US20190022202A1 - Therapeutic anticancer neoepitope vaccine - Google Patents

Therapeutic anticancer neoepitope vaccine Download PDF

Info

Publication number
US20190022202A1
US20190022202A1 US16/068,449 US201716068449A US2019022202A1 US 20190022202 A1 US20190022202 A1 US 20190022202A1 US 201716068449 A US201716068449 A US 201716068449A US 2019022202 A1 US2019022202 A1 US 2019022202A1
Authority
US
United States
Prior art keywords
linker
neoepitopes
seq
vaccine
antigenic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US16/068,449
Other languages
English (en)
Inventor
Stine Granum
Elisabeth Stubsrud
Agnete Brunsvik Fredriksen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nykode Therapeutics AS
Original Assignee
Vaccibody AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vaccibody AS filed Critical Vaccibody AS
Assigned to VACCIBODY AS reassignment VACCIBODY AS ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: FREDRIKSEN, AGNETE BRUNSVIK, GRANUM, Stine, STUBSRUD, Elisabeth
Publication of US20190022202A1 publication Critical patent/US20190022202A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001116—Receptors for cytokines
    • A61K39/001121—Receptors for chemokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A61K2039/6056—Antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/62—Medicinal preparations containing antigens or antibodies characterised by the link between antigen and carrier
    • A61K2039/627—Medicinal preparations containing antigens or antibodies characterised by the link between antigen and carrier characterised by the linker
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/64—Medicinal preparations containing antigens or antibodies characterised by the architecture of the carrier-antigen complex, e.g. repetition of carrier-antigen units
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/70—Multivalent vaccine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/80—Vaccine for a specifically defined cancer
    • A61K2039/876—Skin, melanoma

Definitions

  • the present invention relates to an anticancer vaccine comprising polynucleotides or polypeptides, methods of treatment of cancer wherein such an anticancer vaccine is used as well as methods for producing the vaccine.
  • cancer immune therapies targeting cancer cells with the help of the patient's own immune system i.e. cancer vaccines
  • cancer vaccines have attracted interest because such therapies may reduce or even eliminate some of the side-effects seen in the traditional cancer treatment.
  • the foundation of immunology is based on self-nonself discrimination. Most of the pathogens inducing infectious diseases contain molecular signatures that can be recognized by the host and trigger immune responses. However tumor cells are derived from normal cells, and do not generally express any molecular signatures, making them more difficult to be distinguished from normal cells.
  • tumor associated antigens i.e. antigens expressed at low levels in normal tissues and expressed at a much higher level in tumor tissue.
  • tumorassociated antigens have been the target for cancer vaccines for the last decade.
  • immunological treatment directed towards tumor associated antigens exhibit several challenges, in that the tumor cells may evade the immune system by downregulating the antigen in question, and the treatment may also lead to toxicities due to normal cell destruction.
  • tumor neoantigens arise due to one or more mutations in the tumor genome leading to a change in the amino acid sequence of the protein in question. Since these mutations are not present in normal tissue, the side-effects of the treatment directed towards the tumor associated antigens do not arise with an immunologic treatment towards tumor neoantigens.
  • the average number of somatic, tumor-specific non-synonymous mutations for malignant melanoma is between 100 and 120.
  • Some of the genetic alterations can be recognized by the immune system, representing ideal antigens. Animal models have confirmed the utility of immunization with tumor neoantigens, and two clinical trials have been initiated, one with a vaccine comprising up to 10 mutated proteins and the other with an RNA vaccine (IVAC MUTANOME).
  • the RNA vaccine comprises 2 RNA molecules each comprising five different mutation-encoding sequences.
  • the present invention relates to a therapeutic anticancer vaccine being directed to a plurality of neoepitopes from tumor neoantigens, wherein the neoepitopes are presented to the immune system as a dimeric protein called a vaccibody.
  • WO 2004/076489 describes dimeric proteins called vaccibodies in detail.
  • the invention relates to the polynucleotide as defined above.
  • Such polynucleotide is e.g. useful in a vaccine according to the invention.
  • the invention in a third aspect relates to a vector comprising the polynucleotide as defined above, and in a fourth aspect the invention relates to a host cell comprising the polynucleotide or the vector as defined above.
  • the invention relates to a polypeptide encoded by the polynucleotide as defined above.
  • Such polypeptide is e.g. useful in a vaccine according to the invention, and in a sixth aspect the invention relates to a dimeric protein consisting of two polypeptides as defined above.
  • the invention relates to the polypeptide, the dimeric protein, or the polynucleotide as defined above for use as a medicament.
  • the vaccine comprises a polypeptide or a dimeric protein
  • the invention relates to a method for preparing a dimeric protein or an polypeptide as defined above, wherein the method comprises
  • the vaccine comprises a polynucleotide
  • the invention relates to a method for preparing a vaccine, such as a DNA or RNA vaccine, comprising an immunologically effective amount of a polynucleotide, wherein said method comprises
  • the invention in a tenth aspect relates to a method of treating cancer in a patient, the method comprising administering to the patient in need thereof, a vaccine as defined above.
  • the invention in an alternative tenth aspect, relates to a vaccine as defined above for use in a method of treating cancer.
  • FIG. 1 shows a schematic drawing of a dimeric protein according to the invention having 3, 10 or 20 neoepitopes on each monomer, respectively.
  • FIG. 2 shows that neoantigen-based vaccibody proteins are produced and secreted as functional homodimers after transfection of HEK293 cells with VB10.NEO constructs.
  • FIG. 2 upper left panels shows Western blots of VB10.NEO CT26-X (VB4001) and VB10.NEO B16-X (VB4003) comprising 10 neoepitopes and
  • FIG. 2 lower left panels shows Western blots of VB10.NEO CT26-III (VB4002) and VB10.NEO B16-III (VB4004) comprising 3 neoepitopes.
  • the formation of functional homodimers are shown in the left panels of the western blots for each construct ( ⁇ reducing agent).
  • FIG. 2 right panels shows results from two ELISA experiments detecting vaccibody proteins in the supernatant from HEK293 cells transfected with the VB10.NEO constructs.
  • Upper right panel shows the expression level of the VB10.NEO CT26 constructs, VB4001 and VB4002, and lower right panel shows the expression level of the VB10.NEO B16 constructs, VB4003 and VB4004
  • FIG. 3 illustrates that strong and broad T-cell responses are induced after a single injection with vaccibody DNA vaccines comprising 10 neoepitopes when compared to vaccibody DNA vaccines comprising 3 neoepitopes.
  • the left panel displays IFN- ⁇ responses towards individual neoepitopes in the B16 melanoma model when injecting VB10.NEO B16-III (VB4004) or VB10.NEO B16-X (VB4003) comprising 3 and 10 neoepitopes, respectively.
  • the right panel displays IFN- ⁇ responses towards neoepitopes in the CT26 colon carcinoma model when injecting VB10.NEO CT26-III (VB4002) or VB10.NEO CT26-X (VB4001) comprising 3 and 10 neoepitopes, respectively.
  • the x-axis represents the 10 different neoepitopes, pepM1-M10.
  • FIG. 4 illustrates that vaccibody DNA vaccines comprising 10 neoepitopes induces a stronger and broader total immune response than vaccibody DNA vaccines comprising only 3 neoepitopes.
  • Upper panel Comparison of the immune responses towards neoepitopes in the B16 melanoma model when injecting with VB10.NEO B16-X comprising 10 neoepitopes (VB4003) and VB10.NEO B16-III comprising 3 neoepitopes (VB4004), respectively.
  • FIG. 5 Vaccibody DNA vaccines comprising 10 neoepitopes induce a much stronger immune response than a mix of the corresponding 10 peptides plus adjuvant.
  • Upper panel Comparison of the vaccibody expression level of two variants of VB10.NEO B16-X with varying order of the 10 neoepitopes (VB4003 and VB4014) in the supernatant of HEK293 cells transfected with the corresponding Vaccibody DNA constructs, detected by sandwich ELISA.
  • every other neoepitope is either hydrophobic or hydrophilic, whereas in VB4014, the hydrophobic neoepitopes are placed centrally in the neoepitope antigenic module.
  • a hydrophobic core of neoepitopes in the antigenic module may improve expression and secretion of functional vaccibody proteins in the same constructs.
  • Lower panel The histogram shows immune responses induced by the DNA vaccines VB10.NEO B16-X VB4003 and VB4014, and a mix of 10 peptides plus adjuvant (the same 10 neoepitopes as encoded in the VB10.NEO B16-X constructs). The order of the neoepitopes within the neoepitope antigenic module does not change the hierarchy of the immunogenicity of the individual neoepitopes.
  • FIG. 6 VB10.NEO B16-X DNA vaccine where the 10 neoepitopes are spaced with 10 amino acid (aa) linkers (VB4011), induces a stronger total immune response, compared to VB10.NEO B16-X DNA vaccine where the 10 neoepitopes are spaced with 5 aa linkers (VB4003).
  • Upper panel Comparison of the vaccibody expression level of VB4003 and VB4011 in the supernatant of HEK293 cells transfected with the corresponding Vaccibody DNA constructs, detected by sandwich ELISA. Similar expression and secretion of functional vaccibody proteins are observed for VB4003 and VB4011.
  • FIG. 7 Vaccibody DNA vaccine comprising 2 ⁇ 10 neoepitopes (VB4018) induces a broader immune response against individual neoepitopes compared to vaccibody DNA vaccine comprising 1 ⁇ 10 neoepitopes (VB4003).
  • Upper panel Comparison of vaccibody expression levels of VB10.NEO B16-X (VB4003) and VB10.NEO B16-XX (VB4018) in the supernatant of HEK293 cells transfected with the corresponding vaccibody DNA constructs, detected by sandwich ELISA.
  • Lower panel Histogram showing the IFN- ⁇ immune response towards neoepitopes from the B16 melanoma model in mice injected with VB4003 or VB4018.
  • the benefit of including 2 copies of each neoepitope is limited on the total immune response, however, a broader immune response is observed towards individual neoepitopes.
  • Empty vector is included as a negative control.
  • FIG. 8 Several copies of each neoeptiope in a vaccibody construct gives a more uniform immune response against the 5 selected best neoepitopes.
  • Upper panel Comparison of vaccibody expression level of VB10.NEO B16-X (VB4003 and VB4011), VB10.NEO B16-XX (VB4018), VB10.NEO B16-Vx2 (VB4019) and VB10.NEO B16-Vx4 in the supernatant of HEK293 cells transfected with the corresponding vaccibody DNA constructs, detected by sandwich ELISA.
  • the figure illustrates that several copies of each neoepitope as observed with the vaccibody constructs VB4019 (Vx2) and VB4021 (Vx4) mediate a more evenly immune response towards the 5 shared neoepitopes compared to the decatope VB4003, where the 5 selected neoepitopes are presented once.
  • the construct holding 10 different neoepitopes i.e. just a single copy of the 5 neoepitopes tested in this assay
  • an increased length of the linker (10 amino acids, VB4011) induced the strongest total immune response towards the 5 shared neoepitopes.
  • FIG. 10 Expression levels of different vaccibody constructs comprising 3-neoepitopes are compared.
  • the vaccibody proteins are detected in the supernatant of HEK293 cells transfected with the different Vaccibody DNA constructs by sandwich ELISA
  • Upper panel Improved expression and secretion of functional vaccibody proteins are observed when the 3 neoepitopes are spaced with an 10 aa linker (VB4012) compared to a 5 aa linker (VB4004).
  • Lower panel The figure illustrates that changing the order of the neoepitopes may affect expression of the vaccibodies.
  • FIG. 11 illustrates immune responses in B16 melanoma mice that are induced after a single injection with vaccibody DNA vaccines comprising either 10 neoepitopes (VB4011), 15 neoepitopes (VB4024) or 20 neoepitopes (VB4025).
  • Upper panel Expression levels of the tested vaccibody constructs comprising 10-, 15- or 20 neoepitopes.
  • the vaccibody proteins are detected in the supernatant of HEK293 cells transfected with the different Vaccibody DNA constructs by sandwich ELISA.
  • the figure shows the total number of IFN ⁇ -spots per 10 6 splenocytes.
  • mice were injected with empty vector not comprising the neoepitopes.
  • vaccibody DNA vaccines comprising 20 neoepitopes induces a stronger and broader total immune response than vaccibody DNA vaccines comprising only 10 neoepitopes.
  • FIG. 12 illustrates immune responses in CT26 colon carcinoma mice that are induced after a single injection with vaccibody DNA vaccines comprising either 10 neoepitopes (VB4009), 15 neoepitopes (VB4026) or 20 neoepitopes (VB4027).
  • Upper panel Expression levels of the tested vaccibody construct VB10.NEO CT26-X comprising 10 neoepitopes (left panel) and vaccibody constructs VB10.NEO CT26-XV and XX comprising 15 and 20 neoepitopes, respectively (right panel).
  • FIG. 13 illustrates that mice immunized twice with VB10.NEO vaccine candidates comprising 10 neoepitopes are able to significantly delay and reduce tumour growth in the a) B16 melanoma model and b) the CT26 colon carcinoma model compared to negative control mice receiving PBS only.
  • the figure shows the tumour volume development over time.
  • mice were divided into responders that were able to stabilize tumour growth and non-responders.
  • Tumor is used in the present context for both a solid tumor as well as for tumor cells found in a bodily fluid, such as blood.
  • Tumor neoantigen is used for any tumor specific antigen comprising one or more mutations as compared to the host's exome and is used synonymously with the term cancer neoantigen.
  • Tumor neoepitope is used for any immunogenic mutation in a tumor antigen and is used synonymously with the term cancer neoepitope.
  • Tumor neoepitope sequence is used to describe the sequence comprising the neoepitope in an antigenic subunit, and is used synonymously with the term cancer neoepitope sequence.
  • Therapeutic anticancer vaccine is used to describe that the vaccine is used for reducing or destroying tumor cells already present in the patient.
  • Cancers develop from the patient's normal tissue by one or a few cells starting an abnormal uncontrolled proliferation of the cells due to mutations. Although the cancer cells are mutated, most of the genome is intact and identical to the remaining cells in the patient. This is also the explanation of some of the failures in prior attempts to develop an anticancer vaccine, namely that the vaccine to some extent is also directed to the normal cells in the patient.
  • the approach of attacking a tumor as defined by the present invention is to use the knowledge that any tumor, due to the mutations, expresses mutated proteins, so-called neoantigens that are not identical to any proteins in the normal cells of the patient, and therefore the neoantigens are efficient targets for a therapeutic anticancer vaccine.
  • the mutations found in a tumor are normally highly individual, and accordingly, the vaccine according to the present invention is personalized for use only in the patient having the mutation in question.
  • the vaccines according to the present invention use the normal adaptive immune system to provide immunity against the tumor cells.
  • the adaptive immune system is specific in that every foreign antigen evokes an immune response specifically towards said foreign antigen by the recognition of specific “non-self” antigens during a process called antigen presentation.
  • the cells of the adaptive immune system are lymphocytes, in particularly B cells and T cells. B cells are involved in the humoral immune response, whereas T cells are involved in cell-mediated immune response.
  • the vaccine according to the present invention is designed for evoking a cell-mediated immune response through activation of T cells against the neoantigens.
  • T cells recognize neoepitopes when they have been processed and presented complexed to a MHC molecule as discussed below.
  • MHC Major Histocompatibility Complex
  • MHC-neoepitope complexes There are two primary classes of major histocompatibility complex (MHC) molecules, MHC I and MHC II.
  • MHC I is found on the cell surface of all nucleated cells in the body.
  • One function of MHC I is to display peptides of non-self proteins from within the cell to cytotoxic T cells.
  • the MHC I complex-peptide complex is inserted into the plasma membrane of the cell presenting the peptide to the cytotoxic T cells, whereby an activation of cytotoxic T cells against the particular MHC-peptide complex is triggered.
  • the peptide is positioned in a groove in the MHC I molecule, allowing the peptide to be about 8-10 amino acids long.
  • MHC II molecules are a family of molecules normally found only on antigen-presenting cells such as dendritic cells, mononuclear phagocytes, some endothelial cells, thymic epithelial cells, and B cells.
  • the antigens presented by class II peptides are derived from extracellular proteins. Extracellular proteins are endocytosed, digested in lysosomes, and the resulting antigenic peptides are loaded onto MHC class II molecules and then presented at the cell surface.
  • the antigen-binding groove of MHC class II molecules is open at both ends and is able to present longer peptides, generally between 15 and 24 amino acid residues long.
  • Class I MHC molecules are recognized by CD8 and co-receptors on the T cells, normally called CD8+ cells, whereas class II MHC molecules are recognized by CD4 and co-receptors on the T cells, normally called CD4+ cells.
  • the neoantigen vaccines of the present invention comprise a polynucleotide encoding a polypeptide comprising three units, i.e. a targeting unit, a dimerization unit and an antigenic unit. Due to the dimerization unit the polypeptide forms a dimeric protein called a vaccibody.
  • the genes encoding the three units are genetically engineered to be expressed as one gene.
  • the polypeptides/dimeric proteins target antigen presenting cells (APCs), which results in enhanced vaccine potency compared to identical non-targeted antigens.
  • the present invention relates to vaccines where the antigenic unit comprises antigenic subunits, wherein each subunit comprises a cancer neoepitope sequence or at least a part of a cancer neoepitope sequence.
  • the neoepitope sequence is obtained by sequencing tumor DNA or RNA and identifying tumor specific mutations representing neoantigens. Thereby, a personalized neoantigen vaccine is obtained that specifically targets the identified tumor antigens.
  • the vaccine comprises n neoepitopes or neoepitope sequences and n ⁇ 1 second linkers, wherein n is an integer from 3 to 50.
  • the antigenic unit according to the invention comprises a plurality of tumor neoepitopes, wherein each neoepitope corresponds to a mutation identified in a tumor neoantigen.
  • the mutation may be any mutation leading to a change in at least one amino acid. Accordingly, the mutation may be one of the following:
  • each subunit consists of a tumor neoepitope sequence and a second linker, whereas the last subunit comprises a neoepitope only, i.e. no such second linker. Due to the separation of the tumor neoepitope sequences by said second linker, each neoepitope is presented in an optimal way to the immune system, whereby the efficiency of the vaccine is ensured as discussed below.
  • the cancer neoepitope sequence preferably has a length suitable for presentation by the MHC molecules discussed above.
  • the cancer neoepitope is from 7 to 30 amino acids long. More preferred are cancer neoepitope sequences having a length of from 7 to 10 amino acids or cancer neoepitope sequences having a length of from 13 to 30 amino acids.
  • the approach is to include as many neoepitopes as possible into the vaccine in order to attack the tumor efficiently.
  • the object of the vaccine is to activate the T cells against the neoepitopes, and the T cells may be diluted in case too many neoepitopes are included into the vaccine, and therefore it is a balance to provide the vaccine with an optimal number of neoepitopes in the antigenic unit.
  • the tumor exome is analysed to identify neoantigens and subsequently the most antigenic neoepitopes are selected.
  • the present inventor has found that at least 3 neoepitopes should be selected to be incorporated into the vaccine, such as at least 5 neoepitopes, such as at least 7 neoepitopes, such as at least 10 neoepitopes, in order to efficiently be able to “hit” substantially all tumor cells.
  • the inventors of the present invention have found that increasing the numbers of neoepitopes in the vaccine constructs from 3 neoepitopes to 10 neoepitopes leads to a surprising increase in the immune response (see FIG. 4 ). In addition, it has been found that increasing the number of neoepitopes in the vaccine constructs from 10 neoepitopes to 15 or 20 neoepitopes leads to a further increase in the immune response (see FIGS. 11 and 12 ).
  • the vaccine according to the present invention comprises at least 10 neoepitopes. In another preferred embodiment the vaccine according to the present invention comprises at least 15 neoepitopes, such as at least 20 neoepitopes.
  • neoepitopes are included in the vaccine in order to obtain the most efficient immune response without diluting the T cells, such as from 3 to 30 neoepitopes, such as from 3 to 20 neoepitopes, such as from 3 to 15 neoepitopes, such as from 3 to 10 neoepitopes, and consequently n is preferably an integer of from 3 to 50, such as from 3 to 30, such as from 5 to 25, such as from 3 to 20, such as from 3 to 15, such as from 3 to 10.
  • neoepitopes may be included in the vaccine in order to obtain the most efficient immune response without diluting the T cells, such as from 5 to 30 neoepitopes, such as for example from 5 to 25 neoepitopes, such as from 5 to 20 neoepitopes, such as from 5 to 15 neoepitopes, such as from 5 to 10 neoepitopes, and consequently n is preferably an integer of from 5 to 50, such as from 5 to 30, such as from 5 to 25, such as from 5 to 20, such as from 5 to 15, such as from 5 to 10.
  • neoepitopes may be included in the vaccine in order to obtain the most efficient immune response without diluting the T cells, such as from 10 to 40 neoepitopes, such as from 10 to 30 neoepitopes, such as from 10 to 25 neoepitopes, such as from 10 to 20 neoepitopes, such as from 10 to 15 neoepitopes, and consequently n is preferably an integer of from 10 to 50, such as from 10 to 30, such as from 10 to 20, such as from 10 to 15 neoepitopes.
  • vaccibody DNA vaccines comprising 10 neoepitopes induces a stronger and broader total immune response than vaccibody DNA vaccines comprising only 3 neoepitopes (see FIG. 4 and Example 2). Further, increasing the number of neoepitopes to more than 20 may result in a less efficient vaccine due to a dilution of the T cells. Further, it can be associated with technical difficulties to include more than 20 neoepitopes.
  • the vaccine comprises from 10 to 20 neoepitopes.
  • neoepitopes are included in the vaccine in order to obtain the most efficient immune response without diluting the T cells, such as from 15 to 30 neoepitopes or such as from 15 to 20 neoepitopes and consequently n is preferably an integer of from 15 to 50, such as from 15 to 30 or such as from 15 to 20 neoepitopes.
  • the antigenic unit comprises one copy of each cancer neoepitope, so that when 10 neoepitopes are included in the vaccine a cell-mediated immune response against 10 different neoepitopes can be evoked.
  • the antigenic unit may comprise at least two copies of at least one neoepitope in order to strengthen the immune response to these neoepitopes. Also for manufacturing and regulatory reasons it may be an advantage to keep the length of plasmid and i.e. the antigenic unit constant, and therefore it may be advantageously to include more than one copy of the same neoepitope in the antigenic unit.
  • the neoepitope may have a substantial length, such as consisting of at least the mutated part of the protein, the most antigenic portion of the mutated protein or maybe of the whole mutated protein, whereby the length of at least one of the neoepitopes is substantially longer than the neoepitopes arising from a non-synonymous point mutation.
  • the length of the antigenic unit is primarily determined by the length of the neoepitopes and the number of neoepitopes arranged in the antigenic unit and is from about 21 to 1500, preferably from about 30 amino acids to about a 1000 amino acids, more preferably from about 50 to about 500 amino acids, such as from about 100 to about 400 amino acids, from about 100 to about 300 amino acids.
  • the cancer neoepitope sequence comprises the neoepitope flanked at both sides by an amino acid sequence.
  • the neoepitope is positioned essentially in the middle of a cancer neoepitope sequence, in order to ensure that the neoepitope is presented by the antigen presenting cells after processing.
  • the amino acid sequences flanking the neoepitope are preferably the amino acid sequences flanking the neoepitope in the neoantigen, whereby the cancer neoepitope sequence is a true subsequence of the cancer neoantigen amino acid sequence.
  • the neoepitopes are randomly arranged in the antigenic subunit, it is preferred to follow at least one of the following methods for ordering the neoepitopes in the antigenic unit in order to enhance the immune response.
  • the antigenic subunits are arranged in the order of more antigenic to less antigenic in the direction from the first linker towards the final neoepitope.
  • the most hydrophobic antigenic subunit(s) is/are substantially positioned in the middle of the antigenic unit and the most hydrophilic antigenic subunit(s) is/are positioned at the beginning and/or end of the antigenic unit.
  • the neoepitopes may be arranged alternating between a hydrophilic and a hydrophobic neoepitope.
  • GC rich neoepitopes should be spaced so that GC clusters are avoided, preferably GC rich neoepitopes are spaced by at least one subunit.
  • the second linker is designed to be non-immunogenic and is preferably also a flexible linker, whereby the tumor neoepitopes, in spite of the high numbers of antigenic subunits present in the antigenic unit, are presented in an optimal manner to the T cells.
  • the length of the second linker is from 4 to 20 amino acids to secure the flexibility.
  • the length of the second linker is from 8 to 20 amino acids, such as from 8 to 15 amino acids, for example 8 to 12 amino acids or such as for example from 10 to 15 amino acids.
  • the length of the second linker is 10 amino acids.
  • the vaccine of the present invention comprises 10 neoepitopes, wherein the second linkers have a length of from 8 to 20 amino acids, such as from 8 to 15 amino acids, for example 8 to 12 amino acids or such as for example from 10 to 15 amino acids.
  • the vaccine of the present invention comprises 10 neoepitopes and wherein the second linkers have a length of 10 amino acids.
  • the second linker is preferably identical in all antigenic subunits. If, however, one or more of the neoepitopes comprise an amino acid motif similar to the linker, it may be an advantage to substitute the neighbouring second linkers with a second linker of a different sequence. Also, if a neoepitope-second linker junction is predicted to constitute an epitope in itself, then a second linker of a different sequence might be used.
  • the second linker is preferably a serine-glycine linker, such as a flexible GGGGS linker, such as GGGSS, GGGSG, GGGGS or multiple variants thereof such as GGGGSGGGGS or (GGGGS) m , (GGGSS) m , (GGGSG) m , where m is an integer from 1 to 5, from 1 to 4 or from 1 to 3. In a preferred embodiment m is 2.
  • the serine-glycine linker further comprises at least one leucine (L), such as at least 2 or at least 3 leucines.
  • L leucine
  • the serine-glycine linker may for example comprise 1, 2, 3 or 4 leucine.
  • the serine-glycine linker comprises 1 leucine or 2 leucines.
  • the second linker comprises or consists of the sequence LGGGS, GLGGS, GGLGS, GGGLS or GGGGL. In another embodiment the second linker comprises or consists of the sequence LGGSG, GLGSG, GGLSG, GGGLG or GGGSL. In yet another embodiment the second linker comprises or consists of the sequence LGGSS, GLGSS, GGLSS, GGGLS or GGGSL.
  • the second linker comprises or consists of the sequence LGLGS, GLGLS, GLLGS, LGGLS or GLGGL. In another embodiment the second linker comprises or consists of the sequence LGLSG, GLLSG, GGLSL, GGLLG or GLGSL. In yet another embodiment the second linker comprises or consists of the sequence LGLSS, GLGLS, GGLLS, GLGSL or GLGSL.
  • the second serine-glycine linker has a length of 10 amino acids and comprises 1 leucine or 2 leucines.
  • the second linker comprises or consists of the sequence LGGGSGGGGS, GLGGSGGGGS, GGLGSGGGGS, GGGLSGGGGS or GGGGLGGGGS. In another embodiment the second linker comprises or consists of the sequence LGGSG GGGSG, GLGSGGGGSG, GGLSGGGGSG, GGGLGGGGSG or GGGSLGGGSG. In yet another embodiment the second linker comprises or consists of the sequence LGGSSGGGSS, GLGSSGGGSS, GGLSSGGGSS, GGGLSGGGSS or GGGSLGGGSS.
  • the second linker comprises or consists of the sequence LGGGSLGGGS, GLGGSGLGGS, GGLGSGGLGS, GGGLSGGGLS or GGGGLGGGGL.
  • the second linker comprises or consists of the sequence LGGSGLGGSG, GLGSGGLGSG, GGLSGGGLSG, GGGLGGGGLG or GGGSLGGGSL.
  • the second linker comprises or consists of the sequence LGGSSLGGSS, GLGSSGLGSS, GGLSSGGLSS, GGGLSGGGLS or GGGSLGGGSL.
  • the vaccine according to the present invention comprises at least 10 neoepitopes that are separated by 10 amino acid linkers. In another preferred embodiment the vaccine according to the present invention comprises at least 15 neoepitopes that are separated by 10 amino acid linkers, such as at least 20 neoepitopes that are separated by 10 amino acid linkers.
  • the vaccine comprises from 10 to 20 or from 10 to 25 neoepitopes that are separated by second linkers.
  • said second linkers are 10 amino acids.
  • the second linker may also have any length as defined herein above, such as for example from 8 to 12 amino acids.
  • Alternative linkers may be selected from the group consisting of GSAT linkers and SEG linkers, or multiple variants thereof.
  • the polypeptide/dimeric protein of the invention leads to attraction of dendritic cells (DCs), neutrophils and other immune cells.
  • DCs dendritic cells
  • the polypeptide/dimeric protein comprising the targeting module will not only target the antigens to specific cells, but in addition facilitate a response-amplifying effect (adjuvant effect) by recruiting specific immune cells to the administration site of the vaccine.
  • adjuvant effect a response-amplifying effect
  • targeting unit refers to a unit that delivers the polypeptide/protein with its antigen to an antigen presenting cell for MHC class II-restricted presentation to CD4+ T cells or for providing cross presentation to CD8+ T cells by MHC class I restriction.
  • the targeting unit is connected through the dimerization unit to the antigenic unit, wherein the latter is in either the COOH-terminal or the NH2-terminal end of the polypeptide/dimeric protein.
  • the antigenic unit is in the COOH-terminal end of the polypeptide/dimeric protein.
  • the targeting unit is designed to target the polypeptide/dimeric protein of the invention to surface molecules expressed on the relevant antigen presenting cells, such as molecules expressed exclusively on subsets of dendritic cells (DC).
  • DC dendritic cells
  • HLA human leukocyte antigen
  • CD14 cluster of differentiation 14
  • CD40 cluster of differentiation 40
  • TLRs Toll-like receptors
  • HLA is a major histocompatibility complex (MHC) in humans.
  • MHC myeloma
  • the Toll-like receptors may for example include TLR-2, TLR-4 and/or TLR-5.
  • the polypeptide/dimeric protein of the invention can be targeted to said surface molecules by means of targeting units comprising for example antibody binding regions with specificity for CD14, CD40, or Toll-like receptor; ligands, e.g. soluble CD40 ligand; natural ligands like chemokines, e.g. RANTES or MIP-1a; or bacterial antigens like for example flagellin.
  • targeting units comprising for example antibody binding regions with specificity for CD14, CD40, or Toll-like receptor; ligands, e.g. soluble CD40 ligand; natural ligands like chemokines, e.g. RANTES or MIP-1a; or bacterial antigens like for example flagellin.
  • the targeting unit has affinity for an MHC class II protein.
  • the nucleotide sequence encoding the targeting unit encodes an the antibody variable domains (VL and VH) with specificity for MHC class II proteins, selected from the group consisting of anti-HLA-DP, anti-HLA-DR and anti-HLA-II.
  • the targeting unit has affinity for a surface molecule selected from the group consisting of CD40, TLR-2, TLR-4 and TLR-5,
  • the nucleotide sequence encoding the targeting unit encodes the antibody variable domains (VL and VH) with specificity for anti-CD40, anti-TLR-2, anti-TLR-4 and anti-TLR-5.
  • the nucleotide sequence encoding the targeting unit encodes Flagellin. Flagellin has affinity for TLR-5.
  • the targeting unit has affinity for a chemokine receptor selected from CCR1, CCR3 and CCR5. More preferably, the nucleotide sequence encoding the targeting unit encodes the chemokine hMIP-1alpha (LD78beta), which binds to its cognate receptors, CCR1, CCR3 and CCR5 expressed on the cell surface of APCs.
  • chemokine hMIP-1alpha LD78beta
  • the binding of the polypeptide/dimeric protein of the invention to its cognate receptors leads to internalization in the APC and degradation of the proteins into small peptides that are loaded onto MHC molecules and presented to CD4+ and CD8+ T cells to induce tumor specific immune responses. Once stimulated and with help from activated CD4+ T cells, CD8+ T cells will target and kill tumor cells expressing the same neoantigens.
  • the targeting unit comprises an amino acid sequence having at least 80% sequence identity to the amino acid sequence 24-93 of SEQ ID NO:1.
  • the targeting unit comprises an amino acid sequence having at least 85% sequence identity to the amino acid sequence 24-93 of SEQ ID NO:1, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity.
  • the targeting unit consists of an amino acid sequence having at least 80% sequence identity to the amino acid sequence 24-93 of SEQ ID NO:1, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as at least 100% sequence identity to the amino acid sequence 24-93 of SEQ ID NO:1.
  • dimerization unit refers to a sequence of amino acids between the antigenic unit and the targeting unit.
  • the dimerization unit serves to connect the antigenic unit and the targeting unit, and facilitates dimerization of two monomeric polypeptides into a dimeric protein.
  • the dimerization unit also provides the flexibility in the polpeptide/dimeric protein to allow optimal binding of the targeting unit to the surface molecules on the antigen presenting cells (APCs), even if they are located at variable distances.
  • the dimerization unit may be any unit that fulfils these requirements.
  • the dimerization unit may comprise a hinge region and optionally another domain that facilitates dimerization, and the hinge region and the other domain may be connected through a third linker.
  • hinge region refers to a peptide sequence of the dimeric protein that facilitates the dimerization.
  • the hinge region functions as a flexible spacer between the units allowing the two targeting units to bind simultaneously to two target molecules on APCs, even if they are expressed with variable distances.
  • the hinge region may be Ig derived, such as derived from IgG3.
  • the hinge region may contribute to the dimerization through the formation of covalent bond(s), e.g. disulfide bridge(s).
  • covalent bond can for example be a disulfide bridge.
  • the other domain that facilitates dimerization is an immunoglobulin domain, such as a carboxyterminal C domain, or a sequence that is substantially identical to the C domain or a variant thereof.
  • the other domain that facilitates dimerization is a carboxyterminal C domain derived from IgG.
  • the immunoglobulin domain contributes to dimerization through non-covalent interactions, e.g. hydrophobic interactions.
  • the immunoglobulin domain has the ability to form dimers via noncovalent interactions.
  • the noncovalent interactions are hydrophobic interactions.
  • the dimerization unit does not comprise a CH2 domain.
  • the dimerization unit consists of hinge exons h1 and h4 connected through a third linker to a CH3 domain of human IgG3.
  • the dimerization unit comprises an amino acid sequence having at least 80% sequence identity to the amino acid sequence 94-237 of SEQ ID NO:3.
  • the dimerization unit comprises an amino acid sequence having at least 85% sequence identity to the amino acid sequence 94-237 of SEQ ID NO:3, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity.
  • the dimerization unit consists of an amino acid sequence having at least 80% sequence identity to the amino acid sequence 94-237 of SEQ ID NO:3, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as at least 100% sequence identity to the amino acid sequence 94-237 of SEQ ID NO:3.
  • the third linker is a G3S2G3SG linker.
  • the dimerization unit may have any orientation with respect to antigenic unit and targeting unit.
  • the antigenic unit is in the COOH— terminal end of the dimerization unit with the targeting unit in the N-terminal end of the dimerization unit.
  • the antigenic unit is in the N-terminal end of the dimerization unit with the targeting unit in the COOH-terminal end of the dimerization unit. It is preferred that the antigenic unit is in the COOH end of the dimerization unit.
  • the antigenic unit and the dimerization unit are preferably connected through a first linker.
  • the first linker may comprise a restriction site in order to facilitate the construction of the polynucleotide. It is preferred that the first linker is a GLGGL linker or a GLSGL linker.
  • the polynucleotide further comprises a nucleotide sequence encoding a signal peptide.
  • the signal peptide is constructed to allow secretion of the polypeptide encoded by the polynucleotide of the invention in the cells transfected with said polynucleotide.
  • Any suitable signal peptide may be used.
  • suitable peptides are an Ig VH signal peptide, such as SEQ ID NO: 31, a human TPA signal peptide, such as SEQ ID NO: 32, and a signal peptide comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence 1-23 of SEQ ID NO:1.
  • the signal peptide comprises an amino acid sequence having at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the amino acid sequence 1-23 of SEQ ID NO:1.
  • the signal peptide consists of an amino acid sequence having at least 80%, preferably at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% sequence identity to the amino acid sequence 1-23 of SEQ ID NO:1.
  • Sequence identity may be determined as follows: A high level of sequence identity indicates likelihood that the first sequence is derived from the second sequence. Amino acid sequence identity requires identical amino acid sequences between two aligned sequences. Thus, a candidate sequence sharing 70% amino acid identity with a reference sequence requires that, following alignment, 70% of the amino acids in the candidate sequence are identical to the corresponding amino acids in the reference sequence. Identity may be determined by aid of computer analysis, such as, without limitations, the ClustalW computer alignment program (Higgins D., Thompson J., Gibson T., Thompson J. D., Higgins D. G., Gibson T. J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res.
  • the ClustalW algorithm may similarly be used to align nucleotide sequences. Sequence identities may be calculated in a similar way as indicated for amino acid sequences.
  • a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the FASTA sequence alignment software package (Pearson W R, Methods Mol Biol, 2000, 132:185-219). Align calculates sequence identities based on a global alignment. Align0 does not penalise to gaps in the end of the sequences. When utilizing the ALIGN og Align0 program for comparing amino acid sequences, a BLOSUM50 substitution matrix with gap opening/extension penalties of ⁇ 12/ ⁇ 2 is preferably used.
  • the invention also relates to a polynucleotide as described above.
  • the polynucleotide may comprise a DNA nucleotide sequence or a RNA nucleotide sequence, such as genomic DNA, cDNA, and RNA sequences, either double stranded or single stranded.
  • polynucleotide is optimized to the species to express the polypeptide according to the invention, i.e. it is preferred that the polynucleotide sequence is human codon optimized.
  • the invention further relates to a polypeptide encoded by the polynucleotide sequence as defined above.
  • the polypeptide may be expressed in vitro for production of the vaccine according to the invention, or the polypeptide may be expressed in vivo as a result of administration of the polynucleotide as defined above.
  • the dimeric protein may be a homodimer, i.e. wherein the two polypeptide chains are identical and consequently comprise identical neoepitopes, or the dimeric protein may be a heterodimer comprising two different monomeric polypeptides encoded in the antigenic units. The latter may be relevant if the amount of neoepitopes exceeds an upper size limit for the antigenic unit. It is however preferred that the dimeric protein is a homodimeric protein.
  • the invention relates to a vector comprising a nucleotide sequence as defined above. It is preferred that the vector allows for easy exchange of the various units described above, in particularly the antigenic unit.
  • the expression vector may be pUMVC4a vector or NTC9385R vector backbones.
  • the antigenic unit may be exchanged with an antigenic unit cassette restricted by the Sfil restriction enzyme cassette where the 5′ site is incorporated in the GLGGL/GLSGL linker and the 3′ site is included after the stop codon in the vector.
  • the invention also relates to a host cell comprising a nucleotide sequence as defined above or comprising a vector as defined above for expression of the polypeptide according to the invention.
  • Suitable host cells include prokaryotes, yeast, insect or higher eukaryotic cells.
  • the vaccine according to the invention is preferably a personalized vaccine in the sense that the neoantigens are identified in the patient's tumor and accordingly, the vaccine is directed exactly against the specific mutated proteins in the patient's tumor.
  • the invention relates to a method for preparing a vaccine comprising an immunologically effective amount of the dimeric protein, or the polypeptide as defined above by producing the polypeptides in vitro.
  • the in vitro synthesis of the polypeptides and proteins may be carried out by any suitable method known to the person skilled in the art, such a through peptide synthesis or expression of the polypeptide in any of a variety of expressions systems followed by purification.
  • the method comprises
  • the dimeric protein or polypeptide obtained under step c) is dissolved in said pharmaceutically acceptable carrier.
  • an adjuvant or buffer may be added to the vaccine.
  • Purification may be carried out according to any suitable method, such as chromatography, centrifugation, or differential solubility.
  • the invention relates to a method for preparing a vaccine comprising an immunologically effective amount of the polynucleotide as defined above.
  • the method comprises
  • the polynucleotide may be prepared by any suitable method known to the skilled person.
  • the polynucleotide may be prepared by chemical synthesis using an oligonucleotide synthesizer.
  • nucleotide sequences such as for example nucleotide sequences encoding the targeting unit, the dimerization unit and/or the subunits of the antigenic unit may be synthesized individually and then ligated to produce the final polynucleotide into the vector backbone.
  • This method preferably includes the steps of
  • the tumor or tumor part may be by through any suitable method, such as by obtaining a biopsy of the tumor or by excision of the tumor, or from any suitable body fluid, such as a blood sample or a urine sample.
  • the genome or the exome i.e. the coding part of the genome, may be sequenced using any suitable method, such as whole exome sequencing.
  • the sequencer may be an Illumina HiSeq2500), using Paired-end 2 ⁇ 100-125 or PE100-125 (read length), multiplex.
  • the next step is to select predicted antigenic peptides comprising the neoepitopes.
  • Tumor mutations are discovered by sequencing of tumor and normal tissue and make a comparison of the obtained sequences.
  • a variety of methods are available for detecting the presence of a particular mutation or allele in an individual's DNA or RNA. For example techniques including dynamic allele-specific hybridization (DASH), microplate array diagonal gel electrophoresis (MADGE), pyrosequencing, oligonucleotide-specific ligation, the TaqMan system as well as various DNA “chip” technologies such as the Affymetrix SNP chips may be applied.
  • DASH dynamic allele-specific hybridization
  • MADGE microplate array diagonal gel electrophoresis
  • pyrosequencing oligonucleotide-specific ligation
  • TaqMan system as well as various DNA “chip” technologies such as the Affymetrix SNP chips may be applied.
  • a method for identifying mutations by direct protein sequencing may be carried out.
  • the neoepitopes are selected in silico on the basis of predictive HLA-binding algorithms. The intention is to identify all relevant neoepitopes and after a ranking or scoring determine the neoepitopes to be included in the vaccine for the specific patient in question.
  • IEDB and NetMHC Available free software analysis of peptide-MHC binding
  • Each mutation is scored with respect to its antigenicity, and the most antigenic neoepitopes are selected and optimally designed in the polynucleotide. As discussed above from 3 to 50 neoepitopes are preferred according to the present invention.
  • the final vaccine is then produced to comprise one of the following:
  • the vaccine may further comprise a pharmaceutically acceptable carrier, diluent, adjuvant or buffer.
  • Pharmaceutically acceptable carriers, diluents, and buffers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, sterile isotonic aqueous buffer, and combinations thereof.
  • pharmaceutically acceptable adjuvants include, but are not limited to poly-ICLC, 1018 ISS, aluminum salts, Amplivax, AS 15, BCG, CP-870,893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, Imiquimod, ImuFact EV1P321, IS Patch, ISS, ISCOMATRIX, JuvImmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PepTel®, vector system, PLGA microparticles, resiquimod, SRL172, Virosomes and other Virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys
  • the carriers may include molecules that ease transfection of cells and adjuvants may include plasmids comprising nucleotide sequences encoding chemokines or cytokines in order to enhance the immune response.
  • the vaccine is formulated into any suitable formulation, such as a liquid formulation for intradermal or intramuscular injection.
  • the vaccine may be administered in any suitable way for either a polypeptide/protein vaccine or a polynucleotide vaccine, such as administered by injection intradermally, intramuscular, subcutaneously, or by mucosal or epithelial application, such as intranasally, orally, enteral or to the bladder.
  • the vaccine is preferably administered intramuscular or intradermally when the vaccine is a polynucleotide vaccine.
  • the vaccine is administered by intranodal injection.
  • intranodal injection means that the vaccine is injected into the lymph nodes.
  • the polynucleotides, polypeptides and dimeric proteins are preferably for use in the treatment of cancer, and formulated in a vaccine as discussed above.
  • a vaccine as discussed above.
  • the cancer may be any cancer wherein the cancer cells comprise mutations.
  • the cancer may be a primary tumor, metastasis or both.
  • the tumor examined for mutations may be a primary tumor or a metastasis.
  • the cancers to be treated are in particularly the cancers known to have a high mutational load, such as melanomas, lung cancer, breast cancer, prostate cancer or colonic cancer.
  • the treatment is performed with a vaccine comprising a polynucleotide as described above, for example wherein the polynucleotide is DNA or RNA.
  • polypeptides are produced locally and relevant immune cells internalize the polypeptides/proteins essentially at the site of production, and substantially no polypeptides or proteins reach the blood stream.
  • Any suitable method for injecting the polynucleotide may be used, such as by the use of a jet injector or assisted by electroporation.
  • the vaccine may be administered as a single dosage, or may be repeated. When the vaccine administration is repeated it is preferred that it is administered with at least 3 week intervals, to avoid exhaustion of the T cells.
  • the dosage regimen would be vaccination week 0, 3, 6 and then every 4 weeks as long as the patient has clinical benefit.
  • the vaccine may be administered for at least a year.
  • the vaccine is administered in an immunologically effective amount.
  • immunologically effective amount is meant the amount of the vaccine required to establish a tumor reducing effect.
  • the physician determines the dosage that typically is in the range of 0.3-6 mg for DNA vaccines, and in the range of 5 ⁇ g-5 mg for polypeptide/protein vaccines.
  • the vaccine treatment according to the present invention may be combined with any other anticancer treatment, such as radiation therapy, chemotherapy, and surgical treatment.
  • the vaccine treatment according to the invention may also be combined with checkpoint-blockade inhibitor treatment.
  • Each of the neoepitopes are peptides of 27 amino acids separated by a flexible GGGGS linker. Short peptides ( ⁇ 20 amino acids) are processed and novel epitopes may be presented on MHC class I molecules and activate CD8+ T cells. However, it is preferred that the vaccine activates CD8+ and CD4+ T cells and therefore neoepitopes encoding for long peptides (>20 amino acids) are chosen. That may allow for efficient peptide processing and presentation on both MHC class I and II (Kreiter et al 2015). In the first two VB10.NEO-X constructs the selected hydrophobic and hydrophilic neoepitopes are evenly distributed. A neutral, flexible GGGGS linker between the 27mer neoepitopes is important to avoid generation of new immunogenic epitopes in the junctions of the combined neoepitopes.
  • Vaccibody vaccines containing either 3 or 10 neoepitopes were compared.
  • the place and order for the 3 first (N-terminal) peptides are similar as in the 3 neoepitope Vaccibody DNA construct. This is done to be able to compare the immunogenicity of these 3 neoepitopes in the context with 3 and in the context containing 7 more epitopes.
  • VB4001 (VB10.NEO CT26-X), VB4002 (VB10.NEO CT26-III), VB4003 (VB10.NEO B16-X) and
  • VB4004 (VB10.NEO B16-III) were selected as vaccine candidates.
  • a schematic drawing of the vaccibodies are shown in FIG. 1 .
  • VB4015 comprises three neoepitopes, B16 pepM1+pepM8+pepM3 that are separated by 5 amino acid linkers.
  • VB4018 comprises 2 copies of the 10 neoepitopes, B16 pepM1+pepM2+pepM3+pepM4+pepM11+pepM6+pepM7+pepM8+pepM9+pepM10 that are separated by 5 amino acid linkers.
  • the neoepitope sequences are shown in Tables 1 and 2.
  • neoepitope gene sequences were ordered from Genescript (New Jersey, US) and cloned into the expression vector pUMVC4a holding the LD78beta targeting unit and the hlgG3 dimerization unit.
  • FIG. 2 left panels: To illustrate the formation of intact homodimeric proteins, the proteins in the supernatant from transfected cells were detected in a Western blot by an anti-hMIP-1alpha antibody, in either the presence or absence of reducing agents. The formation of homodimers are shown in the left lane ( ⁇ reducing agent) whereas the monomers are illustrated in the right lane (+ reducing agent). FIG.
  • right panel shows the expression level of the Vaccibody proteins in the supernatant of HEK293 cells transfected with the different VB10.NEO constructs detected by a sandwich ELISA using antibodies against both hMIP-1alpha and hlgG3.
  • upper panel shows the expression level of the VB10.NEO CT26-X (VB4001) and VB10.NEO CT26-III (VB4002) constructs, comprising 10 or 3 neoepitopes, respectively.
  • right panel shows the expression level of the VB10.NEO B16-X (VB4003) and VB10.NEO B16-III (VB4004) constructs, comprising 10 or 3 neoepitopes, respectively.
  • vaccibodies comprising 3 or 10 neoepitopes
  • 20 ⁇ g plasmid DNA of each vaccibody candidate were injected intramuscularly in the tibial anterior muscle of C57Bl/6-mice (for B16 constructs) or BALB/c-mice (for CT26 constructs), followed by electroporation using TriGrid, Ichor, (US).
  • TriGrid, Ichor, (US) TriGrid, Ichor,
  • the T cell responses were evaluated by IFN-gamma ELISpot. The results are shown in FIG. 3 where the T cell responses are indicated as the number of IFN- ⁇ spots/10 6 splenocytes.
  • vaccibodies comprising 10 neoepitopes induces significant T cell responses towards 4-6 of 10 included neoepitopes in the same mice.
  • the peptides stimulating the strongest IFN- ⁇ response generally have the best MHC I binding score.
  • vaccibodies comprising 10 neoepitopes (VB10.NEO B16-X and VB10.NEO CT26-X) resulted in an increased total neoantigen-specific immune response when compared with vaccibodies comprising 3 neoepitopes (VB10.NEO B16-III and VB10.NEO CT26-III).
  • Example 3 Comparing Immunogenicity of Vaccibody DNA Vaccines and Corresponding Peptide Plus Adjuvant Vaccines
  • the 10 neopitopes in VB4014 is similar as for VB4003, however the order of the neoepitopes are changed and the most hydrophobic neoepitopes are located in the core in the neoepitope antigenic module.
  • C57/Bl6 mice were injected with 20 ⁇ g of the VB10.NEO B16-X constructs VB4003 and VB4014 (The induced immune responses were compared with immune responses of mice s.c.
  • Example 4 Comparing Vaccibodies Comprising Second Linkers with a Length of 5 or 10 Amino Acids
  • Each of the neoepitopes is separated by a second linker.
  • the second linker is a flexible GGGGS linker.
  • HEK293 cells were transfected with VB10.NEO B16-X constructs comprising second linkers with a length of either 5 or 10 amino acids.
  • FIG. 6 illustrates that changing the linker length from 5 (VB4003) to 10 (VB4011) amino acids does not affect expression of vaccibodies comprising 10 neoepitopes ( FIG. 6 , upper panel).
  • mice C57Bl/6 mice were injected with VB10.NEO B16-X constructs comprising 10 neoepitopes with either 5 (VB4003) or 10 (VB4011) amino acid linkers.
  • the mice were sacrificed and splenocytes harvested, stimulated with the individual corresponding neoepitope peptides for 24 hours and T cell responses were quantified in an IFN-gamma ELISpot assay.
  • the results are shown in FIG. 6 , lower panel, and demonstrate that vaccibody constructs comprising 10 amino acid linkers (VB4011) lead to an increased total immune response when compared to vaccibodies comprising 5 amino acid linkers (VB4003). Empty vector was included as a negative control.
  • Example 5 Comparing Vaccibodies Comprising Different Number of Copies of Identical Neoepitopes
  • VB10.NEO B16-X (VB4003) construct comprising 10 neoepitopes was compared to the expression level of VB10.NEO B16-XX (VB4018) comprising 2 ⁇ 10 neoepitopes.
  • the results demonstrate that VB10.NEO B16-XX (VB4018) comprising 20 neoepitopes are slightly less expressed compared to VB10.NEO B16-X (VB4003) comprising 10 neoepitopes ( FIG. 7 , upper panel).
  • Vaccibodies comprising either 10 or 20 neoepitopes was tested by intramuscular injection of C57Bl/6 mice with the Vaccibody DNA vaccine VB10.NEO B16-X (VB4003) and VB10.NEO B16-XX (VB4018) At day 13, the mice were sacrificed and splenocytes harvested, stimulated with the individual corresponding neoepitope peptides for 24 hours and T cell responses were quantified in an IFN-gamma ELISpot assay. The results shown in FIG.
  • lower panel illustrate that the benefit of including 2 copies per neoepitope (2 ⁇ 10 neoepitopes) is limited on the total immune response, however, a broader immune response is observed towards individual neoepitopes.
  • Vaccibody constructs comprising one or more copies of the 5 selected neoepitopes, PepM3, PepM4, PepM7, PepM9 and PepM10, were tested ( FIG. 8 , upper panel).
  • the immune responses of the Vaccibody candidates for each of the five selected neoepitopes are shown in FIG. 8 , lower panel. Multiple copies of the five neoepitopes had limited effect on the total immune response. However, several copies of each neoepitope (VB4018, VB4019 and VB4021) gives a more evenly immune response towards the 5 shared neoepitopes compared to the decatope VB4003, where the 5 neoepitopes are presented once. Interestingly, Vaccibodies comprising a 10 amino acid second linker and the neoepitopes only once (VB4011) displayed a better total immune response than Vaccibodies comprising multiple copies of the five neoepitopes.
  • vaccibody constructs comprising different numbers of neoepitopes were compared to test the immunological effect of adding further neoepitopes.
  • the neoepitope sequences are shown in Table 2.
  • FIG. 11 shows the total number of IFN ⁇ -spots per 10 6 splenocytes.
  • mice were injected with empty vector not comprising the neoepitopes. As seen from FIG. 11 , lower panel, injections with empty vector did not lead to any significant immune response against the individual neoepitopes.
  • the neoepitope sequences are shown in Table 1.
  • FIG. 12 shows the total number of IFN ⁇ -spots per 10 6 splenocytes.
  • mice were injected with empty vector not comprising the neoepitopes. As seen from FIG. 12 , lower panel, injections with empty vector did not lead to any significant immune response against the individual neoepitopes.
  • Example 7 Expression Levels of Different Vaccibody Constructs—are Compared
  • VB10.NEO were used as vaccine candidates for therapeutic vaccine studies.
  • FIG. 13 shows that VB10.NEO DNA vaccine candidates comprising 10 neoepitopes are able to significantly delay and reduce tumour growth.
  • a therapeutic DNA vaccine to be used may be prepared by GMP manufacturing of the plasmid vaccine according to regulatory authorities' guidelines, and Fill & Finish of the DNA vaccine.
  • the DNA vaccine may be formulated by dissolving in a saline solution, such as PBS at a concentration of 2-6 mg/ml.
  • the vaccine may be administered either intradermal or intramuscular with or without following electroporation or alternatively with a jet injector.
  • Neoepitope sequences can be added after the linker GGCCTCGGTGGCCTG.
  • GCACCACTT GCTGCTGACACGCCGACCGCCTGCTGCTTCAGCTACACCTCCCGACAGATTCCACAGAAT TTCATAGCTGACTACTTTG

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Medicinal Preparation (AREA)
US16/068,449 2016-01-08 2017-01-05 Therapeutic anticancer neoepitope vaccine Abandoned US20190022202A1 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
EP16150574.8 2016-01-08
EP16150574 2016-01-08
EP16178393.1 2016-07-07
EP16178393 2016-07-07
PCT/EP2017/050206 WO2017118695A1 (fr) 2016-01-08 2017-01-05 Vaccin thérapeutique anticancéreux à néoépitope

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/050206 A-371-Of-International WO2017118695A1 (fr) 2016-01-08 2017-01-05 Vaccin thérapeutique anticancéreux à néoépitope

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/557,988 Continuation US20220370579A1 (en) 2016-01-08 2021-12-21 Therapeutic anticancer neoepitope vaccine

Publications (1)

Publication Number Publication Date
US20190022202A1 true US20190022202A1 (en) 2019-01-24

Family

ID=57821954

Family Applications (2)

Application Number Title Priority Date Filing Date
US16/068,449 Abandoned US20190022202A1 (en) 2016-01-08 2017-01-05 Therapeutic anticancer neoepitope vaccine
US17/557,988 Pending US20220370579A1 (en) 2016-01-08 2021-12-21 Therapeutic anticancer neoepitope vaccine

Family Applications After (1)

Application Number Title Priority Date Filing Date
US17/557,988 Pending US20220370579A1 (en) 2016-01-08 2021-12-21 Therapeutic anticancer neoepitope vaccine

Country Status (10)

Country Link
US (2) US20190022202A1 (fr)
EP (1) EP3400004A1 (fr)
JP (2) JP2019505512A (fr)
KR (1) KR20180100659A (fr)
CN (1) CN108495649A (fr)
AU (1) AU2017205270B2 (fr)
BR (1) BR112018013881A8 (fr)
CA (1) CA3008437A1 (fr)
IL (1) IL260030A (fr)
WO (1) WO2017118695A1 (fr)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180030155A1 (en) * 2003-02-25 2018-02-01 Vaccibody As Modified Antibody
WO2020176797A1 (fr) * 2019-02-27 2020-09-03 Nektar Therapeutics Association d'immunothérapies pour le traitement du cancer
WO2021219897A1 (fr) 2020-05-01 2021-11-04 Vaccibody As Prophylaxie et traitement anti-bétacoronavirus
WO2022200590A1 (fr) 2021-03-26 2022-09-29 Nykode Therapeutics ASA Combinaison thérapeutique pour le traitement du cancer
WO2022233851A1 (fr) 2021-05-03 2022-11-10 Nykode Therapeutics ASA Constructions immunogènes et vaccins destinés à être utilisés dans le traitement prophylactique et thérapeutique de maladies infectieuses
WO2022238381A2 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Constructions d'immunothérapie pour le traitement d'une maladie
WO2022238402A1 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Constructions et composition induisant une tolérance, et leur utilisation pour le traitement de troubles immunitaires
WO2022238432A2 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Co-expression de constructions et de composés immunoinhibiteurs
WO2022238420A2 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Co-expression de constructions et de composés immunostimulants
WO2022238395A1 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Constructions induisant une tolérance et compositions et leur utilisation pour le traitement de troubles immunitaires
WO2022238363A1 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Constructions immunogènes et vaccins destinés à être utilisés dans le traitement prophylactique et thérapeutique de maladies infectieuses
WO2023079001A1 (fr) 2021-11-03 2023-05-11 Nykode Therapeutics ASA Constructions immunogènes et vaccins destinés à être utilisés dans le traitement prophylactique et thérapeutique de maladies provoquées par le sars-cov-2
WO2024092025A1 (fr) 2022-10-25 2024-05-02 Nykode Therapeutics ASA Constructions et leur utilisation
WO2024100196A1 (fr) 2022-11-09 2024-05-16 Nykode Therapeutics ASA Co-expression de constructions et de polypeptides

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW201930340A (zh) * 2017-12-18 2019-08-01 美商尼恩醫療公司 新抗原及其用途
US11564980B2 (en) 2018-04-23 2023-01-31 Nantcell, Inc. Tumor treatment method with an individualized peptide vaccine
TWI787500B (zh) 2018-04-23 2022-12-21 美商南特細胞公司 新抗原表位疫苗及免疫刺激組合物及方法
WO2020221783A1 (fr) * 2019-04-29 2020-11-05 Vaccibody As Procédés de présélection de néo-épitopes
CA3156704A1 (fr) * 2019-10-09 2021-04-15 Edward Fritsch Vaccin a proteines multi-domaines
CN115698051A (zh) * 2020-04-07 2023-02-03 伊沃逊生物科技股份公司 用apc靶向单元进行新表位免疫治疗
CN115397462A (zh) 2020-04-09 2022-11-25 耐考德治疗股份有限公司 个体化治疗性抗癌疫苗
US20220370581A1 (en) * 2021-05-18 2022-11-24 China Medical University Vaccine and method for treating cancer

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK1599504T3 (da) * 2003-02-25 2015-03-09 Vaccibody As Modificeret antistof
CN101198620A (zh) * 2005-06-17 2008-06-11 曼康公司 激发针对在癌细胞和肿瘤基质上表达的结构域和亚结构域表位的多价免疫应答的方法和组合物
WO2011161244A1 (fr) * 2010-06-25 2011-12-29 Vaccibody As Structures protéiniques homodimères
AU2012261237B2 (en) * 2011-05-24 2017-06-01 BioNTech SE Individualized vaccines for cancer
WO2012159643A1 (fr) * 2011-05-24 2012-11-29 Biontech Ag Vaccins individualisés pour le cancer
TW201302800A (zh) * 2011-06-10 2013-01-16 Oncotherapy Science Inc Ｓｅｍａ５ｂ胜肽及含其之疫苗

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180030155A1 (en) * 2003-02-25 2018-02-01 Vaccibody As Modified Antibody
WO2020176797A1 (fr) * 2019-02-27 2020-09-03 Nektar Therapeutics Association d'immunothérapies pour le traitement du cancer
WO2021219897A1 (fr) 2020-05-01 2021-11-04 Vaccibody As Prophylaxie et traitement anti-bétacoronavirus
WO2022200590A1 (fr) 2021-03-26 2022-09-29 Nykode Therapeutics ASA Combinaison thérapeutique pour le traitement du cancer
WO2022233851A1 (fr) 2021-05-03 2022-11-10 Nykode Therapeutics ASA Constructions immunogènes et vaccins destinés à être utilisés dans le traitement prophylactique et thérapeutique de maladies infectieuses
WO2022238381A2 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Constructions d'immunothérapie pour le traitement d'une maladie
WO2022238402A1 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Constructions et composition induisant une tolérance, et leur utilisation pour le traitement de troubles immunitaires
WO2022238432A2 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Co-expression de constructions et de composés immunoinhibiteurs
WO2022238420A2 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Co-expression de constructions et de composés immunostimulants
WO2022238395A1 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Constructions induisant une tolérance et compositions et leur utilisation pour le traitement de troubles immunitaires
WO2022238363A1 (fr) 2021-05-10 2022-11-17 Nykode Therapeutics ASA Constructions immunogènes et vaccins destinés à être utilisés dans le traitement prophylactique et thérapeutique de maladies infectieuses
WO2023079001A1 (fr) 2021-11-03 2023-05-11 Nykode Therapeutics ASA Constructions immunogènes et vaccins destinés à être utilisés dans le traitement prophylactique et thérapeutique de maladies provoquées par le sars-cov-2
WO2024092025A1 (fr) 2022-10-25 2024-05-02 Nykode Therapeutics ASA Constructions et leur utilisation
WO2024100196A1 (fr) 2022-11-09 2024-05-16 Nykode Therapeutics ASA Co-expression de constructions et de polypeptides

Also Published As

Publication number Publication date
BR112018013881A2 (pt) 2018-12-18
CN108495649A (zh) 2018-09-04
BR112018013881A8 (pt) 2023-05-09
JP2022017499A (ja) 2022-01-25
US20220370579A1 (en) 2022-11-24
RU2018129062A3 (fr) 2020-04-27
WO2017118695A1 (fr) 2017-07-13
IL260030A (en) 2018-07-31
AU2017205270A1 (en) 2018-06-28
KR20180100659A (ko) 2018-09-11
EP3400004A1 (fr) 2018-11-14
AU2017205270B2 (en) 2024-01-18
JP2019505512A (ja) 2019-02-28
CA3008437A1 (fr) 2017-07-13
RU2018129062A (ru) 2020-02-10

Similar Documents

Publication Publication Date Title
US20220370579A1 (en) Therapeutic anticancer neoepitope vaccine
US20220111023A1 (en) Neoepitope rna cancer vaccine
US20230293650A1 (en) Individualized therapeutic anticancer vaccine
CN109152830B (zh) 用于免疫疗法的核/壳结构平台
RU2753246C2 (ru) Составы вакцин против неоплазии и способы их получения
CN104736553A (zh) 细胞穿透肽
JP2021038225A (ja) ネコ用がんワクチン
WO2021214297A1 (fr) Immunisation contre des maladies associées au sars-cov
EP4132959A1 (fr) Immunothérapie par néo-épitope avec unité de ciblage apc
TW202126327A (zh) 新抗原組合物及其用途
RU2782422C2 (ru) Терапевтическая противораковая неоэпитопная вакцина
WO2022238381A2 (fr) Constructions d'immunothérapie pour le traitement d'une maladie
US20240173391A1 (en) Therapeutic combination for treating cancer
AU2022381515A1 (en) Immunogenic constructs and vaccines for use in the prophylactic and therapeutic treatment of diseases caused by sars-cov-2
WO2022174052A1 (fr) Antigènes consensus de la prostate, molécules d'acide nucléique codant pour ceux-ci, et vaccins et utilisations les comprenant
JP2023546485A (ja) Ｐｄ－ｌ１の細胞外ドメインを含むキメラ抗原

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

AS Assignment

Owner name: VACCIBODY AS, NORWAY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:GRANUM, STINE;STUBSRUD, ELISABETH;FREDRIKSEN, AGNETE BRUNSVIK;REEL/FRAME:048008/0953

Effective date: 20170116

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE AFTER FINAL ACTION FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: ADVISORY ACTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION