US20210260182A1 - RECOMBINANT POXVIRUS BASED VACCINE AGAINST SARS-CoV-2 VIRUS - Google Patents

RECOMBINANT POXVIRUS BASED VACCINE AGAINST SARS-CoV-2 VIRUS Download PDF

Info

Publication number
US20210260182A1
US20210260182A1 US17/187,678 US202117187678A US2021260182A1 US 20210260182 A1 US20210260182 A1 US 20210260182A1 US 202117187678 A US202117187678 A US 202117187678A US 2021260182 A1 US2021260182 A1 US 2021260182A1
Authority
US
United States
Prior art keywords
virus
sars
poxvirus
cov
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
US17/187,678
Other languages
English (en)
Inventor
Seth Lederman
Scott J. Goebel
David Evans
Ryan Noyce
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Alberta
Tonix Pharma Ltd Ireland
Tonix Pharmaceuticals Holding Corp
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US17/187,678 priority Critical patent/US20210260182A1/en
Assigned to Tonix Pharmaceuticals, Inc. reassignment Tonix Pharmaceuticals, Inc. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: INSTITUTE, SOUTHERN RESEARCH
Assigned to TONIX PHARMACEUTICALS HOLDING CORP. reassignment TONIX PHARMACEUTICALS HOLDING CORP. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: LEDERMAN, SETH
Assigned to INSTITUTE, SOUTHERN RESEARCH reassignment INSTITUTE, SOUTHERN RESEARCH ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: GOEBEL, SCOTT J.
Publication of US20210260182A1 publication Critical patent/US20210260182A1/en
Assigned to TONIX PHARMA LIMITED reassignment TONIX PHARMA LIMITED ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: TONIX PHARMACEUTICALS HOLDING CORP.
Assigned to TONIX PHARMACEUTICALS HOLDING CORP. reassignment TONIX PHARMACEUTICALS HOLDING CORP. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: Tonix Pharmaceuticals, Inc.
Assigned to THE GOVERNORS OF THE UNIVERSITY OF ALBERTA reassignment THE GOVERNORS OF THE UNIVERSITY OF ALBERTA ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: EVANS, DAVID, NOYCE, Ryan
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/215—Coronaviridae, e.g. avian infectious bronchitis virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/572—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/70—Multivalent vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20071—Demonstrated in vivo effect
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/15—Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination

Definitions

  • Coronaviruses are enveloped single stranded RNA viruses with positive-sense RNA genomes ranging from 25.5 to ⁇ 32 kb in length.
  • the spherical virus particles range from 70-120 nm in diameter with four structural proteins.
  • An aspect of the present disclosure provides a recombinant poxvirus comprising a nucleic acid encoding a SARS-CoV-2 virus protein, methods for producing such viruses and the use of such viruses, for example, as immunogens, in immunogenic formulations against SARS-CoV-2 virus.
  • Another aspect of the present disclosure provides a recombinant synthetic poxvirus comprising a nucleic acid encoding a SARS-CoV-2 virus protein, methods for producing such viruses and the use of such viruses, for example, as immunogens, in immunogenic formulations against SARS-CoV-2 virus.
  • the synthetic poxviruses are assembled and replicated from chemically synthesized DNA which are safe, reproducible and free of contaminants. Because chemical genome synthesis is not dependent on a natural template, a plethora of structural and functional modifications of the viral genome are possible. Chemical genome synthesis is particularly useful when a natural template is not available for genetic replication or modification by conventional molecular biology methods.
  • the disclosure relates to pharmaceutical compositions comprising the recombinant poxviruses of the disclosure.
  • the disclosure relates to cells infected with the recombinant poxviruses of the disclosure.
  • the disclosure relates to methods for selecting a cell that expresses a SARS-CoV-2 virus protein, comprising infecting said cell with the recombinant poxvirus of the disclosure and selecting the infected cell expressing said SARS-CoV-2 virus protein.
  • the disclosure relates to methods of inducing an immune response against a SARS-CoV-2 virus in a subject in need or at risk therefor, comprising administering to said subject an immunologically effective amount of a recombinant poxvirus of the disclosure.
  • the disclosure relates to methods of generating the recombinant poxviruses of the disclosure, the methods comprising: (a) infecting a host cell with a poxvirus; (b) transfecting the infected cell of step (a) with a nucleic acid encoding a SARS-CoV-2 virus protein to generate a recombinant poxvirus; and (c) selecting a recombinant poxvirus, wherein the nucleic acid encoding a SARS-CoV-2 virus protein is located, upon transfection, in a region of the poxvirus that is not essential for the replication of the poxvirus.
  • FIG. 1 Schematic representation of the linear dsDNA synthetic HPXV (GenBank accession Number KY349117) and synthetic VACV (synVACV) (GenBank accession Number MN974381) genomes.
  • the Thymidine Kinase (TK) gene locus is depicted in orange.
  • the TK gene locus in HPXV is located at genome positions: 92077-92610 with gene ID HPXV095 (SEQ ID NO: 1).
  • the TK gene locus in VACV is located at genome positions: 83823-84344 with gene ID synVACV_105 (SEQ ID NO: 2).
  • FIG. 2 Schematic representation of the TK gene locus (HPXV095) of HPXV of approximately 4 kb, located between the HPXV094 and HPXV096 flanking regions.
  • FIG. 3 Sequence alignment of the TK gene locus of synthetic HPXV and synthetic VACV ACAM2000, where it is shown that the nucleotide similarity is around 99%.
  • FIG. 3 refers to SEQ ID NOs: 34-36, respectively, in order of appearance.
  • FIG. 4 Schematic representation of the linear dsDNA HPXV, showing the generation of the PCR fragment encoding the SARS-CoV-2 expression cassette.
  • the expression cassette is introduced in the TK gene locus of the HPXV genome and comprises the SARS-CoV2 Spike S gene that is operatively linked to a vaccinia virus early and late promoter inserted upstream of the SARS-CoV-2 Spike S gene.
  • FIG. 5 Schematic representation of the HPXV and VACV, ACAM 2000 rescue viruses and the insertion of the synthesized expression cassette encoding the SARS-CoV-2 Spike S protein by recombination with the left and right recombination flanking arms.
  • FIG. 6 Schematic representation of the method of generating a recombinant HPXV, which comprises (1) infection of BSC-40 cells with the HPXV expressing yfpgpt cassette in the HPXV095 locus; (2) transfection of the infected cells with the synthesized Expression Cassette 24 hours post infection; (3) Harvest the cell lysate, release progeny virus of HPXV and recombinant HPXV expressing SARS-CoV-2 Spike S protein (rHPXV-SARS S) with repeated cycles rounds of freeze/thaw 48 hours post infection/transfection and (4) selection of cells comprising the rHPXV-SARS S.
  • rHPXV-SARS S SARS-CoV-2 Spike S protein
  • FIG. 7 Schematic representation of the selection and purification of a recombinant HPXV comprising SARS-CoV-2 S protein, which comprises (1) previous steps of infection/transfection; (2) the harvest and cell lysis of the cells to release the control HPXV and the rHPXV-SARS S progeny; (3) plate titrations of progeny virus on BSC-40 cells; and (4) look for non-fluorescent plaques with a fluorescent microscope.
  • Virus progeny that have replaced the yfpgpt cassette with SARS-CoV-2 S are non-fluorescent.
  • FIG. 8 Early, late and overlapping early/late Vaccinia Virus promoters. Core, spacer and initiator (init) are shown.
  • Panel A shows the Early promoter nucleotide sequence (SEQ ID NO: 3); specific nucleotides required for optimal expression are indicated using the 4-base code; noncritical nucleotides are indicated by N; a purine must be present within the init region.
  • Panel B shows the Late promoter nucleotide sequence (SEQ ID NO: 4); the T-run and TAAAT init sequence provide high expression.
  • Panel B shows the synthetic Early/Late promoter nucleotide sequence (SEQ ID NO: 5); the elements of the early and late promoter are indicated above and below the sequence, respectively.
  • FIG. 9 Nucleotide sequence of variations of the overlapping early/late Vaccinia Virus promoters, comprising different spacers 3′ of the late promoter.
  • Panel A shows a 38-nucleotides spacer (SEQ ID NO: 40; full-length sequence of promoter and spacer recited in SEQ ID NO: 37);
  • Panel B shows a 99-nucleotides spacer (SEQ ID NO: 41; full-length sequence of promoter and spacer recited in SEQ ID NO: 38) and
  • Panel C shows a 160-nucleotides spacer (SEQ ID NO: 42; full-length sequence of promoter and spacer recited in SEQ ID NO: 39).
  • FIG. 10 Schematic representation of the method of generating a recombinant scHPXV or synVACV comprising a nucleic acid encoding a SARS-CoV-2 S protein, which comprises (1) infection of BSC-40 cells with the rescue HPXV or VACV virus and (2) transfection of the infected BSC-40 cells with a PCR-generated fragment in the TK gene locus, wherein the PCR-generated fragment comprises the engineered SARS-CoV-2 S gene expression cassette.
  • the SARS-CoV-2 S gene contains one or more modifications (at least Y459H is present).
  • the resulting modified S protein is adapted to infect mice.
  • the vaccinia Early Transcription Terminator Signal ETTS T 5 NT (SEQ ID NO: 14) are also removed from the SARS-CoV-2 S gene through coding silent mutagenesis to generate full length transcripts during the early phase of the infection.
  • FIG. 11 Western blot of SARS-CoV-2 Spike protein expression from BSC-40 cells infected with synVACV ⁇ A2K105 yfp-gpt or synVACV ⁇ A2K105 SARSCoV2-SPIKE-co::nm (TNX-2200) clones 1.1.1.1.1 or 2.1.1.1.1. “Mock” represents a negative control group with no virus. “Mr” is a set of molecular weight markers in kiloDaltons (kDa).
  • S multimer the Spike multimer protein
  • FL S-G the full length glycosylated spike protein
  • FL S the full length spike protein
  • VACV I3 the single stranded DNA binding 13 protein (an internal control)
  • SPIKE-co::nm a spike protein that is codon optimized and has no marker, indicating there is no YFP-GPT expression.
  • FIG. 12 Western blot of Spike protein expression from BSC-40 cells infected with synthetic TNX-801, TNX-1800a-1, or TNX-1800b-2.
  • “Mock” represents a negative control group with no virus.
  • “kDa” is kiloDaltons (molecular weight).
  • the labels on the right identify various proteins: “S multimer”: the Spike multimer protein; “FL S-G”: the full length glycosylated spike protein.; “FL S” the full length spike protein; “VACV I3”: the single stranded DNA binding 13 protein (an internal control).
  • FIG. 13 Schematic of day 7 cutaneous reactions (“takes”) in African Green Monkeys (AGM) vaccinated with a 2.9 ⁇ 10 6 PFU TNX-801.
  • Panel A shows a female AGM (Animal #: 1F 16986);
  • Panel B shows a female AGM (Animal #: 1F 16994);
  • Panel C shows a male AGM (Animal #: 1M 16975);
  • Panel D shows a male AGM (Animal #: 1M 16977).
  • FIG. 14 Schematic of day 7 cutaneous reaction (“takes”) in African Green Monkeys (AGM) vaccinated with 1.06 ⁇ 10 6 PFU TNX-801.
  • Panel A shows a female AGM (Animal #: 2F 16985);
  • Panel B shows a female AGM (Animal #: 1F 16991);
  • Panel C shows a male AGM (Animal #: 2M 16980);
  • Panel D shows a male AGM (Animal #: 1M 16983).
  • FIG. 15 Schematic of day 7 cutaneous reaction (“takes”) in African Green Monkeys (AGM) vaccinated with 2.9 ⁇ 10 6 PFU TNX-1800b-2.
  • Panel A shows a female AGM (Animal #: 3F 16988);
  • Panel B shows a female AGM (Animal #: 3F 16995);
  • Panel C shows a male AGM (Animal #: 3M 16976);
  • Panel D shows a male AGM (Animal #: 3M 16982).
  • FIG. 16 Schematic of day 7 cutaneous reaction (“takes”) in African Green Monkeys (AGM) vaccinated with 1.06 ⁇ 10 6 PFU TNX-1800b-2.
  • Panel A shows a female AGM (Animal #: 4F 16989);
  • Panel B shows a female AGM (Animal #: 4F 16990);
  • Panel C shows a male AGM (Animal #: 4M 16972);
  • Panel D shows a male AGM (Animal #: 4M 16973).
  • FIG. 17 Schematic of day 7 cutaneous reaction (“takes”) in African Green Monkeys (AGM) vaccinated with 0.6 ⁇ 10 6 PFU TNX-1800a-1.
  • Panel A shows a female AGM (Animal #: 5F 16992);
  • Panel B shows a female AGM (Animal #: 5F 16993);
  • Panel C shows a male AGM (Animal #: 5M 16979);
  • Panel D shows a male AGM (Animal #: 5M 16981).
  • FIG. 18 Stained plates showing cytopathic effects in BSC-40, HeLa and HEK 293 cells 48 hours after infection with TNX-801, TNX-1800b-2, TNX-1200, or TNX-2200.
  • FIGS. 19A, 19B, 19C and 19D Viral growth curves in BSC-40, HeLa and HEK 293 cells over time.
  • FIG. 19A shows cells infected with TNX-1200;
  • FIG. 19B shows cells infected with TNX-2200;
  • FIG. 19C shows cells infected with TNX-801; and
  • FIG. 19D shows cells infected with TNX-1800b-2.
  • FIGS. 20A and 20B Viral growth curves in BSC-40 cells infected with a synthetic horsepox virus (HPXV) over time.
  • FIG. 20A shows viral titer (PFU/mL) measured in cells infected with TNX-801, scHPXV ⁇ 095 yfp-gpt , TNX-1800a-1, scHPXV ⁇ 200 yfp-gpt , or TNX-1800b-2;
  • FIG. 20B shows fold change from input in infected cells.
  • FIGS. 21A and 21B Viral growth curves in BSC-40 cells infected with a synthetic vaccinia virus (VACV) over time.
  • FIG. 21A shows viral titer (PFU/mL) measured in cells infected with TNX-1200, TNX-2200 or synVACV ⁇ A2K105 yfp-gpt ;
  • FIG. 21B shows fold change from input in infected cells.
  • FIG. 22 Schematic representation of a linear dsDNA HPXV, showing the generation of a PCR fragment encoding a SARS-CoV-2 expression cassette.
  • the expression cassette is introduced into the TK gene locus of the HPXV genome and comprises a DNA encoding the SARS-CoV2 Spike S gene protein that is operatively linked to a vaccinia virus early and late promoter inserted upstream of the SARS-CoV-2 Spike S DNA.
  • the expression cassette further comprises a 1 kb HPXV left flanking arm (e.g., HPXV092, HPXV093 and HPXV094) and a 1 kb HPXV right flanking arm (e.g., HPXV096).
  • Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein.
  • the nomenclatures used in connection with, and the laboratory procedures and techniques of, analytical chemistry, biochemistry, immunology, molecular biology, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses, and chemical analyses.
  • chimeric or “engineered” or “modified” (e.g., chimeric poxvirus, engineered polypeptide, modified polypeptide, engineered nucleic acid, modified nucleic acid) or grammatical variations thereof are used interchangeably herein to refer to a non-native sequence that has been manipulated to have one or more changes relative a native sequence.
  • essential gene for replication or “essential region for replication” refers to those gene(s) or region(s) indispensable for the replication of an organism, and therefore are considered a foundation of life.
  • a gene or region is considered essential (i.e. has a role in cell culture) if its deletion results in a decrease in virus titer of greater than 10-fold in either a single or multiple step growth curve.
  • Most of the essential genes are thought to encode proteins that maintain a central metabolism, replicate DNA, translate genes into proteins, maintain a basic cellular structure, and mediate transport processes into and out of the cell. Genes involved in virion production, actin tail formation, and extracellular virion release are typically also considered as essential.
  • transposons Two main strategies have been employed to identify essential genes on a genome-wide basis: directed deletion of genes and random mutagenesis using transposons.
  • individual genes or ORFs
  • random mutagenesis transposons are randomly inserted in as many positions in a genome as possible, aiming to inactivate the targeted genes. Insertion mutants that are still able to survive or grow are not in essential genes. (Zhang, R., 2009 & Gerdes, S., 2006).
  • expression cassette or “transcription unit”, as used herein, defines a nucleic acid sequence region that contains one or more genes to be transcribed.
  • the nucleotide sequences encoding the to be transcribed gene(s), as well as the polynucleotide sequences containing the regulatory elements contained within an expression cassette, are operably linked to each other.
  • the genes are transcribed from a promoter and transcription is terminated by at least one polyadenylation signal.
  • each of the one or more genes are transcribed from one promoter.
  • the one or more genes are transcribed from one single promoter. In that case, the different genes are at least transcriptionally linked.
  • Each transcription unit will comprise the regulatory elements necessary for the transcription and translation of any of the selected sequences that are contained within the unit.
  • Each transcription unit may contain the same or different regulatory elements.
  • homologous when modified with an adverb such as “highly,” may refer to sequence similarity and may or may not relate to a common evolutionary origin.
  • Heterologous in all its grammatical forms and spelling variations, may refer to a nucleic acid which is non-native to the virus. It means derived from a different species or a different strain than the nucleic acid of the organism to which the nucleic acid is described as being heterologous relative to.
  • the viral genome of the synVACV comprises heterologous terminal hairpin loops. Those heterologous terminal hairpin loops can be derived from a different viral species or from a different VACV strain.
  • a “host cell” includes an individual cell or cell culture that can be or has been a recipient for the virus of the disclosure.
  • Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or in genomic DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation.
  • a host cell includes cells transfected and/or transformed in vivo with a poxvirus of this disclosure.
  • an “immunologically effective amount” refers to the amount to be administered of a composition of matter that comprises at least one antigen, or immunogenic portion thereof, which is able to elicit an immunological response in the host cell or an antibody-mediated immune response to the composition.
  • An immunologically effective amount of a recombinant poxvirus refers to the amount of poxviral particles necessary to deliver a SARS-CoV-2 virus protein and elicit an immune response against said SARS-CoV-2 virus protein.
  • an immunologically effective amount of the recombinant poxvirus of the present disclosure is an amount within the range of 10 2 -10 9 PFU.
  • an immunologically effective amount of the recombinant poxvirus of the present disclosure is from about 10 3 -10 5 PFU. In some embodiments, an immunologically effective amount of the recombinant poxvirus of the present disclosure is about 10 5 PFU.
  • operative linkage and “operatively linked” (or “operably linked”) or variations thereof, as used herein, are used interchangeably with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components.
  • the nucleic acid encoding a SARS-CoV-2 virus protein may be operatively linked to a promoter.
  • the nucleic acid sequence encoding a SARS-CoV-2 virus protein may be operatively linked in cis with a poxvirus specific promoter nucleic acid sequence, but does not need to be directly adjacent to it.
  • a linker sequence can be located between both sequences.
  • MOI multiplicity of infection
  • patient refers to either a human or a non-human animal.
  • mammals such as humans, primates, livestock animals (including bovines, porcines, camels, etc.), companion animals (e.g., canines, felines, etc.) and rodents (e.g., mice and rats).
  • polynucleotide or “nucleic acid,” as used interchangeably herein, refer to chains of nucleotides of any length, and include DNA and RNA.
  • the nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a chain by DNA or RNA polymerase.
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modification to the nucleotide structure may be imparted before or after assembly of the chain.
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
  • Other types of modifications include, for example, “caps”, substitution of one or more of the naturally occurring nucleotides with an analog; internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.); those containing pendant moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.); those with intercalators (e.g., acridine, psoralen, etc.); those containing chelators (e.g., metal
  • any of the hydroxyl groups ordinarily present in the sugars may be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to prepare additional linkages to additional nucleotides, or may be conjugated to solid supports.
  • the 5′ and 3′ terminal OH can be phosphorylated or substituted with amines or organic capping group moieties of from 1 to 20 carbon atoms.
  • Other hydroxyls may also be derivatized to standard protecting groups.
  • Polynucleotides can also contain analogous forms of ribose or deoxyribose sugars that are generally known in the art, including, for example, 2′-O-methyl-, 2′-O-allyl, 2′-fluoro- or 2′-azido-ribose, carbocyclic sugar analogs, alpha- or beta-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs and abasic nucleoside analogs such as methyl riboside.
  • One or more phosphodiester linkages may be replaced by alternative linking groups.
  • linking groups include, but are not limited to, embodiments wherein phosphate is replaced by P(O)S(“thioate”), P(S)S (“dithioate”), (O)NR 2 (“amidate”), P(O)R, P(O)OR′, CO or CH 2 (“formacetal”), in which each R or R′ is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing an ether and (—O—) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not all linkages in a polynucleotide need be identical. The preceding description applies to all polynucleotides referred to herein, including RNA and DNA.
  • polypeptide “oligopeptide”, “peptide” and “protein” are used interchangeably herein to refer to chains of amino acids of any length.
  • the chain may be linear or branched, it may comprise modified amino acids, and/or may be interrupted by non-amino acids.
  • the terms also encompass an amino acid chain that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
  • polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids, etc.
  • the polypeptides can occur as single chains or associated chains.
  • Percent (%) sequence identity or “sequence % identical to” with respect to a reference polypeptide (or nucleotide) sequence is defined as the percentage of amino acid residues (or nucleic acids) in a candidate sequence that are identical with the amino acid residues (or nucleic acids) in the reference polypeptide (nucleotide) sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • positions of the viral genome can be altered.
  • position as used herein is meant a location in the genome sequence. Corresponding positions are generally determined through alignment with other parent sequences.
  • purify refers to the removal, whether completely or partially, of at least one impurity from a mixture containing the polypeptide and one or more impurities, which thereby improves the level of purity of the polypeptide in the composition (i.e., by decreasing the amount (ppm) of impurity(ies) in the composition).
  • purified in the context of viruses refers to a virus which is substantially free of cellular material and culture media from the cell or tissue source from which the virus is derived.
  • substantially free of cellular material includes preparations of virus in which the virus is separated from cellular components of the cells from which it is isolated or recombinantly produced.
  • the term “recombinant poxvirus” refers to a poxvirus comprising an exogenous or heterologous sequence in its genome generated by artificial manipulation of the viral genome, i.e. generation by recombinant DNA technology.
  • the recombinant poxvirus contains an exogenous polynucleotide sequence encoding a polypeptide of interest.
  • the recombinant poxvirus comprises a nucleic acid encoding a SARS-CoV-2 virus protein.
  • the term “residue” in the context of a polypeptide refers to an amino-acid unit in the linear polypeptide chain. It is what remains of each amino acid, i.e. —NH—CHR—C—, after water is removed in the formation of the polypeptide from ⁇ -amino-acids, i.e. NH2-CHR—COOH.
  • sequence similarity in all its grammatical forms, refers to the degree of identity or correspondence between nucleic acid or amino acid sequences that may or may not share a common evolutionary origin.
  • synthetic virus refers to a virus initially derived from synthetic DNA (e.g., chemically synthesized DNA, PCR amplified DNA, engineered DNA, polynucleotides comprising nucleoside analogs, etc., or combinations thereof) and includes its progeny, and the progeny may not necessarily be completely identical (in morphology or in genomic DNA complement) to the original parent synthetic virus due to natural, accidental, or deliberate mutation.
  • the synthetic virus refers to a virus where substantially all of the viral genome is initially derived from synthetic DNA (e.g., chemically synthesized DNA, PCR amplified DNA, engineered DNA, polynucleotides comprising nucleoside analogs, etc., or combinations thereof).
  • the synthetic virus is derived from chemically synthesized DNA.
  • substantially pure refers to material which is at least 50% pure (i.e., free from contaminants), more preferably, at least 90% pure, more preferably, at least 95% pure, yet more preferably, at least 98% pure, and most preferably, at least 99% pure.
  • the term “vaccine”, as used herein, refers to a composition comprising at least one immunologically active component that induces an immunological response in an animal and possibly, but not necessarily, one or more additional components that enhance the immunological activity of the active component.
  • a vaccine may additionally comprise further components typical to pharmaceutical compositions.
  • the immunologically active component of a vaccine may comprise complete virus particles in either their original form or as attenuated particles (modified live vaccine), or particles inactivated by appropriate methods (killed or inactivated vaccine).
  • the immunologically active component of a vaccine may comprise appropriate elements of the organisms (subunit vaccines) that best stimulate the immune system.
  • the immunologically active component may be a protein of the viral envelope.
  • the immunologically active component may be a protein forming part of the nucleocapsid.
  • the immunologically active component of a vaccine against SARS-CoV-2 is an envelope protein.
  • Non-limiting examples of such proteins are the Spike protein (S), the Membrane protein (M) and the Hemagglutinin-Esterase protein (HE).
  • the immunologically active component of a vaccine against SARS-CoV-2 is the nucleocapsid protein (N).
  • viral vector describes a genetically modified virus which was manipulated by a recombinant DNA technique in a way so that its entry into a host cell is capable of resulting in a specific biological activity, e.g. the expression of a foreign target gene carried by the vector.
  • a viral vector may or may not be replication competent in the target cell, tissue, or organism.
  • a viral vector can incorporate sequences from the genome of any known organism. The sequences can be incorporated in their native form or can be modified in any way to obtain a desired activity. For example, the sequences can comprise insertions, deletions or substitutions.
  • a viral vector can also incorporate an insertion site for an exogenous polynucleotide sequence.
  • the viral vector is a poxvirus.
  • the viral vector is a horsepox viral vector.
  • the viral vector is a synthetic horsepox viral vector.
  • wild type virus As used herein, the terms “wild type virus”, “wild type genome”, “wild type protein,” or “wild type nucleic acid” refer to a sequence of amino or nucleic acids that occurs naturally within a certain population (e.g., a particular viral species, etc.).
  • Poxviruses are large ( ⁇ 200 kbp) DNA viruses that replicate in the cytoplasm of infected cells.
  • the Orthopoxvirus (OPV) genus comprises a number of poxviruses that vary greatly in their ability to infect different hosts.
  • Vaccinia virus (VACV) for example, can infect a broad group of hosts, whereas variola virus (VARV), the causative agent of smallpox, only infects humans.
  • VACV variola virus
  • a feature common to many, if not all poxviruses, is their ability to non-genetically “reactivate” within a host. Non-genetic reactivation refers to a process wherein cells infected by one poxvirus can promote the recovery of a second “dead” virus (for example one inactivated by heat) that would be non-infectious on its own.
  • Purified poxvirus DNA is not infectious because the virus life cycle requires transcription of early genes via the virus-encoded RNA polymerases that are packaged in virions.
  • virus DNA is transfected into cells previously or subsequently infected with a helper poxvirus, providing the necessary factors needed to transcribe, replicate, and package the transfected genome in trans (Sam C K, Dumbell K R. Expression of poxvirus DNA in coinfected cells and marker rescue of thermosensitive mutants by subgenomic fragments of DNA. Ann Virol (Inst Past). 1981; 132:135-50).
  • a desired virus can be obtained by performing a reactivation reaction in a cell line that supports the propagation of both viruses, and then eliminating the helper virus by plating the mixture of viruses on cells that do not support the helper virus' growth (Scheiflinger F, Dorner F, Falkner F G. Construction of chimeric vaccinia viruses by molecular cloning and packaging. Proceedings of the National Academy of Sciences of the United States of America. 1992; 89(21):9977-81).
  • the present disclosure provides recombinant poxviruses comprising a nucleic acid encoding a SARS-CoV-2 virus protein, wherein the SARS-CoV-2 protein is selected from the group consisting of the spike protein (S), the membrane protein (M) and the nucleocapsid protein (N), or combinations of two or more of said proteins.
  • S spike protein
  • M membrane protein
  • N nucleocapsid protein
  • the poxvirus belongs to the Chordopoxvirinae subfamily. In some embodiments, the poxvirus belongs to a genus of Chordopoxvirinae subfamily selected from Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Crocodylipoxvirus, Leporipoxvirus, Molluscipoxvirus, Orthopoxvirus, Parapoxvirus, Suipoxvirus, or Yatapoxvirus. In some embodiments, the recombinant poxvirus is an Orthopoxvirus.
  • the Orthopoxvirus is selected from the group consisting of camelpox virus (CMLV), cowpox virus (CPXV), ectromelia virus (ECTV, “mousepox agent”), horsepox virus (HPXV), monkeypox virus (MPXV), rabbitpox virus (RPXV), raccoonpox virus, skunkpox virus, Taterapox virus, Uasin Gishu disease virus, vaccinia virus (VACV), variola virus (VARV) and volepox virus (VPV).
  • the poxvirus is a Parapoxvirus.
  • the Parapoxvirus is selected from orf virus (ORFV), pseudocowpox virus (PCPV), bovine popular stomatitis virus (BPSV), squirrel parapoxvirus (SPPV), red deer parapoxvirus, Ausdyk virus, Chamois contagious ecythema virus, reindeer parapoxvirus, or sealpox virus.
  • ORFV orf virus
  • PCPV pseudocowpox virus
  • BPSV bovine popular stomatitis virus
  • SPPV squirrel parapoxvirus
  • red deer parapoxvirus Ausdyk virus
  • Chamois contagious ecythema virus Chamois contagious ecythema virus
  • reindeer parapoxvirus or sealpox virus.
  • the poxvirus is a Molluscipoxvirus.
  • the Molluscipoxvirus is molluscum contagiousum virus (MCV).
  • the poxvirus is a Yatapoxvirus
  • the Yatapoxvirus is selected from Tanapox virus or Yaba monkey tumor virus (YMTV).
  • the poxvirus is a Capripoxvirus.
  • the Capripoxvirus is selected from sheepox, goatpox, or lumpy skin disease virus.
  • the poxvirus is a Suipoxvirus.
  • the Suipoxvirus is swinepox virus.
  • the poxvirus is a Leporipoxvirus.
  • the Leporipoxvirus is selected from myxoma virus, Shope fibroma virus (SFV), squirrel fibroma virus, or hare fibroma virus.
  • the poxvirus is an HPXV.
  • the horsepox virus is strain MNR-76.
  • the poxvirus is a VACV.
  • the VACV is selected from the group of strains consisting of: Western Reserve, Western Reserve Clone 3, Tian Tian, Tian Tian clone TP5, Tian Tian clone TP3, NYCBH, NYCBH clone Acambis 2000, Wyeth, Copenhagen, Lister, Lister 107, Lister-LO, Lister GL-ONC1, Lister GL-ONC2, Lister GL-ONC3, Lister GL-ONC4, Lister CTC1, Lister IMG2 (Turbo FP635), IHD-W, LC16m18, Lederle, Tashkent clone TKT3, Tashkent clone TKT4, USSR, Evans, Praha, L-IVP, V-VET1 or LIVP 6.1.1, Ikeda, EM-
  • Chemical viral genome synthesis opens up the possibility of introducing a large number of useful modifications to the resulting genome or to specific parts of it.
  • the modifications may improve ease of cloning to generate the virus, provide sites for introduction of recombinant gene products, improve ease of identifying reactivated viral clones and/or confer a plethora of other useful features (e.g. introducing a desired antigen, producing an oncolytic virus, etc.).
  • the modifications may include the attenuation or deletion of one or more virulence factors.
  • the modifications may include the addition or insertion of one or more virulence regulatory genes or gene-encoding regulatory factors.
  • the terminal hairpins of poxviruses have been difficult to clone and to sequence.
  • some of the published genome sequences e.g., VACV, ACAM 2000 and HPXV MNR-76
  • the published sequence of the HPXV genome is likewise incomplete, probably missing ⁇ 60 bp from the terminal ends.
  • 129 nt ssDNA fragments were chemically synthesized using the published sequence of the VACV terminal hairpins as a guide and ligated onto dsDNA fragments comprising left and right ends of the HPXV genome.
  • the terminal hairpins of the poxvirus of the disclosure are derived from VACV.
  • the terminal hairpins are derived from CMLV, CPXV, ECTV, HPXV, MPXV, RPXV, raccoonpox virus, skunkpox virus, Taterapox virus, Uasin Gishu disease virus or VPV.
  • the terminal hairpins are based on the terminal hairpins of any poxvirus whose genome has been completely sequenced or a natural isolate of which is available for genome sequencing.
  • the poxviruses are synthetic versions of HPXV comprising the terminal hairpins of VACV (GenBank accession number KY349117; see US 2018/0251736, incorporated by reference herein).
  • the modifications introduced in a poxvirus genome may include the deletion of one or more restriction sites.
  • the modifications may include the introduction of one or more restriction sites.
  • the restriction sites to be deleted from the genome or added to the genome may be selected from one or more of restriction sites such as but not limited to AanI, AarI, AasI, AatI, AatII, AbaSI, AbsI, Acc65I, AccI, AccII, AccIII, AciI, AcII, AcuI, AfeI, AflII, AflIII, AgeI, AhdI, AleI, AluI, AlwI, AlwNI, ApaI, ApaLI, ApeKI, ApoI, AscI, AseI, AsiSI, AvaI, AvaII, AvrII, BaeGI, BaeI, BamHI BanI, BanII, BbsI, BbvCI, BbvI, B
  • any desired restriction site(s) or combination of restriction sites may be inserted into the genome or mutated and/or eliminated from the genome.
  • one or more AarI sites are deleted from the viral genome.
  • one or more BsaI sites are deleted from the viral genome.
  • one or more restriction sites are completely eliminated from the genome (e.g. all the AarI sites in the viral genome may be eliminated).
  • one or more AvaI restriction sites are introduced into the viral genome.
  • one or more StuI sites are introduced into the viral genome.
  • the one or more modifications may include the incorporation of recombineering targets including but not limited to loxP or FRT sites.
  • the poxvirus modifications may include the introduction of fluorescence markers such as but not limited to green fluorescent protein (GFP), enhanced GFP, yellow fluorescent protein (YFP), cyan/blue fluorescent protein (BFP), red fluorescent protein (RFP), or variants thereof, etc.; selectable markers such as but not limited to drug resistance markers (e.g. E.
  • fluorescence markers such as but not limited to green fluorescent protein (GFP), enhanced GFP, yellow fluorescent protein (YFP), cyan/blue fluorescent protein (BFP), red fluorescent protein (RFP), or variants thereof, etc.
  • selectable markers such as but not limited to drug resistance markers (e.g. E.
  • the modifications include one or more selectable markers to aid in the selection of reactivated clones (e.g. a fluorescence marker such as YFP, a drug selection marker such as gpt, etc.) to aid in the selection of reactivated viral clones.
  • the one or more selectable markers are deleted from the reactivated clones after the selection step.
  • the poxviruses are synthetic horsepox viruses (scHPXV).
  • the synthetic horsepox viruses have been produced by recombination of overlapping DNA fragments of the viral genome and reactivation of the functional poxvirus is carried out in cells previously infected with a helper virus. Briefly, overlapping DNA fragments that encompass all or substantially all of the viral genome of the horsepox are chemically synthesized and transfected into helper virus-infected cells. The transfected cells are cultured to produce mixed viral progeny comprising the helper virus and reactivated horsepox virus. Next, the mixed viral progeny is plated on host cells that do not support the growth of the helper virus but allow the synthetic poxvirus to grow, in order to eliminate the helper virus and recover the synthetic poxviruses.
  • substantially all of the synthetic poxviral genome is derived from chemically synthesized DNA. In some embodiments, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, over 99%, or 100% of the synthetic poxviral genome is derived from chemically synthesized DNA. In some embodiments, the poxviral genome is derived from a combination of chemically synthesized DNA and naturally occurring DNA.
  • the number of overlapping DNA fragments used to generate the synthetic poxvirus will depend on the size of the poxviral genome. Practical considerations such as reduction in recombination efficiency as the number of fragments increases on the one hand and difficulties in synthesizing very large DNA fragments as the number of fragments decreases on the other hand will also inform the number of overlapping fragments used.
  • the synthetic poxviral genome may be synthesized as a single fragment.
  • the synthetic poxviral genome is assembled from 2-14 overlapping DNA fragments.
  • the synthetic poxviral genome is assembled from 4-12 overlapping DNA fragments.
  • the synthetic poxviral genome is assembled from 6-10 overlapping DNA fragments.
  • the synthetic poxviral genome is assembled from 8-12 overlapping DNA fragments. In some embodiments, the synthetic poxviral genome is assembled from 10 overlapping DNA fragments. In an exemplary embodiment of the disclosure, a synthetic horsepox virus (scHPXV) is reactivated from 10 chemically synthesized overlapping double-stranded DNA fragments. In some embodiments, all of the fragments encompassing the poxviral genome are chemically synthesized. In some embodiments, one or more of the fragments are chemically synthesized and one or more of the fragments are derived from naturally occurring DNA (e.g. by PCR amplification or by well-established recombinant DNA techniques).
  • scHPXV synthetic horsepox virus
  • the terminal hairpin loops are synthesized separately and ligated onto the fragments comprising the left and right ends of the poxviral genome.
  • terminal hairpin loops may be derived from a naturally occurring template.
  • the terminal hairpins of the synthetic poxvirus are derived from VACV.
  • the terminal hairpins of the recombinant synthetic poxvirus are derived from CMLV, CPXV, ECTV, HPXV, MPXV, RPXV, raccoonpox virus, skunkpox virus, Taterapox virus, Uasin Gishu disease virus or VPV.
  • the terminal hairpins of the recombinant scHPXV are derived from VACV. In some embodiments, the terminal hairpins of the recombinant scHPXV are derived from CMLV, CPXV, ECTV, HPXV, MPXV, RPXV, raccoonpox virus, skunkpox virus, Taterapox virus, Uasin Gishu disease virus or VPV. In some embodiments, the terminal hairpins of the poxvirus are based on the terminal hairpins of any poxvirus whose genome has been completely sequenced or a natural isolate of which is available for genome sequencing.
  • the size of the overlapping fragments used to generate the poxvirus of the disclosure will depend on the size of the poxviral genome. It is understood that there can be wide variations in fragment sizes and various practical considerations such as the ability to chemically synthesize very large DNA fragments, will inform the choice of fragment sizes.
  • the fragments range in size is from about 2000 bp to about 50000 bp. In some embodiments, the fragments range in size is from about 3000 bp to about 45000 bp. In some embodiments, the fragments range in size is from about 4000 bp to 40000 bp. In some embodiments, the fragments range in size is from about 5000 bp to 35000 bp.
  • the largest fragments are about 20000 bp, 21000 bp, 22000 bp, 23000 bp, 24 000 bp, 25000 bp, 26000 bp, 27000 bp, 28000 bp, 29000 bp, 30000 bp, 31000 bp, 32000 bp, 33000 bp, 34000 bp, 35000 bp, 36000 bp, 37000 bp, 38000 bp, 39000 bp, 40000 bp, 41000 bp, 42000 bp, 43000 bp, 44000 bp, 45000 bp, 46000 bp, 47000 bp, 48000 bp, 49000 bp, or 50000 bp.
  • a scHPXV is reactivated from 10 chemically synthesized overlapping double-stranded DNA fragments ranging in size from about 8500 bp to about 32000 bp (Table 2).
  • the poxviruses of the present disclosure can be propagated in any substrate that allows the virus to grow to titers that permit the uses of the recombinant poxvirus described herein.
  • the poxvirus of the present disclosure may be grown in cells (e.g. avian cells, bat cells, bovine cells, camel cells, canary cells, cat cells, deer cells, equine cells, fowl cells, gerbil cells, goat cells, human cells, monkey cells, pig cells, rabbit cells, raccoon cells, seal cells, sheep cells, skunk cells, vole cells, etc.) that are susceptible to infection by the poxviruses.
  • the poxvirus is grown in adherent cells.
  • the poxvirus is grown in suspension cells. In some embodiments, the poxvirus is grown in mammalian cells. Such methods are well-known to those skilled in the art. Representative mammalian cells include, but are not limited to, BHK, MRC, BGMK, BRL3A, BSC-40, CEF, CEK, CHO, COS, CVI, HaCaT, HEL, HeLa cells, HEK293, human bone osteosarcoma cell line 143B, MDCK, NIH/3T3, Vero cells, etc.
  • the recombinant poxvirus is removed from cell culture and separated from cellular components, typically by well-known clarification procedures, e.g., such as gradient centrifugation and column chromatography, and may be further purified as desired using procedures well known to those skilled in the art, e.g., plaque assays.
  • the poxvirus is grown in Vero cells.
  • the poxvirus is grown in ACE2 Knockout Vero cells.
  • the poxvirus is grown in Vero adherent cells.
  • the poxvirus is grown in Vero suspension cells.
  • the poxvirus is grown in BSC-40 cells.
  • the poxvirus is grown in BHK-21 cells.
  • the poxvirus is grown in MRC-5 cells. In some embodiments, the poxvirus is grown in MRC-5 cells in the presence of for example, 5% serum, including but not limited to fetal calf serum. In some embodiments, the poxvirus is grown in avian cells. Such methods are well-known to those skilled in the art. Representative avian cells include, but are not limited to, chicken embryo fibroblasts, DF-1 cells (see, e.g., Himly et al., Virology, (1998) 248:295-304), duck embryo-derived cells, EB66® cells (see, e.g., Leon et al. Vaccine, (2016) 34: 5878-5885), AGE1.
  • the poxvirus is grown in chicken embryo fibroblasts. In some embodiments, the poxvirus is grown in duck embryo-derived cells. In some embodiments, the poxvirus is grown in EB66® cells. In some embodiments, the poxvirus is grown in AGE1.CRpIX® cells. In some embodiments, the poxvirus is grown in DF-1 cells.
  • the method of producing a synthetic poxvirus comprises a step of chemically synthesizing overlapping DNA fragments that correspond to substantially all of the viral genome of the poxvirus and, optionally, chemically synthesizing the terminal hairpin loops from another virus or from another strain of virus; (ii) transfecting the overlapping DNA fragments into helper virus-infected cells; (iii) culturing said cells to produce a mixture of helper virus and synthetic poxvirus particles in said cells; and (iv) plating the mixture on host cells specific to the poxvirus to recover the synthetic poxvirus.
  • the method of producing a synthetic horsepox virus comprises a step of (i) chemically synthesizing overlapping DNA fragments that correspond to substantially all of the viral genome of the horsepox virus and chemically synthesizing the terminal hairpin loops from another poxvirus (such as VACV, strain WB or NYCBH clone ACAM 2000); (ii) transfecting the overlapping DNA fragments into helper virus-infected cells; (iii) culturing said cells to produce a mixture of helper virus and synthetic horsepox virus particles in said cells; and (iv) plating the mixture on host cells specific to the horsepox virus to recover the synthetic horsepox virus.
  • another poxvirus such as VACV, strain WB or NYCBH clone ACAM 2000
  • the poxvirus is a synthetic horsepox virus.
  • the synthetic horsepox virus genome is based on the published genome sequence described for horsepox virus (GenBank accession DQ792504) and the terminal hairpins are based on the published genome sequence similar to VACV strain NYCBH clone ACAM2000 (GenBank accession MN974380).
  • the synthetic horsepox virus comprises the sequence deposited in GenBank as accession number KY349117; see US 2018/0251736, incorporated by reference herein.
  • the synthetic horsepox virus is characterized by a nucleic acid encoding a SARS-CoV-2 virus S protein comprises the sequence set forth in SEQ ID NO: 43.
  • the poxvirus is a synthetic recombinant vaccinia virus (synVACV).
  • the synthetic vaccinia genome is based on the published genome sequence described for VACV strain NYCBH clone ACAM2000 (GenBank accession AY313847; Osborne J D et al. Vaccine. 2007; 25(52):8807-32).
  • the synthetic vaccinia genome is based on the published genome sequence similar to VACV strain NYCBH clone ACAM2000 (GenBank accession MN974380; see WO 2019/213452, incorporated by reference herein).
  • the synthetic vaccinia virus comprises the sequence deposited in GenBank as accession number MN974381 (see WO 2019/213452, incorporated by reference herein). In some embodiments, the synthetic vaccinia virus is characterized by a nucleic acid encoding a SARS-CoV-2 virus S protein comprises the sequence set forth in SEQ ID NO: 44.
  • any of the synthetic poxviruses disclosed in US 2018/0251736 and WO 2019/213452 may be used to generate a recombinant poxvirus comprising a SARS-CoV-2 protein, as disclosed herein.
  • the present disclosure relates to a recombinant poxvirus comprising a nucleic acid encoding a SARS-CoV-2 virus protein, wherein the SARS-CoV-2 protein is selected from the group consisting of the spike protein (S), the membrane protein (M) and the nucleocapsid protein (N), or combinations of two or more of said proteins.
  • the nucleotide sequence of the SARS-CoV-2 virus is any one of the published genome sequences, including, but not limited, to the genome sequences of the Wuhan strain, the UK strain B.1.1.7 strain, the South African B. 1.351 strain, the Brazilian B.1.1.28 strain, other emerging variants and any of their variants.
  • the nucleotide sequence of the SARS-CoV-2 virus is selected from the group consisting of GenBank accession numbers NC045512.2, LC521925.1, MN988668.1, MN985325.1, MN975262.1, MN938384.1, LR757998.1, LR757996.1, LR757995.1 and MN908947.3.
  • the nucleotide sequence of the SARS-CoV-2 virus is characterized by the sequence set forth in GenBank Accession Number MN988668.1; SEQ ID NO: 46.
  • the nucleotide sequence of the SARS-CoV-2 virus is further selected from the group consisting of GenBank accession numbers QQX99439 (e.g., B.1.1.7 United Kingdom variant), TEGALLY (e.g., B.1.351 South Africa variant), YP_009724390 (e.g., a Wuhan variant), and FARIA (e.g., B.1.1.28 Brazil variant).
  • GenBank accession numbers QQX99439 e.g., B.1.1.7 United Kingdom variant
  • TEGALLY e.g., B.1.351 South Africa variant
  • YP_009724390 e.g., a Wuhan variant
  • FARIA e.g., B.1.1.28 Brazil variant
  • the viral envelope of the SARS-CoV-2 virus is covered by characteristic spike-shaped glycoproteins (S) as well as the envelope (E) and membrane (M) proteins.
  • S protein mediates host cell attachment and entry.
  • the helical nucleocapsid comprised of the viral genome encapsidated by the nucleocapsid protein (N), resides within the viral envelope.
  • the poxvirus or synthetic poxvirus comprises a nucleic acid encoding a SARS-CoV-2 envelope protein.
  • Non-limiting examples of such proteins are the Spike protein (S), the Membrane protein (M) and the Hemagglutinin-Esterase protein (HE).
  • the poxviruses or synthetic poxviruses comprise a nucleic acid encoding the S protein (SEQ ID NO: 9). In some embodiments, the poxviruses or synthetic poxviruses comprise a nucleic acid encoding the S protein (SEQ ID NO: 47). In some embodiments, the poxviruses or synthetic poxviruses comprise a nucleic acid encoding the M protein (SEQ ID NO: 10). In some embodiments, the poxviruses or synthetic poxviruses comprise a nucleic acid encoding the M protein (SEQ ID NO: 48).
  • the poxviruses or synthetic poxviruses comprise a nucleic acid encoding the N protein (SEQ ID NO: 11). In some embodiments, the poxviruses or synthetic poxviruses comprise a nucleic acid encoding the N protein (SEQ ID NO: 49). In some embodiments, the poxviruses or synthetic poxviruses comprise a nucleic acid encoding the HE protein (protein E or HE of Wuhan-HU-1, Accession LC521925.1; SEQ ID NO: 12). In some embodiments, the poxviruses or synthetic poxviruses comprise a combination of S protein and M protein. In some embodiments, the poxviruses or synthetic poxviruses comprise a combination of S protein and N protein. In some embodiments, the poxviruses or synthetic poxviruses comprises a combination of M protein and N protein.
  • the SARS-CoV-2 virus is a Wuhan seafood market pneumonia virus 2019-nCoV isolate. GenBank accession number LC521925.1; SEQ ID NO: 13. In some embodiments, the SARS-CoV-2 virus is a Wuhan seafood market pneumonia virus 2019-nCoV isolate. GenBank accession number MN988668.1; SEQ ID NO: 46.
  • the amino acid sequence of the SARS-CoV-2 virus protein is modified with reference to a wild type protein.
  • the nucleotide sequence encoding the S protein is modified with reference to a wild type nucleotide sequence.
  • the amino acid sequence of the S protein is modified with reference to the wild type protein (protein S of Wuhan-HU-1, Accession LC521925.1; SEQ ID NO: 9).
  • the amino acid sequence of the S protein is modified with reference to the wild type protein (protein S of Wuhan-HU-1, Accession MN988668.1; SEQ ID NO: 47).
  • the amino acid sequence of the S protein is modified with reference to the wild type protein (protein S of Wuhan-Hu-1, Accession NC_045512.2; SEQ ID NO: 53)
  • the amino acid sequence of the SARS-CoV-2 virus protein is modified with reference to a wild type protein, so that the modified protein is adapted to infect mice. See Roberts et al. PLoS Pathog 3(1): e5. doi:10.1371; incorporated herein by reference in its entirety.
  • Tyrosine at position 459 is substituted by Histidine (Y459H) in the S protein with reference to the wild type protein (SEQ ID NO: 47).
  • the S protein comprises one or more mutations that enable antibody-dependent enhancement.
  • Aspartic acid at position 614 is substituted by Glycine (D614G) in the S protein with reference to the wild type protein (SEQ ID NO: 47). See Korber et al. bioRxiv 2020.04.29.069054; incorporated herein by reference in its entirety.
  • the S protein comprises one or more mutations in the fusion core of the HR1 region.
  • Serine at position 943 is substituted by Proline (S943P) in the S protein with reference to the wild type protein (SEQ ID NO: 47).
  • the S protein comprises one or more mutations that stabilize the S protein in an antigenically optimal prefusion conformation, which results in increased expression, conformational homogeneity and elicitation of potent antibody responses.
  • the mutations that stabilize the S protein in the prefusion conformation are located at the beginning of the central helix. See Pallesen et al. Proc Natl Acad Sci USA. 2017; 114(35); incorporated herein by reference in its entirety.
  • Lysine at position 986 is substituted by Proline (K986P) in the S protein with reference to the wild type protein (SEQ ID NO: 47).
  • Valine at position 987 is substituted by Proline (V987P) in the S protein with reference to the wild type protein (SEQ ID NO: 47).
  • the S protein comprises any one of substitutions Y459H, D614G, S943P, K986P and V987P, or a combination thereof, with reference to the wild type protein (SEQ ID NO: 47).
  • the amino acid sequence of the M protein is modified with reference to the wild type protein (protein M of Wuhan-HU-1, Accession LC521925.1; SEQ ID NO: 10). In some embodiments, the amino acid sequence of the M protein is modified with reference to the wild type protein (protein M of Wuhan-HU-1, Accession MN988668.1; SEQ ID NO: 48). In some embodiments, Glutamic acid at position 11 is substituted by a Lysine in the M protein with reference to the wild type protein. In some embodiments, Glutamic acid at position 11 is substituted by a Lysine in the M protein with reference to the wild type protein (SEQ ID NO: 10). In some embodiments, Glutamic acid at position 11 is substituted by a Lysine in the M protein with reference to the wild type protein (SEQ ID NO: 48).
  • the amino acid sequence of the N protein is modified with reference to the wild type protein (protein N of Wuhan-HU-1, Accession LC521925.1; SEQ ID NO: 11). In some embodiments, the amino acid sequence of the N protein is modified with reference to the wild type protein (protein N of Wuhan-HU-1, Accession MN988668.1; SEQ ID NO: 49).
  • the nucleic acid sequence encoding the SARS-CoV-2 virus protein is modified with reference to the wild type protein. In some embodiments, the nucleic acid sequence encoding the SARS-CoV-2 virus protein is modified with reference to the wild type protein (SEQ ID NO: 9). In some embodiments, the nucleic acid sequence encoding the SARS-CoV-2 virus protein is modified with reference to the wild type protein (SEQ ID NO: 47). In some embodiments, the nucleic acid sequence encoding the SARS-CoV-2 virus protein is modified with reference to the wild type protein for efficient expression of transgenes in poxviruses.
  • the heterologous gene coding sequences containing the vaccinia Early Transcription Terminator Signal (ETTS) (TTTTTNT; also called T 5 NT (SEQ ID NO: 14)) are removed. See Earl et al. Journal of Virology, 1990; 2448-2451; incorporated herein by reference in its entirety.
  • the poxvirus genome retains two overlapping endogenous ETTS.
  • the heterologous gene coding sequences containing the vaccinia Early Transcription Terminator Signal (ETTS) (TTTTTNT; also called T 5 NT (SEQ ID NO: 14)) are removed with reference to the nucleic sequence encoding the S protein of the SARS-CoV-2 virus (protein S of Wuhan-HU-1, Accession MN988668.1; SEQ ID NO: 47).
  • ETS vaccinia Early Transcription Terminator Signal
  • the nucleic acid encoding a SARS-CoV-2 virus protein is operatively linked to a promoter.
  • the promoter is a poxvirus-specific promoter.
  • the promoter is located between the left flanking arm and the ATG of the transgene expression cassette.
  • the poxvirus promoter is a vaccinia virus early promoter.
  • the poxvirus promoter is an optimized vaccinia virus early promoter (AAAATTGAAANNNTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN; SEQ ID NO: 3).
  • the poxvirus promoter is a synthetic vaccinia virus late promoter (TTTTTTTTTTTTTTTTTTTNNNNNNTAAATG; SEQ ID NO: 4). In some embodiments, the poxvirus promoter is an overlapping synthetic early/late promoter (AAAAATTGAAATTTTATTTTTTTTTTTTTTGGAATATAAATA; SEQ ID NO: 5). See FIG. 8 . See Chakrabarti et al. BioTechniques 23:1094-1097; incorporated herein by reference in its entirety.
  • the vaccinia virus late promoter nucleotide sequence comprises the sequence set forth in SEQ ID NO: 6 (TTTTATTTTTTTTTTTTGGAATATAAATA). In some embodiments, the vaccinia virus late promoter is the sequence set forth in SEQ ID NO: 6. In some embodiments, the vaccinia virus late promoter nucleotide sequence comprises the sequence set forth in SEQ ID NO: 7 (AAAATTGAAAAAATA). In some embodiments, the poxvirus promoter is an overlapping synthetic early/late promoter comprising the sequence set forth in SEQ ID NO: 8 (TTTTATTTTTTTTTTTTTTGGAATATAAATATCCGGT AAAATTGAAAAAATA).
  • the poxvirus promoter is an overlapping synthetic early/late promoter comprising a nucleic acid spacer sequence of 38-160 nucleotides 3′ of the early promoter and between the RNA start site and the ATG.
  • the spacer is 160 nucleotides long, resulting in enhanced levels of expression. See FIG. 9 . See Di Pilato et al. Journal of General Virology (2015), 96, 2360-2371; incorporated herein by reference in its entirety.
  • the vaccinia virus late promoter and the spacer comprises the sequence set forth in SEQ ID NO: 39. In some embodiments, the vaccinia virus late promoter and the spacer is the sequence set forth in SEQ ID NO: 39.
  • the protein of the SARS-CoV-2 is inserted into a non-essential gene for replication.
  • the SARS-CoV-2 protein is inserted into the Thymidine Kinase (TK) locus (Gene ID HPXV095; positions 992077-92610; SEQ ID NO: 1) of the horsepox virus or the synthetic horsepox virus.
  • the SARS-CoV-2 protein is inserted into the Thymidine Kinase (TK) locus (Gene ID synVACV_105; positions 83823-84344; SEQ ID NO: 2) of the vaccinia virus or the synthetic vaccinia virus.
  • the TK locus provides a stable insertion site for foreign genes of interest.
  • the TK locus also provides a selection marker to identify those clones where the nucleic acid encoding a SARS-CoV-2 protein has been inserted.
  • the clones where the nucleic acid encoding a SARS-CoV-2 protein is inserted are not capable of growing in the presence of 5-bromo-2-deoxyuridine (BrdU), which is an analogue of the pyrimidine deoxynucleoside thymidine, due to not having the TK gene.
  • PrdU 5-bromo-2-deoxyuridine
  • An exemplary method to generate a recombinant poxvirus of the disclosure comprising the S protein of SARS-CoV-2 virus comprises:
  • any of the recombinant poxviruses comprising a nucleic acid encoding a SARS-CoV-2 virus protein described in the present disclosure may be used in any of the methods disclosed herein.
  • the disclosure relates to a method for selecting a cell that expresses a SARS-CoV-2 virus protein, comprising infecting said cell with the recombinant poxvirus of the disclosure and selecting the infected cell expressing said SARS-CoV-2 virus protein.
  • the disclosure relates to a method of inducing an immune response against a SARS-CoV-2 virus in a subject, comprising administering to said subject an immunologically effective amount of the recombinant poxvirus of the disclosure.
  • the disclosure relates to a method of generating a recombinant poxvirus of the disclosure, the method comprising:
  • step (a) Infecting a host cell with a poxvirus;
  • step (b) Transfecting the infected cell of step (a) with a nucleic acid encoding a SARS-CoV-2 virus protein to generate a recombinant poxvirus; and
  • step (c) Selecting a recombinant poxvirus, wherein the nucleic acid encoding a SARS-CoV-2 virus protein is located, upon transfection, in a region of the poxvirus that is not essential for the replication of the poxvirus.
  • the recombinant poxvirus of the disclosure is used as a vaccine to express a SARS-CoV-2 virus protein.
  • Methods to assess the safety, immunogenicity and protective capacity of the recombinant poxvirus are known in the art. See Kremer M et al. 2012. p 59-92. In Isaacs S N (ed), Vaccinia virus and poxvirology, vol 890. Humana Press, Totowa, N.J.
  • the immunization is via a subcutaneous route.
  • the immunization is via an intramuscular route.
  • the immunization is via an intranasal route.
  • the immunization is via scarification.
  • a range between about 10 4 and about 10 8 PFU of the recombinant poxvirus is used. In some embodiments, about 10 4 , about 10 5 , about 10 6 , about about 10 7 or about 10 8 PFU of recombinant poxvirus is used for the immunization. In some embodiments, about 10 5 PFU of the recombinant poxvirus is used for the immunization. A physician will be able to determine the adequate PFU dosage for each subject. In some embodiments, one dose is administered to the subject. In some embodiments, more than one dose is administered to the subject.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against a SARS-CoV-2 virus in a subject, comprising administering to said subject an immunologically effective amount of a recombinant poxvirus or a pharmaceutical composition.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against the SARS-CoV-2 virus in a subject, wherein the immunologically effective amount of the recombinant poxvirus is administered by scarification.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against a SARS-CoV-2 virus in a subject, wherein the immune response comprises antibodies that are capable of neutralizing the SARS-CoV-2 virus. In some embodiments, the recombinant poxvirus is useful towards the method of inducing an immune response against a SARS-CoV-2 virus in a subject, wherein the immunologically effective amount of a recombinant poxvirus is capable of protecting the subject from SARS-CoV-2 virus.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against a SARS-CoV-2 virus in a subject, wherein the immunologically effective amount of a recombinant poxvirus reduces or prevents the progression of the virus after SARS-CoV-2 infection in the subject.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against a SARS-CoV-2 virus in a subject, wherein the immune response is a T-cell immune response.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against a SARS-CoV-2 virus and a poxvirus comprising administering to said subject an immunologically effective amount of a recombinant poxvirus or pharmaceutical composition.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against the SARS-CoV-2 virus and the poxvirus, wherein said immunologically effective amount of the recombinant poxvirus is administered by scarification.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against the SARS-CoV-2 virus and the poxvirus, wherein said immune response comprises antibodies that are capable of neutralizing the SARS-CoV-2 virus and the poxvirus.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against the SARS-CoV-2 virus and the poxvirus, wherein the immunologically effective amount of a recombinant poxvirus is capable of protecting the subject from the SARS-CoV-2 virus and the variola virus.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against the SARS-CoV-2 virus and the poxvirus, wherein the immunologically effective amount of a recombinant poxvirus reduces or prevents the progression of the SARS-CoV-2 virus infection and/or poxvirus infection in the subject.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against the SARS-CoV-2 virus and the poxvirus, wherein the immune response is a T-cell immune response.
  • the recombinant poxvirus is useful towards the method of inducing an immune response against the SARS-CoV-2 virus and the poxvirus, wherein the poxvirus is vaccinia virus, variola, horsepox virus or monkeypox virus.
  • the recombinant poxvirus is useful towards the method of inducing T cell immunity against a SARS-CoV-2 virus comprising administering to said subject an immunologically effective amount of a recombinant poxvirus or pharmaceutical composition.
  • the recombinant poxvirus is useful towards the method of inducing T cell immunity against the SARS-CoV-2 virus, wherein said immunologically effective amount of the recombinant poxvirus is administered by scarification.
  • the recombinant poxvirus is useful towards the method of inducing T cell immunity against the SARS-CoV-2 virus, wherein the immunologically effective amount of a recombinant poxvirus is capable of protecting the subject from SARS-CoV-2 virus. In some embodiments, the recombinant poxvirus is useful towards the method of inducing T cell immunity against the SARS-CoV-2 virus, wherein the immunologically effective amount of a recombinant poxvirus reduces or prevents the progression of the virus after SARS-CoV-2 infection in the subject.
  • the recombinant poxvirus is useful towards the method of inducing T cell immunity against a SARS-CoV-2 virus and a poxvirus comprising administering to a subject an immunologically effective amount of the recombinant poxvirus reduces or pharmaceutical composition.
  • the recombinant poxvirus is useful towards the method of inducing T cell immunity against the SARS-CoV-2 virus and the poxvirus, wherein said immunologically effective amount of the recombinant poxvirus is administered by scarification.
  • the recombinant poxvirus is useful towards the method of inducing T cell immunity against the SARS-CoV-2 virus and the poxvirus, wherein the immunologically effective amount of a recombinant poxvirus is capable of protecting the subject from the SARS-CoV-2 virus and the poxvirus.
  • the recombinant poxvirus is useful towards the method of inducing T cell immunity against the SARS-CoV-2 virus and the poxvirus, wherein the immunologically effective amount of a recombinant poxvirus reduces or prevents the progression of the virus after SARS-CoV-2 infection and/or variola virus infection in the subject.
  • the recombinant poxvirus is useful towards the method of inducing T cell immunity against the SARS-CoV-2 virus and the poxvirus, wherein the poxvirus is vaccinia virus, variola, horsepox virus or monkeypox virus.
  • the recombinant poxvirus is useful towards the method of reducing or preventing the progression of a SARS-CoV-2 virus infection in a subject in need or at risk thereof comprising administering to said subject an immunologically effective amount of the recombinant poxvirus or pharmaceutical composition.
  • the recombinant poxvirus is useful towards the method of reducing or preventing the progression of a SARS-CoV-2 virus and a poxvirus infection in a subject in risk thereof comprising administering to said subject an immunologically effective amount of the recombinant poxvirus or pharmaceutical composition.
  • the recombinant poxvirus is useful towards the method of reducing or preventing the progression of the SARS-CoV-2 virus and the poxvirus infection, wherein the poxvirus is vaccinia virus, variola, horsepox virus or monkeypox virus.
  • the recombinant poxvirus is useful for a vaccine against a SARS-CoV-2 virus comprising a recombinant virus or a pharmaceutical composition.
  • the recombinant poxvirus is useful for a bivalent vaccine against a SARS-CoV-2 virus and a poxvirus comprising a recombinant virus or a pharmaceutical composition.
  • the recombinant poxvirus is useful for a bivalent vaccine against a SARS-CoV-2 virus, wherein the poxvirus is a vaccinia virus, variola, horsepox virus or monkeypox.
  • Synthetic horsepox virus 1 ATTTACGGATTCACCAATAAAAATAAACTAGAGAAACTTAGTACTAATAAGGAAC 55 comprising a nucleic acid 56 TAGAATCGTATAGTTCTAGCCCTCTTCAAGAACCCATTAGGTTAAATGATTTTCT 110 encoding a SARS-CoV-2 111 GGGACTATTGGAATGTATTAAAAAGAATATTCCTCTAACAGATATTCCGACAAAG 165 virus S protein.
  • the synthetic horsepox virus (scHPXV) is generated following the methods disclosed in US 2018/0251736, incorporated herein by reference in its entirety.
  • the design of the synthetic HPXV genome is based on the previously described genome sequence for HPXV (strain MNR-76; GenBank accession DQ792504) (Tulman E R, Delhon G, Afonso C L, Lu Z, Zsak L, Sandybaev N T, et al. Genome of horsepox virus. Journal of virology. 2006; 80(18):9244-58).
  • the 212,633 bp genome is divided into 10 overlapping fragments. These fragments are designed so that they shared at least 1.0 kbp of overlapping sequence (i.e. homology) with each adjacent fragment, to provide sites where homologous recombination will drive the assembly of full-length genomes.
  • the fragments generated are shown in Table 2. These overlapping sequences will provide sufficient homology to accurately carry out recombination between the co-transfected fragments
  • a yfp/gpt cassette under the control of a poxvirus early late promoter is introduced into the HPXV095/J2R locus within GA_Fragment_3, so that reactivation of HPXV (scHPXV YFP-gpt::095) will be easy to visualize under a fluorescence microscope.
  • SFV-catalyzed recombination and reactivation of poxvirus DNA to assemble recombinant poxviruses has previously been described (Yao X D et al. Journal of virology. 2003; 77(13):7281-90; and Yao X D et al. Methods Mol Biol.
  • SFV has a narrow host range, productively infecting rabbit cells and certain monkey cell lines, like BGMK. It can infect, but grows very poorly on cells like BSC-40. Second, it grows more slowly compared to Orthopoxviruses, taking approximately 4-5 days to form transformed “foci” in monolayers of cells, a characteristic that is very different from Orthopoxviruses, which produce plaques within 1-2 days in culture.
  • Leporipoxviruses and Orthopoxviruses allows differentiation of these viruses by performing the reactivation assays in BGMK cells and plating the progeny on BSC-40 cells.
  • helper viruses such as, but not limited to, fowlpox virus
  • different cell combinations may be used.
  • BGMK cells are infected with SFV at a MOI of 0.5 and then transfected with 5 ⁇ g of digested GA_HPXV fragments 2 h later. Five days post transfection, all of the infectious particles are recovered by cell lysis and re-plated on BSC-40 cells, which only efficiently support growth of HPXV. The resulting reactivated scHPXV YFP-gpt::095 plaques are visualized under a fluorescence microscope. The visualization is enabled by the yfp/gpt selectable marker in the HPXV095/J2R locus within Frag_3. Virus plaques are detected in BSC-40 monolayers within 48 h of transfection. The efficiency of recovering scHPXV YFP-gpt::095 is dependent on a number of factors, including DNA transfection efficiency, but ranges up to a few PFU/ ⁇ g of DNA transfected.
  • a yfp/gpt cassette under the control of a poxvirus early late promoter is also introduced into the HPXV200 locus within GA_Fragment_7, so that reactivation of HPXV (scHPXV YFP-gpt::200) will be easy to visualize under a fluorescence microscope.
  • SFV-catalyzed recombination and reactivation of poxvirus DNA to assemble recombinant poxviruses has previously been described (Yao X D et al. Journal of virology. 2003; 77(13):7281-90; and Yao X D et al. Methods Mol Biol.
  • SFV has a narrow host range, productively infecting rabbit cells and certain monkey cell lines, like BGMK. It can infect, but grows very poorly on cells like BSC-40. Second, it grows more slowly compared to Orthopoxviruses, taking approximately 4-5 days to form transformed “foci” in monolayers of cells, a characteristic that is very different from Orthopoxviruses, which produce plaques within 1-2 days in culture.
  • Leporipoxviruses and Orthopoxviruses allows differentiation of these viruses by performing the reactivation assays in BGMK cells and plating the progeny on BSC-40 cells.
  • helper viruses such as, but not limited to, fowlpox virus
  • different cell combinations may be used.
  • BGMK cells are infected with SFV at a MOI of 0.5 and then transfected with 5 ⁇ g of digested GA_HPXV fragments 2 hours later. Five days post transfection, all of the infectious particles are recovered by cell lysis and re-plated on BSC-40 cells, which only efficiently support growth of HPXV. The resulting reactivated scHPXV YFP-gpt::200 plaques are visualized under a fluorescence microscope. The visualization is enabled by the yfp/gpt selectable marker in the HPXV200 locus within Frag_7. Virus plaques are detected in BSC-40 monolayers within 48 hours of transfection. The efficiency of recovering scHPXV YFP-gpt::200 is dependent on a number of factors, including DNA transfection efficiency, but ranges up to a few PFU/ ⁇ g of DNA transfected.
  • the synthetic vaccinia virus ACAM2000 was generated using the methods disclosed in WO 2019/213452, incorporated herein by reference in its entirety.
  • VACV synthetic VACV genome
  • the design of the synthetic VACV (synVACV) genome was based on the previously described genome sequence for VACV ACAM2000 (GenBank accession AY313847) (Osborne J D et al. Vaccine. 2007; 25(52):8807-32).
  • the genome was divided into 9 overlapping fragments ( FIG. 1 ). These fragments were designed so that they shared at least 1.0 kbp of overlapping sequence (i.e. homology) with each adjacent fragment, to provide sites where homologous recombination will drive the assembly of full-length genomes (Table 3). These overlapping sequences provided sufficient homology to accurately carry out recombination between the co-transfected fragments (Yao X D, Evans D H. Journal of Virology. 2003; 77(13):7281-90).
  • VACV ACAM2000 genome fragments used in this study. The size and the sequence within the VACV ACAM2000 genome [GenBank Accession AY313847] are described. Fragment Name Size (bp) Sequence GA_LITR 18,525 SEQ ID NO: 25 ACAM2000 GA_FRAG_1 24,931 SEQ ID NO: 26 ACAM2000 GA_FRAG_2 23,333 SEQ ID NO: 27 ACAM2000 GA_FRAG_3 26,445 SEQ ID NO: 28 ACAM2000 GA_FRAG_4 26,077 SEQ ID NO: 29 ACAM2000 GA_FRAG_5 24,671 SEQ ID NO: 30 ACAM2000 GA_FRAG_6 25,970 SEQ ID NO: 31 ACAM2000 GA_FRAG_7 28,837 SEQ ID NO: 32 ACAM2000 GA_RITR 17,641 SEQ ID NO: 33 ACAM2000
  • the resulting synthetic VACV, ACAM 2000 has been deposited in GenBank as accession number MN974381.
  • nucleotide sequence alignment of the synthetic HPXV (Accession number KY349117) and the synthetic VACV (Accession number MN974381) indicates a nucleotide sequence identity of 99% throughout the 4 Kb TK gene locus and a co-linearity (Start and Stop) of the TK gene sequences, which were used for the construction of the ⁇ TK insertion locus or knockout TK locus. See FIG. 3 .
  • the TK gene is non-essential for viral replication in tissue culture. It also provides a stable insertion site for foreign gene(s) of interest and a selection marker (TK ⁇ ) in the presence of the nucleotide analog 5-Bromodeoxyuridine (5-BrdU).
  • the PCR sequence manipulations used for the generation of the expression cassette containing the promoter/gene sequences allow for the use of the same expression cassette with the two different rescue viruses.
  • virus specific sequences for the rescue of the transfected PCR fragment comprising the engineered SARS-CoV-2 S protein, virus specific sequences (recombination left and right flanking arms, corresponding to HPXV094 and HPXV096, respectively) allows the recombination of the expression cassette into the viral TK locus. See FIG. 2 and FIG. 5 .
  • a nucleotide sequence alignment of the Spike (S) gene of different SARS-CoV-2 isolates is performed.
  • the viral isolates aligned are the ones published under the following accession numbers NC045512.2, LC521925.1, MN988668.1, MN985325.1, MN975262.1, MN938384.1, LR757998.1, LR757996.1, LR757995.1 and MN908947.3.
  • the alignment of the S genes indicates 100% homology at the nucleotide level between the S gene of the different viral isolates.
  • All viral isolates sequences are isolates with complete genome sequence entries from China, Japan and the US. Early indications from isolate sequence analysis seems to indicate little viral drift. However, if drift is ultimately observed, the same techniques can be used with the modified virus and its proteins and nucleic acid sequences.
  • the nucleotide sequence encoding the S protein of the SARS-CoV-2 comprises the nucleotide sequence set forth in SEQ ID NO: 9 or SEQ ID NO: 47.
  • the SARS-CoV-2 is not well adapted for infection in mice. Therefore, genomic adaptative mutations are introduced to adapt the virus for infection in mice. In particular, a mutation in the nucleotide sequence is introduced, the mutation resulting in a S protein comprising a Y459H substitution.
  • Table 4 shows genomic adaptative mutations in SARS-CoV virus, that can be adapted and introduced into other regions of the SARS-CoV-2 virus. See Roberts A et al. PLoS Pathog. 2007 January; 3(1): e5. doi: 10.1371.
  • ORF a open reading frame
  • CDS b coding sequence, sequence of nucleotides that corresponds with the sequence of amino acids in a protein (location includes start and stop codon); nsp c ; non-structural protein, cleavage product of ORF lab; Main pro : main 3C-like protease; Hel: helicase; RBM d : receptor binding motif (amino acids 424-494).
  • heterologous gene coding sequences containing the vaccinia Early Transcription Terminator Signal should be removed, in one embodiment of this disclosure, through coding silent mutagenesis to generate full length transcripts during the early phase of the infection.
  • TTTTTNT T5NT
  • SEQ ID NO: 14 Removing the ETTS in the S protein coding sequence can positively impact the generation of robust immune responses. See Earl P L et al. J Virol. 1990 May; 64(5):2448-51.
  • SEQ ID NO: 47 examples of other mutations introduced in the S protein (SEQ ID NO: 47) in other embodiments of this disclosure are the following: D614G, S943P, K986P and V987P. One or more of these mutations can be introduced in the S protein in those embodiments.
  • Poxvirus replication occurs in the cytoplasm of the infected cell.
  • the viruses do not enter the nucleus of the infected cell during the replication cycle, and therefore do not utilize the host cell transcriptional apparatus.
  • poxviruses encode their own transcriptional machinery including the viral RNA polymerase and their own regulatory promoter recognition signals. Therefore, for efficient high-level expression from eukaryotic transgene expression has to be driven from poxvirus promoters.
  • Poxvirus gene expression is controlled by early, intermediate and late promoters and can be defined as early (8 Hours before infection) and late (8 hours post-infection). DNA synthesis occurs 8 hours post infection and is referred to as the temporal boundary for the initiation of late gene expression.
  • the promoter used to control transcription of the S protein is an overlapping synthetic early/late promoter comprising the sequence (TTTTATTTTTTTTTTTTTTGGAATATAAATATCCGGTAAAATTGAAAAAATA SEQ ID NO: 8) including a 160 nucleotides long spacer 3′ of the early promoter and between the RNA start site and the ATG (SEQ ID NO: 42). See FIG. 9 . See Di Pilato et al. Journal of General Virology (2015), 96, 2360-2371; incorporated herein by reference in its entirety. It seems that spacers with more than 50 nt would offer greater space to the transcription machinery, possibly accelerating gene expression, and spacers with more than 99 nt offer advantages to early gene expression.
  • the expression cassette generated comprises the engineered SARS-CoV-2 S protein adapted for mouse infection and where the ETTS sequences have been removed and controlled under the transcription of the overlapping tandem early/late promoter.
  • FIGS. 6 and 7 An exemplary method to generate a recombinant horsepox comprising the S protein of SARS-CoV-2 virus is shown in FIGS. 6 and 7 and comprises:
  • a variety of methods can be used to assay the expression of the polypeptide encoded by the inserted gene. These methods include, but are not limited to, black plaque assay (an in situ enzyme immunoassay performed on viral plaques), Western blot analysis, radioimmunoprecipitation (RIPA), and enzyme immunoassay (EIA). Antibodies that recognize the SARS-CoV-2 S may be used.
  • sequence of one embodiment of a synthetic horsepox virus comprising a nucleic acid encoding a SARS-CoV-2 virus S protein is SEQ ID NO: 43.
  • sequence of one embodiment of a synthetic vaccinia virus comprising a nucleic acid encoding a SARS-CoV-2 virus S protein is SEQ ID NO: 44.
  • CEF Primary chicken embryo fibroblasts
  • mice are immunized by single-shot and prime-boost vaccination with 10 5 , 10 6 , 10 7 or 10 8 PFU of recombinant synthetic horsepox virus expressing SARS-CoV-2 protein via either scarification, intranasally, intramuscular or subcutaneous inoculations.
  • Animals inoculated with non-recombinant virus (WT) or phosphate-buffered saline (Mock) are used as controls.
  • Subjects at risk for infection by SARS-CoV-2 S are vaccinated using a recombinant poxvirus engineered SARS-CoV-2 S protein of this disclosure through scarification with a bifurcated needle (standard dose, 2.5 ⁇ 10 5 to 12.5 ⁇ 10 5 plaque-forming units) typically into the upper arm.
  • the recombinant poxvirus engineered SARS-CoV-2 S protein can also be administered as a single dose one-shot vaccine (e.g., 1 ⁇ 10 6 PFU TNX-1800), in which vials containing 100 doses per vial are manufactured. The vaccination protects them from infection. However, subsequent vaccinations may be useful to boost immunity.
  • the engineered SARS-CoV-2 S protein is administered at a dose level, for example, between about 5 ⁇ 10 10 to 1 ⁇ 10 11 viral particles (vp) per vaccination, either as a single dose or as a two-dose schedule spaced by, for example, 56 days in healthy adults (18-55 years old) and healthy elderly ( ⁇ 65 years old).
  • Vaccine elicited S specific antibody levels are measured, for example, by ELISA and neutralizing titers are measured, for example, in a microneutralization assay (see, e.g., methods in Example 11).
  • CD4+T-helper (Th)1 and Th2, and CD8+ immune responses are assessed, for example, by intracellular cytokine staining (ICS).
  • the SARS-CoV-2 Spike protein (SEQ ID NO: 45) was codon-optimized (SARS-CoV-2-Spike-co; SEQ ID NO: 50) for expression during poxvirus infection and was synthesized by GenScript.
  • the synthesized DNA also contains a poxvirus synthetic early/late promoter at nucleotide position 10-48.
  • the synthesized DNA was subcloned into a plasmid containing homology to either the HPXV095 gene locus (SEQ ID NO: 51) or the HPXV200 gene locus (SEQ ID NO: 52).
  • Homologous recombination was used to insert the synthesized DNA by replacing the selectable markers that were previously inserted into the synthetic VACV (synVACV) or synthetic HPXV (scHPXV).
  • the selectable markers were inserted as a fusion between yellow fluorescent protein (YFP) and guanine phosphoriosyltransferase (GPT) into either of the HPXV095 or A2K105 genes, respectively (see methods as disclosed in US 2018/0251736, incorporated herein by reference in its entirety).
  • TK locus also referred to as the A2K105 gene locus
  • SARS-CoV-2-co codon-optimized SARS-CoV-2 Spike
  • plasmid containing the SARS-CoV-2-Spike-co nucleotide sequence flanked by approximately 400 nucleotides homologous to the A2K105 gene was linearized using the restriction enzyme SacI. Following restriction enzyme digestion, the linearized plasmid was further purified to remove residual enzyme. BSC-40 cells were infected with synVACV expressing YFP-GPT in the A2K105 gene locus (synVACV ⁇ A2K105 yfp-gpt ) at a MOI of 0.1 for 1 hour. Following infection, the virus inoculum was replaced with OptiMEM media and was incubated for an additional 30 minutes at 37° C.
  • Lipofectamine 2000 ThermoFisher Scientific
  • BSC-40 cells were incubated for 48 hours to allow for homologous recombination to occur. After 48 hours, the plates were scraped to lift virus-infected cells and the mixture was transferred to a conical tube. The cells were lysed following three rounds of freezing at ⁇ 80° C. and thawing. An appropriate dilution, which can range from 1 ⁇ 10 ⁇ 2 to 1 ⁇ 10 ⁇ 5 , of the infection/transfection mixture was plated onto BSC-40 cells followed by an agar overlay. Infected cell plates were incubated until non-fluorescent “recombinant” plaques were visualized. These non-fluorescent plaques were marked, and agar plugs were picked and added into a 10 mM Tris pH 8.0 solution.
  • plaques were subsequently used to infect BSC-40 cells in a second round of infection. This plaque picking process and infection of BSC-40 cells was repeated until YFP was undetectable in the infected cells (ranges between 4-6 rounds of purification).
  • PCR analysis using primers sA2K J2R Flank Forward Primer 5′ to 3′: ATGCGATTCAAAAAAGAATCAGC (SEQ ID NO: 56) and sA2K J2R Flank Reverse Primer 5′ to 3′: CAATTTCCTCAAAATACATAAACGG (SEQ ID NO: 57)) that amplify the A2K105 gene locus was performed to confirm that the SARS-CoV-2 Spike gene was inserted into the A2K105 locus.
  • the membrane was subsequently blotted using anti-SARS-CoV2 Spike (ProSci) or anti-VACV 13 antibodies. Primary antibody binding was detected by blotting the membrane with IRDye secondary antibodies detectable at 800 nm or 680 nm channels (LI-COR).
  • the SARS CoV2 Spike antibody detected different forms of the SARS-CoV-2 Spike protein including the full-length, glycosylated full-length, cleaved, and multimeric forms.
  • NGS Next Generation Sequencing
  • TK locus also referred to as the HPXV095 gene locus
  • SARS-CoV-2-co codon-optimized SARS-CoV-2 Spike
  • plasmid containing the SARS-CoV-2-Spike-co nucleotide sequence flanked by approximately 400 nucleotides homologous to the HPXV095 gene was linearized using the restriction enzyme, SacI. Following restriction enzyme digestion, the linearized plasmid was further purified to remove residual enzyme. BSC-40 cells were infected with scHPXV expressing YFP-GPT in the HPXV095 gene locus at a MOI of 0.1 for 1 hour. Following infection, the virus inoculum was replaced with OptiMEM media and was incubated for an additional 30 minutes at 37° C.
  • Lipofectamine 2000 ThermoFisher Scientific
  • BSC-40 cells were incubated for 48 hours to 72 hours to allow for homologous recombination to occur. Subsequently, the plates were scraped to lift virus-infected cells and the mixture was transferred to a conical tube. The cells were lysed following 3 rounds of freezing at ⁇ 80° C. and thawing. An appropriate dilution, which can range from 1 ⁇ 10 ⁇ 2 to 1 ⁇ 10 ⁇ 5 , of the infection/transfection mixture was plated onto BSC-40 cells followed by an agar overlay. Infected cell plates were incubated until non-fluorescent “recombinant” plaques were visualized.
  • non-fluorescent plaques were marked, and agar plugs were picked and added into a 10 mM Tris pH 8.0 solution. The plaques were subsequently used to infect BSC-40 cells in a second round of infection. This plaque picking process and infection of BSC-40 cells was repeated until YFP was undetectable in the infected cells (ranges between 4-6 rounds of plaque purification).
  • One non-fluorescent plaque was isolated from the low efficiency of homologous recombination in the HPXV-infected cells.
  • PCR analysis using primers (sA2K/HPXV J2R Flank Forward Primer 5′-3′: TATCGCATTTTCTAACGTGATGG (SEQ ID NO: 58) and sA2K/HPXV J2R Flank Reverse Primer 5′-3′: CCTCATTTGCACTTTCTGGTTC (SEQ ID NO: 59)) that amplify the HPXV095 gene locus was performed to confirm that the SARS-Spike-co gene was inserted into the HPXV095 locus.
  • the viral genomic DNA was subsequently isolated from a preparation of sucrose-purified virus particles and used in Next Generation Sequencing with the Illumina MiSeq platform. The sequence data was analyzed by de novo assembly and mapped to reference software using the CLC Genomics Workbench software (Qiagen).
  • HPXV200 gene locus also referred to as the Variola virus B22R homolog locus
  • SARS-CoV-2-co codon-optimized SARS-CoV-2 Spike
  • plasmid containing SARS-CoV-2-Spike-co flanked by approximately 400 nucleotides homologous to the HPXV200 gene was linearized using the restriction enzyme, SacI. Following restriction enzyme digestion, the linearized plasmid was further purified to remove residual enzyme. BSC-40 cells were infected with scHPXV expressing YFP-GPT in the HPXV200 gene locus at a MOI of 0.1 for 1 hour. Following infection, the virus inoculum was replaced with OptiMEM media and incubated for an additional 30 minutes at 37° C.
  • Lipofectamine 2000 ThermoFisher Scientific
  • BSC-40 cells were incubated for 48 hours to 72 hours to allow for homologous recombination to occur. Subsequently, the plates were scraped to lift virus-infected cells and the mixture was transferred to a conical tube. The cells were lysed following three rounds of freezing at ⁇ 80° C. and thawing. An appropriate dilution, which can range from 1 ⁇ 10 ⁇ 2 to 1 ⁇ 10 ⁇ 5 , of the infection/transfection mixture was plated onto BSC-40 cells followed by an agar overlay. Infected cell plates were incubated until non-fluorescent “recombinant” plaques were visualized.
  • non-fluorescent plaques were marked, and agar plugs were picked and added into a 10 mM Tris pH 8.0 solution. These plaques were subsequently used to infect BSC-40 cells in a second round of infection.
  • One non-fluorescent plaque was isolated due to low efficiency of homologous recombination in HPXV-infected cells compared to VACV-infected cells. The plaque picking process was repeated by infecting BSC-40 cells until YFP was undetectable (about 4-6 rounds of plaque purification).
  • PCR analysis using primers (sHPXV 200 Flank Forward Primer 5′-3′: ATAGCCACAATTATTGACGGGC (SEQ ID NO: 60) and sHPXV 200 Flank Reverse Primer 5′-3′: ggatgatatggtaatgtaactaccgatac (SEQ ID NO: 61)) that amplify the HPXV200 gene locus was performed to confirm that the SARS-Spike-co gene was inserted into the HPXV200 locus.
  • the viral genomic DNA was subsequently isolated from a preparation of sucrose-purified virus particles and used for Next Generation Sequencing with the Illumina MiSeq platform. The sequence was analyzed by de novo assembly and mapped to reference software using the CLC Genomics Workbench software (Qiagen).
  • SARS CoV2 Spike antibody detected different forms of the SARS-CoV-2 Spike protein including the full-length, glycosylated full-length, cleaved, and multimeric forms.
  • a “take” has been previously described as a biomarker of a positive vaccine response indicating protective immunity (e.g., T cell immunity) against a vaccinia virus, such as smallpox (Jenner, E., 1800, 2 nd Ed.
  • the “take” is a measure of functional T cell immunity validated by the eradication of smallpox, a respiratory-transmitted disease caused by variola, in the 1960's.
  • the presence of a “take” sited on AGMs after vaccination with TNX-1800b-2 or TNX-1800a-1 is predictive that a T cell immune response will be activated due to the introduction of the SARS-CoV-S protein, a COVID-19 antigen.
  • the T cell immune response is activated when na ⁇ ve T cells are presented with antigens (e.g., SARS-CoV-2 S protein), leading to na ⁇ ve T cell differentiation and proliferation.
  • antigens e.g., SARS-CoV-2 S protein
  • This response also leads to immunological memory by generating memory T cells which provide protection and an accelerated immune response from subsequent challenge by the same antigen.
  • the vaccinated AGMs are challenged with SARS-CoV-2 via the intratracheal route and the challenges show that the vaccination provides a protective immunity against the virus.
  • the surviving animals are euthanized on Day 88.
  • a Microneutralization Assay was performed 14 days after the AGMs were vaccinated with the indicated HPXV strains to assess the anti-SARS-CoV-2 neutralizing titers in the serum.
  • the assay was initially performed in duplicate and a third replicate was performed if the first two replicates were not within a 2-fold dilution of each other.
  • Serum samples were initially heat inactivated at 56° C. for 30-60 minutes after being aliquoted onto a master plate.
  • the master plates can be stored at 4-8° C. for seven days or at ⁇ 20° C. for three months.
  • Vero E6 cells at a concentration 2 ⁇ 10 4 cells per well were seeded into 96-well plates 18-24 hours before addition of the serum test samples.
  • master plates were thawed and nine serum test samples were 2-fold serial diluted from 1:5 to 1:640 on a separate 96-well plate/dilution block (columns 1-9). Additionally, each 96-well plate/dilution block contained a positive control serum (column 10), virus controls (column 11) and cell controls (column 12). After dilution, an equal volume of virus stock (1,000 TCID50/mL) is added to columns 1-11.
  • assay quality control (QC) plates were set up at the same time consisting of positive control serum (columns 1-2), a negative control (columns 3-4), viral input back titer (columns 5-6), virus control (VC; columns 7-9) and cell controls (CC; columns 10-12). At least two QC plate were used per assay. Test and QC plates were incubated at 37° C. for 2-2.5 hours in a 5% CO 2 incubator. After incubation, aliquots of mixtures (sera and virus) for both test and QC plates (including controls) were transferred onto the 96-well plates pre-seeded with Vero E6 cell and incubated for 72 ⁇ 4 hours.
  • Samples with luminescence above or below the plate cut-off are positive and negative for neutralizing antibody, respectively.
  • Table 6 shows the level of anti-SARS-CoV-2 neutralizing titers measured in vaccinated AGMs after 14 days of a single vaccination.
  • the AGMs vaccinated with TNX-1800b-2 and TNX1800a-1 generated neutralizing titers ( ⁇ 1:40 titer) of antibodies against SARS-CoV-2.
  • the TNX-801 an scHPXV not carrying the S protein expression cassette
  • placebo group did not generate anti-SARS-CoV-2 neutralizing titers ( ⁇ 1:10 titer). Both the 2.9 ⁇ 10 6 PFU and 1.06 ⁇ 10 6 PFU doses of TNX-801 and TNX-1800 were well-tolerated.
  • BSC-40 HeLa and HEK 293 cells were seeded into a 6-well plate and subsequently infected with TNX-801, TNX-1800, TNX-1200, or TNX-2200 at a MOI of 0.01. After 48 hours of infection, cells were fixed and stained with 5% formaldehyde containing crystal violet. BSC-40 cells infected with TNX-801 and TNX-1800 had a significant cytopathic effect, while HeLa and HEK 293 cells showed minor and no cytopathic effect, respectively ( FIG. 18 ). BSC-40 HeLa and HEK293 cells infected with TNX-1200 and TNX-2200 had a significant cytopathic effect in all infected cell lines ( FIG.
  • BSC-40 cells were infected with HPXV clones (e.g., _TNX-801, scHPXV ⁇ 095 yfp-gpt , TNX-1800a-1, scHPXV ⁇ 200 yfp-gpt , or TNX-1800b-2; ( FIGS. 20A-B )) or VACV clones (e.g., TNX-1200, TNX-2200 or synVACV ⁇ A2K105 yfp-gpt ; ( FIGS. 21A-B )) at a MOI of 0.01.
  • Viral titer (PFU/mL) was measured at 0, 3, 6, 12, 24, 48 and 72 hours to determine viral growth in infected cells.
  • the presence of SARS-CoV-2 Spike protein slows HPXV clone viral growth by approximately 0.5 log, while it slows VACV clone viral growth by approximately 1 log.
  • the cytopathic effect seen in Vero cells and BSC-40 cells infected with the various HPXV and VACV clones shows that these cell lines can be used to manufacture the viruses (e.g., TNX-1800 and TNX-801).
  • SARS-CoV-2 Spike (S) nucleotide sequence (SEQ ID NO: 45) is modified by removing the Early Transcription Terminator Signal (T 5 NT) (SEQ ID NO: 14) using silent coding mutagenesis thereby retaining the SARS-CoV-2 Spike (S) protein coding sequences.
  • the location of an insertion site for the heterologous transgene SARS-CoV-2 Spike (S) within the DNA nucleotide sequence of a synthetic chimeric (sc) Horsepox genome is selected (for example the TK gene locus HPXV095; positions 992077-92610; SEQ ID NO:1).
  • the DNA nucleotide sequences proximal to the left and right of the selected HPXV insertion site, which define the Left and Right Flanking arms, are identified (see FIG. 22 ). Those arms are used to drive homologous nucleotide site specific recombination between the rescue virus and heterologous transgene.
  • One exemplary DNA nucleotide sequence of approximately 6 kb for a SARS-CoV-2 Spike (S) synthetic expression cassette comprising the DNA nucleotide sequences of a Left Flanking Arm, a vaccinia virus Early/Late Promotor operably linked to the modified CoVID-SARS-2 Spike (S) nucleic acid sequence, and a Right Flanking Arm is then synthesized (e.g., by a commercial vendor (e.g., Genewiz)). See FIG. 22 .
  • the SARS-CoV-2 Spike (S) Synthetic expression cassette DNA is then transfected into cells (e.g., BSC-40 cells) infected with an scHPXV.
  • Recombinant horsepox viral progeny containing the SARS-CoV-2 Spike (S) synthetic expression cassette are selected using media containing BrdU so as to prevent viral amplification of the parental virus retaining the original insertion site viral genomic DNA sequences.
  • the recombinant virus is purified using successive rounds of plaque purification.
  • the nucleotide sequence from the purified virus across the entire SARS-CoV-2 Spike (S) heterologous transgene cassette is confirmed by sequence analysis (e.g., PCR sequence analysis). See SEQ ID NO: 63.
  • Similar constructs and steps can be carried out using a horsepox virus to generate a recombinant scHPXV containing a mouse adapted spike protein expression cassette (see SEQ ID NO: 64) and a vaccinia virus, using, for example, the vaccinia TK gene locus synVACV105; positions 83823-84344 (see SEQ ID NO: 2) to generate a recombinant vaccinia virus containing a mouse adapted spike protein expression cassette (see SEQ ID NO: 65).
  • Example 15 Efficacy of Recombinant Poxvirus Carrying an Expression Cassette Encoding a SARS-CoV-2 S Protein in Immunized African Green Monkeys Challenged with SARS-CoV-2
  • African Green Monkeys were vaccinated percutaneously via scarification using a bifurcated needle as described in Example 12.
  • Table 7 shows the level of anti-SARS-CoV-2 neutralizing titers measured in vaccinated AGMs after 0, 7, 15, 21, 29, 41 and 47 days of a single vaccination.
  • the AGMs vaccinated with TNX-1800b-2 and TNX1800a-1 generated neutralizing titers ( ⁇ 1:40 titer) of antibodies against SARS-CoV-2.
  • the TNX-801 an scHPXV not carrying the S protein expression cassette
  • placebo group did not generate anti-SARS-CoV-2 neutralizing titers ( ⁇ 1:10 titer). Both the 2.9 ⁇ 10 6 PFU and 1.06 ⁇ 10 6 PFU doses of TNX-801 and TNX-1800 were well-tolerated.
  • the vaccinated AGMs were anesthetized and challenged (also referred to as inoculated) with approximately 2 ⁇ 10 6 TCID 50 /animal wild-type SARS-CoV-2 via the 1. intranasal and 2. intratracheal route.
  • the volume of virus was split evenly between each of the two routes (1 mL per route with a 1 ⁇ 106 TCID 50 /mL virus stock).
  • AGMs were anesthetized and inoculated by slowly pipetting 500 ⁇ L into each are followed by inhalation.
  • the intratracheal route AGMs were anesthetized, and a tube was inserted into the trachea.
  • a syringe containing the inoculate with the virus was attached to the tube and the inoculate was slowly instilled into the trachea followed by an equal volume of PBS to flush the tube. After the AGMs were inoculated, the animal was returned to its home cage and monitored for recovery from the anesthesia.
  • An oropharyngeal swab specimen and a tracheal lavage specimen were collected on Day 41 and Day 47 from the inoculated AGMs.
  • the specimens were processed by RT-qPCR methods to measure SARS-CoV-2 copy number.
  • Table 8 shows the SARS-CoV-2 copy number from oropharyngeal swab specimens.
  • Table 9 shows the SARS-CoV-2 copy number from tracheal lavage specimens.
  • AGMs vaccinated with TNX-1800b-2 and TNX-1800a-1 developed protective immunity against SARS-CoV-2.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Pulmonology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
US17/187,678 2020-02-26 2021-02-26 RECOMBINANT POXVIRUS BASED VACCINE AGAINST SARS-CoV-2 VIRUS Pending US20210260182A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/187,678 US20210260182A1 (en) 2020-02-26 2021-02-26 RECOMBINANT POXVIRUS BASED VACCINE AGAINST SARS-CoV-2 VIRUS

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US202062981997P 2020-02-26 2020-02-26
US202063114514P 2020-11-16 2020-11-16
US17/187,678 US20210260182A1 (en) 2020-02-26 2021-02-26 RECOMBINANT POXVIRUS BASED VACCINE AGAINST SARS-CoV-2 VIRUS

Publications (1)

Publication Number Publication Date
US20210260182A1 true US20210260182A1 (en) 2021-08-26

Family

ID=75267580

Family Applications (1)

Application Number Title Priority Date Filing Date
US17/187,678 Pending US20210260182A1 (en) 2020-02-26 2021-02-26 RECOMBINANT POXVIRUS BASED VACCINE AGAINST SARS-CoV-2 VIRUS

Country Status (12)

Country Link
US (1) US20210260182A1 (zh)
EP (1) EP4110386A1 (zh)
JP (1) JP2023515582A (zh)
KR (1) KR20220165731A (zh)
CN (1) CN116348135A (zh)
AU (1) AU2021226592A1 (zh)
BR (1) BR112022016992A2 (zh)
CA (1) CA3173996A1 (zh)
IL (1) IL295925A (zh)
MX (1) MX2022010588A (zh)
TW (1) TW202146428A (zh)
WO (1) WO2021174142A1 (zh)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113621076A (zh) * 2021-08-31 2021-11-09 南华大学 一种针对新冠病毒变异毒株Delta的融合蛋白、喷鼻式疫苗及其制备方法和应用
WO2023168286A1 (en) * 2022-03-01 2023-09-07 Tonix Pharmaceuticals Holding Corp. Recombinant poxvirus based vaccine against the omicron strain of sars-cov-2 virus and variants thereof
WO2023133227A3 (en) * 2022-01-06 2023-09-21 Board Of Regents, The University Of Texas System A sars-cov-2 human parainfluenza virus type 3-vectored vaccine
WO2024105539A1 (en) * 2022-11-15 2024-05-23 University Of Cape Town Recombinant lsdv vectored bovine coronavirus antigen constructs

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220154114A (ko) * 2020-02-14 2022-11-21 지오박스, 인크. 백신 및 SARS-CoV2에 대한 면역 반응을 유도하기 위한 그의 용도
US20230295655A1 (en) * 2020-07-31 2023-09-21 Tokyo Metropolitan Institute Of Medical Science Recombinant vaccinia virus
EP4316514A1 (en) * 2022-08-03 2024-02-07 Consejo Superior de Investigaciones Científicas (CSIC) Mva-based vectors and their use as vaccine against sars-cov-2

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6004777A (en) * 1997-03-12 1999-12-21 Virogenetics Corporation Vectors having enhanced expression, and methods of making and uses thereof
US20130216566A1 (en) * 2003-06-20 2013-08-22 D. Karl Anderson Vectors expressing SARS immunogens, compositions containing such vectors or expression products thereof, methods and assays for making and using
US20180251736A1 (en) * 2016-11-02 2018-09-06 David Evans Synthetic chimeric poxviruses
US20180326039A1 (en) * 2015-09-16 2018-11-15 Shin Nippon Biomedical Laboratories, Ltd. Vaccine compositions
US20200407402A1 (en) * 2020-06-29 2020-12-31 The Scripps Research Institute Stabilized Coronavirus Spike (S) Protein Immunogens and Related Vaccines

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005028634A2 (en) * 2003-09-18 2005-03-31 Emory University Improved mva vaccines
WO2005103259A1 (en) * 2004-04-26 2005-11-03 University Health Network Sars-cov nucleocapsid protein epitopes and uses thereof
CN101020055B (zh) * 2006-02-16 2012-08-08 中国疾病预防控制中心性病艾滋病预防控制中心 基于复制型痘苗病毒载体的sars疫苗
EP3045181B1 (en) * 2015-01-19 2018-11-14 Ludwig-Maximilians-Universität München A novel vaccine against the middle east respiratory syndrome coronavirus (MERS-CoV)
TW201946651A (zh) 2018-05-02 2019-12-16 大衛 伊凡斯 合成之嵌合牛痘病毒

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6004777A (en) * 1997-03-12 1999-12-21 Virogenetics Corporation Vectors having enhanced expression, and methods of making and uses thereof
US20130216566A1 (en) * 2003-06-20 2013-08-22 D. Karl Anderson Vectors expressing SARS immunogens, compositions containing such vectors or expression products thereof, methods and assays for making and using
US20180326039A1 (en) * 2015-09-16 2018-11-15 Shin Nippon Biomedical Laboratories, Ltd. Vaccine compositions
US20180251736A1 (en) * 2016-11-02 2018-09-06 David Evans Synthetic chimeric poxviruses
US20200407402A1 (en) * 2020-06-29 2020-12-31 The Scripps Research Institute Stabilized Coronavirus Spike (S) Protein Immunogens and Related Vaccines

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Wu et al., "A new coronavirus associated with human respiratory disease in China," Nature, Vol. 579: 265-269 (Year: 2020) *
Zhang et al., "Progress and Prospects on Vaccine Development against SARS-CoV-2," Vaccines 8: 153 (Year: 2020) *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113621076A (zh) * 2021-08-31 2021-11-09 南华大学 一种针对新冠病毒变异毒株Delta的融合蛋白、喷鼻式疫苗及其制备方法和应用
WO2023133227A3 (en) * 2022-01-06 2023-09-21 Board Of Regents, The University Of Texas System A sars-cov-2 human parainfluenza virus type 3-vectored vaccine
WO2023168286A1 (en) * 2022-03-01 2023-09-07 Tonix Pharmaceuticals Holding Corp. Recombinant poxvirus based vaccine against the omicron strain of sars-cov-2 virus and variants thereof
WO2024105539A1 (en) * 2022-11-15 2024-05-23 University Of Cape Town Recombinant lsdv vectored bovine coronavirus antigen constructs

Also Published As

Publication number Publication date
CN116348135A (zh) 2023-06-27
MX2022010588A (es) 2023-02-09
TW202146428A (zh) 2021-12-16
BR112022016992A2 (pt) 2022-10-25
JP2023515582A (ja) 2023-04-13
IL295925A (en) 2022-10-01
CA3173996A1 (en) 2021-09-02
KR20220165731A (ko) 2022-12-15
WO2021174142A1 (en) 2021-09-02
EP4110386A1 (en) 2023-01-04
AU2021226592A1 (en) 2022-09-22

Similar Documents

Publication Publication Date Title
US20210260182A1 (en) RECOMBINANT POXVIRUS BASED VACCINE AGAINST SARS-CoV-2 VIRUS
Mackett et al. General method for production and selection of infectious vaccinia virus recombinants expressing foreign genes
Kotwal et al. Analysis of a large cluster of nonessential genes deleted from a vaccinia virus terminal transposition mutant
DK2933336T3 (en) Baculovirus-based production of biopharmaceuticals free of contaminating baculoviral virions
JP6316227B2 (ja) 複数の相同ヌクレオチド配列を含むベクター
Senkevich et al. A poxvirus protein with a RING zinc finger motif is of crucial importance for virulence
KR102403547B1 (ko) 외인성 항원을 포함하는 인간 시토메갈로바이러스
RU2569183C2 (ru) Векторы
JPH0795954B2 (ja) 外来性遺伝子発現のためのポックスウイルス組換え体の製造方法
US20230002741A1 (en) Synthetic chimeric poxviruses
CN112543806A (zh) 合成嵌合痘苗病毒
JP2000507092A (ja) 外来ｄｎａを含むパラポックスウイルス、それらの製造及びワクチンにおけるそれらの使用
CN113817753B (zh) 表达SARS-CoV-2纤突蛋白或其变异体SΔ21的假型化VSV病毒构建和应用
Yuan et al. Direct cloning of a herpesvirus genome for rapid generation of infectious BAC clones
WO2009051823A2 (en) Bacterial artificial chromosome containing feline herpes virus type 1 genome and uses thereof
CN112261951A (zh) 包含合成嵌合痘苗病毒的干细胞及其使用方法
KR20230144530A (ko) 아데노바이러스 혈청형 35 헬퍼 벡터
WO2023168286A1 (en) Recombinant poxvirus based vaccine against the omicron strain of sars-cov-2 virus and variants thereof
CN116492456B (zh) 非洲猪瘟病毒d129l基因及其在制备复制缺陷型非洲猪瘟疫苗中的应用
CN116492455B (zh) 非洲猪瘟病毒k421r基因及利用其制备的复制缺陷型非洲猪瘟疫苗
Inayoshi et al. Bacterial artificial chromosome-based reverse genetics system for cloning and manipulation of the full-length genome of infectious bronchitis virus
JP3924328B2 (ja) 新規ｄｎａベクター、及び組み換え新規ｄｎａベクターを有効成分とするワクチン
JPH0544269B2 (zh)

Legal Events

Date Code Title Description
AS Assignment

Owner name: TONIX PHARMACEUTICALS, INC., NEW JERSEY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INSTITUTE, SOUTHERN RESEARCH;REEL/FRAME:057172/0593

Effective date: 20210805

Owner name: TONIX PHARMACEUTICALS HOLDING CORP., NEW JERSEY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:LEDERMAN, SETH;REEL/FRAME:057172/0569

Effective date: 20210713

Owner name: INSTITUTE, SOUTHERN RESEARCH, ALABAMA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GOEBEL, SCOTT J.;REEL/FRAME:057172/0531

Effective date: 20210802

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

AS Assignment

Owner name: TONIX PHARMA LIMITED, IRELAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:TONIX PHARMACEUTICALS HOLDING CORP.;REEL/FRAME:060858/0287

Effective date: 20220818

Owner name: TONIX PHARMACEUTICALS HOLDING CORP., NEW JERSEY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:TONIX PHARMACEUTICALS, INC.;REEL/FRAME:060858/0272

Effective date: 20220818

Owner name: THE GOVERNORS OF THE UNIVERSITY OF ALBERTA, CANADA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:EVANS, DAVID;NOYCE, RYAN;REEL/FRAME:060858/0242

Effective date: 20220810

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STCV Information on status: appeal procedure

Free format text: NOTICE OF APPEAL FILED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION