US20110237461A1 - Using phage epitopes to profile the immune response - Google Patents

Using phage epitopes to profile the immune response Download PDF

Info

Publication number
US20110237461A1
US20110237461A1 US13/050,544 US201113050544A US2011237461A1 US 20110237461 A1 US20110237461 A1 US 20110237461A1 US 201113050544 A US201113050544 A US 201113050544A US 2011237461 A1 US2011237461 A1 US 2011237461A1
Authority
US
United States
Prior art keywords
seq
cancer
antibody
polypeptide
probes
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US13/050,544
Other languages
English (en)
Inventor
Arul M. Chinnaiyan
Xiaoju Wang
Alex Tsodikov
Jeanne Ohrnberger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Howard Hughes Medical Institute
University of Michigan
Exact Sciences Development Co LLC
Original Assignee
University of Michigan
Armune Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Michigan, Armune Biosciences Inc filed Critical University of Michigan
Priority to US13/050,544 priority Critical patent/US20110237461A1/en
Assigned to Armune Biosciences, Inc. reassignment Armune Biosciences, Inc. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: OHRNBERGER, JEANNE
Assigned to THE REGENTS OF THE UNIVERSITY OF MICHIGAN, Armune Biosciences, Inc. reassignment THE REGENTS OF THE UNIVERSITY OF MICHIGAN ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: TSODIKOV, ALEX
Assigned to THE REGENTS OF THE UNIVERSITY OF MICHIGAN reassignment THE REGENTS OF THE UNIVERSITY OF MICHIGAN ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: WANG, XIAOJU
Assigned to HOWARD HUGHES MEDICAL INSTITUTE ("HHMI") reassignment HOWARD HUGHES MEDICAL INSTITUTE ("HHMI") ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHINNAIYAN, ARUL M.
Assigned to THE REGENTS OF THE UNIVERSITY OF MICHIGAN reassignment THE REGENTS OF THE UNIVERSITY OF MICHIGAN ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: HOWARD HUGHES MEDICAL INSTITUTE ("HHMI")
Publication of US20110237461A1 publication Critical patent/US20110237461A1/en
Priority to US14/822,045 priority patent/US9658231B2/en
Assigned to EXACT SCIENCES DEVELOPMENT COMPANY, LLC reassignment EXACT SCIENCES DEVELOPMENT COMPANY, LLC ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ARMUNE BIOSCIENCE, INC.
Priority to US15/933,574 priority patent/US11307203B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57434—Specifically defined cancers of prostate
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/005—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57419—Specifically defined cancers of colon
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57423—Specifically defined cancers of lung
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57488—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds identifable in body fluids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4703—Regulators; Modulating activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4703—Regulators; Modulating activity
    • G01N2333/4704—Inhibitors; Supressors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/91—Transferases (2.)
    • G01N2333/912—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)

Definitions

  • PCA prostate cancer
  • Prostate cancer is typically diagnosed with a digital rectal exam and/or prostate specific antigen (PSA) screening.
  • PSA prostate specific antigen
  • An elevated serum PSA level can indicate the presence of PCA.
  • PSA is used as a marker for prostate cancer because it is secreted only by prostate cells.
  • a healthy prostate will produce a stable amount—typically below 4 nanograms per milliliter (ng/ml), or a PSA reading of “4” or less—whereas cancer cells produce escalating amounts that correspond with the severity of the cancer.
  • a level between 4 and 10 ng/ml may raise a doctor's suspicion that a patient has prostate cancer, while amounts above 50 ng/ml may show that the tumor has spread elsewhere in the body.
  • PSA prostate specific antigen
  • an antibody profiling panel comprising: a plurality of polypeptide probes, wherein at least one of the polypeptide probes comprises a full-length or fragment of a protein encoded by a gene listed in Tables 1, 2, 3, or 4; and each of the probes in the plurality of polypeptide probes is capable of being specifically bound by an antibody, is disclosed herein.
  • an antibody profiling panel comprising: a plurality of polypeptide probes, wherein at least one of the polypeptide probes comprises a sequence listed in Tables 1, 2, 3, or 4 or a sequence encoded by a sequence listed in Tables 1, 2, 3, or 4; and each of the probes in the plurality of polypeptide probes is capable of being specifically bound by an antibody, is disclosed herein.
  • the subject is a human.
  • the antibody is an autoantibody.
  • the antibody is a human autoantibody.
  • the presence of a human autoantibody that binds to a polypeptide probe is indicative of cancer (e.g. an expression level for one or more autoantibodies is indicative of the presence, absence, or stage of the cancer).
  • the quantity or level of a human autoantinbody that binds to a polypeptide probe is indicative of cancer.
  • the cancer is a prostate, lung, breast or colon cancer.
  • the polypeptide probe comprises a polypeptide sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, or a fragment thereof.
  • the polypeptide probe comprises a polypeptide sequence encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, or a fragment thereof.
  • the polypeptide probe comprises the full-length or a fragment of a protein that is encoded by DCHS1 (SEQ ID NO: 29), Centrosomal Protein (CEP 164) (SEQ ID NO: 30), KBTBD6 (SEQ ID NO: 31), RPS19 (SEQ ID NO: 32), RPL34 (SEQ ID NO: 33), Hemk1 (SEQ ID NO: 34), eIF4G1 (SEQ ID NO: 35), BMI1 (SEQ ID NO: 36), BRD2 (SEQ ID NO: 37), RP3-323M22 (Nucleolin) (SEQ ID NO: 38), SFRS14 (SEQ ID NO: 39), LOC388789 (SEQ ID NO: 40), RNA binding motif protein 6 (genomic DNA sequence) (SEQ ID NO: 41), BRMSL1 (SEQ ID NO: 42), NKX3-1 (SEQ ID NO: 43), RPSA (SEQ ID NO: 44), Cytochrome C Oxidase 5 subunit (SEQ ID NO:
  • UBE2I (SEQ ID NO: 52), TIMP2 (SEQ ID NO: 53), WDR77 (SEQ ID NO: 54), a fragment of Deaminase Domain Cont 1 (Human DNA sequence from clone RP1-20N2 on chromosome 6q24 Contains the gene for a novel protein similar to yeast and bacterial cytosine deaminase, NTs 48121-50100) (SEQ ID NO: 55), Lamin A/C (SEQ ID NO: 85), Lsm3 (SEQ ID NO: 86), a fragment of cDNA clone Chromosome 19, which encompasses the nucleic acid sequence for DAZ associated protein ( Homo sapiens chromosome 19 clone CTB-25B13, NTs 20521-22500) (SEQ ID NO: 87), ADAM metallopetidase domain 9 (SEQ ID NO: 88), AZGP1 (SEQ ID NO: 89), Desmocolin 3 (SEQ ID NO: 90
  • the antibody profiling panel comprises a plurality of polypeptide probes, wherein at least one of the polypeptide probes comprises a full-length or fragment of a protein listed in Table 1, or a polypeptide sequence selected from SEQ ID NO: 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, or 141, and each of said probes in said plurality of polypeptide probes is capable of being specifically bound by an antibody.
  • one or more of the polypeptide probes can comprise SEQ ID NO: 1, 2, 3, 4, 5, 6, or 7. In another embodiment, one or more of the polypeptide probes can comprise a polypeptide encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, or 21. In one embodiment, the antibody profiling panel can further comprise a full-length or fragment of a protein listed in Tables 2, 3, or 4. In another embodiment, the antibody profiling panel, one of the polypeptide probes can comprise SEQ ID NO: 8, 9, 10, 11, 12, 13, or 14. In another embodiment, one or more of the polypeptide probes can comprise a polypeptide encoded by SEQ ID NO: 22, 23, 24, 25, 26, 27, or 28. In one embodiment the antibody is an autoantibody.
  • the antibody is a human autoantibody.
  • the presence of a human autoantinbody that binds to a polypeptide probe is indicative of cancer (e.g. an expression level for one or more autoantibodies is indicative of the presence, absence, or stage of the cancer).
  • the quantity or level of a human autoantibody that binds to a polypeptide probe is indicative of cancer.
  • the cancer is a prostate, lung, breast or colon cancer.
  • the plurality of probes comprise a polypeptide probe comprising a full-length or fragment of a protein encoded by CEP164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, Deaminase Domain, FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789.
  • the polypeptide probe comprises SEQ ID NO: 2, 5, 9, 11, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or a fragment thereof.
  • the polypeptide probe comprises a polypeptide sequence encoded by SEQ ID NO: 16, 19, 70, 72, 73, 74, 76, 77, 78, 79, 80, 81, 82, 83, 84, or a fragment thereof.
  • the plurality of probes comprise a polypeptide probe comprising a full-length or fragment of a protein encoded by CEP164, RPL34, BRMSL1, NKX31, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, or Deaminase Domain.
  • the plurality of probes comprise a polypeptide probe comprising a polypeptide sequence selected from SEQ ID NOs.
  • the plurality of probes comprises a polypeptide probe comprising a polypeptide sequence encoded by SEQ ID NO: 16, 19, 70, 72, 73, 74, 76, 77, 78, 79, 80, 81, 82, 83, or 84.
  • the plurality of probes comprise a polypeptide probe comprising a full-length or fragment of a protein encoded by FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789. In one embodiment, the plurality of probes comprise a polypeptide probe comprising a polypeptide sequence selected from SEQ ID NO: 9, 11, 14, or 60. In one embodiment, the plurality of probes comprises a polypeptide probe comprising a polypeptide sequence encoded by SEQ ID NO: 23, 25, 28, 71, or 75.
  • an antibody profiling panel comprising: a plurality of polypeptide probes, wherein at least one of the polypeptide probes comprises a full-length or fragment of a protein that is DCHS1, CEP164, KBTBD6, RPS19, RPL34, RNA binding protein 6, or Hemk1; and each of the probes in the plurality of polypeptide probes is capable of being specifically bound by an antibody, is disclosed herein.
  • the plurality of probes further comprise a polypeptide probe comprising a full-length or fragment of a protein encoded by eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789.
  • the polypeptide probe comprises a sequence listed in Table 1 or 2, such as SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or a fragment thereof.
  • the antibody is an autoantibody.
  • the antibody is a human autoantibody.
  • the presence of a human autoantinbody that binds to a polypeptide probe is indicative of cancer (e.g. an expression level for one or more autoantibodies is indicative of the presence, absence, or stage of the cancer).
  • the quantity or level of a human autoantibody that binds to a polypeptide probe is indicative of cancer.
  • the cancer is a prostate, lung, breast or colon cancer.
  • one or more of the probes is displayed by a phage.
  • the one or more probes is attached to a substrate, such as attached via a phage.
  • the substrate is an array.
  • the panel comprises at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes.
  • the panel characterizes a cancer, such as prostate cancer, with at least 80% sensitivity and specificity.
  • the panel screens for a cancer, such as prostate cancer, with at least 80% sensitivity and specificity.
  • the method comprises detecting in a sample obtained from a subject a presence or level of one or more antibodies to one or more polypeptide probes comprising a full-length or a fragment of a protein encoded by DCHS1, CEP164, KBTBD6, RPS19, RPL34, SFRS14, RNA binding protein 6, or Hemk1; and characterizing or identifying, the prostate cancer based on a presence or level of the one or more antibodies.
  • the method further comprises detecting a presence, absence or level of one or more antibodies to one or more polypeptide probe comprising a full-length or a fragment of a protein encoded by eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789.
  • the antibody is an autoantibody. In another embodiment the antibody is a human autoantibody.
  • the method comprises detecting in a sample obtained from a subject a presence or level of one or more antibodies to one or more polypeptide probes comprising a full-length or a fragment of a protein encoded by CEP164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, or Deaminase Domain; and characterizing the prostate cancer based on a presence or level of the one or more antibodies.
  • the method further comprises detecting a presence, absence or level of one or more antibodies to one or more polypeptide probe comprising a full-length or a fragment of a protein encoded by FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789.
  • the subject is a human.
  • the antibody is an autoantibody.
  • the antibody is a human autoantibody.
  • the presence of a human autoantibody that binds to a polypeptide probe is indicative of cancer (e.g. an expression level for one or more autoantibodies is indicative of the presence, absence, or stage of the cancer).
  • the quantity or level of a human autoantinbody that binds to a polypeptide probe is indicative of cancer.
  • the cancer is a prostate, lung, breast or colon cancer.
  • a method of obtaining a biopsy wherein a determiniation of whether a biopsy should be obtained is based on detecting an expression level for an antibody.
  • a subject suspected of having cancer based on an expression level of an antibody is recommended to have a biopsy obtained.
  • a biological sample is obtained from a subject with a PSA level of greater than about 2.5 ng/ml, and the sample is contacted with one or more probes for an antibody, and based on the expression level of an antibody, a biopsy is obtained or recommended for the subject.
  • the subject has a PSA level between about 2.5 ng/mL and about 10 ng/mL.
  • the subject is a human.
  • the antibody is an autoantibody.
  • the antibody is a human autoantibody.
  • the method further comprises contacting a biological sample obtained from the subject with one or more probes for a second antibody when the biopsy provides a positive result for a cancer, such as prostate cancer, and based on the expression level of the second antibody, a prognosis or theranosis is provided.
  • a cancer such as prostate cancer
  • the subject is a human.
  • the second antibody is an autoantibody.
  • the second antibody is a human autoantibody.
  • the method comprises detecting an expression level for one or more antibodies, wherein the expression level of the one or more antibodies is indicative of the presence, absence, or stage of the cancer.
  • the indication is whether the cancer is aggressive or indolent.
  • the method of identifying a cancer as aggressive or indolent comprises: obtaining a positive biopsy result for cancer from the subject; contacting a biological sample obtained from the subject with one or more probes for an antibody; detecting an expression level for the antibody; and characterizing or identifying the cancer as aggressive or indolent based on the expression level of the antibody.
  • the subject is a human.
  • the antibody is an autoantibody. In another embodiment the antibody is a human autoantibody. In one embodiment the presence of a human autoantibody that binds to a polypeptide probe is indicative of cancer (e.g. an expression level for one or more autoantibodies is indicative of the presence, absence, or stage of the cancer). In another embodiment the quantity or level of a human autoantinbody that binds to a polypeptide probe is indicative of cancer. In one embodiment the cancer is a prostate, lung, breast or colon cancer.
  • FIG. 1 is a schematic depicting detecting in a sample from a subject with PSA levels greater than 2.5 ng/mL the expression of one or more autoantibodies (“Autoantibody Test I”). If the result of the Autoantibody Test I is negative, a biopsy is not recommended to be obtained from the subject for further analysis. If result of the Autoantibody Test II is positive, then a biopsy is obtained. If the biopsy is positive for prostate cancer, expression of one or more autoantibodies is detected from a sample from the subject to characterize the cancer as aggressive or indolent, and a prognosis or theranosis provided.
  • FIG. 2 lists the nucleic acid sequence for DCHS 1 (SEQ ID NO: 29).
  • FIG. 3 lists the nucleic acid sequence for Centrosomal Protein (CEP 164) (SEQ ID NO: 30).
  • FIG. 4 lists the nucleic acid sequence for KBTBD6 (SEQ ID NO: 31).
  • FIG. 5 lists the nucleic acid sequence for RPS19 (SEQ ID NO: 32).
  • FIG. 6 lists the nucleic acid sequence for RPL34 (SEQ ID NO: 33).
  • FIG. 7 lists the nucleic acid sequence for Hemk1 (SEQ ID NO: 34).
  • FIG. 8 lists the nucleic acid sequence for eIF4G1 (SEQ ID NO: 35).
  • FIG. 9 lists the nucleic acid sequence for BMI1 (SEQ ID NO: 36).
  • FIG. 10 lists the nucleic acid sequence for BRD2 (SEQ ID NO: 37).
  • FIG. 11 lists the nucleic acid sequence for RP3-323M22 (Nucleolin) (SEQ ID NO: 38).
  • FIG. 12 lists the nucleic acid sequence for SFRS14 (SEQ ID NO: 39).
  • FIG. 13 lists the nucleic acid sequence for LOC388789 (SEQ ID NO: 40).
  • FIG. 14 lists the nucleic acid sequence for RNA binding motif protein 6 (genomic DNA sequence) (SEQ ID NO: 41).
  • FIG. 15 lists the nucleic acid sequence for BRMSL1 (SEQ ID NO: 42).
  • FIG. 16 lists the nucleic acid sequence for NKX3-1 (SEQ ID NO: 43).
  • FIG. 17 lists the nucleic acid sequence for RPSA (SEQ ID NO: 44).
  • FIG. 18 lists the nucleic acid sequence for Cytochrome C Oxidase 5 subunit (SEQ ID NO: 45).
  • FIG. 19 lists the nucleic acid sequence for FAM53B (SEQ ID NO: 46).
  • FIG. 20 lists the nucleic acid sequence for a fragment of the UTR region of chromosome 11 (Homo sapiens genomic DNA, chromosome 11 clone: CTD-2579L12, NTs 149521-151500) (SEQ ID NO: 47).
  • FIG. 21 lists the nucleic acid sequence for MAPKKK9 (SEQ ID NO: 48).
  • FIG. 22 lists the nucleic acid sequence for cDNA clone XR — 113641.1 ( Homo sapiens hypothetical LOC643783, transcript variant 2 (LOC643783), partial miscRNA) (SEQ ID NO: 49).
  • FIG. 23 lists the nucleic acid sequence for PSA (SEQ ID NO: 50).
  • FIG. 24 lists the nucleic acid sequence for H2aa4 (SEQ ID NO: 51).
  • FIG. 25 lists the nucleic acid sequence for UBE2I (SEQ ID NO: 52).
  • FIG. 26 lists the nucleic acid sequence for TIMP2 (SEQ ID NO: 53).
  • FIG. 27 lists the nucleic acid sequence for WDR77 (SEQ ID NO: 54).
  • FIG. 28 lists the nucleic acid sequence for a fragment of Deaminase Domain Cont 1 (Human DNA sequence from clone RP1-20N2 on chromosome 6q24 Contains the gene for a novel protein similar to yeast and bacterial cytosine deaminase, NTs 48121-50100) (SEQ ID NO: 55).
  • FIG. 29 lists the nucleic acid sequence for Lamin A/C (SEQ ID NO: 85).
  • FIG. 30 lists the nucleic acid sequence Lsm3 (SEQ ID NO: 86).
  • FIG. 31 lists the nucleic acid sequence for a fragment of cDNA clone Chromosome 19, which encompasses the nucleic acid sequence for DAZ associated protein ( Homo sapiens chromosome 19 clone CTB-25B13, NTs 20521-22500) (SEQ ID NO: 87).
  • FIG. 32 lists the nucleic acid sequence for ADAM metallopetidase domain 9 (SEQ ID NO: 88).
  • FIG. 33 lists the nucleic acid sequence for AZGP1 (SEQ ID NO: 89).
  • FIG. 34 lists the nucleic acid sequence for Desmocolin 3 (SEQ ID NO: 90).
  • FIG. 35 lists the nucleic acid sequence for PERP (SEQ ID NO: 91).
  • FIG. 36 lists the nucleic acid sequence for Chromosome 3 UTR region ropporin/RhoEGF (Homo sapiens 3 BAC RP11-783D3 (Roswell Park Cancer Institute Human BAC Library) NTs 178621-180600) (SEQ ID NO: 92).
  • FIG. 37 lists the nucleic acid sequence for Cox5a (SEQ ID NO: 93).
  • FIG. 38 lists the nucleic acid sequence for a Mitochondrion sequence ( Homo sapiens isolate PD047 mitochondrion, NTs 4801-6780) (SEQ ID NO: 94).
  • FIG. 39 lists the nucleic acid sequence for MYH9 (SEQ ID NO: 95).
  • FIG. 40 lists the nucleic acid sequence for ASND1 (SEQ ID NO: 96).
  • FIG. 41 lists the nucleic acid sequence for Cathepsin F (SEQ ID NO: 97).
  • FIG. 42 lists the nucleic acid sequence for Mastermind-like 2 ( Homo sapiens genomic DNA, chromosome 1 lq clone:RP11-82212, NTs 157801-159780) (SEQ ID NO: 98).
  • FIG. 43 lists the nucleic acid sequence for CSNK2A2 (SEQ ID NO: 99).
  • FIG. 44 lists the nucleic acid sequence for AURKAIP1 (SEQ ID NO: 100).
  • FIG. 45 lists the nucleic acid sequence for a fragment of Chromosome 4 ( Homo sapiens BAC clone RP11-327017 from 4, NTs 107401-109380) (SEQ ID NO: 101).
  • FIG. 46 lists the nucleic acid sequence for ARF6 (SEQ ID NO: 102).
  • FIG. 47 lists the nucleic acid sequence for JAG1 (Human DNA sequence from clone RP1-278022 on chromosome 20 Contains two novel genes, NTs 26161-26140) (SEQ ID NO: 103).
  • FIG. 48 lists the nucleic acid sequence for a Mitochondrion sequence ( Homo sapiens isolate PD047 mitochondrion, NTs 2041-4020) (SEQ ID NO: 104).
  • FIG. 49 lists the nucleic acid sequence for a fragment of Chromosome 20 (Human DNA sequence from clone RP1-278O22 on chromosome 20 Contains two novel genes, NTs 25321-27300) (SEQ ID NO:105).
  • FIG. 50 lists the nucleic acid sequence for a fragment of Chromosome 6 UTR region (Human DNA sequence from clone RP3-523G1 on chromosome 6p22.3-24.1, NTs 34621-36600) (SEQ ID NO: 106).
  • FIG. 51 lists the nucleic acid sequence for a fragment of MAPKKK5 (SEQ ID NO: 107).
  • FIG. 52 lists the nucleic acid sequence for RASA1 (SEQ ID NO: 108).
  • FIG. 53 lists the nucleic acid sequence for Hsp90b (SEQ ID NO: 109).
  • FIG. 54 lists the nucleic acid sequence for ribosomal protein S6 (RPS6) (SEQ ID NO: 110).
  • FIG. 55 lists the nucleic acid sequence for a fragment of Homo sapiens chromosome 3 (Homo sapiens 3 BAC RP13-616I3 (Roswell Park Cancer Institute Human BAC Library) NTs 22921-24900) (SEQ ID NO: 111).
  • compositions and methods of the present disclosure relate to compositions and methods for characterizing a cancer or screening for a cancer.
  • tests which can be used to analyze a presence or absence of an antibody from a subject, such as a subject being tested or screened for a cancer.
  • an antibody is an autoantibody.
  • the test comprises a single antigen, thus detecting only an antibody that binds to that antigen.
  • a panel of antigens is constructed such that the panel tests for a presence of one or more antibodies which specifically bind to two or more antigens derived from proteins associated with a specific cancer, such as lung cancer, prostate cancer, or ovarian cancer.
  • a cancer is characterized for a subject using a composition or method disclosed herein.
  • a subject is an individual or patient.
  • a subject is a human.
  • a subject is a cancer patient.
  • a subject exhibits no symptom of cancer, such as no symptoms of prostate cancer.
  • a subject has no detectable symptom of cancer, such as no detectable symptoms for prostate cancer.
  • a subject exhibits a symptom of cancer, such as a symptom for prostate cancer.
  • a subject is a human.
  • a subject is an individual.
  • a subject is a patient, such as a cancer patient.
  • Characterizing a cancer, or screening for a cancer can include detecting the cancer (including pre-symptomatic early stage detecting), determining the prognosis, diagnosis, or theranosis of the cancer, or determining the stage or progression of the cancer.
  • a prognosis is predicting or giving a likelihood of outcome of a disease or condition, such as an extent of malignancy of a cancer, a likelihood of survival, or expected life expectancy, such as in an individual with prostate cancer.
  • a prognosis is a prediction or likelihood analysis of cancer progression, cancer recurrence, or metastatic spread or relapse.
  • the diagnosis is prediction or likelihood an individual or subject has a disease or condition, such as prostate cancer.
  • the individual is an asymptomatic individual. In another embodiment, the individual is a symptomatic individual.
  • a theranosis is a therapy selected based on an outcome of determining a binding of one or more antibodies from a sample from a subject to an antigen or polypeptide probe as described herein. In one embodiment, a theranosis is identifying an appropriate treatment or treatment efficacy for a cancer. In one embodiment, a theranosis is modifying a treatment. In another embodiment, a theranosis is selecting a treatment regimen. In yet another embodiment, a theranosis is discontinuing or not selecting a particular treatment regimen. In one embodiment a treatment regimen or therapeutic agent is selected based on the presence or absence of an autoantibody that binds to polypeptide probes described herein.
  • the autoantibody is a human aautoantibody. In one embodiment a treatment regimen or therapeutic agent is excluded based on the presence or absence of an autoantibody that binds to polypeptide probes described herein. In one embodiment the autoantibody is a human aautoantibody.
  • characterizing or screening for a cancer is detecting the cancer, such as pre-symptomatic early stage detecting.
  • characterizing a cancer is determining the stage or progression of the cancer, such as early-stage, late-stage or advanced stage of cancer.
  • Characterizing or screening for a cancer can also be determining the likelihood or possibility an individual has a cancer.
  • Characterizing or screening for a cancer can also be identification of a cancer, such as determining whether expression of one or more antibodies is indicative of the cancer.
  • an antigen panel is used to detect a presence of one or more antibodies to one or more proteins, antigens, mimotopes, or epitopes.
  • one or more polypeptide probes described herein is a protein or fragment thereof.
  • one or more polypeptide probes described herein comprises an antigen, mimotope, or epitope.
  • a “mimotope” can mimic the epitope of a protein or peptide.
  • the mimotope is structurally similar to an antigen or epitope of an expressed protein, but is unrelated or weakly related at the protein sequence level.
  • the antigen panel comprises one or more polypeptide probes comprising a polypeptide sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, or a fragment thereof.
  • the antigen panel comprises one or more polypeptide probes comprising a sequence encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, or a fragment thereof.
  • the polypeptide probe comprises the full-length or a fragment of a protein that is encoded by SEQ ID NO: 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,102, 103, 104, 105, 106, 107, 108, 109, 110, 111, or a fragment thereof.
  • the antigen panel comprises one or more polypeptide probes derived from one or more proteins encoded by one or more genes selected from: CEP164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, Deaminase Domain, FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789.
  • detection of one or more antibodies is used to detect a presence of prostate cancer in a subject.
  • the antigen panel comprises one or more polypeptide probes derived from one or more proteins encoded by one or more genes selected from: DCHS1, CEP164, KBTBD6, RPS19, RPL34, RNA binding protein 6, Hemk1, eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, and LOC388789.
  • detection of one or more antibodies is used to detect a presence of prostate cancer in a subject.
  • a cancer can also be characterized by determining a presence or absence, or level, of one or more antibodies in a sample.
  • a sample is obtained from a subject.
  • the subject can be a mammal, including, but not limited to, humans, non-human primates, rodents, and the like.
  • a sample is a biological fluid.
  • the biological fluid can be, but not limited to, peripheral blood, sera, or plasma.
  • the sample can be ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, or bronchopulmonary aspirates.
  • CSF cerebrospinal fluid
  • an antibody is an autoantibody.
  • An autoantibody refers to an antibody produced by a host (with or without immunization) and directed to a host antigen (such as a tumor antigen). Tumor-associated antigens recognized by humoral effectors of the immune system are an attractive target for diagnostic and therapeutic approaches to human cancer.
  • the binding of an antibody with a polypeptide probe can be specific, such that the interaction of the autoantibody with the polypeptide probe is dependent upon a presence of a particular structure (i.e., the antigenic determinant or epitope) of the polypeptide probe.
  • Antigenic determinates or epitopes can comprise amino acids in linear or non-linear sequence in a polypeptide probe and can also comprise one or more amino acids which are in proximity to each other via protein folding (e.g., conformational epitopes).
  • a single polypeptide or protein can potentially be bound by multiple antibodies which recognize different epitopes.
  • known epitopes of a particular polypeptide can be used as a probe to detect for a presence, absence or level of autoantibodies which bind a particular epitope
  • the polypeptide probe can be an antigen identified through serologic identification of antigens, for example by recombinant expression cloning (SEREX), such as described by Kim et al., Biotech. Lett . (2004); 26: 585-588.
  • SEREX recombinant expression cloning
  • an antigen can be identified by screening expression cDNA libraries from human solid tumors with sera of autologous patients. This type of screening of a cDNA expression library by conventional methods typically requires the preparation of a large number of membrane filters blotted with bacteriophage plaques that are then searched with a specific probe. In the case of the SEREX experiments, the screening is performed using sera from cancer patients, which can be in very limited quantities.
  • a polypeptide probe for detecting an antibody can also be identified by phage-display technology, which can be based on the insertion of foreign nucleotide sequences into genes encoding for various capsid proteins of T7 phage, resulting in a heterogeneous mixture of phages, each displaying the different peptide sequence encoded by a corresponding insert.
  • a physical link between a displayed fusion protein and DNA encoded for it make this phage target selectable.
  • the phage target can express or display a polypeptide probe, which can be used to detect antibodies that are produced by a subject, or autoantibodies, which can then be used to detect or characterize a cancer.
  • the polypeptide probe can be displayed by a phage and used to detect an antibody from a sample obtained from a subject.
  • an antibody is an autoantibody.
  • Polypeptide is used in its broadest sense and can include a sequence of subunit amino acids, amino acid analogs, or peptidomimetics. The subunits can be linked by peptide bonds.
  • the polypeptides can be naturally occurring, processed forms of naturally occurring polypeptides (such as by enzymatic digestion), chemically synthesized or recombinantly expressed.
  • the polypeptides for use in the methods of the present invention can be chemically synthesized using standard techniques.
  • the polypeptides can comprise D-amino acids (which are resistant to L- amino acid-specific proteases), a combination of D- and L-amino acids, ⁇ amino acids, or various other designer or non-naturally occurring amino acids (e.g., ⁇ -methyl amino acids, C ⁇ - methyl amino acids, and N ⁇ -methyl amino acids, etc.) to convey special properties.
  • Synthetic amino acids can include ornithine for lysine, and norleucine for leucine or isoleucine.
  • the polypeptides can have peptidomimetic bonds, such as ester bonds, to prepare polypeptides with novel properties.
  • a polypeptide can be generated that incorporates a reduced peptide bond, i.e., R 1 —CH 2 —NH-R 2 , where R 1 and R 2 are amino acid residues or sequences.
  • a reduced peptide bond can be introduced as a dipeptide subunit.
  • Such a polypeptide can be resistant to protease activity, and can possess an extended half-life in vivo.
  • a polypeptide can also include a peptoid (N-substituted glycines), in which the one or more side chains are appended to nitrogen atoms along the molecule's backbone, rather than to the ⁇ -carbons, as in amino acids.
  • Polypeptide and peptide are intended to be used interchangeably throughout this application, i.e. where the term peptide is used, it can also include polypeptide and where the term polypeptides is used, it can also include peptide.
  • a polypeptide probe can be a fragment or portion of a larger protein.
  • a fragment can range in size from two amino acid residues to the entire amino acid sequence minus one amino acid.
  • a polypeptide probe is a fragment of an untranslated region (UTR) of a protein, such as a fragment that is encoded by a nucleic sequence that is a UTR region of a gene, such as the 5′ or 3′ UTR of a gene.
  • UTR untranslated region
  • the fragment can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acids in size.
  • the fragment is less than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acids in size.
  • a polypeptide probe useful in the compositions and methods herein, regardless of size, is capable of specific interaction with an antibody, such as an autoantibody.
  • a polypeptide probe can be a fragment of a protein encoded by a gene, or a region upstream or downstream of a coding sequence, such as a UTR region, of a gene listed in Table 1, Table 2, Table 3 or Table 4.
  • the polypeptide probe comprises a polypeptide sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, or a fragment thereof.
  • the polypeptide probe comprises a polypeptide sequence encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, or a fragment thereof.
  • the polypeptide probe comprises the full-length or a fragment of a protein that is encoded by SEQ ID NO: 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,102, 103, 104, 105, 106, 107, 108, 109, 110, 111, or a fragment thereof.
  • a polypeptide probe is a fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene.
  • the gene can be CEP164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, or Deaminase Domain.
  • the gene is FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789.
  • a polypeptide probe comprises SEQ ID NO: 2, 5, 9, 11, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or a fragment thereof.
  • a polypeptide probe comprises a polypeptide encoded by SEQ ID NO: 16, 19, 23, 25, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or a fragment thereof.
  • the gene can be DCHS1, CEP164, KBTBD6, RPS19, RPL34, RNA binding protein 6, or Hemk1.
  • the gene is eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789.
  • a polypeptide probe can comprise a peptide sequence, or fragment thereof, such as those listed in Tables 1, 2, 3 or 4.
  • a polypeptide probe comprises SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or a fragment thereof.
  • a polypeptide probe comprises a polypeptide encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or a fragment thereof.
  • FIG. 2 PQTTAPRRAR AGCTTTCGCTAGAGACGCCTCCATA (proto- (SEQ ID PRRS (SEQ AGTCACTTGCCCGTTGGCCCCCACG cadherin-16 NO: 29) ID NO: 1) ATCGGGGTCGGTTGCTCGCAGGGC precursor) TGAGCAGAGATGTGCCAGGAGGGT TGTTCTCACGCAAGAGGACGCTGT ACTCCTGCTGCTGGAAAGTAGGCG CCTCGTCGTTGACGTCAGCGACACT GACGGTCAGGACCTGCGTGGCCGA GCGCGGCGGGGAGCCGTGGTCTGA GG (SEQ ID NO: 15) 1B4A Centrosomal NM_014956.4 FIG.
  • FIG. 8 IRDPNQGG TTCTTCTACAGACATTTGTATAGT (SEQ ID KDITEEIMS TGTCATAGTGTCCCCAGGAATAG NO: 35) GARTASTP AGAGGACTGCGAGATTAGGCTCA TPPQTGGG GACCCCGGTTCCAAGACTGGGGA LEPQANGE TGGTGATGGGGTCGGAGAAGGCG TPQVAVIV ACGAAGGCTGGGATTCTGAAGGG RPDDRSQG CTATGCTCTGGGCCAGGCAGCCC AIIADRPGL TGGCCGGTCAGCAATGATTGCTC PGPEHSPSE CCTGTGACCGGTCATCTGGCCGG SQPSSPSPT ACAATGACAGCAACCTGGGGCGT PSPVLEP CTCCCCATTAGCTTGAGGCTCCAG GSEPNLAV ACC
  • FIG. 15 APRTRTLR TCGTCGAGGCTCCTGCTCCTGTGA (SEQ ID ARRSPRME CTCTCGAGCAGCCAGAGGCTCCT NO: 42) IAQKWMM ACCTCTATCGAGTCTTTACCTACT KTVKEEEW ACTTCTGACACTTTCTTCTTCTTA NVWMKCPI CCTTACAAACCTACTTTACAGGTT LKNSLPIS AGAACTTTTTGTCAAATGGCTAG KINFIKND AGTTTCTAGTTGAAATATTTCTTG (SEQ ID CTAATTCAGTCCACCTACGTTTTG NO: 56) ATGTTCTTCAGTATCGACCTTTTC GTGGTCTTATGAACCTTGGCGACC GTTGAAATGTCCTTTTATACGTTT AAGCATGTTTCCATCGTCCTTAGA TATCTCTCGACGAATCTTAGAC
  • GGRGGGG GGAGGTCGAGGCGGAGGCGGAG (SEQ ID GGGGRGA GAGGAGGAGGCCGAGGCGCCGG No: 36) GGGRGAG AGGAGGCCGAGGCGCCGGAGCA AGGGRPEA GGAGGAGGCCGGCCGGAGGCGG A (SEQ ID CATGAGACGAGCGTGGCGGCCGC NO: 9) GGCTGCTCGGGGCCGCGCTGGTT GNCCATTGACAGCGGCGTCTGCA GCTCGCTTCAAGATGGCCGCTTG GCTCGCATTCATTTTCTGCTGAAC GACTTTTAACTTTCATTGTCTTTTC CGCCCGCTTCGATCGCCTCGCGCC GGCTGCTCTTTCCGGGATTTTTTA TCAAGCAGAAATGCATCGAACAA CGAGAATCAAGATCACTGAGCTA AATCCCCNCCTGATGTGTGTGCTT TGTGGAGGGTACTTCATTGATGCC ACAACCATAATAGAATGTCTACA TTCCTTCTGTAAAACGTGTATTGT TCGTTACCTGGA
  • An antibody such as an autoantibody, to one or more of a protein, or a fragment of a protein, encoded by a gene such as listed in Tables 1, 2, 3 or 4, or a polypeptide encoded by a UTR sequence of a gene such as one listed in Tables 1, 2, 3 or 4, can be detected according to one or more methods described herein and used to characterize a cancer, such as prostate cancer.
  • a cancer such as prostate cancer.
  • Many of the proteins may have a role in various cancers, including prostate cancer.
  • the human DCHS 1 protein protocadherin-16 precursor
  • DCHS1 is a cadherin, a class of type-1 transmembrane proteins. Cadherins typically play important roles in cellular adhesion, for example, by binding cells expressing similar cadherins to each other. Structurally, DCHS 1 is thought to contain 27 cadherin repeats (extracellular calcium ion-binding domains). DCHS 1 expression has been associated with certain cancers, potentially playing a role in tumor adherence (see, e.g., Sjöblom, et. al. Science , (2006) 314:268-274).
  • CEP164 is believed to be a centrosomal protein which binds chromatin and plays a role in the DNA damage-activated signaling cascade. It is known to interact with ataxia telangiectasia mutated (ATM) and ATM/Rad3-related (ATR) kinases which phosphorylate CEP164 upon replication stress, ultraviolet radiation (UV), and ionizing radiation (IR). CEP164 also plays a role in cell cycle regulation, specifically at the G2/M checkpoint and in nuclear division (see, e.g., Sivasubramaniam et al., Genes & Dev . (2008); 22(5):687-600). As CEP 164 plays a role in genome stabilization, misregulation or mutation of this gene and/or protein can play a role in certain cancers.
  • ATM ataxia telangiectasia mutated
  • ATR ATM/Rad3-related kinases which phosphorylate CEP164 upon replication stress, ultraviolet radiation (UV), and
  • the human KBTBD6 (kelch repeat and BTB (POZ) domain containing 6) is a protein expressed in a wide variety of normal tissues. Its expression and/or misregulation has also been noted in multiple cancer types, including prostate, ovarian, kidney and lung tumors. The function of the protein is not currently known, however, the presence of the kelch repeat and BTB domain suggest that the protein is involved in protein-protein interactions and actin filament organization.
  • RPS19 ribosomal protein S19
  • RPS19 encodes a ribosomal protein that is a component of the 40S subunit. Located in the cytoplasm as part of the ribosomal complex, mutations in this gene are associated with Diamond-Blackfan anemia, suggesting a non-ribosomal function for the protein in erythropoietic differentiation.
  • RPS19 protein is also known to interact with fibroblast growth factor-2 (see, e.g., Soulet et al., Biochem. Biophys. Res. Commun . (2001); 289:591-596).
  • RPL34 60S Ribosomal protein L34
  • c-MYC c-MYC
  • c-MYC c-MYC
  • RBM6 RNA binding protein 6
  • ATR ATM or ATR
  • HEMK1 HEMK methyltransferase family protein 1
  • HEMK1 S-adenosylmethionine-dependent methyltransferase and is also thought to bind nucleic acids.
  • HEMK1 is considered a tumor-suppressor, misregulation of which is associated with various cancers, including prostate cancer, pancreatic cancer and liver cancer (see, e.g., U.S. Pat. App. Pub. No. 2008/0213791).
  • polypeptide probes such as a fragment of a protein encoded by a gene, or a polypeptide encoded by a sequence of a UTR region of a gene, such as a gene listed in Tables 1, 2, 3 or 4, can be used to detect one or more antibodies, such as autoantibodies, from a sample from a subject.
  • the polypeptide probe comprises a polypeptide sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, or a fragment thereof.
  • the polypeptide probe comprises a polypeptide sequence encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, or a fragment thereof.
  • the polypeptide probe comprises the full-length or a fragment of a protein that is encoded by SEQ ID NO: 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,102, 103, 104, 105, 106, 107, 108, 109, 110, 111, or a fragment thereof.
  • a polypeptide probe is a fragment of a protein encoded by CEP 164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, or Deaminase Domain, or may be a polypeptide encoded by a UTR sequence of the gene, such as the 5′ or 3′ UTR sequence of CEP164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, or Deaminase Domain.
  • a polypeptide probe can be a fragment of a protein encoded by FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789.
  • a polypeptide probe comprises a peptide sequence, or fragment thereof, such as those listed in Tables 1, 2, 3, and 4.
  • the polypeptide probe can comprise SEQ ID NO: 2, 5, 9, 11, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or a fragment thereof, or a fragment thereof.
  • the polypeptide probe comprises a polypeptide encoded by SEQ ID NO: 16, 19, 23, 25, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or a fragment thereof.
  • a polypeptide probe is a fragment of a protein encoded by DCHS1, CEP164, KBTBD6, RPS 19, RPL34, RNA binding protein 6, or Hemk1, or may be a polypeptide encoded by a UTR sequence of the gene, such as the 5′ or 3′ UTR sequence of DCHS1, CEP164, KBTBD6, RPS19, RPL34, RNA binding protein 6, or Hemk1.
  • a polypeptide probe can be a fragment of a protein encoded by eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789.
  • a polypeptide probe comprises a peptide sequence, or fragment thereof, such as those listed in Tables 1 and 2.
  • the polypeptide probe can comprise SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14, or a fragment thereof.
  • the polypeptide probe comprises a polypeptide encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or a fragment thereof.
  • a panel as provided herein can be used to analyze one or more antibodies to a plurality of polypeptide probes, such as one or more autoantibodies.
  • a panel allows for the simultaneous analysis of multiple antibodies, such as autoantibodies, to a plurality of polypeptide probes correlating with carcinogenesis and/or metastasis.
  • a panel can include markers identified as correlating with cancerous tissue, metastatic cancer, localized cancer that is likely to metastasize, pre-cancerous tissue that is likely to become cancerous, and pre-cancerous tissue that is not likely to become cancerous.
  • panels may be analyzed alone or in combination in order to provide the best possible diagnosis and/or prognosis.
  • an antibody profiling panel can comprise a plurality of polypeptide probes, wherein one or more of the probes is capable of binding an antibody.
  • an antibody profiling panel can comprise a plurality of probes, wherein one or more of the probes is capable of binding an antibody that targets a foreign antigen.
  • an antibody profiling panel can comprise a plurality of probes, wherein each of the probes is capable of binding an autoantibody.
  • an antibody profiling panel comprises 2-100 probes, 50-200 probes, 100-500 probes 200-750 probes, 200-1000 probes, 2-5,000 probes or 2-10,000 probes.
  • an antibody profiling panel comprises at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 polypeptide probes.
  • an antibody profiling panel comprises at least about 50, 100, 150, 200, 250, 500, 750, 1000, 5000, 10,000, 15,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000, 75,000, or 100,000 polypeptide probes.
  • the probes are polypeptide probes.
  • the probes are molecules that mimic an epitope bound by a particular antibody.
  • An antibody profiling panel can comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 polypeptide probes, wherein the polypeptide probes are a fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, such as genes listed in Tables 1, 2, 3, or 4.
  • the polypeptide probe comprises a polypeptide sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, or a fragment thereof.
  • the polypeptide probe comprises a polypeptide sequence encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, or a fragment thereof.
  • the polypeptide probe comprises the full-length or a fragment of a protein that is encoded by SEQ ID NO: 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,102, 103, 104, 105, 106, 107, 108, 109, 110, 111, or a fragment thereof.
  • an antibody profiling panel comprises a plurality of polypeptide probes, wherein at least a subset of the polypeptide probes is a fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is CEP164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, or Deaminase Domain.
  • the polypeptide probe can comprise a fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789.
  • an antibody profiling panel comprises a plurality of polypeptide probes, wherein at least a subset of the polypeptide probes is a fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is DCHS1, CEP164, KBTBD6, RPS19, RPL34, RNA binding protein 6, or Hemk1.
  • the polypeptide probe can comprise a fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789.
  • an antibody profiling panel comprises a plurality of polypeptide probes, wherein at least a subset of the polypeptide probes is a peptide sequence, or fragment thereof, as listed in Tables 1, 2, 3, or 4.
  • an antibody profiling panel comprises a plurality of polypeptide probes, wherein at least a subset of the polypeptide probes comprises a polypeptide sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, or a fragment thereof.
  • an antibody profiling panel comprises a plurality of polypeptide probes, wherein at least a subset of the polypeptide probes comprises a polypeptide sequence encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, or a fragment thereof.
  • the polypeptide probe comprises the full-length or a fragment of a protein that is encoded by SEQ ID NO: 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,102, 103, 104, 105, 106, 107, 108, 109, 110, 111, or a fragment thereof.
  • an antibody profiling panel comprises a plurality of polypeptide probes, wherein at least a subset of the polypeptide probes comprises SEQ ID NO: 2, 5, 9, 11, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or a fragment thereof, or a fragment thereof.
  • an antibody profiling panel comprises a plurality of polypeptide probes, wherein at least a subset of the polypeptide probes is encoded by SEQ ID NO: 16, 19, 23, 25, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or a fragment thereof.
  • an antibody profiling panel comprises a plurality of polypeptide probes, wherein at least a subset of the polypeptide probes comprises SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14, or a fragment thereof.
  • an antibody profiling panel comprises a plurality of polypeptide probes, wherein at least a subset of the polypeptide probes is encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or a fragment thereof.
  • an antibody profiling panel can also comprise one or more polypeptide probes of the protein PSA, or fragment of PSA, in combination with one or more of the polypeptide probes discussed herein.
  • an antibody profiling panel can comprise polypeptide probes including a full-length protein or fragment of PSA and one or more polypeptide probes comprising SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, or a fragment thereof.
  • an antibody profiling panel can comprise polypeptide probes including a full-length protein or fragment of PSA and one or more polypeptide probes comprising a polypeptide sequence encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, or a fragment thereof.
  • the polypeptide probe comprises the full-length or a fragment of a protein that is encoded by SEQ ID NO: 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,102, 103, 104, 105, 106, 107, 108, 109, 110, 111, or a fragment thereof.
  • an antibody profiling panel can comprise polypeptide probes including a full-length protein or fragment of PSA and a full-length protein encoded by a gene, fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is CEP164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, or Deaminase Domain.
  • an antibody profiling panel can comprise a plurality of polypeptide probes, wherein the probes include a full-length protein or fragment of PSA and a full-length protein encoded by a gene, fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789.
  • an antibody profiling panel can comprise polypeptide probes including a full-length protein or fragment of PSA and a full-length protein encoded by a gene, fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is DCHS1, CEP164, KBTBD6, RPS19, RPL34, RNA binding protein 6, or Hemk1.
  • an antibody profiling panel can comprise a plurality of polypeptide probes, wherein the probes include a full-length protein or fragment of PSA and a full-length protein encoded by a gene, fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789.
  • an autoantibody profiling panel can comprise a plurality of polypeptide probes, wherein the probes includes a full-length protein or fragment of PSA and one or probes comprising a peptide sequence, or fragment thereof, as listed in Tables 1, 2, 3 and 4.
  • an autoantibody profiling panel can comprise a plurality of polypeptide probes, wherein the probes includes a full-length protein or fragment of PSA and one or more probes comprising SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, or a fragment thereof.
  • an autoantibody profiling panel can comprise a plurality of polypeptide probes, wherein the probes includes a full-length protein or fragment of PSA and one or more probes comprising a polypeptide sequence encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, or a fragment thereof.
  • an autoantibody profiling panel can comprise a plurality of polypeptide probes, wherein the probes includes a full-length protein or fragment of PSA and one or more probes comprising the full-length or a fragment of a protein that is encoded by SEQ ID NO: 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,102, 103, 104, 105, 106, 107, 108, 109, 110, 111, or a fragment thereof.
  • an autoantibody profiling panel can comprise a plurality of polypeptide probes, wherein the probes includes a full-length protein or fragment of PSA and one or more probes comprising SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or a fragment thereof.
  • an autoantibody profiling panel can comprise a plurality of polypeptide probes, wherein the probes includes a full-length protein or fragment of PSA and one or more probes comprising SEQ ID NO: 2, 5, 9, 11, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or a fragment thereof, or a fragment thereof; or a polypeptide sequence encoded by a sequence selected from SEQ ID NOs. 16, 19, 23, 25, 28, 70, 71, 72, 73, 74, 75,76, 77, 78, 79, 80, 81, 82, 83, 84, or a fragment thereof.
  • a PSA polypeptide probe can be combined with any two or more of the polypeptide probes described herein, such as a polypeptide probe derived from a protein encoded by a gene, fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is CEP164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, Deaminase Domain, FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789.
  • a polypeptide probe derived from a protein encoded by a gene fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a
  • a PSA polypeptide probe can be combined with any two or more of the polypeptide probes described herein, such as a polypeptide probe derived from a protein encoded by a gene, fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is DCHS1, CEP164, KBTBD6, RPS19, RPL34, RNA binding protein 6, Hemk1, eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789.
  • a PSA polypeptide probe can be combined with at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 of polypeptide probes disclosed herein, such as listed in Tables 1, 2, 3, and 4.
  • a polypeptide probe comprises SEQ ID NO: 2, 5, 9, 11, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or a fragment thereof, or a fragment thereof.
  • a polypeptide probe comprises SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14, or a fragment thereof.
  • a polypeptide probe comprises SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, or a fragment thereof.
  • a polypeptide probe comprises a polypeptide encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or a fragment thereof.
  • a polypeptide probe comprises a polypeptide encoded by SEQ ID NO: 16, 19, 23, 25, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or a fragment thereof.
  • a polypeptide probe comprises a polypeptide encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, or a fragment thereof.
  • a polypeptide probe disclosed herein is attached to a substrate (e.g., glass slide chip or nanowell chip).
  • a polypeptide probe can be directly or indirectly attached to the substrate.
  • a polypeptide probe is attached to a substrate via a phage.
  • the substrate can be any physically separable solid to which a polypeptide probe can be directly or indirectly attached including, but not limited to, surfaces provided by microarrays and wells, particles such as beads, columns, optical fibers, wipes, glass and modified or functionalized glass, quartz, mica, diazotized membranes (paper or nylon), polyformaldehyde, cellulose, cellulose acetate, paper, ceramics, metals, metalloids, semiconductive materials, quantum dots, coated beads or particles, other chromatographic materials, magnetic particles; plastics (including acrylics, polystyrene, copolymers of styrene or other materials, polypropylene, polyethylene, polybutylene, polyurethanes, TEFLONTM, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, ceramics, conducting polymers (including polymers such as polypyrole and polyindole); micro
  • the polypeptide probe can bound to a planar surface or to a particle, such as a bead or microsphere.
  • the polypeptide probe is attached to a bead.
  • the bead can be a polystyrene, brominated polystyrene, polyacrylic acid, polyacrylonitrile, polyacrylamide, polyacrolein, polydimethylsiloxane, polybutadiene, polyisoprene, polyurethane, polyvinyl acetate, polyvinylchloride, polyvinylpyridine, polyvinylbenzylchloride, polyvinyltoluene, polyvinylidene chloride, polydivinylbenzene, polyglycidylmethacrylate, polymethylmethacrylate, or copolymers, blends, composites, or combination thereof.
  • the bead can have a diameter of between about 1 nm-1000 ⁇ m, 1 nm-500 ⁇ m, 5 nm-500 ⁇ m, or 10 nm-100 ⁇ m. In one embodiment, the bead has a diameter of between about 10 nm and 100 ⁇ m. In yet another embodiment, the bead has a diameter of less than about 1000 ⁇ m, 500 ⁇ m, 400 ⁇ m, 300 ⁇ m, 200 ⁇ m, or 100 ⁇ m.
  • the bead is labeled or stained with more than one dye, such as at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 different dyes.
  • the bead is labeled or stained with two dyes.
  • the two dyes are hydrophobic.
  • the two dyes are fluorescent dyes, such as squaric acid-based dyes.
  • the squaric acid-based dyes are selected from cyclobutenedione derivatives, symmetrical and unsymmetrical squaraines, substituted cephalosporin compounds, fluorinated squaraine compositions, alkylalkoxy squaraines, or squarylium compounds.
  • the squaric acid-based dyes are selected from a red fluorescent dye and an orange fluorescent dye, such as the red fluorescent dye comprising 1,3-bis(1,3-dihydro-1,3,3-trimethyl-2H-indol-2-ylidene)methyl]-2,4-dihydro xycyclobutenediylium, bis(inner salt) and the orange fluorescent dye comprising 2-(3,5-dimethylpyrrol-2-yl)-4-(3,5-dimethyl-2H-pyrrol-2-ylidene)-3-hydroxy-2-cyclobuten-1-one.
  • the red fluorescent dye comprising 1,3-bis(1,3-dihydro-1,3,3-trimethyl-2H-indol-2-ylidene)methyl]-2,4-dihydro xycyclobutenediylium, bis(inner salt)
  • the orange fluorescent dye comprising 2-(3,5-dimethylpyrrol-2-yl)-4-(3,5-dimethyl-2H-pyr
  • the substrate is coated using passive or chemically-derivatized coatings with any number of materials, including polymers, such as dextrans, acrylamides, gelatins or agarose. Such coatings can facilitate the use of the array with a biological sample.
  • a presence of an immune response to a specific protein expressed in cancerous cells can be indicative of a presence of cancer.
  • the present invention provides a method (e.g., diagnostic or screening method) for detecting a presence of an antibody, such as an autoantibody, to a tumor or tumor-associated antigen.
  • an antibody such as an autoantibody
  • the presence of an antibody in cancerous but not cancerous cells is indicative of the presence of cancer.
  • the antibody is an antibody to a tumor antigen.
  • a method or composition disclosed herein can find utility in the diagnosis, screening, or characterization of a cancer.
  • a presence of an antibody, such as an autoantibody, to a specific protein can be indicative of a cancer.
  • detection of an antibody in a sample, such as an autoantibody can be indicative of a specific stage or sub-type of the same cancer.
  • the information obtained by detecting an antibody as described herein can be used to determine a prognosis or theranosis, wherein an appropriate course of treatment can be determined.
  • a subject with a specific antibody or stage of cancer can respond differently to a given treatment than individuals lacking the antibody. The information obtained from a method disclosed herein can thus provide for the personalization of diagnosis and treatment.
  • a cancer is characterized by detecting the level or presence or absence of an antibody, such as an autoantibody, in a sample.
  • the cancer can be, but is not limited to, breast cancer, ovarian cancer, lung cancer, colon cancer, hyperplastic polyp, adenoma, colorectal cancer, high grade dysplasia, low grade dysplasia, prostatic hyperplasia, prostate cancer, melanoma, pancreatic cancer, brain cancer (such as a glioblastoma), hematological malignancy, hepatocellular carcinoma, cervical cancer, endometrial cancer, head and neck cancer, esophageal cancer, gastrointestinal stromal tumor (GIST), renal cell carcinoma (RCC) or gastric cancer.
  • GIST gastrointestinal stromal tumor
  • RRCC renal cell carcinoma
  • the colorectal cancer can be CRC Dukes B or Dukes C-D.
  • the hematological malignancy can be B-Cell Chronic Lymphocytic Leukemia, B-Cell Lymphoma-DLBCL, B-Cell Lymphoma-DLBCL-germinal center-like, B-Cell Lymphoma-DLBCL-activated B-cell-like, and Burkitt's lymphoma.
  • the cancer can also be a premalignant condition, such as Barrett's Esophagus.
  • a method for screening or characterizing a prostate cancer can comprise detecting in a sample obtained from a subject a presence and/or level of one or more autoantibodies to one or more polypeptide probes comprising a polypeptide probe is a fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is CEP164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, Deaminase Domain, FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789.
  • a polypeptide probe can also comprise a polypeptide sequence, or a fragment thereof, selected from Table 1, 2, 3 and 4, such as a polypeptide probe comprising polypeptide probe comprises SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14, or a fragment thereof, or a polypeptide probe comprising a polypeptide encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or a fragment thereof.
  • a polypeptide probe can also comprise SEQ ID NO: 12, 5, 9, 11, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or a fragment thereof, or a fragment thereof, or a polypeptide encoded by SEQ ID NO: 16, 19, 23, 25, 28, 70, 71, 72, 73, 74, 75,76, 77, 78, 79, 80, 81, 82, 83, 84, or a fragment thereof.
  • the method can comprise detecting in a sample obtained from a subject a presence and/or level of one or more autoantibodies to one or more polypeptide probes comprising a polypeptide probe is a fragment of a protein encoded by a gene, or a fragment encoded by a sequence of a UTR region of a gene, wherein the gene is DCHS1, CEP164, KBTBD6, RPS19, RPL34, SFRS14, RNA binding protein 6, Hemk1, eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789.
  • a polypeptide probe can also comprise a polypeptide sequence, or a fragment thereof, selected from Table 1 or Table 2, such as a polypeptide probe comprising SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14, or a fragment thereof, or a polypeptide probe encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or a fragment thereof.
  • the method can comprise detecting in a sample obtained from a subject a presence and/or level of one or more autoantibodies to one or more polypeptide probes comprising SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, or a fragment thereof., or a fragment thereof; or polypeptide probe encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80
  • a cancer (or absence of cancer) can be characterized.
  • a presence or level of DCHS1, CEP164 and/or RPS19 autoantibodies is detected, indicating a presence of prostate cancer in the subject.
  • a method further comprises detecting a presence or level of one or more autoantibodies to one or more polypeptide probe comprising a fragment of eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789.
  • the fragment of a protein encoded by eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789 can comprise a polypeptide sequence selected from Table 2.
  • a method disclosed herein can comprise detecting a plurality of antibodies, such as through the detection of binding of one or more antibodies that bind to a plurality of polypeptide probes.
  • the antibodies are autoantibodies.
  • the antibodies are antibodies to foreign antigens.
  • the method comprises detecting in a sample one or more antibodies that binds to a panel of polypeptide probes, wherein the panel comprises 2-100 probes, 50-200 probes, 100-500 probes 200-750 probes, 200-1000 probes, 2-5,000 probes or 2-10,000 probes.
  • the panel of polypeptide probes comprises at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 polypeptide probes.
  • the panel comprises at least about 50, 100, 150, 200, 250, 500, 750, 1000, 5000, 10,000, 15,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000, 75,000, or 100,000 polypeptide probes.
  • the panels comprises a plurality of polypeptide probes, wherein a subset of the probes comprise fragments of the same full-length protein, such that autoantibodies to different epitopes bind to the different probes and indicate a presence of an immune response, or antibody, to the full-length protein.
  • a panel comprising multiple polypeptide probes allow for the simultaneous analysis of multiple markers correlating with carcinogenesis and/or metastasis.
  • a panel includes markers identified as correlating with cancerous tissue, metastatic cancer, localized cancer that is likely to metastasize, pre-cancerous tissue that is likely to become cancerous, pre-cancerous tissue that is not likely to become cancerous, or any combination thereof.
  • a panel can be analyzed alone or in combination in order to provide a diagnosis, prognosis, or theranosis.
  • One or more markers for inclusion on a panel can be selected by screening for their diagnostic, prognostic, or theranostic value.
  • any of the proteins listed in Tables 1, 2, 3 or 4, or proteins encoded by the genes listed in Tables 1, 2, 3 or 4, in any combination, can be utilized to detect a presence of an antibody, such as an autoantibody, in a subject.
  • the protein is encoded SEQ ID NO: 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,102, 103, 104, 105, 106, 107, 108, 109, 110, 111, or a fragment thereof.
  • any combination of two or more proteins (e.g., cancer markers) or fragments thereof is used to detect one or more autoantibodies (e.g., a panel consisting of one or more full-length or fragments of the polypeptides listed in Tables 1, 2, 3, and/or 4).
  • one or more autoantibodies e.g., a panel consisting of one or more full-length or fragments of the polypeptides listed in Tables 1, 2, 3, and/or 4).
  • any combination of two or more proteins (e.g., cancer markers) or fragments thereof is used to detect one or more autoantibodies (e.g., a panel consisting of one or more full-length or fragments of the polypeptides listed in Tables 1 and 2).
  • the method comprises detecting one or more antibodies that bind to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 polypeptide probes, wherein the polypeptide probes are full-length or fragments of proteins encoded by the genes listed in Tables 1, 2, 3, and/or 4, or polypeptides encoded by the UTR sequence of the gene.
  • the antibody profiling panel comprises a plurality of polypeptide probes, wherein one or more polypeptide probes is a protein or fragment of a protein encoded by CEP 164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, Deaminase Domain, FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789, or any combination thereof.
  • the antibody profiling panel comprises a plurality of polypeptide probes, wherein one or more polypeptide probes is a protein or fragment of a protein encoded by DCHS1, CEP164, KBTBD6, RPS19, RPL34, RNA binding protein 6, Hemk1, eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, LOC388789, or any combination thereof.
  • the cancer can be characterized with increased accuracy, such as with increased specificity, sensitivity, or both.
  • the sensitivity can be determined by: (number of true positives)/(number of true positives+number of false negatives), whereas the specificity can be determined by: (number of true negatives)/(number of true negatives+number of false positives).
  • the cancer can be characterized (e.g., detected, prognosed, etc.) with at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55,60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sensitivity.
  • the cancer can be characterized (e.g., detected, prognosed, etc.) with at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55,60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% specificity.
  • Specificity or sensitivity of detection can be altered by altering the polypeptide probe make-up of a panel.
  • sensitivity of a diagnostic, prognostic, or theranosstic assay e.g., an antibody detection assay, such as an autoantibody detection assay
  • an antibody detection assay such as an autoantibody detection assay
  • tailoring the probes to a particular subject or cancer to be diagnosed/prognosed can be increased by increasing the number of probes, increasing the diversity of probes (e.g, utilizing probes comprising distinct epitopes from the same and/or different markers), or tailoring the probes to a particular subject or cancer to be diagnosed/prognosed.
  • the confidence level for determining the specificity, sensitivity, or both may be with at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55,60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% confidence.
  • a method and system disclosed herein can also comprise detecting a plurality of antibodies, such as through the detection of antibodies binding to a plurality of polypeptide probes, and characterizing or screening for a cancer with increased or greater specificity as compared to a characterization based on detection of antibodies that bind to less than the plurality of polypeptide probes.
  • the antibodies are autoantibodies.
  • the antibodies are to foreign antigens.
  • Two or more polypeptide probes can be used to diagnose a particular cancer.
  • a cancer can be diagnosed by measuring the binding of autoantibodies to two polypeptide probe.
  • the number of polypeptide useful for diagnosing a cancer includes, but is not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20 polypeptide probes.
  • prostate cancer is diagnosed with 5 or more polypeptide probes.
  • prostate cancer is diagnosed with 5 polypeptide probes, which provides a diagnosis that has a higher sensitivity as compared to using less than the 5 polypeptide probes.
  • prostate cancer is diagnosed with 10 or more polypeptide probes.
  • a prostate cancer is diagnosed with 10 polypeptide probes, which provides a diagnosis that has a higher specificity as compared to using less than the 10 polypeptide probes.
  • the level, presence or absence of an antibody can be determined by detecting the binding of one or more autoantibodies to a polypeptide probe. Detection of an antibody can be either quantitative or qualitative. For quantitative assays, the amount of antibody detected can be compared to a control or reference to determine whether an antibody is overexpressed or underexpressed in a sample.
  • the control or reference can be a normal sample or a sample from a known disease state, such as a cancer sample.
  • Antibody binding to a polypeptide probe can be detected by techniques known in the art, such as, but not limited to, radioimmunoassay, ELISA (enzyme-linked immunosorbant assay), “sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays (e.g., using colloidal gold, enzyme or radioisotope labels, for example), Western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays, etc.), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays. Any of the assays used can be quantitative or qualitative, as desired.
  • Detection of an antibody bound to a polypeptide probe can be detected using labeling technology.
  • one or more antibodies in a sample collected from a subject to be tested can be directly labeled (e.g., with a fluorescent or radioactive label) and exposed to a polypeptide probe or probe panel.
  • Detection of a signal from the interaction can be achieved using methodology appropriate to the type of label used (e.g., fluorescent microscopy can be used to detect binding of a fluorescently labeled autoantibody to a polypeptide probe).
  • an autoantibody is detected by detecting binding of a labeled secondary antibody or other antibody-binding reagent which specifically binds to the antibody bound to the polypeptide probe (e.g., a “sandwich immunoassay”).
  • a labeled secondary antibody or other antibody-binding reagent which specifically binds to the antibody bound to the polypeptide probe.
  • Many methods are known in the art for detecting binding in an immunoassay and are within the scope of the present invention.
  • the immunoassay described in U.S. Pat. Nos. 5,599,677, 5,672,480, or both, each of which is herein incorporated by reference, is used.
  • automation is utilized to detect binding of one or more autoantibodies to a polypeptide probe or probe panels.
  • Methods for the automation of immunoassays include those described in U.S. Pat. Nos. 5,885,530, 4,981,785, 6,159,750, and 5,358,691, each of which is herein incorporated by reference. Analysis and/or presentation of results can also be automated.
  • a computer with software that analyzes raw data and generates a prognosis, diagnosis, or theranosis based on the level, presence or absence of antibody binding to one or more polypeptide probes is used.
  • a computer-based analysis program can be used to translate the raw data generated by the detection assay (e.g., a presence, absence, or amount of antibody binding to one or more polypeptide probes) into data of predictive value for a clinician.
  • the clinician can access the predictive data using any suitable means.
  • the data is transmitted over a network.
  • the data is accessible by a clinician.
  • a sample e.g., a biopsy or a serum or urine sample
  • a profiling service e.g., clinical lab at a medical facility, genomic profiling business, etc.
  • the sample comprises a tissue or other biological sample and the subject visits a medical center to have the sample obtained and sent to the profiling center.
  • a subject collects the sample themself (e.g., a buccal swab) and directly sends it to a profiling center.
  • the sample comprises previously determined biological information.
  • the information can be directly sent to the profiling service by the subject (e.g., an information card containing the information may be scanned by a computer and the data transmitted to a computer of the profiling center using an electronic communication system).
  • a sample Upon being received by the profiling service, a sample can be processed and a profile produced (i.e., antibody level, presence or absence of antibody).
  • a profile generated can be specific for the diagnostic, prognostic, or theranostic information desired for a subject.
  • a sample from a subject is analyzed for a presence or expression level of one or more antibodies to one or more proteins encoded by a gene, fragment of one or more proteins encoded by a gene, or fragment encoded by aUTR region of a gene, wherein the gene is CEP 164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, Deaminase Domain, FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789.
  • the antibodies are autoantibodies.
  • a sample from a subject is analyzed for a presence or expression level of one or more antibodies to one or more proteins encoded by a gene, fragment of one or more proteins encoded by a gene, or fragment encoded by aUTR region of a gene, wherein the gene is DCHS1, CEP164, KBTBD6, RPS19, RPL34, RNA binding protein 6, Hemk1, eIF4G1, BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789.
  • the antibodies are autoantibodies.
  • Profile data can be prepared in a format suitable for interpretation by a treating clinician.
  • the prepared format represents a diagnosis, screening or risk assessment (e.g., likelihood of metastasis or PSA failure or the development of high prostate specific antigen levels in a patient following prostate cancer therapy (e.g., surgery)) for the subject, along with recommendations for particular treatment options.
  • the data can be displayed to the clinician by any suitable method.
  • the profiling service generates a report that is printed for the clinician (e.g., at the point of care). In another embodiment, the report is displayed to the clinician on a computer monitor.
  • the information is first analyzed at the point of care or at a regional facility.
  • the raw data is then sent to a central processing facility for further analysis.
  • further analysis comprises converting the raw data to information useful for a clinician or subject, such as a patient.
  • the central processing facility can provide the advantage of privacy (all data is stored in a central facility with uniform security protocols), speed, and uniformity of data analysis.
  • the central processing facility can also control the fate of the data following treatment of a subject.
  • using an electronic communication system the central facility provides data to the clinician, the subject, researchers, or any other individual.
  • a subject is able to directly access the data using the electronic communication system.
  • a subject chooses further intervention or counseling based on the result.
  • the data is used for research use.
  • the data can be used to further optimize the inclusion or elimination of markers as useful indicators of a particular condition or stage of disease.
  • the detection of one or more antibodies from a sample can be used in conjunction with one or more other tests used for detecting or screening for cancer.
  • the antibody detection can be used prior to, concurrent with, or subsequent to one or more other tests.
  • a genetic test for a mutation or expression level of one or more genes can be used in conjunction with determining the antibody profile of a subject.
  • Antibody detection can provide a non-invasive, inexpensive means for detecting or screening for a cancer.
  • the detection of a level, presence or absence of one or more antibodies can be used to determine whether a second sample or additional analysis of a sample from a subject is to be performed.
  • a biopsy after detecting an expression level of one or more antibodies of sample obtained from subject to one or more polypeptide probes comprising a fragment of a protein encoded by, or a polypeptide encoded by a UTR sequence of, CEP164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, Deaminase Domain, FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789, a biopsy can be recommended for the subject.
  • a biopsy after detecting an expression level of one or more antibodies of sample obtained from subject to one or more polypeptide probes comprising a fragment of a protein encoded by, or a polypeptide encoded by a UTR sequence of, DCHS1, CEP164, KBTBD6, RPS19, RPL34, SFRS14, RNA binding protein 6, Hemk1, eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789, a biopsy can be recommended for the subject.
  • an expression level for one or more antibodies from a subject can be detected, and based on the expression level of the one or more antibodies, the subject can be identified as suspected of having cancer. In one embodiment, the subject is characterized as having a high probability or likelihood of having cancer. Based on the detection or expression level of the one or more antibodies, a recommendation that a biopsy be obtained can be made for the subject. In another embodiment, if there is a lack of detection or expression of the one or more antibodies, further analysis is not recommended and a biopsy not be obtained. (see for example, FIG. 1 , “Autoantibody Test I”)
  • the subject prior to detecting one or more antibodies from a subject, the subject is suspected of having cancer.
  • the subject can have had a genetic test for a mutation or gene expression analysis, image analysis (such as magnetic resonance imaging (MRI), positron emission tomography (PET) scan, computerized tomography (CT) scan, nuclear magnetic resonance (NMR)), or biopsy, and have inconclusive or uncertain results.
  • image analysis such as magnetic resonance imaging (MRI), positron emission tomography (PET) scan, computerized tomography (CT) scan, nuclear magnetic resonance (NMR)
  • biopsy a genetic test for a mutation or gene expression analysis
  • MRI magnetic resonance imaging
  • PET positron emission tomography
  • CT computerized tomography
  • NMR nuclear magnetic resonance
  • an antibody profiling panel described herein can be used in conjunction with a separate test which determines a presence or level of PSA (e.g., a serum PSA test).
  • the panels is utilized to diagnose or prognose a presence of a cancer (e.g., prostate cancer) in a subject.
  • a subject is suspected of having prostate cancer based on their PSA level, age, or both.
  • a subject can be male and over 30, 35, 40, 45, 50, 55, 60, 65, 70 or 75 years of age.
  • the subject is between 30-80 , 40-75, 45-75, or 50-75 years of age.
  • the subject had a PSA blood test, digital rectal exam, or both.
  • the subject may have a PSA level of at least about 1.0, 1.5, 2.0, 2.5, or 4.0 ng/ml.
  • the subject can have a PSA level of between about 1.0-15 ng/ml, 2.0-15 ng/ml, or 2.5-10 ng/ml.
  • a biological sample from a subject such as a subject with a PSA level greater than about 2.5 ng/ml
  • one or more probes for an antibody such as one or more probes for an autoantibody.
  • a biopsy for the subject can be recommended (see for example FIG. 1 , “Autoantibody Test I”).
  • the antibody test can comprise detecting one or more antibodies in a sample that bind to a polypeptide probe as described herein.
  • the antibody test is an autoantibody test.
  • the antibody binds a polypeptide probe comprising SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, or a fragment thereof.
  • the antibody binds a polypeptide probe comprising a polypeptide sequence encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, or a fragment thereof.
  • the antibody binds a polypeptide probe comprising full-length or a fragment of a protein that is encoded by SEQ ID NO: 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101,102, 103, 104, 105, 106, 107, 108, 109, 110, 111, or a fragment thereof.
  • the antibody binds a polypeptide probe comprising a full-length or fragment of a protein encoded by, or a polypeptide encoded by a CEP164, RPL34, BRMSL1, NKX3-1, RPSA, Cytochrome C oxidase 5 Subunit, UTR-region of chromosome 11, MAPKKK9, cDNA clone XR — 113641.1, PSA, H2aa4, UBE2I, TIMP2, WDR77, Deaminase Domain, FAM53B, 5′UTR BMI1, RP3-323M22, or LOC388789.
  • a polypeptide probe comprises SEQ ID NO: 2, 5, 9, 11, 14, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or a fragment thereof, or a fragment thereof.
  • a polypeptide probe comprises a polypeptide encoded by SEQ ID NO: 16, 19, 23, 25, 28, 70, 71, 72, 73, 74, 75,76, 77, 78, 79, 80, 81, 82, 83, 84, or a fragment thereof.
  • the antibody binds a polypeptide probe comprising a full-length or fragment of a protein encoded by, or a polypeptide encoded by a UTR of, DCHS 1, CEP 164, KBTBD6, RPS 19, RPL34, RNA binding protein 6, Hemk1, eIF4G1, 5′UTR BMI1, BRD2, RP3-323M22, SFRS14, or LOC388789.
  • a polypeptide probe comprises SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or a fragment thereof.
  • a polypeptide probe comprises a polypeptide encoded by SEQ ID NO: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or a fragment thereof.
  • a biological sample obtained from the subject can be contacted with one or more probes for an antibody, which can be the same or different, as those used in deciding whether to obtain a biopsy. Based on the expression level of antibodies in the sample, a prognosis for the cancer can be provided. (see for example, FIG. 1 , “Autoantibody Test II”)
  • a method of characterizing or screening for a cancer from a subject with a positive biopsy result is provided.
  • the subject has not yet provided a sample for detecting one or more antibodies.
  • the subject has provided an initial sample for detecting one or more antibodies and detection of the one or more antibodies is used in deciding whether a biopsy is obtained.
  • detection of one or more antibodies is used for a diagnosis, prognosis or theranosis of a cancer, such as prostate cancer.
  • the method comprises detecting an expression level for one or more antibodies, wherein the expression level of the one or more antibodies is indicative of the presence, absence, or stage of the cancer.
  • the indication is whether the cancer is aggressive or indolent.
  • a cancer is classified based on the detection of one or more antibodies to one or more polypeptide probes disclosed herein. In one embodiment, the cancer is classified as aggressive or malignant. In another embodiment, the cancer is classified as indolent or benign. Furthermore, after classification, detection of one or more antibodies from a sample from the subject can be used to select a treatment or therapeutic for the cancer.
  • RNA was isolated from total RNA following Novogen's Straight A's mRNA isolation protocol. OrientExpression cDNA synthesis and cloning system were used for the construction of T7 phage prostate cancer cDNA libraries.
  • Protein A/G agarose beads (Pierce Biotechnology, Rockford, Ill.) were used to purify IgGs from the serum of prostate cancer patients. To enhance the selection of epitopes binding to IgGs specifically associated with prostate cancer, a dual procedure was performed.
  • a pre-clearing step was used to remove nonspecific clones by pre-absorbing the phage epitope libraries onto purified IgGs from normal serum pool from 10 control men.
  • the pre-cleared phage libraries were selected onto the pool of IgGs purified from the serum of 6 localized prostate cancer patients.
  • protein-A/G agarose beads provide a purification of the serum of IgGs. Fifty ⁇ l protein-A/G agarose beads were placed into 1.5 ml eppendorf tube and washed two times with 1 ⁇ PBS. Washed beads were blocked with 4% nonfat milk at 4° C. for 1 hr. The beads were then incubated at 4° C.
  • Fifty ⁇ l fresh protein-A/G agarose beads were washed and blocked as same as above. The beads were then incubated at 4° C. for 3 hrs with 500 ml of PBS containing 15 ml patient sera pool at a 1:30 dilution. This amount of serum provides a three-fold molar excess of IgG to calculated number of protein-A/G binding capacity.
  • the beads were washed three times with 1 ⁇ PBS and then incubated with phage library supernatant from above allowed to react with the antibodies on the beads at 4° C. overnight. The mixture was centrifuged at 3000 rpm for 2 min and supernatant was discarded. The beads were then washed three times with 1 ⁇ PBS.
  • Random phage colonies were picked up and amplified in 96-well plates. Fresh phage lysates were spotted onto on FASTTM nitrocellulose coated glass slides (Schleicher & Schuell, Keene, N.H.). Extra T7 empty phage spots were spotted in quadruplicate as negative reference for normalizing the signal value from different slides.
  • the arrays were dried overnight at room temperature. Before processing with serum, the arrays were rinsed briefly in a 4% nonfat milk/PBS with 0.1% tween-20 to remove unbound phage, then transferred immediately to 4% nonfat milk/PBS as a blocking solution for 1 hr at room temperature. Without allowing the array to dry, 2 ml of PBS containing human serum and T7-tag antibody (Novagen) at a dilution of 1:500 and 1:5000 respectively was applied to the surface in a screw-top slide hybridization tube.
  • the arrays were incubated at room temperature for 1 hour, and then washed gently three times in PBS/0.1% Tween-20 solution 10 min each. All washes were performed at room temperature. After washing, the arrays were incubated with 2 ml of PBS containing Cy3-labeled goat anti-mouse antibody and Cy5-labeled goat anti-human antibody (Jackson ImmunoResearch) at a dilution of 1:5,000 for both for 1 hr in the dark. Three washes were performed using PBS/0.1% Tween-20 solution with 10 min each. The arrays were then dried using a stream of compressed air and scanned using 532 nm and 635 nm lasers (Axon Laboratories).
  • the arrays were quantified using GenePix software (Axon Laboratories). Raw ratios of each array were subtracted by median of ratios of the negative control spots with the observation that the signal for negative T7 empty phage on each chip correlates very well with the signal intensity for whole array. Then Z-transformation was applied to clones so that the mean of each clone is zero across arrays and the standard deviation is 1. Due to the fact a presence of antibodies specific to cancer was tested, epitopes with high reactivity in controls and low reactivity in patients were not expected. A GA/KNN algorithm, a machine learning language, was employed to calibrate the system. Briefly, the data set was randomly separated into a training set and a test set.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • Oncology (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Hospice & Palliative Care (AREA)
  • General Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Peptides Or Proteins (AREA)
US13/050,544 2010-03-17 2011-03-17 Using phage epitopes to profile the immune response Abandoned US20110237461A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US13/050,544 US20110237461A1 (en) 2010-03-17 2011-03-17 Using phage epitopes to profile the immune response
US14/822,045 US9658231B2 (en) 2010-03-17 2015-08-10 Using phage epitopes to profile the immune response
US15/933,574 US11307203B2 (en) 2010-03-17 2018-03-23 Using phage epitopes to profile the immune response

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US31475010P 2010-03-17 2010-03-17
US13/050,544 US20110237461A1 (en) 2010-03-17 2011-03-17 Using phage epitopes to profile the immune response

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/822,045 Continuation US9658231B2 (en) 2010-03-17 2015-08-10 Using phage epitopes to profile the immune response
US15/933,574 Continuation US11307203B2 (en) 2010-03-17 2018-03-23 Using phage epitopes to profile the immune response

Publications (1)

Publication Number Publication Date
US20110237461A1 true US20110237461A1 (en) 2011-09-29

Family

ID=44649827

Family Applications (3)

Application Number Title Priority Date Filing Date
US13/050,544 Abandoned US20110237461A1 (en) 2010-03-17 2011-03-17 Using phage epitopes to profile the immune response
US14/822,045 Active US9658231B2 (en) 2010-03-17 2015-08-10 Using phage epitopes to profile the immune response
US15/933,574 Active 2033-11-17 US11307203B2 (en) 2010-03-17 2018-03-23 Using phage epitopes to profile the immune response

Family Applications After (2)

Application Number Title Priority Date Filing Date
US14/822,045 Active US9658231B2 (en) 2010-03-17 2015-08-10 Using phage epitopes to profile the immune response
US15/933,574 Active 2033-11-17 US11307203B2 (en) 2010-03-17 2018-03-23 Using phage epitopes to profile the immune response

Country Status (3)

Country Link
US (3) US20110237461A1 (fr)
EP (2) EP3450979A3 (fr)
WO (1) WO2011116209A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100009382A1 (en) * 2004-06-09 2010-01-14 The Regents Of The University Of Michigan Methods and compositions for diagnosing lung cancer
US20150232931A1 (en) * 2013-09-20 2015-08-20 The Regents Of The University Of Michigan Compositions and methods for the analysis of radiosensitivity
WO2017223533A1 (fr) * 2016-06-24 2017-12-28 University Of Southern California Analogues de mentsh en tant qu'agents thérapeutiques pour le diabète, l'obésité et leurs maladies et complications associées

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104368012B (zh) * 2014-08-20 2019-03-22 中国人民解放军第三〇七医院 人rpl34基因的用途及其相关药物
US10542961B2 (en) 2015-06-15 2020-01-28 The Research Foundation For The State University Of New York System and method for infrasonic cardiac monitoring

Citations (69)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4109496A (en) * 1977-12-20 1978-08-29 Norris Industries Trapped key mechanism
US4323546A (en) * 1978-05-22 1982-04-06 Nuc Med Inc. Method and composition for cancer detection in humans
US4657760A (en) * 1979-03-20 1987-04-14 Ortho Pharmaceutical Corporation Methods and compositions using monoclonal antibody to human T cells
US4873191A (en) * 1981-06-12 1989-10-10 Ohio University Genetic transformation of zygotes
US4968103A (en) * 1988-07-22 1990-11-06 Photofinish Cosmetics Inc. Method of making a brush
US4981785A (en) * 1988-06-06 1991-01-01 Ventrex Laboratories, Inc. Apparatus and method for performing immunoassays
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5206344A (en) * 1985-06-26 1993-04-27 Cetus Oncology Corporation Interleukin-2 muteins and polymer conjugation thereof
US5223409A (en) * 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5225212A (en) * 1989-10-20 1993-07-06 Liposome Technology, Inc. Microreservoir liposome composition and method
US5283317A (en) * 1987-08-03 1994-02-01 Ddi Pharmaceuticals, Inc. Intermediates for conjugation of polypeptides with high molecular weight polyalkylene glycols
US5358691A (en) * 1992-03-27 1994-10-25 Abbott Laboratories Automated continuous and random access analytical system
US5489677A (en) * 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5539082A (en) * 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5599677A (en) * 1993-12-29 1997-02-04 Abbott Laboratories Immunoassays for prostate specific antigen
US5602240A (en) * 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5614396A (en) * 1990-06-14 1997-03-25 Baylor College Of Medicine Methods for the genetic modification of endogenous genes in animal cells by homologous recombination
US5631169A (en) * 1992-01-17 1997-05-20 Joseph R. Lakowicz Fluorescent energy transfer immunoassay
US5674486A (en) * 1991-06-25 1997-10-07 San Diego Regional Cancer Center Cancer immunotherapy with carrier cells
US5714331A (en) * 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5719262A (en) * 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5824544A (en) * 1995-03-24 1998-10-20 Genzyme Corporation Adenovirus vectors for gene therapy
US5830730A (en) * 1997-05-08 1998-11-03 The Regents Of The University Of California Enhanced adenovirus-assisted transfection composition and method
US5872154A (en) * 1995-02-24 1999-02-16 The Trustees Of The University Of Pennsylvania Method of reducing an immune response to a recombinant adenovirus
US5885530A (en) * 1996-06-28 1999-03-23 Dpc Cirrus, Inc. Automated immunoassay analyzer
US5885808A (en) * 1992-11-04 1999-03-23 Imperial Cancer Research Technology Limited Adenovirus with modified binding moiety specific for the target cells
US5904920A (en) * 1991-10-04 1999-05-18 Whitehead Institute For Biomedical Research Regulation of systemic immune responses utilizing cytokines and antigens
US5972334A (en) * 1996-05-01 1999-10-26 Genitope Corporation Vaccines for treatment of lymphoma and leukemia
US5981225A (en) * 1998-04-16 1999-11-09 Baylor College Of Medicine Gene transfer vector, recombinant adenovirus particles containing the same, method for producing the same and method of use of the same
US5994128A (en) * 1995-06-15 1999-11-30 Introgene B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US5994523A (en) * 1994-04-22 1999-11-30 The United States Of America As Represented By The Department Of Health And Human Services Melanoma antigens and their use in diagnostic and therapeutic methods
US5994069A (en) * 1996-01-24 1999-11-30 Third Wave Technologies, Inc. Detection of nucleic acids by multiple sequential invasive cleavages
US5994132A (en) * 1996-10-23 1999-11-30 University Of Michigan Adenovirus vectors
US5994106A (en) * 1994-06-10 1999-11-30 Genvec, Inc. Stocks of recombinant, replication-deficient adenovirus free of replication-competent adenovirus
US6001557A (en) * 1994-10-28 1999-12-14 The Trustees Of The University Of Pennsylvania Adenovirus and methods of use thereof
US6019978A (en) * 1995-06-05 2000-02-01 The Wistar Institute Of Anatomy And Biology Replication-defective adenovirus human type 5 recombinant as a vaccine carrier
US6051230A (en) * 1992-03-05 2000-04-18 Board Of Regents, The University Of Texas System Compositions for targeting the vasculature of solid tumors
US6080912A (en) * 1997-03-20 2000-06-27 Wisconsin Alumni Research Foundation Methods for creating transgenic animals
US6159750A (en) * 1995-12-22 2000-12-12 Abbott Laboratories Fluorescence polarization immunoassay diagnostic method
US6180357B1 (en) * 1999-10-08 2001-01-30 Arius Research, Inc. Individualized patient-specific anti-cancer antibodies
US6207147B1 (en) * 1996-10-11 2001-03-27 The Regents Of The University Of California Cancer immunotherapy using tumor cells combined with mixed lymphocytes
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20030028981A1 (en) * 1997-10-14 2003-02-13 Chandler Don J. Precision fluorescently dyed particles and methods of making and using same
US20030092009A1 (en) * 2000-11-16 2003-05-15 Kaia Palm Profiling tumor specific markers for the diagnosis and treatment of neoplastic disease
US6573361B1 (en) * 1999-12-06 2003-06-03 Monsanto Technology Llc Antifungal proteins and methods for their use
US6610508B1 (en) * 1999-03-08 2003-08-26 Anadys Pharmaceuticals, Inc. Translation driver system and methods for use thereof
US20030175736A1 (en) * 2001-08-02 2003-09-18 The Regents Of The University Of Michigan Expression profile of prostate cancer
US20030219760A1 (en) * 2001-09-05 2003-11-27 The Brigham And Women's Hospital, Inc. Diagnostic and prognostic tests
US6686147B1 (en) * 1998-07-15 2004-02-03 Ludwig Institute For Cancer Research Cancer associated antigens and uses therefor
US20040044181A1 (en) * 2001-08-31 2004-03-04 Tang Y. Tom Novel nucleic acids and polypeptides
US6783961B1 (en) * 1999-02-26 2004-08-31 Genset S.A. Expressed sequence tags and encoded human proteins
US20050032065A1 (en) * 2002-06-24 2005-02-10 Afar Daniel E. H. Methods of prognosis of prostate cancer
US20050147961A1 (en) * 2002-04-30 2005-07-07 Esser Mark T. Human papillomavirus multiplexed assay
US6943241B2 (en) * 2001-11-05 2005-09-13 Research Association For Biotechnology Full-length cDNA
US20060014138A1 (en) * 2004-06-09 2006-01-19 The Regents Of The University Of Michigan Phage microarray profiling of the humoral response to disease
US20060024692A1 (en) * 2002-09-30 2006-02-02 Oncotherapy Science, Inc. Method for diagnosing non-small cell lung cancers
US20070037143A1 (en) * 2005-06-02 2007-02-15 Digilab Biovision Gmbh Method for screening for protease modulators
US20070054353A1 (en) * 2002-09-26 2007-03-08 John White Nuclear receptor transcriptional corepressor and uses thereof
US20070082330A1 (en) * 2001-03-21 2007-04-12 Xenoport, Inc. Compounds displayed on icosahedral phage and methods of using same
US7205117B1 (en) * 1998-12-10 2007-04-17 University Of Nottingham Cancer detection method and reagents
US7214498B2 (en) * 2001-03-23 2007-05-08 Benaroya Research Institute At Virginia Mason Tumor associated antigens and methods of using the same
US20070269798A1 (en) * 2001-04-17 2007-11-22 Xenoport, Inc. Epitope-captured antibody display
US7368527B2 (en) * 1999-03-12 2008-05-06 Human Genome Sciences, Inc. HADDE71 polypeptides
US20080153113A1 (en) * 1998-05-11 2008-06-26 Robertson John F R Tumour Markers
US20080213791A1 (en) * 2005-11-08 2008-09-04 Euclid Diagnostics Llc Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer
US20080280844A1 (en) * 2007-05-09 2008-11-13 Lessnick Stephen L Methods and compositions for the diagnosis and treatment of ewing's sarcoma
US7541150B2 (en) * 2002-04-08 2009-06-02 University Of Louisville Research Foundation, Inc Method for the diagnosis and prognosis of malignant diseases
US20110237457A1 (en) * 2010-03-26 2011-09-29 Armune Biosciences, Inc. Method and system of particle-coupled phage epitope
US20130130355A1 (en) * 2011-09-28 2013-05-23 Armune Biosciences, Inc. Method and system of particle-phage epitope complex

Family Cites Families (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8901778D0 (en) 1989-01-27 1989-03-15 Univ Court Of The University O Manipulatory technique
US5527686A (en) 1991-07-29 1996-06-18 Serex, Inc. Differential binding affinities and dissociation assays based thereon
EP0672131B1 (fr) 1992-10-30 2003-12-17 The General Hospital Corporation Une nouvelle protein de controle du cycle cellulaire
CA2290736A1 (fr) 1997-07-11 1999-01-21 Introgene B.V. Therapie genique anticancereuse a l'aide d'interleukine-3
MXPA01001727A (es) 1998-08-14 2001-11-27 Aventis Pharm Prod Inc Formulaciones de adenovirus para terapia genetica.
JP2002523105A (ja) 1998-08-27 2002-07-30 アバンテイス・フアルマ・エス・アー 異種遺伝子の運搬用の標的化アデノウイルスベクター
EP1074617A3 (fr) 1999-07-29 2004-04-21 Research Association for Biotechnology Amorces pour la synthèse de cADN de pleine longueur et leur utilisation
US20030138860A1 (en) 2000-06-14 2003-07-24 Robertson John Forsyth Russell Cancer detection methods and reagents
US20030232399A1 (en) 2000-06-14 2003-12-18 Robertson John Forsyth Russell Cancer detection methods and reagents
US7060436B2 (en) 2000-06-17 2006-06-13 Third Wave Technologies, Inc. Nucleic acid accessible hybridization sites
CA2421122A1 (fr) 2000-09-01 2002-03-07 Hyseq, Inc. Nouveaux acides nucleiques et polypeptides
US20030143668A1 (en) 2001-06-18 2003-07-31 National Institute Of Advanced Industrial Guanosine triphosphate-binding protein coupled receptors
WO2003010198A1 (fr) 2001-07-26 2003-02-06 Kenton Srl Identification d'antigenes tumoraux specifiques par selection de bibliotheques d'adnc avec des serums et utilisation de ces antigenes dans des techniques de diagnostic
WO2003064593A2 (fr) 2001-11-09 2003-08-07 Virginia Mason Research Center Panneaux d'antigenes et procedes d'utilisation associes
JP4557497B2 (ja) 2002-03-03 2010-10-06 ローム・アンド・ハース・エレクトロニック・マテリアルズ，エル．エル．シー． シランモノマー及びポリマーを製造する方法及びそれを含むフォトレジスト組成物
DE10243778A1 (de) 2002-09-20 2004-03-25 Siemens Ag Stelleinrichtung
GB2424070B (en) 2002-11-14 2007-06-27 Univ Nottingham Methods for preparing tumour marker proteins
DE60318294T2 (de) 2003-03-31 2008-12-11 Stichting Researchfonds Pathologie Nachweis von invasivem Krebs induziert von HPV und dessen Vorläufer Läsionen mit Invasionspotential
WO2006100156A2 (fr) 2005-03-24 2006-09-28 Nolabs Ab Dispositif d'acces medical intravasculaire, interstitiel ou intra-organes et procede de fabrication faisant appel a du monoxyde d'azote
GB2426581A (en) 2005-05-27 2006-11-29 Univ Nottingham Immunoassay methods
CN101632020B (zh) * 2006-09-13 2013-11-27 昂西免疫有限公司 改进的免疫测定方法
GB0725239D0 (en) 2007-12-24 2008-02-06 Oncimmune Ltd Calibrator for autoantibody assay
EP2252893B1 (fr) * 2008-02-21 2013-10-23 Iris International, Inc. Procédé pour la détermination précoce d'une récurrence après une thérapie pour le cancer de la prostate
US8392127B2 (en) * 2008-03-22 2013-03-05 Merck Sharp & Dohme Corp. Methods and gene expression signature for assessing growth factor signaling pathway regulation status
WO2009149166A2 (fr) * 2008-06-03 2009-12-10 Children's Hospital Medical Center Procédés et compositions pour le diagnostic et le traitement de troubles prolifératifs
WO2010065940A1 (fr) * 2008-12-04 2010-06-10 The Regents Of The University Of California Matériels et méthodes de diagnostic et de pronostic d'un cancer de la prostate

Patent Citations (79)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4109496A (en) * 1977-12-20 1978-08-29 Norris Industries Trapped key mechanism
US4323546A (en) * 1978-05-22 1982-04-06 Nuc Med Inc. Method and composition for cancer detection in humans
US4657760A (en) * 1979-03-20 1987-04-14 Ortho Pharmaceutical Corporation Methods and compositions using monoclonal antibody to human T cells
US4873191A (en) * 1981-06-12 1989-10-10 Ohio University Genetic transformation of zygotes
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5206344A (en) * 1985-06-26 1993-04-27 Cetus Oncology Corporation Interleukin-2 muteins and polymer conjugation thereof
US5283317A (en) * 1987-08-03 1994-02-01 Ddi Pharmaceuticals, Inc. Intermediates for conjugation of polypeptides with high molecular weight polyalkylene glycols
US4981785A (en) * 1988-06-06 1991-01-01 Ventrex Laboratories, Inc. Apparatus and method for performing immunoassays
US4968103A (en) * 1988-07-22 1990-11-06 Photofinish Cosmetics Inc. Method of making a brush
US5223409A (en) * 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5225212A (en) * 1989-10-20 1993-07-06 Liposome Technology, Inc. Microreservoir liposome composition and method
US5614396A (en) * 1990-06-14 1997-03-25 Baylor College Of Medicine Methods for the genetic modification of endogenous genes in animal cells by homologous recombination
US5489677A (en) * 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5602240A (en) * 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5714331A (en) * 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5674486A (en) * 1991-06-25 1997-10-07 San Diego Regional Cancer Center Cancer immunotherapy with carrier cells
US5904920A (en) * 1991-10-04 1999-05-18 Whitehead Institute For Biomedical Research Regulation of systemic immune responses utilizing cytokines and antigens
US5631169A (en) * 1992-01-17 1997-05-20 Joseph R. Lakowicz Fluorescent energy transfer immunoassay
US6051230A (en) * 1992-03-05 2000-04-18 Board Of Regents, The University Of Texas System Compositions for targeting the vasculature of solid tumors
US5358691A (en) * 1992-03-27 1994-10-25 Abbott Laboratories Automated continuous and random access analytical system
US5885808A (en) * 1992-11-04 1999-03-23 Imperial Cancer Research Technology Limited Adenovirus with modified binding moiety specific for the target cells
US5539082A (en) * 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5719262A (en) * 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5672480A (en) * 1993-12-29 1997-09-30 Abbott Laboratories Immunoassays for prostate specific antigen
US5599677A (en) * 1993-12-29 1997-02-04 Abbott Laboratories Immunoassays for prostate specific antigen
US5994523A (en) * 1994-04-22 1999-11-30 The United States Of America As Represented By The Department Of Health And Human Services Melanoma antigens and their use in diagnostic and therapeutic methods
US5994106A (en) * 1994-06-10 1999-11-30 Genvec, Inc. Stocks of recombinant, replication-deficient adenovirus free of replication-competent adenovirus
US6001557A (en) * 1994-10-28 1999-12-14 The Trustees Of The University Of Pennsylvania Adenovirus and methods of use thereof
US5872154A (en) * 1995-02-24 1999-02-16 The Trustees Of The University Of Pennsylvania Method of reducing an immune response to a recombinant adenovirus
US5824544A (en) * 1995-03-24 1998-10-20 Genzyme Corporation Adenovirus vectors for gene therapy
US6019978A (en) * 1995-06-05 2000-02-01 The Wistar Institute Of Anatomy And Biology Replication-defective adenovirus human type 5 recombinant as a vaccine carrier
US6033908A (en) * 1995-06-15 2000-03-07 Introgene, B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US5994128A (en) * 1995-06-15 1999-11-30 Introgene B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US6159750A (en) * 1995-12-22 2000-12-12 Abbott Laboratories Fluorescence polarization immunoassay diagnostic method
US5994069A (en) * 1996-01-24 1999-11-30 Third Wave Technologies, Inc. Detection of nucleic acids by multiple sequential invasive cleavages
US5972334A (en) * 1996-05-01 1999-10-26 Genitope Corporation Vaccines for treatment of lymphoma and leukemia
US5885530A (en) * 1996-06-28 1999-03-23 Dpc Cirrus, Inc. Automated immunoassay analyzer
US6207147B1 (en) * 1996-10-11 2001-03-27 The Regents Of The University Of California Cancer immunotherapy using tumor cells combined with mixed lymphocytes
US5994132A (en) * 1996-10-23 1999-11-30 University Of Michigan Adenovirus vectors
US6080912A (en) * 1997-03-20 2000-06-27 Wisconsin Alumni Research Foundation Methods for creating transgenic animals
US5830730A (en) * 1997-05-08 1998-11-03 The Regents Of The University Of California Enhanced adenovirus-assisted transfection composition and method
US20030028981A1 (en) * 1997-10-14 2003-02-13 Chandler Don J. Precision fluorescently dyed particles and methods of making and using same
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US5981225A (en) * 1998-04-16 1999-11-09 Baylor College Of Medicine Gene transfer vector, recombinant adenovirus particles containing the same, method for producing the same and method of use of the same
US7402403B1 (en) * 1998-05-11 2008-07-22 Oncimmune Limited Tumour markers
US20080153113A1 (en) * 1998-05-11 2008-06-26 Robertson John F R Tumour Markers
US6686147B1 (en) * 1998-07-15 2004-02-03 Ludwig Institute For Cancer Research Cancer associated antigens and uses therefor
US7205117B1 (en) * 1998-12-10 2007-04-17 University Of Nottingham Cancer detection method and reagents
US6783961B1 (en) * 1999-02-26 2004-08-31 Genset S.A. Expressed sequence tags and encoded human proteins
US7115416B1 (en) * 1999-02-26 2006-10-03 Serono Genetics Institute S.A. Expressed sequence tags and encoded human proteins
US6610508B1 (en) * 1999-03-08 2003-08-26 Anadys Pharmaceuticals, Inc. Translation driver system and methods for use thereof
US7368527B2 (en) * 1999-03-12 2008-05-06 Human Genome Sciences, Inc. HADDE71 polypeptides
US6180357B1 (en) * 1999-10-08 2001-01-30 Arius Research, Inc. Individualized patient-specific anti-cancer antibodies
US6573361B1 (en) * 1999-12-06 2003-06-03 Monsanto Technology Llc Antifungal proteins and methods for their use
US20030092009A1 (en) * 2000-11-16 2003-05-15 Kaia Palm Profiling tumor specific markers for the diagnosis and treatment of neoplastic disease
US20070082330A1 (en) * 2001-03-21 2007-04-12 Xenoport, Inc. Compounds displayed on icosahedral phage and methods of using same
US7214498B2 (en) * 2001-03-23 2007-05-08 Benaroya Research Institute At Virginia Mason Tumor associated antigens and methods of using the same
US20070269798A1 (en) * 2001-04-17 2007-11-22 Xenoport, Inc. Epitope-captured antibody display
US20030175736A1 (en) * 2001-08-02 2003-09-18 The Regents Of The University Of Michigan Expression profile of prostate cancer
US20040044181A1 (en) * 2001-08-31 2004-03-04 Tang Y. Tom Novel nucleic acids and polypeptides
US20030219760A1 (en) * 2001-09-05 2003-11-27 The Brigham And Women's Hospital, Inc. Diagnostic and prognostic tests
US6943241B2 (en) * 2001-11-05 2005-09-13 Research Association For Biotechnology Full-length cDNA
US7541150B2 (en) * 2002-04-08 2009-06-02 University Of Louisville Research Foundation, Inc Method for the diagnosis and prognosis of malignant diseases
US7067258B2 (en) * 2002-04-30 2006-06-27 Merck & Co., Inc. Human papillomavirus multiplexed assay
US20050147961A1 (en) * 2002-04-30 2005-07-07 Esser Mark T. Human papillomavirus multiplexed assay
US20050032065A1 (en) * 2002-06-24 2005-02-10 Afar Daniel E. H. Methods of prognosis of prostate cancer
US20070054353A1 (en) * 2002-09-26 2007-03-08 John White Nuclear receptor transcriptional corepressor and uses thereof
US20060024692A1 (en) * 2002-09-30 2006-02-02 Oncotherapy Science, Inc. Method for diagnosing non-small cell lung cancers
US7858323B2 (en) * 2004-06-09 2010-12-28 The Regents Of The University Of Michigan Phage microarray profiling of the humoral response to disease
US7597890B2 (en) * 2004-06-09 2009-10-06 The Regents Of The University Of Michigan Methods and compositions for diagnosing lung cancer
US20100009382A1 (en) * 2004-06-09 2010-01-14 The Regents Of The University Of Michigan Methods and compositions for diagnosing lung cancer
US20060014138A1 (en) * 2004-06-09 2006-01-19 The Regents Of The University Of Michigan Phage microarray profiling of the humoral response to disease
US20110070652A1 (en) * 2004-06-09 2011-03-24 The Regents Of The University Of Michigan Phage microarray profiling of the humoral response to disease
US8617547B2 (en) * 2004-06-09 2013-12-31 The Regents Of The University Of Michigan Methods and compositions for diagnosing prostate cancer
US20070037143A1 (en) * 2005-06-02 2007-02-15 Digilab Biovision Gmbh Method for screening for protease modulators
US20080213791A1 (en) * 2005-11-08 2008-09-04 Euclid Diagnostics Llc Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer
US20080280844A1 (en) * 2007-05-09 2008-11-13 Lessnick Stephen L Methods and compositions for the diagnosis and treatment of ewing's sarcoma
US20110237457A1 (en) * 2010-03-26 2011-09-29 Armune Biosciences, Inc. Method and system of particle-coupled phage epitope
US20130130355A1 (en) * 2011-09-28 2013-05-23 Armune Biosciences, Inc. Method and system of particle-phage epitope complex

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
abcam Anti-methionine antibody product ab6456 downloaded from the internet 2/8/2017 *
Leinonen et al (2002 Clinical Chemistry 48:2208-16) *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100009382A1 (en) * 2004-06-09 2010-01-14 The Regents Of The University Of Michigan Methods and compositions for diagnosing lung cancer
US20110070652A1 (en) * 2004-06-09 2011-03-24 The Regents Of The University Of Michigan Phage microarray profiling of the humoral response to disease
US8617547B2 (en) 2004-06-09 2013-12-31 The Regents Of The University Of Michigan Methods and compositions for diagnosing prostate cancer
US9267133B2 (en) 2004-06-09 2016-02-23 The Regents Of The University Of Michigan Phage microarray profiling of the humoral response to disease
US10006023B2 (en) 2004-06-09 2018-06-26 The Regents Of The University Of Michigan Phage microarray profiling of the humoral response to disease
US20150232931A1 (en) * 2013-09-20 2015-08-20 The Regents Of The University Of Michigan Compositions and methods for the analysis of radiosensitivity
WO2017223533A1 (fr) * 2016-06-24 2017-12-28 University Of Southern California Analogues de mentsh en tant qu'agents thérapeutiques pour le diabète, l'obésité et leurs maladies et complications associées
CN109414472A (zh) * 2016-06-24 2019-03-01 南加利福尼亚大学 Mentsh类似物作为用于糖尿病、肥胖及其相关疾病和并发症的治疗剂
US11124551B2 (en) * 2016-06-24 2021-09-21 University Of Southern California MENTSH analogs as therapeutics for diabetes, obesity, and their associated diseases and complications
US20210371479A1 (en) * 2016-06-24 2021-12-02 University Of Southern California Mentsh analogs as therapeutics for diabetes, obesity, and their associated diseases and complications
US11760783B2 (en) * 2016-06-24 2023-09-19 University Of Southern California MENTSH analogs as therapeutics for diabetes, obesity, and their associated diseases and complications

Also Published As

Publication number Publication date
WO2011116209A3 (fr) 2012-04-05
EP3450979A3 (fr) 2019-04-24
US11307203B2 (en) 2022-04-19
US9658231B2 (en) 2017-05-23
WO2011116209A2 (fr) 2011-09-22
EP2548025A4 (fr) 2013-09-25
EP2548025A2 (fr) 2013-01-23
US20180224455A1 (en) 2018-08-09
EP3450979A2 (fr) 2019-03-06
US20160041174A1 (en) 2016-02-11

Similar Documents

Publication Publication Date Title
US11307203B2 (en) Using phage epitopes to profile the immune response
AU2014204510B2 (en) Protein signature/markers for the detection of adrenocarcinoma
WO2008061104A2 (fr) Méthodes et trousses de détection de marqueurs du cancer de la prostate
JP5731488B2 (ja) 癌のマーカーとしてのセセルニン‐１
AU2007272607A1 (en) Lung cancer diagnostic assay
Qin et al. Development of a “reverse capture” autoantibody microarray for studies of antigen‐autoantibody profiling
US20130130355A1 (en) Method and system of particle-phage epitope complex
CA2706786A1 (fr) Procede de diagnostic et matrices destinees a etre utilisees dans ces procedes
Murphy et al. Epitope presentation is an important determinant of the utility of antigens identified from protein arrays in the development of autoantibody diagnostic assays
Gunawardana et al. Identifying novel autoantibody signatures in ovarian cancer using high-density protein microarrays
EP2620772A1 (fr) Biomarqueurs du cancer gastrique et leurs procédés d'utilisation
CA2662012C (fr) Isoformes et procedes de detection de boris et traitement de maladie
JP2018136122A (ja) 膵がんを診断するための血漿バイオマーカーパネル
US20110237457A1 (en) Method and system of particle-coupled phage epitope
US20190137498A1 (en) Methods and compositions for detecting cancer
EP2619218B1 (fr) Kits destines a l'identification des cancers du sein et de l'ovaire dans un echantillon de fluide corporel et utilisation de ceux-ci
KR102131860B1 (ko) 아르기닌이 메틸화된 ggt1에 특이적으로 결합하는 대장암 진단용 바이오마커 조성물
WO2024057956A1 (fr) Variant d'isoforme p53 pour diagnostiquer un cancer
US20150004621A1 (en) Biological marker for early cancer detection and methods for cancer detection (bf819)
JP6312141B2 (ja) 前立腺がん検査用尿中バイオマーカー

Legal Events

Date Code Title Description
AS Assignment

Owner name: ARMUNE BIOSCIENCES, INC., MICHIGAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:TSODIKOV, ALEX;REEL/FRAME:026627/0454

Effective date: 20110516

Owner name: THE REGENTS OF THE UNIVERSITY OF MICHIGAN, MICHIGA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:WANG, XIAOJU;REEL/FRAME:026627/0457

Effective date: 20110323

Owner name: THE REGENTS OF THE UNIVERSITY OF MICHIGAN, MICHIGA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:TSODIKOV, ALEX;REEL/FRAME:026627/0454

Effective date: 20110516

Owner name: HOWARD HUGHES MEDICAL INSTITUTE ("HHMI"), MARYLAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CHINNAIYAN, ARUL M.;REEL/FRAME:026627/0462

Effective date: 20110715

Owner name: ARMUNE BIOSCIENCES, INC., MICHIGAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:OHRNBERGER, JEANNE;REEL/FRAME:026627/0427

Effective date: 20110531

AS Assignment

Owner name: THE REGENTS OF THE UNIVERSITY OF MICHIGAN, MICHIGA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:HOWARD HUGHES MEDICAL INSTITUTE ("HHMI");REEL/FRAME:026632/0895

Effective date: 20110715

AS Assignment

Owner name: EXACT SCIENCES DEVELOPMENT COMPANY, LLC, WISCONSIN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ARMUNE BIOSCIENCE, INC.;REEL/FRAME:044568/0634

Effective date: 20171215

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION