best hits and reciprocal best hits between two genomes (enve-omics.ce.gatech.edu/ani/). 8 published Janthinobacterium lividum genomes were downloaded and compared with internally isolated Janthinobacterium lividum genome sequences for ANI analysis. To further evaluate evolutionary relationship of Janthinobacterium lividum strains, phylogenomic trees of all Janthinobacterium lividum strains were constructed using whole genome sequences. There are at least 4 distinct subgroups of Janthinobacterium lividum ( FIG. 3 ). Furthermore, each subgroup consists of Janthinobacterium lividum collected from various sources including soil, plant, amphibian, and human skin ( FIG. 3 ).
- Janthinobacterium lividum DB02473 was grown in fermenters at 5 L scale. Fermenters were inoculated from 14-15 h old shake flask culture inoculum, and growth was monitored by measuring absorbance at 600 nm. Fermentor culture was harvested aseptically and cell pellet was resuspended in formulation buffer containing cryoprotectants and stabilizers, to prepare frozen formulation or lyophilized formulation. The final formulated product was tested for viability, purity, and functional activity against pathogens T. rubrum and S. aureus , before and after dilution to 10 8 , 10 7 and 10 6 CFU/ml. Purity was >99.99%, there was zero to minimal drop in viability and no change in activity between undiluted and diluted samples.
- Trichophyton rubrum strain 18754 was purchased from ATCC and maintained according to instructions. Janthinobacterium lividum strain JL007 cryostock 2 was stored at ⁇ 80° C. with either DMSO or glycerol as cryoprotectant. S. aureus strain 25923 was purchased from ATCC and maintained according to instructions.
- the absorbance at 600 nm was measured and the CFU/ml calculated assuming that 1 OD unit was equal to 5 ⁇ 10 ⁇ circumflex over ( ) ⁇ 8 CFU/ml.
- One sample was plated immediately as described below and another sample was taken on ice to the lab and analyzed for T. rubrum activity using the Ramsey assay (see below) and the Staphylococcus antibiosis assay and plated for counts again. Additionally, 3 samples were then made from the harvest to equal 10 8 , 10 7 and 10 6 CFU/ml. 100 ⁇ l from each dilution was added to the first well of a 96 well plate in triplicate.
- T. rubrum The inhibition of T. rubrum was referred as the reduction of colony size in mm compared to controls. Radii of T. rubrum colonies were first measured using ImageJ in pixels (straight line) and converted into mm based the pixel measurements of petri dishes.
- In vitro assay was set up following standard experimental procedure. Briefly, S. aureus 25923 was struck out BHI agar from a cryostock and incubated at 37° C. overnight. The agar plate was used for the assay within 1 week. 3 ml of BHI media was inoculated with colonies from the agar plate and grown for 2-3 hr at 37° C. The absorbance at 600 nm was measured and diluted to 1 ⁇ 10 ⁇ circumflex over ( ) ⁇ 7 CFU/ml, assuming that 1 OD unit is equal to 1 ⁇ 10 ⁇ circumflex over ( ) ⁇ 9 CFU/ml.
- Results are qualitative.
- a successful outcome shows a sparse collection of S. aureus colonies on the experimental or JL007 control plated compared with a lawn on the mock control.
- a qualitative score of 1-3 is given for 1 showing 50-75% growth, 2 showing 15-50% growth and 3 showing ⁇ 15% growth compared with the mock control.
- FIG. 8 Representative images of the mock control, 10 ⁇ circumflex over ( ) ⁇ 8 CFU/ml culture and the mock control are shown in FIG. 8 .
- FIG. 10 shows the difference in mm between the size of the proximal fringe (indicated in FIG. 8 c ) of the mock control and the experimental samples. Each is an average of the four T. rubrum colonies from each plate. It can be concluded that dilution of the sample shows no significant effect on the inhibition of T. rubrum growth; an approximately 5 mm decrease in growth of the T. rubrum colony is observed at the position closest to the JL007 cross.
- Results from the S. aureus antibiosis assays are qualitative as the method used for the assay causes JL007 from the harvested fermenters to stop all but sporadic growth. For comparative purposes, a representative mock and lab grown JL007 images from a previous fermentation developmental are shown. Table 6 shows the qualitative score for the undiluted and each dilution for F107 and F108. It can be concluded that there is no difference between the undiluted and dilutions of F107 and F108.
- Janthinobacterium lividum strains were tested for virulence factors and examined for their antibiotic resistance profiles by performing both in silico analyses and wet lab experimental confirmation.
- silico genome mining revealed no known virulence factors and no antibiotic resistance genes in genomes of five (5) strains of Janthinobacterium lividum (Table 1).
- Janthinobacterium lividum strains are sensitive to cephalosporin, quinolone, and tetracycline classes of antibiotics, less sensitive to aminoglycosides, macrolides, aztreonam, carbapenem, meropenem, chloramphenicol, clindamycin, and amoxicillin/clavulanate (4:1), and are resistant to bacitracin.
- Shotgun sequencing libraries for each Janthinobacterium lividum strain was generated using the Nextera Flex kit (Illumina).
- the shotgun libraries were pooled and sequenced in a HiSeq X platform.
- the sequencing reads were automatically demultiplexed into individual FASTA files, run through bioinformatic analysis pipeline yielding a genome assembled from cleaned sequencing reads.
- the sensitivity of Janthinobacterium lividum to antibiotics is reflected by a clear zone of inhibition of Janthinobacterium lividum cells surrounding the antibiotic discs.
- the zone of inhibition was measured using ImageJ and was transformed into cm for analysis.
- Antibiotic sensitivities were also confirmed by laboratory assays, using the Janthinobacterium lividum grown from Janthinobacterium lividum culture grown in vegitone LB broth. Antibiotic assays performed showed that all 5 Janthinobacterium lividum strains are sensitive to the following antibiotic/doses: penicillin 10 IU, ampicillin 10 ⁇ g, streptomycin 10 ⁇ g, vancomycin 30 ⁇ g, erythromycin 15 ⁇ g, doxycycline 30 ⁇ g, teracycline 30 ⁇ g, cephalothin 30 ⁇ g, ciprofloxaxin 5 ⁇ g, and chloramphenicol 5 ⁇ g ( FIG. 5 ).
- Janthinobacterium lividum strains are sensitive to cephalosporin, quinolone, and tetracycline classes of antibiotics, less sensitive to aminoglycosides, macrolides, aztreonam, carbapenem, meropenem, chloramphenicol, clindamycin, and amoxicillin/clavulanate (4:1), and are resistant to bacitracin (Table 7 and 8).
- Trichophyton rubrum strain 18754 was purchased from ATCC and maintained according to instructions. Janthinobacterium lividum strains were stored at ⁇ 80° C. with either DMSO or glycerol as cryoprotectant.
- Janthinobacterium lividum - T. rubrum antibiosis assays were carried out using the DB02473 human-isolated Janthinobacterium lividum strain. For plates incubated at ambient temperature, T. rubrum grows beyond initial inoculation spots starting at Day 4. At day 7 , Janthinobacterium lividum -treated T. rubrum colonies grown in co-culture with Janthinobacterium lividum were noticeably smaller than mock control (no Janthinobacterium lividum ) colonies. At Day 14 , Janthinobacterium lividum treated colonies were significantly smaller than control colonies ( FIG. 10 ), indicating a strong growth inhibition by Janthinobacterium lividum . Similar results were observed with other unique Janthinobacterium lividum strains.
- the 1.2-ml samples were sonicated using a probe sonicator set at 40% intensity for 3 ⁇ 40 s with 20 s on ice between sonication bursts. This procedure was based on findings from a pilot experiment and gives 60-80% lysis of Janthinobacterium lividum DB02473.
- the sonicated material was centrifuged at 14,000 ⁇ g for 2 minutes. 700 ⁇ l of the supernatant was transferred to barcoded Micronic tubes provided by Metabolon. The tubes were capped, flash frozen in liquid nitrogen and stored at ⁇ 80° C. The remainder of the lysate supernatant was stored in the ⁇ 80° C. in freezer boxes after being flash frozen.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Dermatology (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Birds (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Gerontology & Geriatric Medicine (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Virology (AREA)
- Oral & Maxillofacial Surgery (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Cosmetics (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicinal Preparation (AREA)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/602,708 US20220160617A1 (en) | 2019-04-09 | 2020-04-09 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962920010P | 2019-04-09 | 2019-04-09 | |
| US17/602,708 US20220160617A1 (en) | 2019-04-09 | 2020-04-09 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
| PCT/US2020/027556 WO2020210553A1 (en) | 2019-04-09 | 2020-04-09 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20220160617A1 true US20220160617A1 (en) | 2022-05-26 |
Family
ID=70476522
Family Applications (5)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/602,708 Abandoned US20220160617A1 (en) | 2019-04-09 | 2020-04-09 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
| US16/885,152 Active US11040077B2 (en) | 2019-04-09 | 2020-05-27 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
| US17/243,509 Active 2040-04-09 US12064459B2 (en) | 2019-04-09 | 2021-04-28 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
| US17/384,598 Abandoned US20210386802A1 (en) | 2019-04-09 | 2021-07-23 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
| US18/762,414 Pending US20250295713A1 (en) | 2019-04-09 | 2024-07-02 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
Family Applications After (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/885,152 Active US11040077B2 (en) | 2019-04-09 | 2020-05-27 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
| US17/243,509 Active 2040-04-09 US12064459B2 (en) | 2019-04-09 | 2021-04-28 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
| US17/384,598 Abandoned US20210386802A1 (en) | 2019-04-09 | 2021-07-23 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
| US18/762,414 Pending US20250295713A1 (en) | 2019-04-09 | 2024-07-02 | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
Country Status (12)
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4438052A1 (en) * | 2023-03-30 | 2024-10-02 | FytagoLife B.V. | Plant extract for use in treatment of a fungal infection |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2658897T3 (es) | 2011-08-24 | 2018-03-12 | Novan, Inc. | Macromoléculas de liberación de óxido nítrico ajustables que tienen múltiples estructuras donantes de óxido nítrico |
| US11813284B2 (en) | 2013-08-08 | 2023-11-14 | Novan, Inc. | Topical compositions and methods of using the same |
| US10322082B2 (en) | 2014-07-11 | 2019-06-18 | Novan, Inc. | Topical antiviral compositions and methods of using the same |
| SG11202111168UA (en) * | 2019-04-09 | 2021-11-29 | Dermbiont Inc | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
| US11517597B2 (en) * | 2020-09-29 | 2022-12-06 | Chambio Co., Ltd. | Method for improving skin condition with postbiotic extract |
| CN112891343B (zh) * | 2021-03-22 | 2022-04-01 | 华中农业大学 | 3-吲哚乙腈在制备抑制新型冠状病毒SARS-CoV-2药物中的应用 |
| TWI890918B (zh) * | 2022-01-24 | 2025-07-21 | 耀然實業股份有限公司 | 私密處保養組成物、私密處保養產品及私密處用品 |
| CN114705800A (zh) * | 2022-03-25 | 2022-07-05 | 重庆市公共卫生医疗救治中心 | 尿液中生物标志物检测试剂在制备新冠肺炎病毒无症状感染者筛查试剂盒中的用途 |
| AU2023271525A1 (en) * | 2022-05-16 | 2024-12-05 | Maruho Co., Ltd. | Composition for treating ringworm |
| US20260021219A1 (en) * | 2022-09-30 | 2026-01-22 | Kimberly-Clark Worldwide, Inc. | Methods and absorbent articles for inhibiting fecal protease activity |
| KR20260049280A (ko) * | 2023-08-07 | 2026-04-13 | 로레알 | 피부 항-노화 치료를 위한 새로운 조성물 |
| KR20250104680A (ko) * | 2023-12-29 | 2025-07-08 | 한국생명공학연구원 | 잔티노박테리움 속 균주 또는 비올라세인을 포함하는 발모 촉진 또는 탈모 예방 또는 치료용 조성물 |
| WO2025179157A1 (en) | 2024-02-23 | 2025-08-28 | Imvela Corp. | Compositions containing indole-derived metabolites and methods of use thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210361725A1 (en) * | 2019-04-09 | 2021-11-25 | Dermbiont, Inc. | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
Family Cites Families (51)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3261761A (en) | 1962-05-07 | 1966-07-19 | Arthur W Anderson | Method of freeze drying bacterial cultures |
| US4205132A (en) | 1978-07-17 | 1980-05-27 | Microlife Technics, Inc. | Lyophilization of bacteria |
| EP0045718A3 (de) | 1980-07-25 | 1983-01-19 | Ciba-Geigy Ag | Nasalpräparate und Verfahren zu deren Herstellung |
| US4900348A (en) | 1983-08-02 | 1990-02-13 | The Ohio State University Research Foundation | Production of disease suppresive compost and container media, and microorganism culture for use therein |
| US5081225A (en) | 1989-02-09 | 1992-01-14 | E. R. Squibb & Sons, Inc. | Gram-positive and gram-negative antibacterial compounds from the microorganism, janthinobacterium lividum |
| JPH05194141A (ja) | 1992-01-14 | 1993-08-03 | Mitsubishi Kasei Corp | 化粧料 |
| JPH06247964A (ja) | 1993-02-22 | 1994-09-06 | Snow Brand Milk Prod Co Ltd | 新規生理活性物質hs−1及びその製造方法 |
| IT1296148B1 (it) | 1996-11-22 | 1999-06-09 | Renata Maria Anna Ve Cavaliere | Uso di batteri lattici per accrescere il livello delle ceramidi della pelle e delle mucose, e composizioni dermatologiche e cosmetiche atte |
| US5888396A (en) | 1996-12-17 | 1999-03-30 | Perriello; Felix Anthony | Bioremediation of pollutants with butane-utilizing bacteria |
| US6244346B1 (en) | 1996-12-17 | 2001-06-12 | Global Biosciences, Inc. | Method and apparatus for reducing fouling of injection and recovery wells |
| US6716435B1 (en) | 1997-04-18 | 2004-04-06 | Ganeden Biotech, Inc. | Absorbent product containing absorbent structure and Bacillus coagulans |
| US6645506B1 (en) | 1997-04-18 | 2003-11-11 | Ganeden Biotech, Inc. | Topical compositions containing extracellular products of Pseudomonas lindbergii and Emu oil |
| ATE493139T1 (de) | 1997-04-18 | 2011-01-15 | Ganeden Biotech Inc | Oberflächige verwendung von probiotischen bacillussporen zur verhinderung oder bekämpfung von mikrobiellen infektionen |
| US7507402B1 (en) | 1997-04-18 | 2009-03-24 | Ganeden Biotech, Inc. | Topical use of probiotic Bacillus spores to prevent or control microbial infections |
| US7374753B1 (en) | 1997-06-03 | 2008-05-20 | Ganeden Biotech, Inc. | Probiotic lactic acid bacterium to treat bacterial infections associated with SIDS |
| US6811786B1 (en) | 1999-04-01 | 2004-11-02 | Ganeden Biotech, Inc. | Methods for reducing cholesterol using Bacillus coagulans spores, systems and compositions |
| US7767203B2 (en) | 1998-08-07 | 2010-08-03 | Ganeden Biotech, Inc. | Methods for the dietary management of irritable bowel syndrome and carbohydrate malabsorption |
| US6461607B1 (en) | 1998-08-24 | 2002-10-08 | Ganeden Biotech, Inc. | Probiotic, lactic acid-producing bacteria and uses thereof |
| US6224863B1 (en) | 1998-10-30 | 2001-05-01 | University Of South Carolina | Antibiotic composition from alcaligenes species and method for making and using the same |
| IT1306716B1 (it) | 1999-06-21 | 2001-10-02 | Mendes S U R L | Associazione di batteri lattici e suo uso per la prevenzione e/o iltrattamento terapeutico di infezioni e di stati infiammatori. |
| EP1212093B1 (en) | 1999-08-26 | 2004-07-07 | Ganeden Biotech, Inc. | Use of emu oil as a carrier for antifungal, antibacterial and antiviral medications |
| US6849256B1 (en) | 1999-11-08 | 2005-02-01 | Ganeden Biotech Incorporated | Inhibition of pathogens by probiotic bacteria |
| JP4554745B2 (ja) | 1999-11-18 | 2010-09-29 | 日本合成化学工業株式会社 | 乳化重合用分散剤およびその用途 |
| JP2001269699A (ja) | 2000-03-24 | 2001-10-02 | Japan Science & Technology Corp | 硝酸汚染地下水の直接浄化方法 |
| US20030072829A1 (en) | 2001-01-05 | 2003-04-17 | Austin Richard M. | Bacterial isolates from organisms that respire at least partially through their skin and biologically active extracts derived therefrom |
| AUPS057102A0 (en) | 2002-02-15 | 2002-03-07 | Vri Biomedical Ltd | Compositions and methods for treatment of skin disorders |
| WO2003074660A2 (en) | 2002-02-28 | 2003-09-12 | New England Biolabs, Inc. | Modified chitin binding domain and uses thereof |
| US20040243076A1 (en) | 2003-05-13 | 2004-12-02 | Sca Hygiene Products Ab | Hygiene product with a probiotic composition |
| US7244607B2 (en) | 2003-10-01 | 2007-07-17 | The United States Of America, As Represented By The Secretary Of Agriculture | Chromobacterium subtsugae sp. nov. for control of insect pests |
| JP2005126375A (ja) | 2003-10-24 | 2005-05-19 | Shimomura Kinue | 乳酸飲料水 |
| MXPA06015184A (es) | 2004-06-23 | 2007-11-22 | Nestec Sa | Procedimiento y composiciones utiles para prevenir y/o tratar pieles sensibles y/o secas. |
| JP2006253864A (ja) | 2005-03-09 | 2006-09-21 | Fujitsu Ltd | データ蓄積型転送方法及びそのシステム並びに装置 |
| US7385203B2 (en) | 2005-06-07 | 2008-06-10 | Hitachi, Ltd. | Charged particle beam extraction system and method |
| KR100802494B1 (ko) | 2006-02-24 | 2008-02-12 | (주)한국바이오케미칼 | 비올라세인을 함유하는 해충 방제제, 항진균제 및 그의제조방법 |
| JP2007227290A (ja) | 2006-02-27 | 2007-09-06 | Canon Inc | 画像表示装置および映像受信表示装置 |
| CN101659698B (zh) * | 2008-08-26 | 2012-03-28 | 清华大学 | 紫色杆菌素合成相关蛋白质系统及其编码基因簇与应用 |
| CN101386834A (zh) * | 2008-10-28 | 2009-03-18 | 清华大学 | 生产紫色杆菌素的方法及重组菌 |
| JP2010113169A (ja) | 2008-11-07 | 2010-05-20 | Kagawa Univ | 凸版印刷用版材及びその製造方法 |
| US8506952B2 (en) * | 2009-07-03 | 2013-08-13 | James Madison Innovations, Inc. | Probiotic compositions and process thereof |
| JP2011152687A (ja) | 2010-01-27 | 2011-08-11 | Seiko Epson Corp | 液体吐出装置の調整方法及び補正値の算出方法 |
| WO2012098358A1 (en) | 2011-01-20 | 2012-07-26 | Biopharma Technology Ltd | Freeze drying method |
| KR101982491B1 (ko) | 2011-08-30 | 2019-05-27 | 아카데미쉬 메디쉬 센트륨 | 인슐린 저항 예방 및/또는 치료 방법 |
| HUE029357T2 (en) | 2012-05-08 | 2017-02-28 | Adaptive Biotechnologies Corp | Preparations and devices for measuring and calibrating amplification distortion in multiplex PCR reactions |
| WO2014029578A1 (en) | 2012-08-24 | 2014-02-27 | Haldor Topsøe A/S | Method and catalyzed filter element with improved alkali-resistance for flue gas cleaning |
| WO2014145958A2 (en) | 2013-03-15 | 2014-09-18 | Seres Health, Inc. | Network-based microbial compositions and methods |
| CN105979952B (zh) | 2013-11-25 | 2022-04-08 | 赛里斯治疗公司 | 协同细菌组合物以及其制造方法和用途 |
| EP4299122A3 (en) | 2014-05-07 | 2024-03-27 | The Regents of The University of California | Compositions and methods for treating skin and mucous membrane diseases |
| CN104293703A (zh) * | 2014-09-22 | 2015-01-21 | 中国农业科学院农产品加工研究所 | 一种高产紫色杆菌素的兰黑紫色杆菌及其应用 |
| WO2019118984A2 (en) * | 2017-12-15 | 2019-06-20 | Solarea Bio, Inc. | Microbial compositions and methods for treating type 2 diabetes, obesity, and metabolic syndrome |
| UA126440C2 (uk) | 2018-12-27 | 2022-10-05 | Ігор Семенович Марков | Полівалентна комбінована інактивована рідка вакцина проти збудників бактеріальних і грибкових захворювань сечостатевої системи, спосіб її виготовлення і спосіб лікування та профілактики нею |
| WO2020179999A1 (ko) | 2019-03-07 | 2020-09-10 | 씨제이제일제당(주) | 바실러스 서브틸리스 cjbs303 및 이를 포함하는 조성물 |
-
2020
- 2020-04-09 SG SG11202111168UA patent/SG11202111168UA/en unknown
- 2020-04-09 CA CA3132858A patent/CA3132858A1/en active Pending
- 2020-04-09 US US17/602,708 patent/US20220160617A1/en not_active Abandoned
- 2020-04-09 CN CN202080027750.1A patent/CN113853198A/zh active Pending
- 2020-04-09 AU AU2020271885A patent/AU2020271885A1/en not_active Abandoned
- 2020-04-09 WO PCT/US2020/027556 patent/WO2020210553A1/en not_active Ceased
- 2020-04-09 KR KR1020217036685A patent/KR20220003539A/ko not_active Ceased
- 2020-04-09 MX MX2021012391A patent/MX2021012391A/es unknown
- 2020-04-09 BR BR112021020247A patent/BR112021020247A2/pt unknown
- 2020-04-09 JP JP2021560596A patent/JP2022526446A/ja active Pending
- 2020-04-09 EP EP20722912.1A patent/EP3952848A1/en not_active Withdrawn
- 2020-05-27 US US16/885,152 patent/US11040077B2/en active Active
-
2021
- 2021-04-28 US US17/243,509 patent/US12064459B2/en active Active
- 2021-07-23 US US17/384,598 patent/US20210386802A1/en not_active Abandoned
- 2021-10-06 IL IL287032A patent/IL287032A/en unknown
-
2024
- 2024-07-02 US US18/762,414 patent/US20250295713A1/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210361725A1 (en) * | 2019-04-09 | 2021-11-25 | Dermbiont, Inc. | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
| US20210386802A1 (en) * | 2019-04-09 | 2021-12-16 | Dermbiont, Inc. | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes |
Non-Patent Citations (1)
| Title |
|---|
| Janda et al.: 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls, Journal of Clinical Microbiology Vol. 45, No. 9, 09/01/2007. (Year: 2007) * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4438052A1 (en) * | 2023-03-30 | 2024-10-02 | FytagoLife B.V. | Plant extract for use in treatment of a fungal infection |
| WO2024205410A1 (en) * | 2023-03-30 | 2024-10-03 | Fytagolife B.V. | Plant extract for use in treatment of a fungal infection |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2022526446A (ja) | 2022-05-24 |
| WO2020210553A1 (en) | 2020-10-15 |
| US12064459B2 (en) | 2024-08-20 |
| CA3132858A1 (en) | 2020-10-15 |
| SG11202111168UA (en) | 2021-11-29 |
| EP3952848A1 (en) | 2022-02-16 |
| AU2020271885A1 (en) | 2021-11-25 |
| IL287032A (en) | 2021-12-01 |
| US11040077B2 (en) | 2021-06-22 |
| KR20220003539A (ko) | 2022-01-10 |
| US20210386802A1 (en) | 2021-12-16 |
| US20200345799A1 (en) | 2020-11-05 |
| CN113853198A (zh) | 2021-12-28 |
| MX2021012391A (es) | 2022-01-18 |
| US20210361725A1 (en) | 2021-11-25 |
| US20250295713A1 (en) | 2025-09-25 |
| BR112021020247A2 (pt) | 2021-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12064459B2 (en) | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with pathogenic microbes | |
| US20240269198A1 (en) | Compositions and methods for improving skin health and for the treatment and prevention of diseases, disorders and conditions associated with fungi and other pathogenic microbes | |
| AU2019339515B2 (en) | Bacteriotherapy against proprionibacterium acnes for the treatment of acne | |
| WO2016054093A1 (en) | Altering human cutaneous microbiome to increase growth of staphylococcus epidermidis and reduce staphylococcus aureus proliferation | |
| WO2020118054A1 (en) | Compositions for stabilizing bacteria and uses thereof | |
| US20240350561A1 (en) | Probiotic bacteria composition for inhibiting fungal proliferation | |
| EP3445448A1 (en) | Skin disorder therapeutics and methods of use | |
| US20250134866A1 (en) | Commensal signalling compounds for treating or preventing microbiome dysfunction in the skin or mouth | |
| HK40066550A (zh) | 用於改善皮肤健康和用於治疗和预防与病原微生物相关联的疾病、疾患和病症的组合物和方法 | |
| CN118139633A (zh) | 用于抑制真菌增殖的益生菌组合物 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: APPLICATION UNDERGOING PREEXAM PROCESSING |
|
| AS | Assignment |
Owner name: DERMBIONT, INC., MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BRUCKER, ROBERT M.;ZHANG, XUECHENG;LISTER, IDA;AND OTHERS;REEL/FRAME:057795/0128 Effective date: 20200508 |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |