US20150064203A1 - Anticancer agent - Google Patents

Anticancer agent Download PDF

Info

Publication number
US20150064203A1
US20150064203A1 US14/383,118 US201314383118A US2015064203A1 US 20150064203 A1 US20150064203 A1 US 20150064203A1 US 201314383118 A US201314383118 A US 201314383118A US 2015064203 A1 US2015064203 A1 US 2015064203A1
Authority
US
United States
Prior art keywords
amino acid
acid sequence
human antibody
light chain
type light
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/383,118
Other languages
English (en)
Inventor
Taizo Uda
Emi Hifumi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Japan Science and Technology Agency
Original Assignee
Japan Science and Technology Agency
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Japan Science and Technology Agency filed Critical Japan Science and Technology Agency
Assigned to JAPAN SCIENCE AND TECHNOLOGY AGENCY reassignment JAPAN SCIENCE AND TECHNOLOGY AGENCY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: HIFUMI, EMI, UDA, TAIZO
Publication of US20150064203A1 publication Critical patent/US20150064203A1/en
Priority to US15/166,647 priority Critical patent/US10040863B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3023—Lung
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/515—Complete light chain, i.e. VL + CL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation

Definitions

  • the present invention relates to an anticancer agent containing a human antibody ⁇ -type light chain that demonstrates cytotoxicity against cancer cells and particularly lung cancer cells.
  • Antibodies are composed of heavy chains (H chains) and light chains (L chains).
  • the heavy chains and light chains are composed of a variable region (VR) and a constant region (CR), and the variable region has a complementarity determining region (CDR).
  • antibody light chains are classified into ⁇ chains and ⁇ chains.
  • antibody enzymes have both the ability of antibodies to accurately recognize molecules and the activity of enzymes, they are expected to be applied in numerous fields, including medicine, the chemical industry and the food industry. In particular, since antibody enzymes exhibit high specificity for a target molecule and are able to impair target molecules due to their enzyme activity, they are expected to serve as superior anticancer agents that demonstrate few adverse side effects.
  • Antibody enzymes having complete human sequences have conventionally been unable to be obtained with the exception of the Bence-Jones Protein (BJP) obtained from multiple myeloma patients. Since there are few multiple myeloma patients and only a small amount of BJP that has enzyme activity, it was difficult to acquire a human antibody enzyme. However, since human antibody enzymes are predicted to demonstrate few adverse side effects when administered to a human body, pharmaceutical companies both at home and overseas are awaiting the development of a useful human antibody enzyme.
  • BJP Bence-Jones Protein
  • Patent Document 1 Japanese Unexamined Patent Application, First Publication No. 2006-197930
  • An object of the present invention is to provide an anticancer agent that has for an active ingredient thereof a human antibody light chain that demonstrates cytotoxicity against cancer cells and particularly against lung cancer cells.
  • the inventors of the present invention acquired a novel human antibody light chain from peripheral blood obtained from volunteers hyperimmunized over a plurality of times using a rabies vaccine virus, and as a result of studying those volunteers, surprisingly found that several of the resulting human antibody ⁇ -type light chains demonstrated a high degree of cytotoxicity against cancer cells and particularly lung cancer cells, thereby leading to completion of the present invention.
  • the anticancer agent according to the present invention is characterized in that it contains:
  • variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 1, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence;
  • variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 7, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence;
  • variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 9, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence;
  • variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 13, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence;
  • variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 19, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence;
  • variable region is composed of a polypeptide represented by an amino acid sequence consisting of the 1st to 113th amino acids of SEQ ID NO: 38, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence;
  • variable region is composed of a polypeptide represented by an amino acid sequence consisting of the 1st to 112th amino acids of SEQ ID NO: 40, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence; or
  • variable region is composed of a polypeptide represented by an amino acid sequence consisting of the 1st to 107th amino acids of SEQ ID NO: 41, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • an anticancer agent can be provided that is highly cytotoxic against cancer cells and particularly lung cancer cells. Since the anticancer agent of the present invention has an antibody enzyme for the active ingredient thereof, it is highly specific for cancer cells. Moreover, since the amino acid sequence of the antibody enzyme is completely human, it is free of problems such as allergies with respect to humans. Consequently, the anticancer agent of the present invention is extremely useful as a highly active, innovative and novel pharmaceutical and as a test piece for the development thereof.
  • FIG. 1 is a diagram indicating amino acid sequences of wild type human antibody ⁇ -type light chains.
  • FIG. 2( a ) schematically indicates a cDNA design for obtaining a monomer human antibody light chain
  • FIG. 2 ( b ) schematically indicates the compositions of a human antibody light chain prior to introduction of a mutation and a human antibody light chain following introduction of a mutation.
  • FIG. 3 is a diagram indicating the results of purifying a polypeptide of a clone #1, with FIG. 3( a ) indicating the results of newly carrying out primary purification of the polypeptide of clone #1, and FIG. 3( b ) indicating the results of newly carrying out secondary purification of the polypeptide of clone #1.
  • FIG. 4 is a graph indicating the results of investigating the cytotoxicity of various clones against cancer cells.
  • FIG. 5 is a graph indicating the results of investigating the cytotoxicity of various clones against cancer cells.
  • FIG. 6A is a diagram indicating the amino acid sequences of wild type human antibody ⁇ -type light chains.
  • FIG. 6B is a diagram indicating the amino acid sequences of wild type human antibody ⁇ -type light chains.
  • FIG. 6C is a diagram indicating the amino acid sequences of wild type human antibody ⁇ -type light chains continuing from FIG. 6B .
  • FIG. 6D is a diagram indicating the amino acid sequences of wild type human antibody ⁇ -type light chains.
  • FIG. 6E is a diagram indicating the amino acid sequences of wild type human antibody ⁇ -type light chains continuing from FIG. 6D .
  • FIG. 6F is a diagram indicating the amino acid sequences of wild type human antibody ⁇ -type light chains continuing from FIG. 6E .
  • FIG. 6G is a diagram indicating the amino acid sequences of wild type human antibody ⁇ -type light chains.
  • FIG. 6H is a diagram indicating the amino acid sequences of wild type human antibody ⁇ -type light chains continuing from FIG. 6G .
  • FIG. 6I is a diagram indicating the amino acid sequence of a wild type human antibody ⁇ -type light chain.
  • FIG. 7 is a diagram indicating the results of an in vivo assay.
  • FIG. 8 is a diagram indicating the results of safety studies (toxicity studies).
  • the present invention provides an anticancer agent containing a human antibody ⁇ -type light chain that demonstrates cytotoxicity against cancer cells.
  • a “human antibody ⁇ -type light chain” refers to a ⁇ -type light chain of human-derived immunoglobulin.
  • an “anticancer agent” refers to a pharmaceutical agent having an activity that eradicates cancer cells or suppresses or inhibits the proliferation thereof.
  • cytotoxicity refers to a property that induces cell death or causes functional impairment in cells.
  • the active ingredient of the anticancer agent according to the present invention in the form of a human antibody ⁇ -type light chain is any of those described in (1) to (8) below.
  • variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 7, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 9, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 13, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • variable region is composed of a polypeptide represented by an amino acid sequence consisting of the 1st to 113th amino acids of SEQ ID NO: 38, an amino acid sequence in which one or a plurality of the amino acids in that amino acid sequence have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • the human antibody ⁇ -type light chain in the form of a dimer in which the variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 1 may also be referred to as human antibody ⁇ -type light chain (#1).
  • the human antibody ⁇ -type light chain (#1) can have a known human antibody constant region added to the aforementioned variable region, and in one embodiment, the entire length of the amino acid sequence is as shown in SEQ ID NO: 2.
  • CDR1 in the human antibody ⁇ -type light chain (#1) consists of the 24th to 39th amino acids in the amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2
  • CDR2 consists of the 55th to 61st amino acids in the amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2
  • CDR3 consists of the 94th to 102nd amino acids in the amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2.
  • a cysteine residue for forming a disulfide bond is present in a wild type antibody ⁇ -type light chain that results in the formation of a dimer.
  • the human antibody ⁇ -type light chain (#1) also has a cysteine residue for forming a disulfide bond with another light chain in the same manner as the wild type.
  • the cysteine residue is the cysteine residue at position 220 in the amino acid sequence of SEQ ID NO: 2.
  • the human antibody ⁇ -type light chain (#1) demonstrates cytotoxicity against cancer cells and particularly lung cancer cells. Consequently, it is preferable for use as an active ingredient of an anticancer agent. Since the ability to accurately recognize a target molecule is important for the human antibody ⁇ -type light chain (#1) to demonstrate anticancer activity, the active center of the anticancer activity of the human antibody ⁇ -type light chain (#1) is in the variable region.
  • mutants are also commonly known to exist in naturally-occurring proteins that do not cause a significant change in the structure or function of that protein.
  • substitution, addition or deletion of one or a plurality of amino acids in a specific amino acid sequence X is referred to as mutation.
  • the human antibody ⁇ -type light chain according to the present invention may form a dimer in which the variable region is composed of a polypeptide represented by an amino acid sequence in which one or a plurality of amino acids in the amino acid sequence of SEQ ID NO: 1 have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • This polypeptide may also be referred to as a mutant of the human antibody ⁇ -type light chain (#1).
  • a mutant of the human antibody ⁇ -type light chain (#1) may also be composed of a polypeptide represented by an amino acid sequence in which one or a plurality of amino acids other than the cysteine at position 220 in the amino acid sequence of SEQ ID NO: 2 have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • a mutant of the human antibody ⁇ -type light chain (#1) used as the human antibody ⁇ -type light chain according to the present invention is a dimer having an anticancer action in the same manner as the human antibody ⁇ -type light chain (#1). Consequently, CDR1, CDR2 and CDR3 of a mutant of the human antibody ⁇ -type light chain (#1) are identical to the amino acid sequence of SEQ ID NO:1 or SEQ ID NO: 2 (are preserved therein), and the cysteine corresponding to cysteine at position 220 in the amino acid sequence of SEQ ID NO: 2 is also preserved.
  • a mutant of the human antibody ⁇ -type light chain (#1) is preferably such that amino acids in regions other than CDR1, CDR2 and CDR3 are mutated and amino acids in other regions of the variable region are mutated.
  • a human antibody ⁇ -type light chain in the form of a dimer in which the variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 9 may also be referred to as human antibody ⁇ -type light chain (#4).
  • the human antibody ⁇ -type light chain (#4) can have a known human antibody constant region added to the aforementioned variable region, and in one embodiment, the entire length of the amino acid sequence is as shown in SEQ ID NO: 10.
  • CDR1 in the human antibody ⁇ -type light chain (#4) consists of the 24th to 40th amino acids in the amino acid sequences of SEQ ID NO: 9 and SEQ ID NO: 10
  • CDR2 consists of the 56th to 62nd amino acids in the amino acid sequences of SEQ ID NO: 9 and SEQ ID NO: 10
  • CDR3 consists of the 95th to 102nd amino acids in the amino acid sequences of SEQ ID NO: 9 and SEQ ID NO: 10.
  • a cysteine residue for forming a disulfide bond with another light chain is the cysteine residue at position 220 in the amino acid sequence of SEQ ID NO: 10.
  • the human antibody ⁇ -type light chain (#4) demonstrates cytotoxicity against cancer cells and particularly lung cancer cells. Consequently, it is preferable for use as an active ingredient of an anticancer agent.
  • the human antibody ⁇ -type light chain according to the present invention may forma dimer in which the variable region is composed of a polypeptide represented by an amino acid sequence in which one or a plurality of amino acids in the amino acid sequence of SEQ ID NO: 9 have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • This polypeptide may also be referred to as a mutant of the human antibody ⁇ -type light chain (#4).
  • a mutant of the human antibody ⁇ -type light chain (#4) may also be composed of a polypeptide represented by an amino acid sequence in which one or a plurality of amino acids other than the cysteine at position 220 in the amino acid sequence of SEQ ID NO: 10 have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • a mutant of the human antibody ⁇ -type light chain (#4) used as the human antibody ⁇ -type light chain according to the present invention is a dimer having an anticancer action in the same manner as the human antibody ⁇ -type light chain (#4). Consequently, CDR1, CDR2 and CDR3 of a mutant of the human antibody ⁇ -type light chain (#4) are identical to the amino acid sequence of SEQ ID NO:9 or SEQ ID NO: 10 (are preserved therein), and the cysteine corresponding to cysteine at position 220 in the amino acid sequence of SEQ ID NO: 10 is also preserved.
  • a mutant of the human antibody ⁇ -type light chain (#4) is preferably such that amino acids in regions other than CDR1, CDR2 and CDR3 are mutated and amino acids in other regions of the variable region are mutated.
  • a human antibody ⁇ -type light chain in the form of a dimer in which the variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 13 may also be referred to as human antibody ⁇ -type light chain (#7).
  • the human antibody ⁇ -type light chain (#7) can have a known human antibody constant region added to the aforementioned variable region, and in one embodiment, the entire length of the amino acid sequence is as shown in SEQ ID NO: 14.
  • CDR1 in the human antibody ⁇ -type light chain (#7) consists of the 24th to 39th amino acids in the amino acid sequences of SEQ ID NO: 13 and SEQ ID NO: 14, CDR2 consists of the 55th to 61st amino acids in the amino acid sequences of SEQ ID NO: 13 and SEQ ID NO: 14, and CDR3 consists of the 94th to 101st amino acids in the amino acid sequences of SEQ ID NO: 13 and SEQ ID NO: 14.
  • a cysteine residue for forming a disulfide bond with another light chain is the cysteine residue at position 219 in the amino acid sequence of SEQ ID NO: 14.
  • the human antibody ⁇ -type light chain (#7) demonstrates cytotoxicity against cancer cells and particularly lung cancer cells. Consequently, it is preferable for use as an active ingredient of an anticancer agent.
  • the human antibody ⁇ -type light chain according to the present invention may form a dimer in which the variable region is composed of a polypeptide represented by an amino acid sequence in which one or a plurality of amino acids in the amino acid sequence of SEQ ID NO: 13 have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • This polypeptide may also be referred to as a mutant of the human antibody ⁇ -type light chain (#7).
  • a mutant of the human antibody ⁇ -type light chain (#7) may also be composed of a polypeptide represented by an amino acid sequence in which one or a plurality of amino acids other than the cysteine at position 219 in the amino acid sequence of SEQ ID NO: 14 have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • a mutant of the human antibody ⁇ -type light chain (#7) used as the human antibody ⁇ -type light chain according to the present invention is a dimer having an anticancer action in the same manner as the human antibody ⁇ -type light chain (#7). Consequently, CDR1, CDR2 and CDR3 of a mutant of the human antibody ⁇ -type light chain (#7) are identical to the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 14 (are preserved therein), and the cysteine corresponding to cysteine at position 219 in the amino acid sequence of SEQ ID NO: 14 is also preserved.
  • a mutant of the human antibody ⁇ -type light chain (#7) is preferably such that amino acids in regions other than CDR1, CDR2 and CDR3 are mutated and amino acids in other regions of the variable region are mutated.
  • a human antibody ⁇ -type light chain in the form of a monomer in which the variable region is composed of a polypeptide represented by the amino acid sequence of SEQ ID NO: 19 may also be referred to as human antibody ⁇ -type light chain (22F6_monomer).
  • the human antibody ⁇ -type light chain (22F6_monomer) can have a known human antibody constant region added to the aforementioned variable region, and in one embodiment, the entire length of the amino acid sequence is represented by an amino acid sequence in which the 219th cysteine in the amino acid sequence of SEQ ID NO: 20 has been deleted or substituted with another amino acid (such as alanine).
  • CDR1 in the human antibody ⁇ -type light chain (22F6_monomer) consists of the 24th to 39th amino acids in the amino acid sequences of SEQ ID NO: 19 and SEQ ID NO: 20
  • CDR2 consists of the 55th to 61st amino acids in the amino acid sequences of SEQ ID NO: 19 and SEQ ID NO: 20
  • CDR3 consists of the 94th to 101st amino acids in the amino acid sequences of SEQ ID NO: 19 and SEQ ID NO: 20.
  • the human antibody ⁇ -type light chain (22F6_monomer) demonstrates cytotoxicity against cancer cells and particularly lung cancer cells. Consequently, it is preferable for use as an active ingredient of an anticancer agent.
  • the human antibody ⁇ -type light chain according to the present invention may be a monomer in which the variable region is composed of a polypeptide represented by an amino acid sequence in which one or a plurality of amino acids in the amino acid sequence of SEQ ID NO: 20 have been substituted, added or deleted, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • This polypeptide may also be referred to as a mutant of the human antibody ⁇ -type light chain (22F6_monomer).
  • a mutant of the human antibody ⁇ -type light chain may also be composed of a polypeptide represented by an amino acid sequence in which the 219th cysteine has been deleted or substituted with another amino acid and one or a plurality of amino acids other than the amino acid at position 219 have been substituted, added or deleted in the amino acid sequence of SEQ ID NO: 20, or an amino acid sequence having homology of 95% or more with that amino acid sequence.
  • a mutant of the human antibody ⁇ -type light chain (22F6_monomer) used as the human antibody ⁇ -type light chain according to the present invention is a monomer having an anticancer action in the same manner as the human antibody ⁇ -type light chain (22F6_monomer). Consequently, CDR1, CDR2 and CDR3 of a mutant of the human antibody ⁇ -type light chain (22F6_monomer) are identical to the amino acid sequence of SEQ ID NO: 19 or SEQ ID NO: 20 (are preserved therein), and the cysteine corresponding to cysteine at position 219 in the amino acid sequence of SEQ ID NO: 20 is deleted or substituted with another amino acid.
  • a mutant of the human antibody ⁇ -type light chain is preferably such that amino acids in regions other than CDR1, CDR2 and CDR3 are mutated and amino acids in other regions of the variable region are mutated.
  • the human antibody ⁇ -type light chain according to the present invention may also contain an additional polypeptide.
  • additional polypeptides include epitope-tagged polypeptides such as those tagged with His tag, Myc or Flag.
  • a person with ordinary skill in the art is able to easily mutate one or a plurality of amino acids among amino acid residues that compose a polypeptide or add an epitope-tagged polypeptide using a known technology.
  • an arbitrary base of a polynucleotide that encodes a polypeptide can be mutated in accordance with a known point mutagenesis method.
  • a primer corresponding to an arbitrary site of a polynucleotide that encodes a polypeptide can be designed to create a deletion mutant or an addition mutant.
  • the human antibody ⁇ -type light chain according to the present invention includes a naturally-occurring purification product, a product obtained by a chemical synthesis procedure, and a product produced by recombination technology from a prokaryotic host or eukaryotic host (including bacterial cells, yeast cells, higher plant cells, insect cells and mammalian cells).
  • the human antibody ⁇ -type light chain may or may not be glycosylated depending on the host used in the recombinant production procedure.
  • the human antibody ⁇ -type light chain according to the present invention can contain a modified initiating methionine group in several cases as a result of a host intervention process.
  • the human antibody ⁇ -type light chain according to the present invention may be a polypeptide in which amino acids are linked by peptide bonds, it is not limited thereto, and the polypeptide may also be a composite polypeptide containing a structure other than that of a polypeptide.
  • a structure other than that of a polypeptide include sugar chains and isoprenoid groups, there are no particular limitations thereon.
  • the human antibody ⁇ -type light chain according to the present invention can be produced using an expression system known in the art, such as a recombination expression system or a cell-free expression system, by using a vector containing a polynucleotide encoding the human antibody ⁇ -type light chain (polypeptide).
  • a method can be employed having the steps of, for example, incorporating a polynucleotide encoding the human antibody ⁇ -type light chain according to the present invention into a recombination expression vector followed by introducing into a host enabling expression thereof according to a known method, translating within the host (transformant) and purifying the resulting polypeptide.
  • the recombination expression vector may or may not be a plasmid, and is only required to enable the target polynucleotide to be introduced into the host.
  • a promoter that functions in the host so as to express exogenous polynucleotides is preferably incorporated into the expression vector.
  • a polynucleotide encoding the human antibody ⁇ -type light chain according to the present invention is preferably added to a solution containing components such as ribosomes or t-RNA required for protein translation and synthesis followed by incubating at a suitable temperature and purifying the synthesized polypeptide.
  • Examples of cell-free protein synthesis systems include systems using wheat germ extract, systems using rabbit reticulocyte extract, systems using E. coli S30 extract and systems using cell component extracts obtained from plant devacuolated protoplasts.
  • eukaryotic cell systems namely, systems using wheat germ extract or systems using rabbit reticulocyte extract
  • the aforementioned synthesis system is selected in consideration of such factors as the origin of the gene to be translated (prokaryotic or eukaryotic) or the purpose for which the protein is to be used following synthesis.
  • Various commercially available kits can be used for these synthesis systems.
  • cytomembrane components such as microsomal membrane
  • Cell component extracts obtained from plant devacuolated protoplasts are preferable since they can be used as a cell-free protein synthesis liquid that retains cytomembrane components, thereby eliminating the need to add microsomal membrane.
  • cytomembrane components are intended to refer to cell organelles composed of lipid membrane present in the cytomembrane (namely, all types of intracellular granules such as endoplasmic reticulum, Golgi bodies, mitochondria, chloroplast and vacuoles).
  • endoplasmic reticulum and Golgi bodies fulfill an important role in post-translation modification of proteins, they are essential cell components for maturation of membrane proteins and secretory proteins.
  • Human antibody ⁇ -type light chain synthesized with a host expression system or a cell-free protein synthesis system is preferably purified.
  • a step for purifying human antibody ⁇ -type light chain is preferably a step in which a cell extract is prepared from cells or tissue using a known method (such as a method in which the cells or tissue is homogenized, followed by centrifuging and recovering the soluble fraction), followed by purifying the human antibody ⁇ -type light chain from this cell extract using a known method (such as ammonium sulfate precipitation or ethanol precipitation, acid extraction, anionic or cationic chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography or lectin chromatography), it is not limited thereto.
  • High-performance liquid chromatography (HPLC) is most preferably used for purification.
  • the human antibody ⁇ -type light chain according to the present invention can also be purified from cells or tissues that express the human antibody ⁇ -type light chain in nature.
  • cells or tissues that express the human antibody ⁇ -type light chain according to the present invention in nature can be identified using an antibody or an oligonucleotide.
  • Purification of a human antibody ⁇ -type light chain from cells or tissue can also be carried out in the same manner as in the case of purifying a human antibody ⁇ -type light chain synthesized using a host expression system and the like.
  • human antibody ⁇ -type light chain according to the present invention can also be chemically synthesized.
  • chemical synthesis method There are no particular limitations on the chemical synthesis method, and may be carried out by any method used when chemically synthesizing polypeptides.
  • the anticancer agent according to the present invention has the human antibody ⁇ -type light chain according to the present invention as an active ingredient thereof.
  • the mechanism of action by which the human antibody ⁇ -type light chain according to the present invention demonstrates cytotoxicity against cancer cells has not been completely determined, it is presumed that, as a result of the human antibody ⁇ -type light chain according to the present invention specifically recognizing and binding to a specific molecule or structure on the surface of cancer cells simultaneous to decomposing a portion of the components of cancer cells by utilizing its own enzyme activity, the function of the cancer cells is impaired, proliferation thereof is inhibited or cell death is induced.
  • the anticancer agent according to the present invention can be injected or administered directly for use in humans or animals.
  • the anticancer agent according to the present invention can also be formulated for parenteral administration, mucosal administration, intramuscular administration, intravenous administration, subcutaneous administration, intraocular administration or transcutaneous administration.
  • protein contained in a composition can be administered at a dose of 0.01 mg/kg to 30 mg/kg of body weight, preferably at 0.1 mg/kg to 10 mg/kg of body weight, and even more preferably at 0.1 mg/kg to 1 mg/kg of body weight.
  • the anticancer agent according to the present invention can also contain a pharmaceutically acceptable carrier, diluent or vehicle (including combinations thereof) in addition to the human antibody ⁇ -type light chain according to the present invention.
  • Pharmaceutically acceptable carriers or vehicles for therapeutic use are commonly known in the field of pharmacy, and are described in, for example, Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro, ed., 1985).
  • Pharmaceutically usable carriers, vehicles or diluents can be suitably selected by a person with ordinary skill in the art in accordance with the intended administration route and standard pharmaceutical practices.
  • the anticancer agent according to the present invention can further contain an arbitrary suitable binder, lubricant, suspension agent, coating agent or solubilizing agent.
  • the anticancer agent according to the present invention can be formulated so as to be delivered using a minipump, by a mucosal route in the form of, for example, a nasal spray or aerosol for inhalation, or for parenteral delivery (here, the anticancer agent according to the present invention is formulated in an injectable form for delivery via, for example, an intravenous route, an intramuscular route or a subcutaneous route).
  • the formula can be designed so as to be delivered by both routes.
  • the anticancer agent according to the present invention demonstrates a high level of cytotoxicity against lung cancer cells in particular. Consequently, the anticancer agent according to the present invention is preferably in the form of a nasal spray or aerosol for inhalation that enables it to be efficiently delivered to pneumocytes from the nose or bronchi.
  • the anticancer agent according to the present invention in an application in which it is administered into the body, various technologies can be used for improving the stability (half-life in blood) of the active ingredient in the form of the human antibody ⁇ -type light chain in the body.
  • the half-life in the blood of antibodies such as IgG is known to be prolonged if neonatal Fc receptor (FcRn) is bound to the Fc region (see, for example, Roopenian, D. C., et al., Nat. Rev. Immunol., Vol. 7, 715-725 (2007)), and the C-terminal of the human antibody ⁇ -type light chain according to the present invention can be modified so as to have binding activity with FcRn.
  • the human antibody ⁇ -type light chain according to the present invention can be in the form of a dimer, and polyethylene glycol (PEG) can be added as well.
  • the anticancer agent according to the present invention can be incorporated in a kit, for example, together with instructions and the like on the form in which it is to be administered.
  • the kit can also contain various other pharmaceuticals that can be used with the anticancer agent according to the present invention.
  • the anticancer agent according to the present invention since the anticancer agent according to the present invention has for the active ingredient thereof an antibody ⁇ -type light chain that is highly effective in recognizing a target molecule, it does not demonstrate cytotoxicity against cancer cells in which the target molecule of the antibody light chain is not present on the cell surface thereof. Consequently, the anticancer agent of the present invention is expected to be useful in distinguishing types of cancer.
  • Lymphocytes were isolated using Ficoll-paque from peripheral blood acquired from volunteers hyperimmunized over a plurality of times using rabies virus vaccine. Total RNA was obtained from roughly 3.0 ⁇ 10 7 isolated lymphocytes using an RNA extraction kit (Stratagene Corp.). The target cDNA (cDNA library) was then prepared by reverse transcribing the total RNA with the ThermoScript RT-PCT System (Invitrogen Inc.) using oligo (dT) as primer.
  • ThermoScript RT-PCT System Invitrogen Inc.
  • PCR reactions were carried out in two stages using the cDNA acquired in step 1 above as template and using primers for amplifying antibody light chain gene having a V ⁇ gene belonging to subgroup II to obtain roughly 750 bp PCR products ( ⁇ -type light chain genes belonging to subgroup II). These PCR products were cloned and subjected to sequence analysis, and the V ⁇ gene in each germline gene was estimated by a homology search. As a result, all of the resulting 18 clones belonged to subgroup II.
  • clone #1 (germline genotype: A18b), clone #2 (germline genotype: A3/A19), clone #4 (germline genotype: 011/o1), clone #7 (germline genotype: A3/A19), clone #8 (germline genotype: A18b), clone #9 (germline genotype: A18b), clone #11 (germline genotype: A18b), clone #13 (germline genotype: A3/A19) and clone #14 (germline genotype: A3/A19) were used in subsequent experimentation.
  • Each of the clones acquired in step 2 above was respectively introduced into a plasmid vector having an His tag sequence site followed by introducing the plasmid vector into Escherichia coli to produce transformants.
  • the protein expressed in the E. coli was able to be identified as a human antibody light chain by SDS-PAGE analysis and Western blotting using anti-human (Fab′) 2 antibody.
  • the resulting human antibody light chains had M (initiating methionine) on the N-terminal and LEHHHHHH (SEQ ID NO: 23) derived from the plasmid vector on the C-terminal.
  • RNA extraction kit (Stratagene Corp.).
  • cDNA to be used as template was prepared in a PCR reaction to be subsequently described by reverse transcribing the total RNA with the ThermoScript RT-PCR System (Invitrogen Inc.) using oligo(dT) as primer.
  • a PCR reaction was carried out using a primer set for comprehensively amplifying human antibody light chain gene and using the cDNA acquired in step 4 above as template to obtain a roughly 660 bp PCR product.
  • This PCR product was purified and inserted into the E. coli expression vector pET101/D-TOPO® (Invitrogen Inc.) to construct an LCA library.
  • protein in which an His tag was added to the C-terminal of the protein encoded by the PCR product was expressed from an expression vector in which the PCR product was inserted in the pET101/D-TOPO vector.
  • PCR reactions were carried out using the cDNA of this LCA library as template and using primers for amplifying human antibody light chain gene having a V ⁇ gene belonging to subgroup II to obtain roughly 660 bp PCR products.
  • These PCR products were cloned and subjected to sequence analysis and their amino acid sequences and light chain variable and constant regions were estimated using analytical software (Genetix® Ver. 8) followed by estimation of the V ⁇ gene in each germline gene.
  • two clones namely, clone 22F6 (germline genotype: A3/A19) and clone 23D4 (germline genotype: A3/A19) were used in subsequent experimentation.
  • the resulting human antibody light chains had M (initiating methionine) on the N-terminal and LEHHHHHH (SEQ ID NO: 23) derived from the plasmid vector on the C-terminal.
  • the total length of the human antibody light chain pertaining to clone #1 was the base sequence indicated in SEQ ID NO: 27
  • the total length of the human antibody light chain pertaining to clone #8 was the base sequence indicated in SEQ ID NO: 28
  • the total length of the human antibody light chain pertaining to clone #9 was the base sequence indicated in SEQ ID NO: 29
  • the total length of the human antibody light chain pertaining to clone #11 human antibody light chain (#11_WT)
  • the total length of the human antibody light chain pertaining to clone #4 was the base sequence indicated in SEQ ID NO: 31
  • the total length of the human antibody light chain pertaining to clone #2 human antibody light chain (#2_WT)
  • the amino acid sequences estimated from each of the base sequences are shown in FIG. 1 .
  • the human antibody light chain pertaining to clone #1 (human antibody light chain (#1_WT)) was the amino acid sequence shown in SEQ ID NO: 2
  • the human antibody light chain pertaining to clone #8 (human antibody light chain (#8_WT)) was the amino acid sequence shown in SEQ ID NO: 4
  • the human antibody light chain pertaining to clone #9 human antibody light chain (#9_WT)
  • the human antibody light chain pertaining to clone #11 (human antibody light chain (#11_WT)) was the amino acid sequence shown in SEQ ID NO: 8
  • the human antibody light chain pertaining to clone #4 (human antibody light chain (#4_WT)) was the amino acid sequence shown in SEQ ID NO: 10
  • the human antibody light chain pertaining to clone #1 was the amino acid sequence shown in SEQ ID NO
  • wild type human antibody light chains used in the present example were polypeptides in which methionine was added to the N-terminal of each amino acid sequence shown in FIG. 1 and LEHHHHHH (SEQ ID NO: 23) derived from the plasmid vector was added to the C-terminal.
  • cDNA was designed so as to form only monomer human antibody enzymes by introducing a mutation in which the cysteine involved in S—S bond formation (cysteine on the C-terminal of the amino acid sequences of FIG. 1 ) is substituted with alanine.
  • the details of this design with respect to the human antibody light chain having LEHHHHHH derived from the plasmid vector on the C-terminal thereof (#1_WT) are shown in FIG. 2 . As shown in FIG.
  • TGT encoding cysteine at position 220 in the full-length human antibody enzyme gene is substituted with GCT.
  • FIG. 2( b ) although a dimer is formed in the original amino acid sequence due to the presence of cysteine at position 220, S—S bonds are not formed in the substituted amino acid sequence as a result of substituting alanine at position 220, thereby resulting in a monomer.
  • TGT encoding the aforementioned cysteine in the wild-type full-length human antibody enzyme gene was substituted with GCTCTCGAGCACCACCACCACCACCACCACTGA (SEQ ID NO: 26) that encodes ALEHHHHHH (SEQ ID NO: 25) (having a stop codon).
  • the monomer human antibody light chain used in the present example was a polypeptide in which methionine was added to the N-terminal of each amino acid sequence shown in FIG. 1 and ALEHHHHHH was added to the C-terminal instead of cysteine.
  • the mutant of human antibody light chain (#1_WT) is referred to as the human antibody light chain (#1_C220A)
  • the mutant of human antibody light chain (#8_WT) is referred to as the human antibody light chain (#8_C220A)
  • the mutant of human antibody light chain (#9_WT) is referred to as the human antibody light chain (#9_C220A)
  • the mutant of human antibody light chain (#11_WT) is referred to as the human antibody light chain (#11_C220A)
  • the mutant of human antibody light chain (#4_WT) is referred to as the human antibody light chain (#4_C220A)
  • the mutant of human antibody light chain (#2_WT) is referred to as the human antibody light chain (#2_C220A)
  • the mutant of human antibody light chain (#7_WT) is referred to as the human antibody light chain
  • FIG. 3( a ) is a diagram indicating the results of Ni-NTA column chromatography and SDS-PAGE analysis during primary purification of human antibody light chain (#1_WT) and human antibody light chain (#1_C220A).
  • FIG. 3( b ) is a diagram indicating the results of cation exchange chromatography and SDS-PAGE analysis during secondary purification.
  • buffer A 25 mM Tris-HCl (pH 8.0), 0.25 M NaCl, 40 mM imidazole and 0.005% Tween 20
  • concentration of imidazole was increased gradually from 40 mM to 300 mM to elute a component bound to the gel.
  • An Ni-NTA agarose column (diameter: 1 cm, 2 ml) was used for the column and the flow rate was maintained at 0.1 mL/min throughout purification.
  • a target band of roughly 31 kDa was detected in fractions 30 to 37.
  • buffer A 50 mM sodium acetate (pH 5.4), 0.2 M NaCl and 0.005% Tween 20
  • concentration of NaCl was increased gradually from 0.2 M to 0.4 M to elute a component bound to the gel.
  • the SP5PW column (Tosho Corp.) was used for the column and the flow rate was maintained at 0.1 ml/min throughout purification.
  • the other clones also contained dimers and monomers in the expression products of the wild-type human antibody light chains in the same manner as clone (#1), dimers were purified by two-stage purification utilizing Ni-NTA column chromatography and cation exchange chromatography, monomers were contained in the expression products of mutants in which cysteine involved in S—S bonding had been mutated to alanine, and the monomers were purified by the same two-stage purification.
  • FIG. 4 Cell viability at 24 hours and 48 hours after adding human antibody ⁇ -type light chain is shown in FIG. 4 , FIG. 5 , Table 1 and Table 2 for each of the human antibody ⁇ -type light chains.
  • the results for the clones having a germline genotype of A18b or 011/o1 are shown in FIG. 4 and Table 1, and the results for the clones having a germline genotype of A3/A19 are shown in FIG. 5 and Table 2.
  • Tables 1 and 2 also indicate the concentrations of the human antibody ⁇ -type light chains in the wells.
  • the four clones consisting of clone (#1_WT), clone (#4_WT), clone (#7_WT) and clone (22F6_C220A) demonstrated cytotoxicity on the order of 40% to 50% against A549 cells. Other clones were observed to hardly demonstrate any cytotoxicity against A549 cells.
  • clone (#4_WT) and clone (#7_WT) demonstrated particularly potent cytotoxicity.
  • clone (#7_WT) namely, human antibody ⁇ -type light chain (#7)
  • clone (#1_H31Y C220A) demonstrated a high level of cytotoxicity against A549 cells, MOLT-4 cells and ES-2 cells.
  • clone (#7 RLI) and clone (C51) demonstrated a high level of cytotoxicity against MOLT-4 cells.
  • clone (#4) demonstrated a high level of cytotoxicity against ES-2 cells.
  • amino acid sequence of clone (#1_H31Y C220A) is shown in SEQ ID NO: 38
  • the amino acid sequence of clone (#7 VL(I)) is shown in SEQ ID NO: 39
  • amino acid sequence of clone (#7 RLI) is shown in SEQ ID NO: 40
  • the amino acid sequence of clone (C51) is shown in SEQ ID NO: 41
  • the amino acid sequence of clone (C87) is shown in SEQ ID NO: 42
  • amino acid sequence of clone (#7 EI) is shown in SEQ ID NO: 43
  • the amino acid sequence of clone (#7 TR) is shown in SEQ ID NO: 44
  • the amino acid sequence of clone (#7 VL) is shown in SEQ ID NO: 45
  • the amino acid sequence of clone (S13) is shown in SEQ ID NO: 46
  • the amino acid sequence of clone (S21) is shown in SEQ ID NO:
  • the anticancer agent containing the human antibody ⁇ -type light chain of the present application did not demonstrate any toxicity in animal studies.
  • the present invention allows the development of a novel anticancer agent and the use thereof in the field of cancer treatment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pulmonology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
US14/383,118 2012-03-08 2013-03-05 Anticancer agent Abandoned US20150064203A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/166,647 US10040863B2 (en) 2012-03-08 2016-05-27 Anticancer agent

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
JP2012052334 2012-03-08
JP2012-052334 2012-03-08
PCT/JP2013/055927 WO2013133253A1 (fr) 2012-03-08 2013-03-05 Agent anticancéreux

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2013/055927 A-371-Of-International WO2013133253A1 (fr) 2012-03-08 2013-03-05 Agent anticancéreux

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/166,647 Division US10040863B2 (en) 2012-03-08 2016-05-27 Anticancer agent

Publications (1)

Publication Number Publication Date
US20150064203A1 true US20150064203A1 (en) 2015-03-05

Family

ID=49116728

Family Applications (2)

Application Number Title Priority Date Filing Date
US14/383,118 Abandoned US20150064203A1 (en) 2012-03-08 2013-03-05 Anticancer agent
US15/166,647 Active 2033-06-09 US10040863B2 (en) 2012-03-08 2016-05-27 Anticancer agent

Family Applications After (1)

Application Number Title Priority Date Filing Date
US15/166,647 Active 2033-06-09 US10040863B2 (en) 2012-03-08 2016-05-27 Anticancer agent

Country Status (5)

Country Link
US (2) US20150064203A1 (fr)
EP (1) EP2837387B1 (fr)
JP (1) JP5798199B2 (fr)
TW (1) TWI471332B (fr)
WO (1) WO2013133253A1 (fr)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10633429B2 (en) 2013-08-20 2020-04-28 Japan Science And Technology Agency Human antibody κ type light chain complex-containing composition and method for producing same
WO2015048770A2 (fr) 2013-09-30 2015-04-02 Beth Israel Deaconess Medical Center, Inc. Traitements par anticorps pour le virus de l'immunodéficience humaine (vih)
EP3797118A4 (fr) 2018-05-22 2022-06-29 Beth Israel Deaconess Medical Center, Inc. Traitements par anticorps pour le virus de l'immunodéficience humaine (vih)
WO2020106713A1 (fr) * 2018-11-21 2020-05-28 Beth Israel Deaconess Medical Center, Inc. Traitements par anticorps pour le virus de l'immunodéficience humaine (vih)
WO2021015237A1 (fr) * 2019-07-24 2021-01-28 国立研究開発法人科学技術振興機構 Technique novatrice de production d'anticorps-enzyme

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030105000A1 (en) * 2000-11-03 2003-06-05 Pero Stephanie C. Methods and compositions for inhibiting GRB7

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AR039067A1 (es) * 2001-11-09 2005-02-09 Pfizer Prod Inc Anticuerpos para cd40
WO2004033658A2 (fr) * 2002-10-09 2004-04-22 Integrigen, Inc. Polypeptides catalytiques recombinants et leurs utilisations
JP4829609B2 (ja) * 2004-12-22 2011-12-07 独立行政法人科学技術振興機構 ヒト抗体酵素およびその生産方法
WO2008029807A1 (fr) * 2006-09-06 2008-03-13 Japan Science And Technology Agency Nouveau polypeptide ayant une cytotoxicité contre le cancer, procédé pour cribler le polypeptide et utilisation du polypeptide
BRPI0906387A2 (pt) * 2008-02-05 2015-07-07 Bristol Myers Squibb Co Anticorpos alfa 5 - beta 1 e seus usos
AR071891A1 (es) 2008-05-30 2010-07-21 Imclone Llc Anticuerpos humanos anti-flt3 (receptor tirosina cinasa 3 tipo fms humano)
EP2537931B1 (fr) 2010-02-19 2016-10-19 Japan Science And Technology Agency Abzyme antiviral

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030105000A1 (en) * 2000-11-03 2003-06-05 Pero Stephanie C. Methods and compositions for inhibiting GRB7

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Coleman et al. (Research in Immunology, 1994; 145(1): 33-36) *
Fujimoto et al. (FASEB J. Apr. 2010 Vol 24, Meeting Info.: Conference on Experimental Biology) *
Ibragimova and Wade (Biophysical Journal, Oct 1999, Vol. 77, pp. 2191-2198) *
Rudikoff et al. (PNAS USA, 1982, 79: 1979-1983) *
Skolnick et al. (TIBTECH 18:34-39, 2000) *

Also Published As

Publication number Publication date
EP2837387B1 (fr) 2020-07-29
EP2837387A1 (fr) 2015-02-18
US20160340441A1 (en) 2016-11-24
US10040863B2 (en) 2018-08-07
JP5798199B2 (ja) 2015-10-21
TW201341402A (zh) 2013-10-16
EP2837387A4 (fr) 2015-12-02
WO2013133253A1 (fr) 2013-09-12
JPWO2013133253A1 (ja) 2015-07-30
TWI471332B (zh) 2015-02-01

Similar Documents

Publication Publication Date Title
US10040863B2 (en) Anticancer agent
US11535669B2 (en) Fusion constructs and methods of using thereof
CN111094341A (zh) 在可变域和恒定域之间的肘区中具有功能域的抗体
JP2020018298A (ja) Ｃｌｄｎ１８．２及びｃｄ３に対する抗体コンストラクト
CN102428103B (zh) 抗light的人源化抗体及其使用
KR20190091281A (ko) 항인간 cd73 항체
WO2016205042A1 (fr) Anticorps agonistes de sirpα
JP7373650B2 (ja) 抗ｐｄ－ｌ１シングルドメイン抗体
JP2017522903A (ja) Ｃｄ１２７に対する抗体
US20230365696A1 (en) Ifngr1 binding molecules and methods of use
KR20160099083A (ko) 신규 항인간 bdca-2 항체
TWI643871B (zh) 含有人類抗體κ型輕鏈複合體之組成物及其製造方法
CN113512117B (zh) 一种可结合cd206的抗体及其应用
EP3978015A1 (fr) Anticorps bispécifique
WO2021146481A1 (fr) Mutéines d'il2
EP3907239A2 (fr) Anticorps humanisés contre un fragment bêta d'une chaîne de la famille 9 du récepteur cellulaire trbv-9 de l'humain et méthodes de leur application
US20220259290A1 (en) Innovative production technique for antibody-enzyme
WO2022141378A1 (fr) Anticorps à domaine unique anti-pd-1
EP4317435A1 (fr) Molécule multispécifique stable et son utilisation
CN110582297B (zh) 包含T细胞接合抗体构建体的低pH药物组合物
US20230201365A1 (en) Modified cd20 antibodies and uses thereof
WO2021004975A1 (fr) Protéines d'anticorps anti-iga modifiées
CN105001331B (zh) 一种vegf单克隆抗体及其应用
WO2023250380A2 (fr) Technologie de plateforme pour protéines bispécifiques de liaison à l'antigène
CN116836268A (zh) 针对新型冠状病毒SARS-CoV-2的抗体及其用途

Legal Events

Date Code Title Description
AS Assignment

Owner name: JAPAN SCIENCE AND TECHNOLOGY AGENCY, JAPAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:UDA, TAIZO;HIFUMI, EMI;REEL/FRAME:033674/0080

Effective date: 20140729

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION