US20080213791A1 - Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer - Google Patents
Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer Download PDFInfo
- Publication number
- US20080213791A1 US20080213791A1 US12/115,674 US11567408A US2008213791A1 US 20080213791 A1 US20080213791 A1 US 20080213791A1 US 11567408 A US11567408 A US 11567408A US 2008213791 A1 US2008213791 A1 US 2008213791A1
- Authority
- US
- United States
- Prior art keywords
- seq
- receptor
- primers
- protein
- family member
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
- Y10T436/00—Chemistry: analytical and immunological testing
- Y10T436/14—Heterocyclic carbon compound [i.e., O, S, N, Se, Te, as only ring hetero atom]
- Y10T436/142222—Hetero-O [e.g., ascorbic acid, etc.]
- Y10T436/143333—Saccharide [e.g., DNA, etc.]
Definitions
- CpG dinucleotides are statistically underrepresented in the genomes of higher eukaryotes, including mammals. The dinucleotide is reportedly found at only 5-10% of its predicted frequency. The majority of CpG dinucleotides that do remain in the human genome are normally located within repetitive sequences that are characterized by low gene expression levels and exhibit methylation at the cytosine residues.
- CpG islands represent genomic sequences that contain clusters of CpG dinucleotide.
- CpG islands may be associated with the promoter region or 5′ end of coding sequences or may be present within introns or in genomic regions that are not known to be associated with coding sequences. They may be unmethylated or methylated in normal tissues and the methylation pattern may be used to control tissue specific expression and the expression of imprinted genes. Methylation of CpG islands within promoter regions can result in the downregulation or silencing of the associated gene. An increase in methylation of normally unmethylated islands is observed in aging tissues even as the overall methylcytosine content of the DNA is reduced.
- CpG islands may be methylated to varying densities within the same tissue.
- aberrant methylation of cytosines within CpG islands can be a primary epigenetic event that acts to suppress the expression of genes involved in critical cellular processes, such as DNA damage repair, hormone response, cell-cycle control, and tumor-cell adhesion/metastasis, leading to tumor initiation, progression and metastasis (Li et al., Biochim. Biophys. Acta, 1704: 87-102 (2004)).
- Prostate cancer for example, which is the most common malignancy and the second leading cause of death among men in the U.S. (Li et al. (2004), supra), has been found to be associated with the methylation of CpG islands in the promoters of over 30 genes, in particular the CpG island of the glutathione S-transferase P1 (GSTP1) gene.
- GSTP1 methylation has been detected in over 50% of DNA recovered from urine and plasma of prostate cancer patients (Goessl et al., Ann. N.Y. Acad. Sci., 945: 51-58 (2001); Cairns et al., Clin.
- GSTP1 is also methylated in prostatic intraepithelial lesions (PIN) which may lead to a false positive diagnosis.
- PIN prostatic intraepithelial lesions
- Some CpG islands are methylated in prostate cancer and other diseases of the prostate, such as benign prostatic hyperplasia (BPH). They may even exhibit some degree of methylation in normal aging prostates.
- BPH benign prostatic hyperplasia
- the prostate-specific antigen or PSA test continues to be widely used in the early detection of prostate cancer. While the PSA test has resulted in the majority of prostate cancer cases being diagnosed in asymptomatic men (Mettlin et al., Cancer, 83(8): 1679-1684 (1998a); Mettlin et al., Cancer, 82(2): 249-251 (1998b); Humphrey et al., J. Urol., 155: 816-820 (1996); and Grossfeld et al., Epidemiol.
- the PSA test suffers from poor specificity, which can be as low as 33% when a PSA cut-off level of 2.6 ng/ml is used (Thompson et al., N. Engl. J. Med., 350: 2239-2246 (2004)), even though the sensitivity can be as high as 83%.
- the poor specificity of the PSA test is a direct result of increased secretion of PSA in other diseases of the prostate, such as BPH and prostatitis.
- an elevated PSA level indicates the need for additional screening in the form of needle biopsy.
- the results of needle biopsies lead to the diagnoses of prostate cancer.
- the invention provides materials and methods for evaluating cancer. Methods of evaluating can include methods of diagnosing and prognosticating cancer as well as methods of assessing the efficacy of cancer treatment. Generally, the methods provided involve assaying for methylation of CpG islands associated with specific genes.
- the invention also provides pairs of isolated or purified primers that can be used in the methods of the invention, for example, to amplify and/or detect the methylation state of the CpG islands associated with specific genes.
- the invention also provides kits comprising one or more pairs of primers useful in the disclosed methods.
- the invention provides methods of diagnosing cancer by assaying for one or more methylated CpG islands that are indicative of cancer.
- the method comprises providing a biological sample from a subject in need of cancer diagnosis and assaying the sample for methylation of one or more CpG islands associated with at least one gene selected from the group consisting of: neuregulin cell-surface ligand (NRG1), adrenergic B3 receptor (ADRB3), glycosylphosphatidyl-inositol cell-surface receptor (GFRA2), kinesin family member 13B (KIF13B), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (predicted protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1), fibroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1
- the invention also provides a method of diagnosing prostate cancer in a male mammal by assaying for one or more methylated CpG islands that are indicative of prostate cancer.
- the method can include providing a biological sample from a subject in need of cancer diagnosis and assaying the sample for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, ECOP, ZNF596, LOC441320, TDH, FLJ36980, EFHA2, ASAH1, NODAL, LOC399783, ISL2, MMP9, TNFSF11, RHOD or LRRC49.
- Kinesin family member C2 (KIFC2), chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), Ras association (RalGDS/AF-6) domain family 5 (RASSF5), and HtrA serine peptidase 4 (HTRA4).
- KIFC2 Kinesin family member C2
- C20orf23 chromosome 20 open reading frame 23
- GFRA1 GDNF family receptor alpha 1
- GPX7 Glutathione peroxidase 7
- DKK2 Dickkopf homolog 2
- NNN1 netrin 1
- Ras association Ras association
- RalGDS/AF-6) domain family 5 RalGDS/AF-6) domain family 5
- HTRA4 HtrA serine peptidase 4
- the method of diagnosing prostate cancer can also include assaying for methylation of one or more CpG island associated with at least one gene that is known to be methylated in prostate cancer but is known not to be detectably methylated or is methylated at a lower level (e.g., about 50% or less, about 40% or less, 30% or less, about 20% or less, or about 10% or less) in BPH.
- a lower level e.g., about 50% or less, about 40% or less, 30% or less, about 20% or less, or about 10% or less
- the invention also provides methods of prognosticating cancer by assaying for the methylation of one or more genes that are indicative of the grade or stage of the cancer, and/or the length of disease-free survival following treatment for cancer.
- the method comprises providing a biological sample from a subject in need of cancer prognosis and assaying the sample for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, MMP9, TNFSF11, RHOD and LRRC49.
- a method of prognosticating prostate cancer in a male mammal by assaying for one or more methylated CpG islands that are indicative of the grade or stage of prostate cancer, and/or the length of disease-free survival following treatment of prostate cancer.
- the method comprises providing a biological sample from the male mammal and assaying the sample for methylation of a CpG island associated with at least one of the following genes: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, GPR62, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, RASSF5, HTRA4, MMP9, TNFSF11, RHOD or LRRC49.
- NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD HEMK1, FGF4, GPR62, HTR1A, RNF180, DKFZP5640822, ZNF596,
- the method of prognosticating prostate cancer can also include assaying the biological sample for methylation of a CpG island associated with at least one gene that is known to be methylated in prostate cancer but is known not to be detectably methylated or is methylated at a lower level (e.g., about 50% or less, about 40% or less, 30% or less, about 20% or less, or about 10% or less) in BPH.
- Methylation of the CpG islands associated with the genes is indicative of the grade or stage of the cancer, and/or the length of disease-free survival following treatment.
- the invention provides methods of assessing the efficacy of treatment of cancer by assaying for the reduced methylation of CpG islands that indicates efficacy of treatment.
- the method comprises providing a first and a second biological sample from a subject in need of assessing the efficacy of treatment of cancer and assaying the samples for a change in methylation level of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, MMP9, TNFSF11, RHOD and LRRC49.
- the first biological sample is taken before the second biological sample, and the second biological sample is taken during or after a course of treatment.
- a decrease or absence of methylation of the assayed one or more CpG islands in the second sample indicates that the treatment is effective.
- the maintenance or increase of methylation in the assayed CpG islands in the second sample can indicate a reduction or absence of treatment efficacy.
- the method comprises (a) providing a first and a second biological sample from a subject undergoing a course of cancer treatment, wherein the first sample is taken at an earlier time than the second sample, and the second sample is taken during or following a course of treatment and (b) assaying the samples for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, RASSF5, HTRA4, MMP9, TNFSF11, RHOD and LRRC49.
- this method can also include assaying the biological sample for methylation of a CpG island associated with at least one gene that is known to be methylated in prostate cancer but is known not to be detectably methylated or is methylated at a lower level (e.g. about 50% or less, about 40% or less, 30% or less, about 20% or less, or about 10% or less in BPH.
- a lower level e.g. about 50% or less, about 40% or less, 30% or less, about 20% or less, or about 10% or less in BPH.
- the aforementioned methods of diagnosing, prognosticating and assessing the efficacy of treatment of cancer can further include assaying the biological sample for methylation of multiple CpG islands, for example, CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more genes.
- the invention provides a terminator-coupled linear amplification method of determining the methylation status of a CpG island.
- the method includes providing a DNA sample for terminator-coupled linear amplification and then incubating the DNA sample under deaminating conditions to thereby produce a deaminated DNA sample.
- the deaminated DNA sample can be purified.
- the deaminated sample is used as template to amplify a target sequence or target sequences that include one or more CpG islands or portions of one or more CpG islands thereby producing one or more amplified target sequences.
- the one or more amplified target sequences are purified.
- One or more sequences in the amplified target sequences are linearly amplified in the presence of a primer and a dideoxynucleotide to generate one or more fragments of different lengths, wherein each length corresponds to the distance in bases from the 5′ end of the primer to the position where the dideoxynucleotide is incorporated.
- the one or more fragments is purified.
- the one or more fragments are analyzed to determine their lengths. The lengths of the fragments can be used to determine the methylation status of methylated cytosines within the one or more amplified target sequences.
- the invention also provides pairs of primers suitable for amplifying a CpG-island associated with genes described herein.
- Primers can include isolated or purified nucleic acid molecules suitable for amplifying a CpG island containing target sequence.
- Target sequences can include genomic sequence that has been fully methylated and fully deaminated such as those in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30,
- Exemplary primer pairs include SEQ ID NOS: 55 and 56, SEQ ID NOS: 57 and 58, SEQ ID NOS: 59 and 60, SEQ ID NOS: 61 AND 62, SEQ ID NOS: 63 and 64, SEQ ID NOS: 65 and 66, SEQ ID NOS: 67 and 68, SEQ ID NOS: 69 and 70, SEQ ID NOS: 71 and 72, SEQ ID NOS: 73 and 74, SEQ ID NOS: 77 and 78, SEQ ID NOS: 79 and 80, SEQ ID NOS: 81 and 82, SEQ ID NOS: 83 and 84, SEQ ID NOS: 87 and 88, SEQ ID NOS: 89 and 90, SEQ ID NOS: 91 and 92, SEQ ID NOS: 93 and 94, SEQ ID NOS: 95 and 96, SEQ ID NOS: 97 and 98, SEQ ID NOS: 103 and 104, SEQ ID NOS:
- kits that include one or more of the aforementioned pairs of primers.
- FIGS. 1 A- 1 DD set forth the nucleotide sequences for SEQ ID NOS: 1-54. Sequences are presented in accordance with convention from left to right and top to bottom.
- FIGS. 2 A- 2 KK set forth the nucleotide sequences for SEQ ID NOS: 119-198. Sequences are presented in accordance with convention from left to right and top to bottom.
- the invention provides a method of diagnosing cancer by assaying for the methylation of one or more CpG islands that are indicative of cancer.
- Cancer can include, for example, lung, liver, pancreas, head and neck, throat, thyroid, esophagus, brain, ovarian, kidney, skin, colorectal, and hematopoeietic (e.g., lymphomas and leukemic) cancer.
- the method comprises providing a biological sample from a subject in need of cancer diagnosis and assaying the sample for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, MMP9, TNFSF11, RHOD or LRRC49.
- a gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822,
- the method can include assaying for methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes. Methylation of the CpG islands associated with these genes is indicative of cancer.
- the invention further provides a method of diagnosing prostate cancer by assaying for the methylation of one or more CpG islands that are indicative of prostate cancer in a male mammal.
- the method comprises providing a biological sample from a male mammal in need of cancer diagnosis and assaying the sample for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, RASSF5, HTRA4, MMP9, TNFSF11, RHOD and LRRC49.
- the method of diagnosing prostate cancer includes assaying the biological sample for methylation of a CpG island associated with NRG1, KIF13B, or both.
- the method includes assaying for methylation of a CpG island associated with at least one gene selected from the group consisting of: TDH, ASAH1, FGF20, HEMK1, PALD NEUROG, EFHA2, KIFC2, GFRA1, DKK2, TNFSF11, NTN1, and RHOD.
- the method of diagnosing prostate cancer can include assaying for methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes. Methylation of the CpG islands associated with these genes is indicative of cancer.
- the foregoing method of diagnosing prostate cancer can optionally include, in combination with assaying for methylation of CpG islands associated with the foregoing genes, further assaying the biological sample for methylation of a CpG island associated with at least one gene that is known to be (i) methylated in prostate cancer and (ii) not detectably methylated or methylated at a lower level (e.g., about 50% or less, about 40% or less, about 30% or less, about 20% or less, or less than about 10%) in BPH.
- a lower level e.g., about 50% or less, about 40% or less, about 30% or less, about 20% or less, or less than about 10%
- the method when the method includes assaying for at least one CpG island that is known to be methylated in prostate cancer but is known not to be detectably methylated or methylated at a lower level in BPH, the method preferably includes assaying the biological sample for methylation of CpG islands associated with at least three different genes.
- CpG islands known to be methylated in prostate cancer but not detectably methylated or methylated at a lower level in BPH include CpG islands associated with glutathione S-transferase P1 (GSTP 1), glutathione peroxidase 3 (GPX3), glutathione S-transferase M1 (GSTM1), glutathione S-transferase M4 (GSTM4), Cub and Sushi multiple domains1 (CSMD1), tumor necrosis factor receptor superfamily member 10A (TNFRSF10A) tumor necrosis factor receptor superfamily member 10B (TNFRSF10B), tumor necrosis factor receptor superfamily member 10C (TNFRSF10C), tumor necrosis factor receptor superfamily 10D (TNFRSF10D), secreted frizzled-related protein 1 (SFRP1), secreted frizzled-related protein 2 (SFRP2), dickkopf homolog 3 (DKK3), prostaglandin-endoperoxide synthase 2 (PTGS2)
- the invention also provides a method of prognosticating cancer by assaying for the methylation of one or more genes that are indicative of the grade or stage of the cancer, and/or the length of disease-free survival following treatment for cancer.
- the method comprises providing a biological sample from a subject in need of cancer prognosis and assaying the sample for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, MMP9, TNFSF11, RHOD and LRRC49.
- the method can include assaying for methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes. Methylation of the CpG islands associated with these genes is indicative of the grade or stage of the cancer, and/or the length of disease-free survival following treatment for cancer.
- the invention also provides a method of prognosticating prostate cancer in a male mammal by assaying for the methylation of one or more CpG islands that are indicative of the grade or stage of the prostate cancer, and/or the length of disease-free survival following treatment for prostate cancer.
- the method comprises assaying a biological sample from the male mammal for methylation of a CpG island associated with at least one of the following genes: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTRIA, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, or ISL2.
- the method can include assaying the biological sample for methylation of a CpG island associated with at least one of the following genes: KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, RASSF5, HTRA4, MMP9, TNFSF11, RHOD or LRRC49.
- the method of diagnosing prostate cancer includes assaying the biological sample for methylation of a CpG island associated with NRG1, KIF13B, or both.
- the method includes assaying for at least one of the following genes: TDH, ASAH1, FGF20, HEMK1, PALD NEUROG, EFHA2, KIFC2, GFRA1, DKK2, TNFSF11, NTN1, or RHOD.
- the method of diagnosing prostate can include assaying for methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes. Methylation of the CpG islands associated with these genes is indicative of the grade or stage of prostate cancer, and/or the length of disease-free survival following treatment for prostate cancer.
- the foregoing method of prognosticating prostate cancer can optionally include, in combination with assaying for methylation of CpG islands associated with the foregoing genes, further assaying the biological sample for methylation of a CpG island associated with at least one gene that is known to be (i) methylated in prostate cancer and (ii) not detectably methylated or methylated at a lower level (e.g., about 50% or less, about 40% or less, about 30% or less, about 20% or less, or less than about 10%) in BPH.
- Percent methylation level in BPH refers to the percent of patients that exhibit some detectable level of methylation at that locus.
- the method when the method includes assaying for methylation of at least one CpG island that is known to be methylated in prostate cancer but is known not to be detectably methylated or is methylated at a lower level in BPH, the method preferably includes assaying the biological sample for methylation of CpG islands associated with at least three different genes.
- CpG islands known to be methylated in prostate cancer but not detectably methylated or methylated at a lower level in BPH include CpG islands associated with GSTP1, GPX3, GSTM1, GSTM4, CSMD1, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, SFRP1, SFRP2, DKK3, PTGS2, CDKN1C/p57, RASSF1, and GPR62. Methylation of CpG islands associated with the genes is indicative of the grade or stage of the prostate cancer, and/or the length of disease-free survival following treatment for prostate cancer.
- the patterns of CpG methylation may be correlated to the pathological stage and grade of the tumor. For example, in prostate cancer, patterns of CpG methylation may be correlated to the Gleason score of the primary tumor.
- the molecular information derived from CpG methylation may also be correlated to the likelihood of survival and the length of disease-free survival following treatment.
- the method comprises providing a first and a second biological sample from a subject in need of assessing the efficacy of treatment of cancer and assaying the samples for a change in methylation level of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, MMP9, TNFSF11, RHOD and LRRC49.
- the first biological sample is taken (e.g, prior to commencing treatment or during treatment) before the second biological sample
- the second biological sample is taken after a course of treatment.
- the method includes assaying for a change in methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes.
- a decrease or absence of methylation of the assayed one or more CpG islands in the second sample indicates that the treatment is effective.
- the maintenance or increase of methylation in the assayed CpG islands in the second sample can indicate a reduction or absence of treatment efficacy.
- the invention provides a method of assessing the efficacy of treatment of prostate cancer in a male mammal by assaying for the reduced methylation of CpG islands that indicate efficacy of treatment of prostate cancer.
- the method comprises assaying biological samples, which are taken from the male mammal periodically during the course of treatment, for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, and ISL2.
- the method can include assaying the biological samples for methylation of a CpG island associated with at least one gene selected from the group consisting of: KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, RASSF5, HTRA4, MMP9, TNFSF11, RHOD and LRRC49.
- the method of assessing the efficacy of treatment of prostate cancer includes assaying the biological sample for methylation of a CpG island associated with NRG1, KIF13B, or both.
- the method includes assaying for a CpG island associated with at least one gene selected from the group consisting of: TDH, ASAH1, FGF20, HEMK1, PALD NEUROG, EFHA2, KIFC2, GFRA1, DKK2, TNFSF11, NTN1, and RHOD.
- the method can include assaying for methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes.
- the assayed biological samples in the method include a first and a second biological sample.
- the first biological sample can be taken, for example, prior to commencing treatment or during treatment, though in any event prior to taking the second biological sample.
- the second biological sample is taken during or after a course of treatment.
- a decrease or absence of methylation of the assayed one or more CpG islands in the second sample (i.e., following the course of treatment) as compared to the first sample indicates that the treatment is effective.
- the maintenance or increase of methylation in the assayed CpG islands in the second sample as compared to the first sample can indicate a reduction in or absence of treatment efficacy.
- the foregoing method of assessing the efficacy of prostate cancer treatment can optionally include, in combination with assaying for methylation of CpG islands associated with the foregoing genes, further assaying the biological sample for reduced methylation of a CpG island associated with at least one gene that is known to be (i) methylated in prostate cancer and (ii) not detectably methylated or methylated at a lower level (e.g., about 50% or less, about 40% or less, about 30% or less, about 20% or less, or less than about 10%) in BPH.
- a lower level e.g., about 50% or less, about 40% or less, about 30% or less, about 20% or less, or less than about 10%
- the method when the method includes assaying the biological samples for methylation of at least one CpG island that is known to be methylated in prostate cancer but known not to be detectably methylated or methylated at a lower level in BPH, the method preferably includes assaying for methylation of CpG islands associated with at least three different genes.
- CpG islands known not to be methylated in prostate cancer but not detectably methylated or methylated at a lower level in BPH include GSTP1, GPX3, GSTM1, GSTM4, CSMD1, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, SFRP1, SFRP2, DKK3, PTGS2, CDKN1C/p57, RASSF1, and GPR62.
- a decrease or absence of methylation of the CpG islands associated with the assayed genes in the second sample as compared to the first sample following some or all of the course of treatment indicates that the treatment is effective.
- the maintenance or increase of methylation in the assayed CpG islands in the second sample as compared to the first sample can indicate a reduction or absence of treatment efficacy.
- CpG islands (Bird, Nature 321: 209-213 (1986); and Gardiner-Garden et al., J. Molec. Biol. 196: 261-282 (1987)) comprise about 1% of vertebrate genomes and account for about 15% of the total number of CpG dinucleotides.
- CpG islands typically are between about 0.2 and about 2.0 kb in length. They can be located upstream of (e.g., in a promoter or enhancer region) of the coding sequence of the associated genes or they may also extend into or be found within gene-coding regions of their associated genes.
- a gene-coding region can include exons and introns.
- CpG island Use of the phrase “associated with” to describe a CpG island's relation to a gene, is intended to encompass CpG islands that are upstream of gene coding sequences as well as internal CpG islands.
- the CpG island associated with the RET gene is internal and not expected to affect the expression of the RET gene when methylated.
- Some CpG islands are associated with the promoter of two genes and it can affect the expression of both genes. CpGs were labeled based on their location with respect to the nearest gene. In some cases, a CpG island may be located near the promoter of two different genes and may in this case influence the expression of both genes. In such case, the CpG island was named after one of the genes.
- the LRRC49 CpG island is also associated with the THAP domain containing 10 (THAP10) gene.
- a CpG island can also be associated with a pseudogene or be located in a genomic region that includes no known genes or pseudogenes. The CpG island can still be of interest so long as its methylation status correlates with a disease status.
- a CpG island can be separated by up to 25 kilobases (kb) (e.g., up to 20 kb, up to 19 kb, up to 18, kb, up to 17 kb, up to 16 kb, up to 15 kb, up to 10 kb, up to 9 kb, up to 8 kb, up to 7 kb, up to 6 kb, up to 5 kb, up to 4 kb, up to 3 kb, up to 2 kb, or up to 1 kb) from the transcription start site for the nearest gene and still be considered “associated with” the gene.
- CpG islands associated with at least three genes are assayed. However, CpG islands associated with 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or even more genes can be assayed.
- genomic sequences can be analyzed to identify segments containing CpG islands that are at least 200 bp in length, have at least a 60% GC content, and contain at least 7% CpG dinucleotides.
- Preferred sequences are at least 250 bp in length, are at least 60% GC rich, and contain at least 7% CpG dinucleotides.
- undesirable highly repetitive sequences can be screened out using a repeat masker that filters out sequences.
- Desirable sequences contain less than 50% repeats (i.e., a sequence of reduced complexity or a sequence that is present at multiple genomic locations) within the length of the identified CpG island.
- the CpG island is no more than 45%, 40%, 35%, 30%, 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, or 11% repetitive.
- Most desirable sequences are no more than 10% repetitive. Examples of repetitive sequences are available, for example, at the web site for National Center for Biotechnology Information (NCBI).
- Bio sample is intended to encompass any suitable sample that enables accurate assay of CpG island methylation.
- suitable biological samples include, but are not limited to, whole blood, blood plasma, blood serum, urine, saliva, cells (e.g., cells obtained from blood, such as epithelial cells), and tissue. Such samples are obtained in accordance with methods known in the art.
- the biological sample is whole blood, blood plasma, or urine, preferably, CpG islands associated with more than three genes are assayed.
- a CpG island is “not detectably methylated” when it is not methylated or it is methylated at a level below the level of sensitivity of the assay method employed.
- Noncancerous tissue can be benign or normal. Alternatively, but not preferably, the tissue can be diseased, as long as it is not cancerous.
- Methods of assaying methylation of CpG islands include, for example, restriction enzyme-based technology, such as one that employs digestion with a methylation-sensitive restriction endonuclease coupled with Southern blot analysis, methylation-sensitive enzymes and polymerase chain reaction (PCR), such as methylation-sensitive arbitrarily primed PCR (AP-PCR; see, e.g., Gonzalgo et al., Cancer Res., 57: 594-599 (1997)), restriction landmark genomic scanning (RLGS; see, e.g., Plass et al., Genomic 58: 254-262 (1999)), methylated CpG island amplification (MCA; see, e.g., Toyota et al., Cancer Res., 59: 2307-2312 (1999)), differential methylation hybridization (DMH; see, e.g., Huang et al., Human Mol.
- restriction enzyme-based technology such as one that employs digestion with a methylation-
- cytosine conversion-based technology can be used.
- Such technology relies on methylation status-dependent chemical modification of CpG islands (i.e., deamination of unmethylated cytosines in CpG islands) within isolated genomic DNA or fragments thereof followed by DNA sequence analysis.
- Such methods employ reagents like hydrazine and bisulfite. Bisulfite treatment followed by alkaline hydrolysis is described by Olek et al., Nucl. Acids Res., 24: 5064-5066 (1996); and Frommer et al., PNAS USA, 89: 1827-1831 (1992).
- methylation-sensitive primers to assay methylation of CpG islands in isolated genomic DNA is described by Herman et al., PNAS USA, 93: 9821-9826 (1996), and in U.S. Pat. Nos. 5,786,146 and 6,265,171.
- Bisulfite-treated DNA can be subsequently analyzed by conventional molecular techniques, such as PCR amplification, fluorescence-based, real-time PCR (see, e.g., Eads et al., Cancer Res., 59: 2302-2306 (1999); Heid et al., Genome Res., 6: 986-994 (1996); and U.S. Pat. No.
- a preferred method of assaying for methylation of a CpG island includes isolating genomic DNA (and/or fragments thereof) from a biological sample, treating the DNA under deaminating conditions that convert unmethylated cytosines to uracil, using the treated DNA as a template in a PCR reaction to amplify a target sequence that includes the CpG-island of interest, thereby producing an amplified sequence.
- Unmethylated cytosines in the target sequence which are converted to uracils by the deaminating treatment, are amplified as thymines in the corresponding position of the amplified sequence.
- the methylation status of the CpG island can be determined by assaying one or both of the original strands by utilizing primers capable of annealing to the strand of interest.
- the deamination reaction may not proceed to completion, which results in false positives.
- deamination of DNA sequences using bisulfite salt is sensitive to the purity of the DNA, length of incubation, and the secondary structure of the denatured templates.
- Quantitative PCR methods can be used to assay for the efficiency of deamination.
- quantitative PCR methods are limited to assaying the conversion status within the sites where the primers and probes anneal to the template.
- Quantitative PCR methods are also limited to assaying for the methylation of cytosines within the sites where the primers and probes anneal to the template.
- the primers and the probe only anneal efficiently to the templates that are fully converted and contain methylation at the appropriate cytosine nucleotides. Thus, they fail to provide methylation information for CpG dinucleotides that are not assayed for.
- the CpG islands may also be analyzed using direct sequencing following the deamination treatment. However, due to the heterogeneity of the methylation pattern within a CpG island and the presence of homopolymeric stretches within the sequence, direct sequencing of CpG islands can yield a sequencing pattern that is too noisy and complex for the available sequencing software.
- the DNA is linearly amplified using a forward or a reverse primer in the presence of dNTPs and one or two dideoxynucleotides such as dideoxycytidine or dideoxyguanine.
- the amplified sequence can, optionally, be analyzed using only thymine and/or cytosine terminators when assaying for a methylated CpG dinucleotide (or adenine and/or guanine terminators when analyzing the amplified strand opposite to the CpG dinucleotide of interest) to make extension reaction products that terminate at thymines and/or cytosines nucleotides (or at guanine and/or adenine when assaying the opposite strand).
- the amplification reaction results in the generation of fragments with multiple lengths, each length of which corresponds to the distance in bases between the primer used for amplification and the position within the target sequence of a nucleotide that is complementary to the dideoxynucleotide added to the amplification reaction.
- Such amplification can result in the generation of 10 to 20 fragments from an average CpG island-containing amplicon of 100 to 150 bp.
- the extension products can be separated by size on an acrylamide gel and compared to (a) a size standard and/or (b) by comparing the fragments to those generated when fully unmethylated (PCR generated template or clones in E.
- the amplified sequence may contain large stretches of thymine or adenine which may result in additional fragments due to the DNA polymerase slippage during amplification.
- Such “stutter” patterns may be minimized by selectively analyzing segments of the CpG islands that have shorter homopolymeric sequences. Stutter fragments can also be identified by analyzing the control templates.
- the resulting fragments may be analyzed using automated sequencing machines and software designed for determining the size of DNA fragments.
- commercially available software such as GENESCAN (Applied Biosystems, Foster City, Calif.) and GENEMAPPER (Applied Biosystems) are trained to recognize and account for stutter patterns due to DNA polymerase slippage during the amplification of microsatellite repeats.
- Such software may also be used to account for the stutter pattern that is observed when amplifying homopolymeric stretches of DNA, as might be seen after bisulfite conversion of CpG islands.
- fluorescent dyes available for the automated analysis of DNA such as but not limited to 6-carboxyfluorescein (6-FAM), Hexachlorofluorescein (HEX), VIC dye, 5-carboxytetramethylrhodamine (TAMRA), 5-carboxy-X-rhodamine, succinimidyl ester (5-ROX), 6-carboxy-2′,4,7,7′-tetrachlorofluorescein (TET).
- 6-FAM 6-carboxyfluorescein
- HEX Hexachlorofluorescein
- VIC dye 6-carboxytetramethylrhodamine
- 5-carboxy-X-rhodamine 5-carboxy-X-rhodamine
- succinimidyl ester 5-ROX
- 6-carboxy-2′,4,7,7′-tetrachlorofluorescein TET
- Applied Biosystems has a set of 5 dyes that can be used to multiplex fragments from 4 separate amplification reaction and one standard for use in linkage mapping on the ABI sequencers.
- Four different CpG islands from a single individual can be linearly amplified using fluorescently tagged primers, and the products pooled before analysis.
- different CpG islands from different individuals can be linearly amplified using fluorescently tagged primers, and the products pooled before analysis.
- the methods provided herein can be advantageously used to analyze the extent of or percent methylation of a particular CpG dinucleotide site within a sample.
- two different fluorescent-dye terminators are used for thymine and cytosine, respectively (or adenine and guanine, respectively, when analyzing the opposite strand) in a fluorescent dideoxy sequencing reaction.
- the relative abundance of the two dyes in same-size extension products are indicative of the relative abundance of the two nucleotides at a particular sequence position, and can thereby indicate the percent methylation of a particular CpG dinucleotide site within a CpG island.
- control reactions with a range of known ratios of fully methylated to fully unmethlylated templates can be used.
- the data obtained from the control reactions can be used as a reference to estimate relative abundance of methylated and unmethylated cytosines in a sample.
- the levels of methylation or patterns of methylation at given CpG islands can be assayed as appropriate.
- the assay can employ the use of a reference standard when appropriate to enable the determination of abnormal methylation.
- a reference standard can be determined based on reference samples obtained from age-matched noncancerous classes of adjacent tissues, and with normal peripheral blood lymphocytes. When, for example, efficacy of treatment is being assessed, the assay results of biological samples taken over the course of treatment can be compared without the use of a reference standard.
- the methods described herein can include amplifying the DNA from the sample.
- Amplification can be done using PCR amplification or isothermal amplification methods, for example, those described in U.S. Pat. Nos. 5,854,033; 6,124,120; 6,143,495; 6,210,884; 6,642,034; 6,280,949; 6,632,609; and 6,642,034; and U.S. Pat. App. Pub. Nos. 2003/0032024; 2003/0143536; 2003/0235849; 2004/0063144; and 2004/0265897, which are incorporated herein by reference in their entirety.
- Isothermal amplification can include rolling circle or strand displacement amplification. Methods that combine PCR and isothermal amplification have also been described (U.S. Pat. Nos. 6,777,187; and 6,828,098; and U.S. Pat. App. Pub. Nos. 2004/0209298; 2005/0032104; and 2006/0068394, each of which is incorporated herein by reference in its entirety). U.S. Pat. App. Pub. No. 2005/0202490, which is incorporated herein by reference in its entirety, describes the use of such methods in combination with methylation-sensitive restriction enzymes to study the methylation pattern of DNA.
- DNA amplification can also include methylation-coupled whole genomic amplification to generate the DNA needed, such as described in U.S. Pat. App. Pub. No. 2006/0257905, which is incorporated by reference herein in its entirety.
- the methylation-coupled whole genomic amplification can be especially advantageous when DNA is recovered from minute biological samples or from bodily fluids such as urine or plasma.
- amplification methods described herein e.g., the PCR amplification, isothermal amplification, and termination-coupled linear amplification method
- mRNA and protein levels can be assayed, and alterations in their expression levels can be indicative of a change in the level of methylation or the patterns of methylation at given CpG islands.
- Such methods of assaying mRNA and protein levels are also within the skill in the art.
- the mRNA assay methods described in U.S. Provisional Patent Application No. 60/705,964 filed on Aug. 5, 2005 and International Patent Publication No. WO 2007/019444, which are hereby incorporated by reference can be used. Such methods are particularly useful if a degraded tissue sample is used as the biological sample.
- reverse transcription with gene-specific primers can be used to assay mRNA levels. Proteins levels can be assayed, for example, using antibody and staining techniques.
- the invention further provides target sequences and corresponding primers or probes that are useful in the above methods.
- the target sequences provide the context for the selection of CpG islands to assay for methylation. If a given target sequence contains more than one CpG island, all or less than all of the CpG islands, even one CpG dinucleotide, can be assayed for methylation with respect to that particular target sequence.
- a target sequence can include a genomic sequence that is fully methylated and fully deaminated such as SEQ ID NO: 1 or 2 [NRG1], SEQ ID NO: 3 or 4 [ADRB3], SEQ ID NO: 5 or 6 [GFRA2], SEQ ID NO: 7 or 8 [KIF13B], SEQ ID NO: 9 or 10 [RET], SEQ ID NO: 11 or 12 [GPR147], SEQ ID NO: 13 or 14 [NEUROG3], SEQ ID NO: 15 or 16 [PALD], SEQ ID NO: 17 or 18 [HEMK1], SEQ ID NO: 19 or 20 [FGF4], SEQ ID NO: 23 or 24 [HTR1A], SEQ ID NO: 25 or 26 [RNF180], SEQ ID NO: 27 or 28 [ECOP], SEQ ID NO: 29 or 30 [ZNF596], SEQ ID NO: 33 or 34 [LOC441320], SEQ ID NO: 35 or 36 [TDH], SEQ ID NO: 37 or 38 [FLJ36980], SEQ ID NO:
- a target sequence can include a genomic sequence that is partially methylated, such as in DNA obtained from a tumor, and then deaminated such that the target differs from the sequence listed above.
- a target sequence that includes a partially methylated and deaminated CpG island will result in a population of DNA molecules that differ at one or more positions that correspond to the cytosine residues in one or more CpG dinucleotides.
- a target sequence can include a variety of partially methylated and deaminated sequences based on the following genomic sequences SEQ ID NOS: 119 or 220 [KIFC2], SEQ ID NOS: 121 or 122 [C20ORF23], SEQ ID NOS: 123 or 124 [GFRA1], SEQ ID NOS: 129 or 130 [DKK2], SEQ ID NOS: 133 or 134 [RASSF5], SEQ ID NOS: 135 or 136 [NTN1], SEQ ID NOS: 139 or 140 [GPR147], SEQ ID NOS: 141 or 142 [NEUROG3], SEQ ID NOS: 143 or 144 [NODAL], SEQ ID NOS: 145 or 146 [PALD], SEQ ID NOS: 147 or 148 [LOC399783], SEQ ID NOS: 151 or 152 [LOC441320], SEQ ID NOS: 153 or 154 [ZNF596], SEQ ID NOS: 155 or
- targets can be used in combination with known targets (for example known CpG islands associated with GSTP1, GPX3, GSTM1, GSTM4, CSMD1, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, SFRP1, SFRP2, DKK3, PTGS2, CDKN1C/p57, RASSF1, and GPR62.
- known targets for example known CpG islands associated with GSTP1, GPX3, GSTM1, GSTM4, CSMD1, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, SFRP1, SFRP2, DKK3, PTGS2, CDKN1C/p57, RASSF1, and GPR62.
- SEQ ID NO: 31 or 32 [CSMD1]
- SEQ ID NO: 45 or 46 [TNFRSF10C] SEQ ID NO: 47 or 48 [TNFRSF10B] SEQ ID NO: 21 and 22 [GPR62].
- a target sequence can include fully or partially methylated and (subsequently) deaminated sequences based on the following genomic sequences SEQ ID NOS: 131 or 132 [GPX3], SEQ ID NOS: 125 or 126 [GPX7], SEQ ID NOS: 127 or 128 [GSTM4], SEQ ID NOS: 137 or 138 [SFRP2], SEQ ID NOS: 149 or 150 [CSMD1], SEQ ID NOS: 167 or 168 [TNFRSF10B], SEQ ID NOS: 169 or 170 [TNFRSF10C], and SEQ ID NOS: 187 or 188 [GPR62].
- Such target sequences can be isolated or purified in accordance with methods known in the art.
- isolated or purified primers derived from and suitable for amplifying sequences internal to the above isolated or purified nucleic acid molecules.
- the isolated or purified primers can be DNA, RNA, PNA, and the like. It will be understood by one of ordinary skill in the art, however, that one type of nucleic acid can be preferred over another, depending on the particular biological sample, the methodology employed in assaying CpG islands for methylation, and the ability of the particular type of nucleic acid to detect methylation.
- One or more (e.g., two, three four, four, five, six, seven, eight, nine ten or more) isolated pairs of primers can be provided.
- primers are provided as part of a kit useful in the methods disclosed herein.
- the pair of primers can consist essentially of SEQ ID NOS: 55 and 56, SEQ ID NOS: 57 and 58, SEQ ID NOS: 59 and 60, SEQ ID NOS: 61 AND 62, SEQ ID NOS: 63 and 64, SEQ ID NOS: 65 and 66, SEQ ID NOS: 67 and 68, SEQ ID NOS: 69 and 70, SEQ ID NOS: 71 and 72, SEQ ID NOS: 73 and 74, SEQ ID NOS: 75 and 76, SEQ ID NOS: 77 and 78, SEQ ID NOS: 79 and 80, SEQ ID NOS: 81 and 82, SEQ ID NOS: 83 and 84, SEQ ID NOS: 85 and 86, SEQ ID NOS: 87 and 88, SEQ ID NOS: 89 and 90, SEQ ID NOS: 91 and 92, SEQ ID NOS: 93 and 94, SEQ ID NOS: 95 and 96, SEQ ID NO
- each primer can be between 10 and 40 nucleotides and together the pair of primers can flank a region of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 140, 150, 200, 250, 300 bp in length that includes one or more CpG dinucloetides in a CpG island of interest.
- Primer pairs can be modified in various ways, such as by chemical modification of a base, and still be useful in the context of the invention.
- Other primers derived from the target sequences namely SEQ ID NOS: 1-54 and 119-198, and variants thereof, also can be used in the context of the invention.
- primers function to assay for methylation of a given CpG island.
- alternate primers can be selected or the provided primers can be modified or provided in degenerate form to account for target sequence polymorphisms within a given population, so long as the primers are still suitable for assaying modification of CpG islands associated with the genes disclosed herein.
- the primer pairs can be isolated or purified in accordance with methods known in the art. Alternatively, they can be synthesized using routine methods.
- the primers can be part of a kit.
- the kit comprises at least three pairs of primers, wherein each primer pair is specific for a CpG island associated with a different gene.
- the kit can comprise additional primer pairs, such as primer pairs for other CpG islands associated with the same gene or primer pairs for amplifying CpG islands associated with four, five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or even more genes.
- the kit can further comprise one or more reagents for assaying for methylation of CpG islands, instructions for use, and/or other components as are typically found in kits.
- the kit can comprise a buffer suitable for (a) isolating genomic DNA comprising a target sequence from a biological sample, (b) amplifying a portion of the target sequence, and/or (c) deaminating a target sequence.
- a kit can comprise one or more buffers suitable for preparing genomic DNA from serum and/or urine samples.
- This example demonstrates the determination of the methylation status of markers based on methylation-specific PCR amplification.
- Paraffin-embedded prostate tissues were obtained following radical prostatectomies. The tissue samples were sectioned into 23 10-micron sections and slide 1, 12, and 23 were stained using hematoxylin and eosin (H&E). Using the H&E slides as guide, the areas corresponding to the tumor tissues were microdissected from the unstained slides. The remaining tissues were recovered to use as a normal paired sample.
- the DNA was isolated from the tumor tissue and surrounding normal tissues using standard proteinase K digest for 5 days at 50° C., extraction with phenol/chloroform and ethanol precipitation ( Current Protocols in Molecular Biology , edited by Ausubel, et al., Wiley-Interscience (New York 1988, revised 1988-2006)). The DNA was resuspended in TE8 and the quality and quantity of the DNA was assessed by agarose gel electrophoresis using concentration and size standards as reference.
- the DNA was treated with 2.5 M sodium metabisulfite, pH 5.5, in the presence of 1 mM hydroquinone at a concentration of 1 ⁇ g of DNA/500 ⁇ l.
- the reaction was incubated in a thermocycler for a total of 8 cycles (95° C. for 5 minutes; 55° C. for 115 minutes).
- the DNA was purified using the QIAEX II purification kit (Qiagen, Valencia, Calif.) according to the manufacturer's recommendations and eluted in 50 ⁇ l of TE8. Sodium hydroxide (5.5 ⁇ l of 2 N) was added, and the DNA was incubated at RT for 15 min. The DNA was then precipitated with 3 volumes of ethanol and 0.3 volumes of 5 M NH 4 OAC. The DNA was resuspended in 50 ⁇ l of TE8 and stored at ⁇ 20° C.
- QIAEX II purification kit Qiagen, Valencia, Calif.
- PCR methylation-specific polymerase chain reaction
- All PCR reactions were performed in a MASTERCYCLER thermocycler (Eppendorf, Westbury, N.Y.) for 42 cycles of 95° C. for 15 seconds, 63° C. for 30 seconds, and 72° C. for 10 seconds.
- Each reaction was carried out in 30 ⁇ l of 1 ⁇ PLATINUM Taq PCR buffer containing 1.5 mM magnesium chloride, 0.25 mM dNTPS, 12.5 pmoles of each primer, and 0.5 units of PLATINUM Taq enzyme (Invitrogen, Carlsbad Calif.).
- the primers used for each CpG island and the size of the product are shown in Table 1, wherein “F” indicates forward primer, “R” indicates reverse primer, “m” indicates methylated, and “u” indicates unmethylated.
- DNA is obtained from tumor samples and treated with sodium bisulfite as described in example 1.
- Two microliters of the bisulfite treated DNA are amplified with the following primers: ADRB3-F1: GAGAAGAGGAAGGTAGAAGGAG [SEQ ID NO: 221] and ADRB3-R1: CTACCTAACTATAACCAACCC [SEQ ID NO: 222] for 40 cycles as described in example 1 except for the annealing temperature, which is lowered to 55° C.
- the amplified 250 bp product is purified using QIAquick PCR purification kit (Qiagen, Valencia Calif.) and recovered in TE8.
- ADRB3 amplified product Fifty nanograms of the ADRB3 amplified product is sequenced using 1.25 pmole of ADRB3-F2:ACGGAGGAGGATAGTAGTACG [SEQ ID NO: 223] using BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) and the sequencing reaction is purified using Centri-Sep columns (Applied Biosystems) according to the manufacturer's protocols.
- the products of the sequencing reaction are analyzed using an ABI 3700 sequencer according to manufacturer's specification.
- the resulting DNA sequence shows one or more sequence peaks corresponding to cytosine base or a mixed cytosine/thymidine base at the cytosine residue position of CpG dinucleotides that are fully or partially methylated in the original tumor DNA.
- a more detailed sequence analysis is obtained by cloning the product of the amplification reaction using a TOPO TA cloning kit (Invitrogen, Carlsbad Calif.) according to supplier's protocol. Approximately 20 colonies are chosen for further analysis. Each colony is grown in 3 ml of LB media for 16 hours. DNA is isolated from 1.5 ml aliquot using plasmid preparation kit from Qiagen. The plasmid DNA is quantitated using spectrophotometer and 1 microgram aliquot is sequenced as described above. The sequence of the 20 individual clones is compared to determine which cytosines are methylated and to provide an estimate of their rate of methylation in the tumor sample. This example shows that the methylation status of cytosines within CpG islands can be determined using a sequencing approach.
- This example demonstrates the determination of the methylation pattern of multiple CpG islands associated with KIFC2, GFRA1 and GPX7 using terminator-coupled linear amplification.
- DNA from tumor samples prepared as described in example 1 fragments of the CpG islands associated with KIFC2, GFRA1, GPX7 are amplified individually using the mF1 and mR1 primers shown below for each CpG island.
- the amplification reactions are performed for 42 cycles as described in example 1 except for the annealing temperature, which was lowered to 58° C.
- Each amplification product (25 nanograms) is subjected to linear terminator-coupled amplification using 1.5 pmoles of the fluorescently labeled F2 primer shown below for the corresponding amplicon.
- the amplification reaction includes 1 ⁇ VentR (exo ⁇ ) DNA polymerase (New England Biolabs, Beverly Mass.), 30 ⁇ M dATP, 37 ⁇ M dCTP, 100 ⁇ M dGTP, 100 M dTTP, 480 ⁇ M ddCTP and 2 units of VentR (exo ⁇ ) DNA polymerase. Reactions are performed in an MASTERCYCLER thermocycler (Eppendorf) for 30 cycles of 95° C. for 15 seconds, 58° C. for 30 seconds, and 72° C. for 30 seconds.
- Eppendorf MASTERCYCLER thermocycler
- reaction products are pooled into a single tube and purified using Centri-Sep columns (Applied Biosystems) according to the manufacturer's protocols.
- GENESCAN 500 LIZ standard (Applied Biosystems) is added to one tenth of the purified fragment and the DNA separated using the ABI Prism 3100 Genetic Analyzer (Applied Biosystems) according to manufacture's instructions.
- the data is analyzed using the GENESCAN and the GENEMAPPER software (Applied Biosystems).
- the following primers are used for the amplifications:
- KIFC2-F1 AGGTA(C/T)GTTGTATTTGGTGGATTTGG [SEQ ID NO: 224] KIFC2-R1: CCCACCTACAACAACAACACC [SEQ ID NO: 225] KIFC2-F2: 6FAM-GAACGCGTACGGAAGGTAGG [SEQ ID NO: 226] GFRA1-F1: GTGATAGGTTTGTAGATTTGATAGTTG [SEQ ID NO: 227] GFRA1-R1: AACTAACCTCCATTTTAACTATTTC [SEQ ID NO: 228] GFRA1-F2: NED-GAGAGATGAATTTGGATATTAGT [SEQ ID NO: 229] GPX7-F1: GGTAAATTGGTGT(C/T)GTTGGAGAAG [SEQ ID NO: 230] GPX7-R1: ACTAAACAATAATACCC(A/G)ACCTC [SEQ ID NO: 231] GPX7-F2: VIC
- the F1 and R1 primers are used for the amplification of a fragment of a CpG island from the tumor DNA.
- the F2 primers are used for termination-coupled linear amplification.
- termination-coupled linear amplification fragment lengths can be analyzed to (i) determine the presence and/or the positions of methylated cytosines in CpG islands in a sequence of interest as well as (ii) provide information about the efficiency of the deamination reaction, since incomplete deamination results in fragments with length that differ than what is expected from the positions of the CpG dinucleotides within the sequence.
- Urine samples were obtained from 4 patients that were recently diagnosed with prostate cancer. 50 ml samples were spun down at 4000 rpm for 15 min, transferred to 1.5 ml tubes and washed twice with PBS. The DNA was extracted using proteinase K digest (100 ⁇ l of 25 mM Tris pH8.0, 100 mM NaCL, 1% SDS, 5 mM EDTA and 10 ⁇ g of Proteinase K followed by phenol/chloroform extraction and ethanol precipitation. The DNA was resuspended in 10 ⁇ l TE8 buffer (10 mM Tris, pH 8.0, 1 mM EDTA).
- a partially random primer with the sequence GGGN 6 (50 ng) was added to 5 ⁇ l of DNA. 12 ⁇ l of a denaturing solution (50 mM KOH, 0.1 mM EDTA) was added to the DNA/random primer mix. After a five-minute incubation at room temperature, 12 ⁇ l of a neutralization solution (60 mM Tris (pH 7.5), 50 mM HCl) was added to neutralize the reaction. The DNA/primer mix was denatured at 94° C. for 5 minutes, incubated at room temperature for 10 minutes, and then placed on ice.
- the amplification reaction was set up in a final volume of 30 ⁇ l.
- the following reagents were added to give the indicated final concentrations: (a) 1 ⁇ NEB buffer 2 (1 ⁇ NEB buffer 2: 50 mM NaCl, 10 mM Tris-HCl, pH 7.9, 10 mM MgCl 2 , 1 mM dithiothreitol), 333 ⁇ M dATP, dCTP, dGTP, dTTP, 160 ⁇ M S-adenosylmethionine, and 10 ng/ ⁇ l of bovine serum albumin (BSA) were combined and to which was added (b) DNA methyltransferase enzyme 1 (0.15 units/ ⁇ l) (New England Biolabs) and incubated at 37° C. for 10 minutes, and followed by (c) adding Klenow polymerase to a final concentration of 0.167 units/ ⁇ l, and Klenow exo ⁇ to a final concentration of 0.167 units/ ⁇ l (New England Biolabs
- the reaction was incubated at 37° C. for 16 hours, and the reaction was stopped by the addition of EDTA to a final concentration of 5 mM, phenol/chloroform extracted, and ethanol precipitated.
- the DNA was resuspended in 40 ⁇ l of TE8 and 2 ⁇ l were separated on agarose gel to verify the presence of DNA.
- the DNA was treated with sodium bisulfite and analyzed by methylation specific PCR as described in Example 1 using the GPR147 and RET assays. The presence of a band of the expected size for either marker indicated the methylation of the associated marker in the input DNA.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Provided are methods, reagents, and kits for evaluating cancer, such as prostate cancer, in a subject. Disclosed methods of evaluating cancer include methods of diagnosing cancer, methods of prognosticating cancer and methods of assessing the efficacy of cancer treatment. The methods include assaying a biological sample for methylation of a CpG island associated with specified genes. Provided reagents and kits include primers suitable for amplifying at least a portion of a target CpG islands associated with specified genes.
Description
- This patent application is a continuation of International Patent Application No. PCT/US2006/060685, filed Nov. 8, 2006, designating the United States, which claims the benefit of U.S. Provisional Patent Application No. 60/734,577, filed Nov. 8, 2005, which are incorporated by reference herein in their entirety.
- Incorporated by reference in its entirety herein is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 214,875 Byte ASCII (Text) file named “702375_ST25.TXT,” created on May 2, 2008.
- Phosphate linked cytosine-guanine (CpG) dinucleotides are statistically underrepresented in the genomes of higher eukaryotes, including mammals. The dinucleotide is reportedly found at only 5-10% of its predicted frequency. The majority of CpG dinucleotides that do remain in the human genome are normally located within repetitive sequences that are characterized by low gene expression levels and exhibit methylation at the cytosine residues.
- CpG islands, on the other hand, represent genomic sequences that contain clusters of CpG dinucleotide. CpG islands may be associated with the promoter region or 5′ end of coding sequences or may be present within introns or in genomic regions that are not known to be associated with coding sequences. They may be unmethylated or methylated in normal tissues and the methylation pattern may be used to control tissue specific expression and the expression of imprinted genes. Methylation of CpG islands within promoter regions can result in the downregulation or silencing of the associated gene. An increase in methylation of normally unmethylated islands is observed in aging tissues even as the overall methylcytosine content of the DNA is reduced. The aberrant methylation pattern is more pronounced in cancer cells with increased methylation or hypermethylation detected in various cancer tissues. CpG islands may be methylated to varying densities within the same tissue. Thus, aberrant methylation of cytosines within CpG islands can be a primary epigenetic event that acts to suppress the expression of genes involved in critical cellular processes, such as DNA damage repair, hormone response, cell-cycle control, and tumor-cell adhesion/metastasis, leading to tumor initiation, progression and metastasis (Li et al., Biochim. Biophys. Acta, 1704: 87-102 (2004)). It has been proposed that a unique profile of promoter hypermethylation exists for each human cancer in which some gene changes are shared and other gene changes are cancer-type specific (Esteller et al., Cancer Res., 61: 3225-3229 (2001)). Given that aberrant methylation represents new information not normally present in genomic DNA and that aberrant methylation is a common DNA modification and affects a large number of genomic targets, it is feasible to develop diagnostic and prognostic tests based on information obtained from multiple target CpGs. Such tests may be based on CpGs that are aberrantly hypermethylated or hypomethylated in the diseased tissues. They may also be based on changes in methylation density in CpG islands as long as the changes corrolate with the presence of cancer.
- Prostate cancer, for example, which is the most common malignancy and the second leading cause of death among men in the U.S. (Li et al. (2004), supra), has been found to be associated with the methylation of CpG islands in the promoters of over 30 genes, in particular the CpG island of the glutathione S-transferase P1 (GSTP1) gene. GSTP1 methylation has been detected in over 50% of DNA recovered from urine and plasma of prostate cancer patients (Goessl et al., Ann. N.Y. Acad. Sci., 945: 51-58 (2001); Cairns et al., Clin. Cancer Res., 7: 2727-2730 (2001); Jeronimo et al., Urology, 60: 1131-1135 (2002); and Gonzalgo et al., Clin. Cancer Res., 9: 2673-2677 (2003)). However, if diagnosis of prostate cancer relied solely on the detection of the methylation of the CpG island in the GSTP1 gene, the theoretical limit of the sensitivity of such a test would only be approximately 90%. GSTP1 is also methylated in prostatic intraepithelial lesions (PIN) which may lead to a false positive diagnosis. Some CpG islands are methylated in prostate cancer and other diseases of the prostate, such as benign prostatic hyperplasia (BPH). They may even exhibit some degree of methylation in normal aging prostates. Such markers may not be suitable individually for prostate cancer diagnosis. Therefore, a panel of markers is required to achieve the sensitivity and specificity needed for a clinical test.
- The prostate-specific antigen or PSA test continues to be widely used in the early detection of prostate cancer. While the PSA test has resulted in the majority of prostate cancer cases being diagnosed in asymptomatic men (Mettlin et al., Cancer, 83(8): 1679-1684 (1998a); Mettlin et al., Cancer, 82(2): 249-251 (1998b); Humphrey et al., J. Urol., 155: 816-820 (1996); and Grossfeld et al., Epidemiol. Rev., 23(1): 173-180 (2001)), the PSA test suffers from poor specificity, which can be as low as 33% when a PSA cut-off level of 2.6 ng/ml is used (Thompson et al., N. Engl. J. Med., 350: 2239-2246 (2004)), even though the sensitivity can be as high as 83%. The poor specificity of the PSA test is a direct result of increased secretion of PSA in other diseases of the prostate, such as BPH and prostatitis. Thus, an elevated PSA level indicates the need for additional screening in the form of needle biopsy. Ultimately, the results of needle biopsies lead to the diagnoses of prostate cancer.
- Over 1 million needle biopsies of prostates are performed each year at a cost of about $1,500 each and much discomfort to the patient. However, less than 200,000 of these result in a diagnosis of prostate cancer. Therefore, the majority of needle biopsies are being performed needlessly.
- In view of the above, there is a need for non-invasive methods of diagnosing and prognosticating cancer, such as prostate cancer, that reduce the cost and suffering associated with currently available cancer screening methods. It is an object of the invention to provide materials and methods for non-invasive diagnosis and prognosis of cancer, such as prostate cancer. This and other objects and advantages, as well as additional inventive features, will become apparent from the detailed description provided herein.
- The invention provides materials and methods for evaluating cancer. Methods of evaluating can include methods of diagnosing and prognosticating cancer as well as methods of assessing the efficacy of cancer treatment. Generally, the methods provided involve assaying for methylation of CpG islands associated with specific genes. The invention also provides pairs of isolated or purified primers that can be used in the methods of the invention, for example, to amplify and/or detect the methylation state of the CpG islands associated with specific genes. The invention also provides kits comprising one or more pairs of primers useful in the disclosed methods.
- The invention provides methods of diagnosing cancer by assaying for one or more methylated CpG islands that are indicative of cancer. Generally, the method comprises providing a biological sample from a subject in need of cancer diagnosis and assaying the sample for methylation of one or more CpG islands associated with at least one gene selected from the group consisting of: neuregulin cell-surface ligand (NRG1), adrenergic B3 receptor (ADRB3), glycosylphosphatidyl-inositol cell-surface receptor (GFRA2), kinesin family member 13B (KIF13B), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (predicted protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1),
fibroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1A (HTR1A), ring finger protein 180 (LOG 285671 or RNF180), EGFR-co-amplified and overexpressed (DKFZP564K0822 or ECOP), zinc finger protein 596 (ZNF596), similar to 7 transmembrane helix receptor (LOC441320), L-threonine dehydrogenase (TDH), hypothetical protein FLJ36980 (FLJ36980), fibroblast growth factor receptor 20 (FGF20), EF-hand domain family member 2A (LOC286097 or EFHA2), N-acylsphingosine amidohydrolase (acid ceraminase) 1 (ASAH1), nodal homolog (TGF-β signaling pathway) (NODAL), hypothetical protein similar to zinc finger protein 532 (LOC399783), transcription factor LIM homeodomain (ISL2) Kinesin family member C2 (KIFC2),chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), matrix metallopeptidase 9 (MMP9), tumor necrosis factor superfamily member 11 (TNFSF11), ras homolog gene family member D (RHOD), and leucine rich repeat containing 49 (LRRC49). - The invention also provides a method of diagnosing prostate cancer in a male mammal by assaying for one or more methylated CpG islands that are indicative of prostate cancer. The method can include providing a biological sample from a subject in need of cancer diagnosis and assaying the sample for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, ECOP, ZNF596, LOC441320, TDH, FLJ36980, EFHA2, ASAH1, NODAL, LOC399783, ISL2, MMP9, TNFSF11, RHOD or LRRC49. Kinesin family member C2 (KIFC2),
chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), Ras association (RalGDS/AF-6) domain family 5 (RASSF5), and HtrA serine peptidase 4 (HTRA4). Optionally, the method of diagnosing prostate cancer can also include assaying for methylation of one or more CpG island associated with at least one gene that is known to be methylated in prostate cancer but is known not to be detectably methylated or is methylated at a lower level (e.g., about 50% or less, about 40% or less, 30% or less, about 20% or less, or about 10% or less) in BPH. - The invention also provides methods of prognosticating cancer by assaying for the methylation of one or more genes that are indicative of the grade or stage of the cancer, and/or the length of disease-free survival following treatment for cancer. Generally, the method comprises providing a biological sample from a subject in need of cancer prognosis and assaying the sample for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, MMP9, TNFSF11, RHOD and LRRC49.
- Further provided by the invention is a method of prognosticating prostate cancer in a male mammal by assaying for one or more methylated CpG islands that are indicative of the grade or stage of prostate cancer, and/or the length of disease-free survival following treatment of prostate cancer. The method comprises providing a biological sample from the male mammal and assaying the sample for methylation of a CpG island associated with at least one of the following genes: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, GPR62, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, RASSF5, HTRA4, MMP9, TNFSF11, RHOD or LRRC49. Optionally, the method of prognosticating prostate cancer can also include assaying the biological sample for methylation of a CpG island associated with at least one gene that is known to be methylated in prostate cancer but is known not to be detectably methylated or is methylated at a lower level (e.g., about 50% or less, about 40% or less, 30% or less, about 20% or less, or about 10% or less) in BPH. Methylation of the CpG islands associated with the genes is indicative of the grade or stage of the cancer, and/or the length of disease-free survival following treatment.
- Furthermore, the invention provides methods of assessing the efficacy of treatment of cancer by assaying for the reduced methylation of CpG islands that indicates efficacy of treatment. Generally, the method comprises providing a first and a second biological sample from a subject in need of assessing the efficacy of treatment of cancer and assaying the samples for a change in methylation level of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, MMP9, TNFSF11, RHOD and LRRC49. The first biological sample is taken before the second biological sample, and the second biological sample is taken during or after a course of treatment. A decrease or absence of methylation of the assayed one or more CpG islands in the second sample (i.e., following the course of treatment) indicates that the treatment is effective. Alternatively, the maintenance or increase of methylation in the assayed CpG islands in the second sample can indicate a reduction or absence of treatment efficacy.
- Also provided is a method of assessing the efficacy of treatment of prostate cancer in a male mammal by assaying biological samples, which are taken from the male mammal periodically during the course of treatment, for methylation of a CpG island and wherein a decrease or absence of methylation of the CpG islands following the course of treatment indicates that the treatment is effective. The method comprises (a) providing a first and a second biological sample from a subject undergoing a course of cancer treatment, wherein the first sample is taken at an earlier time than the second sample, and the second sample is taken during or following a course of treatment and (b) assaying the samples for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, RASSF5, HTRA4, MMP9, TNFSF11, RHOD and LRRC49. Optionally, this method can also include assaying the biological sample for methylation of a CpG island associated with at least one gene that is known to be methylated in prostate cancer but is known not to be detectably methylated or is methylated at a lower level (e.g. about 50% or less, about 40% or less, 30% or less, about 20% or less, or about 10% or less in BPH.
- In preferred embodiments, the aforementioned methods of diagnosing, prognosticating and assessing the efficacy of treatment of cancer can further include assaying the biological sample for methylation of multiple CpG islands, for example, CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more genes.
- Additionally, the invention provides a terminator-coupled linear amplification method of determining the methylation status of a CpG island. Generally, the method includes providing a DNA sample for terminator-coupled linear amplification and then incubating the DNA sample under deaminating conditions to thereby produce a deaminated DNA sample. Optionally, the deaminated DNA sample can be purified. The deaminated sample is used as template to amplify a target sequence or target sequences that include one or more CpG islands or portions of one or more CpG islands thereby producing one or more amplified target sequences. Optionally, the one or more amplified target sequences are purified. One or more sequences in the amplified target sequences are linearly amplified in the presence of a primer and a dideoxynucleotide to generate one or more fragments of different lengths, wherein each length corresponds to the distance in bases from the 5′ end of the primer to the position where the dideoxynucleotide is incorporated. Optionally, the one or more fragments is purified. The one or more fragments are analyzed to determine their lengths. The lengths of the fragments can be used to determine the methylation status of methylated cytosines within the one or more amplified target sequences.
- The invention also provides pairs of primers suitable for amplifying a CpG-island associated with genes described herein. Primers can include isolated or purified nucleic acid molecules suitable for amplifying a CpG island containing target sequence. Target sequences can include genomic sequence that has been fully methylated and fully deaminated such as those in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, and SEQ ID NO: 54.
- Exemplary primer pairs include SEQ ID NOS: 55 and 56, SEQ ID NOS: 57 and 58, SEQ ID NOS: 59 and 60, SEQ ID NOS: 61 AND 62, SEQ ID NOS: 63 and 64, SEQ ID NOS: 65 and 66, SEQ ID NOS: 67 and 68, SEQ ID NOS: 69 and 70, SEQ ID NOS: 71 and 72, SEQ ID NOS: 73 and 74, SEQ ID NOS: 77 and 78, SEQ ID NOS: 79 and 80, SEQ ID NOS: 81 and 82, SEQ ID NOS: 83 and 84, SEQ ID NOS: 87 and 88, SEQ ID NOS: 89 and 90, SEQ ID NOS: 91 and 92, SEQ ID NOS: 93 and 94, SEQ ID NOS: 95 and 96, SEQ ID NOS: 97 and 98, SEQ ID NOS: 103 and 104, SEQ ID NOS: 105 and 106, SEQ ID NOS: 107 and 108, SEQ ID NOS: 109 and 110, SEQ ID NOS: 111 and 112, SEQ ID NOS: 113 and 114, SEQ ID NOS: 115 and 116, SEQ ID NOS: 117 and 118, SEQ ID NOS: 199 and 200, SEQ ID NOS: 201 and 202, SEQ ID NOS: 203 and 204, SEQ ID NOS: 205 and 206, SEQ ID NOS: 207 and 208, SEQ ID NOS: 209 and 210, SEQ ID NOS: 211 and 212, SEQ ID NOS: 213 and 214, SEQ ID NOS: 215 and 216, SEQ ID NOS: 217 and 218, SEQ ID NOS: 219 and 220, SEQ ID NOS: 221 and 222, SEQ ID NOS: 224 and 225, SEQ ID NOS: 227 and 228, SEQ ID NOS: 227 and 228, SEQ ID NOS: 230 and 231.
- Also provided are kits that include one or more of the aforementioned pairs of primers.
- FIGS. 1A-1DD set forth the nucleotide sequences for SEQ ID NOS: 1-54. Sequences are presented in accordance with convention from left to right and top to bottom.
- FIGS. 2A-2KK set forth the nucleotide sequences for SEQ ID NOS: 119-198. Sequences are presented in accordance with convention from left to right and top to bottom.
- The invention provides a method of diagnosing cancer by assaying for the methylation of one or more CpG islands that are indicative of cancer. Cancer can include, for example, lung, liver, pancreas, head and neck, throat, thyroid, esophagus, brain, ovarian, kidney, skin, colorectal, and hematopoeietic (e.g., lymphomas and leukemic) cancer. Generally, the method comprises providing a biological sample from a subject in need of cancer diagnosis and assaying the sample for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, MMP9, TNFSF11, RHOD or LRRC49. In preferred embodiments, the method can include assaying for methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes. Methylation of the CpG islands associated with these genes is indicative of cancer.
- The invention further provides a method of diagnosing prostate cancer by assaying for the methylation of one or more CpG islands that are indicative of prostate cancer in a male mammal. In one embodiment, the method comprises providing a biological sample from a male mammal in need of cancer diagnosis and assaying the sample for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, RASSF5, HTRA4, MMP9, TNFSF11, RHOD and LRRC49. For example, the method of diagnosing prostate cancer includes assaying the biological sample for methylation of a CpG island associated with NRG1, KIF13B, or both. In another example, the method includes assaying for methylation of a CpG island associated with at least one gene selected from the group consisting of: TDH, ASAH1, FGF20, HEMK1, PALD NEUROG, EFHA2, KIFC2, GFRA1, DKK2, TNFSF11, NTN1, and RHOD. In preferred embodiments, the method of diagnosing prostate cancer can include assaying for methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes. Methylation of the CpG islands associated with these genes is indicative of cancer.
- The foregoing method of diagnosing prostate cancer can optionally include, in combination with assaying for methylation of CpG islands associated with the foregoing genes, further assaying the biological sample for methylation of a CpG island associated with at least one gene that is known to be (i) methylated in prostate cancer and (ii) not detectably methylated or methylated at a lower level (e.g., about 50% or less, about 40% or less, about 30% or less, about 20% or less, or less than about 10%) in BPH. In this regard, when the method includes assaying for at least one CpG island that is known to be methylated in prostate cancer but is known not to be detectably methylated or methylated at a lower level in BPH, the method preferably includes assaying the biological sample for methylation of CpG islands associated with at least three different genes. Examples of CpG islands known to be methylated in prostate cancer but not detectably methylated or methylated at a lower level in BPH include CpG islands associated with glutathione S-transferase P1 (GSTP 1), glutathione peroxidase 3 (GPX3), glutathione S-transferase M1 (GSTM1), glutathione S-transferase M4 (GSTM4), Cub and Sushi multiple domains1 (CSMD1), tumor necrosis factor receptor superfamily member 10A (TNFRSF10A) tumor necrosis factor receptor superfamily member 10B (TNFRSF10B), tumor necrosis factor receptor superfamily member 10C (TNFRSF10C), tumor necrosis factor receptor superfamily 10D (TNFRSF10D), secreted frizzled-related protein 1 (SFRP1), secreted frizzled-related protein 2 (SFRP2), dickkopf homolog 3 (DKK3), prostaglandin-endoperoxide synthase 2 (PTGS2), cyclin-dependent kinase inhibitor 1C (CDKN1C/p57), Ras association (RalGDS/AF-6) domain family 1 (RASSF1), and G-protein coupled receptor 62 (GPR62).
- The invention also provides a method of prognosticating cancer by assaying for the methylation of one or more genes that are indicative of the grade or stage of the cancer, and/or the length of disease-free survival following treatment for cancer. Generally, the method comprises providing a biological sample from a subject in need of cancer prognosis and assaying the sample for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, MMP9, TNFSF11, RHOD and LRRC49. In preferred embodiments, the method can include assaying for methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes. Methylation of the CpG islands associated with these genes is indicative of the grade or stage of the cancer, and/or the length of disease-free survival following treatment for cancer.
- The invention also provides a method of prognosticating prostate cancer in a male mammal by assaying for the methylation of one or more CpG islands that are indicative of the grade or stage of the prostate cancer, and/or the length of disease-free survival following treatment for prostate cancer. In one embodiment, the method comprises assaying a biological sample from the male mammal for methylation of a CpG island associated with at least one of the following genes: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTRIA, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, or ISL2. In addition to or instead of the foregoing, the method can include assaying the biological sample for methylation of a CpG island associated with at least one of the following genes: KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, RASSF5, HTRA4, MMP9, TNFSF11, RHOD or LRRC49. For example, the method of diagnosing prostate cancer includes assaying the biological sample for methylation of a CpG island associated with NRG1, KIF13B, or both. In another example, the method includes assaying for at least one of the following genes: TDH, ASAH1, FGF20, HEMK1, PALD NEUROG, EFHA2, KIFC2, GFRA1, DKK2, TNFSF11, NTN1, or RHOD. In preferred embodiments, the method of diagnosing prostate can include assaying for methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes. Methylation of the CpG islands associated with these genes is indicative of the grade or stage of prostate cancer, and/or the length of disease-free survival following treatment for prostate cancer.
- The foregoing method of prognosticating prostate cancer can optionally include, in combination with assaying for methylation of CpG islands associated with the foregoing genes, further assaying the biological sample for methylation of a CpG island associated with at least one gene that is known to be (i) methylated in prostate cancer and (ii) not detectably methylated or methylated at a lower level (e.g., about 50% or less, about 40% or less, about 30% or less, about 20% or less, or less than about 10%) in BPH. Percent methylation level in BPH refers to the percent of patients that exhibit some detectable level of methylation at that locus. In this regard, when the method includes assaying for methylation of at least one CpG island that is known to be methylated in prostate cancer but is known not to be detectably methylated or is methylated at a lower level in BPH, the method preferably includes assaying the biological sample for methylation of CpG islands associated with at least three different genes. Examples of CpG islands known to be methylated in prostate cancer but not detectably methylated or methylated at a lower level in BPH include CpG islands associated with GSTP1, GPX3, GSTM1, GSTM4, CSMD1, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, SFRP1, SFRP2, DKK3, PTGS2, CDKN1C/p57, RASSF1, and GPR62. Methylation of CpG islands associated with the genes is indicative of the grade or stage of the prostate cancer, and/or the length of disease-free survival following treatment for prostate cancer.
- Obtaining information about the aggressiveness of the cancer, its grade, and its stage is helpful when choosing a course of treatment. The patterns of CpG methylation may be correlated to the pathological stage and grade of the tumor. For example, in prostate cancer, patterns of CpG methylation may be correlated to the Gleason score of the primary tumor. The molecular information derived from CpG methylation may also be correlated to the likelihood of survival and the length of disease-free survival following treatment. The above prognostic methods can enable the prediction of the course of the cancer, as well as the prediction of the best approach to treatment.
- Also provided are methods of assessing the efficacy of treatment of cancer by assaying for the reduced methylation of CpG islands that indicates efficacy of treatment. Generally, the method comprises providing a first and a second biological sample from a subject in need of assessing the efficacy of treatment of cancer and assaying the samples for a change in methylation level of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, ISL2, KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, MMP9, TNFSF11, RHOD and LRRC49. Generally, the first biological sample is taken (e.g, prior to commencing treatment or during treatment) before the second biological sample, and the second biological sample is taken after a course of treatment. In preferred embodiments, the method includes assaying for a change in methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes. A decrease or absence of methylation of the assayed one or more CpG islands in the second sample (i.e., following the course of treatment) indicates that the treatment is effective. Alternatively, the maintenance or increase of methylation in the assayed CpG islands in the second sample can indicate a reduction or absence of treatment efficacy.
- The invention provides a method of assessing the efficacy of treatment of prostate cancer in a male mammal by assaying for the reduced methylation of CpG islands that indicate efficacy of treatment of prostate cancer. In one embodiment, the method comprises assaying biological samples, which are taken from the male mammal periodically during the course of treatment, for methylation of a CpG island associated with at least one gene selected from the group consisting of: NRG1, ADRB3, GFRA2, KIF13B, RET, GPR147, NEUROG3, PALD, HEMK1, FGF4, HTR1A, RNF180, DKFZP5640822, ZNF596, LOC441320, TDH, FLJ36980, FGF20, EFHA2, ASAH1, NODAL, LOC399783, and ISL2. In addition to or instead of the foregoing, the method can include assaying the biological samples for methylation of a CpG island associated with at least one gene selected from the group consisting of: KIFC2, C20orf23, GFRA1, GPX7, DKK2, NTN1, RASSF5, HTRA4, MMP9, TNFSF11, RHOD and LRRC49. For example, the method of assessing the efficacy of treatment of prostate cancer includes assaying the biological sample for methylation of a CpG island associated with NRG1, KIF13B, or both. In another example, the method includes assaying for a CpG island associated with at least one gene selected from the group consisting of: TDH, ASAH1, FGF20, HEMK1, PALD NEUROG, EFHA2, KIFC2, GFRA1, DKK2, TNFSF11, NTN1, and RHOD. In preferred embodiments, the method can include assaying for methylation of CpG islands associated with two, three, four, five, six, seven, eight, nine, ten, eleven, or more of the foregoing genes. Generally, the assayed biological samples in the method include a first and a second biological sample. The first biological sample can be taken, for example, prior to commencing treatment or during treatment, though in any event prior to taking the second biological sample. The second biological sample is taken during or after a course of treatment. A decrease or absence of methylation of the assayed one or more CpG islands in the second sample (i.e., following the course of treatment) as compared to the first sample indicates that the treatment is effective. Alternatively, the maintenance or increase of methylation in the assayed CpG islands in the second sample as compared to the first sample can indicate a reduction in or absence of treatment efficacy.
- The foregoing method of assessing the efficacy of prostate cancer treatment can optionally include, in combination with assaying for methylation of CpG islands associated with the foregoing genes, further assaying the biological sample for reduced methylation of a CpG island associated with at least one gene that is known to be (i) methylated in prostate cancer and (ii) not detectably methylated or methylated at a lower level (e.g., about 50% or less, about 40% or less, about 30% or less, about 20% or less, or less than about 10%) in BPH. In this regard, when the method includes assaying the biological samples for methylation of at least one CpG island that is known to be methylated in prostate cancer but known not to be detectably methylated or methylated at a lower level in BPH, the method preferably includes assaying for methylation of CpG islands associated with at least three different genes. Examples of CpG islands known not to be methylated in prostate cancer but not detectably methylated or methylated at a lower level in BPH include GSTP1, GPX3, GSTM1, GSTM4, CSMD1, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, SFRP1, SFRP2, DKK3, PTGS2, CDKN1C/p57, RASSF1, and GPR62. A decrease or absence of methylation of the CpG islands associated with the assayed genes in the second sample as compared to the first sample following some or all of the course of treatment indicates that the treatment is effective. Alternatively, the maintenance or increase of methylation in the assayed CpG islands in the second sample as compared to the first sample can indicate a reduction or absence of treatment efficacy.
- CpG islands (Bird, Nature 321: 209-213 (1986); and Gardiner-Garden et al., J. Molec. Biol. 196: 261-282 (1987)) comprise about 1% of vertebrate genomes and account for about 15% of the total number of CpG dinucleotides. CpG islands typically are between about 0.2 and about 2.0 kb in length. They can be located upstream of (e.g., in a promoter or enhancer region) of the coding sequence of the associated genes or they may also extend into or be found within gene-coding regions of their associated genes. A gene-coding region can include exons and introns. Use of the phrase “associated with” to describe a CpG island's relation to a gene, is intended to encompass CpG islands that are upstream of gene coding sequences as well as internal CpG islands. For example, the CpG island associated with the RET gene is internal and not expected to affect the expression of the RET gene when methylated. Some CpG islands are associated with the promoter of two genes and it can affect the expression of both genes. CpGs were labeled based on their location with respect to the nearest gene. In some cases, a CpG island may be located near the promoter of two different genes and may in this case influence the expression of both genes. In such case, the CpG island was named after one of the genes. For example, the LRRC49 CpG island is also associated with the THAP domain containing 10 (THAP10) gene. A CpG island can also be associated with a pseudogene or be located in a genomic region that includes no known genes or pseudogenes. The CpG island can still be of interest so long as its methylation status correlates with a disease status.
- A CpG island can be separated by up to 25 kilobases (kb) (e.g., up to 20 kb, up to 19 kb, up to 18, kb, up to 17 kb, up to 16 kb, up to 15 kb, up to 10 kb, up to 9 kb, up to 8 kb, up to 7 kb, up to 6 kb, up to 5 kb, up to 4 kb, up to 3 kb, up to 2 kb, or up to 1 kb) from the transcription start site for the nearest gene and still be considered “associated with” the gene. Preferably, CpG islands associated with at least three genes are assayed. However, CpG islands associated with 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or even more genes can be assayed.
- Methods of identifying CpG islands have been described (e.g., Takai et al., Proc. Nat'l. Assoc. Sci. USA, 99:3740-3745 (2002)). For example, genomic sequences can be analyzed to identify segments containing CpG islands that are at least 200 bp in length, have at least a 60% GC content, and contain at least 7% CpG dinucleotides. Preferred sequences are at least 250 bp in length, are at least 60% GC rich, and contain at least 7% CpG dinucleotides. Moreover, undesirable highly repetitive sequences can be screened out using a repeat masker that filters out sequences. Desirable sequences contain less than 50% repeats (i.e., a sequence of reduced complexity or a sequence that is present at multiple genomic locations) within the length of the identified CpG island. Preferably, the CpG island is no more than 45%, 40%, 35%, 30%, 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, or 11% repetitive. Most desirable sequences are no more than 10% repetitive. Examples of repetitive sequences are available, for example, at the web site for National Center for Biotechnology Information (NCBI).
- “Biological sample” is intended to encompass any suitable sample that enables accurate assay of CpG island methylation. Examples of suitable biological samples include, but are not limited to, whole blood, blood plasma, blood serum, urine, saliva, cells (e.g., cells obtained from blood, such as epithelial cells), and tissue. Such samples are obtained in accordance with methods known in the art. When the biological sample is whole blood, blood plasma, or urine, preferably, CpG islands associated with more than three genes are assayed.
- A CpG island is “not detectably methylated” when it is not methylated or it is methylated at a level below the level of sensitivity of the assay method employed.
- “Noncancerous” tissue can be benign or normal. Alternatively, but not preferably, the tissue can be diseased, as long as it is not cancerous.
- Methods of assaying methylation of CpG islands are known in the art and include, for example, restriction enzyme-based technology, such as one that employs digestion with a methylation-sensitive restriction endonuclease coupled with Southern blot analysis, methylation-sensitive enzymes and polymerase chain reaction (PCR), such as methylation-sensitive arbitrarily primed PCR (AP-PCR; see, e.g., Gonzalgo et al., Cancer Res., 57: 594-599 (1997)), restriction landmark genomic scanning (RLGS; see, e.g., Plass et al., Genomic 58: 254-262 (1999)), methylated CpG island amplification (MCA; see, e.g., Toyota et al., Cancer Res., 59: 2307-2312 (1999)), differential methylation hybridization (DMH; see, e.g., Huang et al., Human Mol. Genet., 8: 459-470 (1999)), and Not I-based differential methylation hybridization (see, e.g., International Patent Publication No. WO 02/086163). Other methods are described in U.S. Pat. App. Pub. No. 2003/0170684 and International Patent Publication No. WO 04/05122.
- Alternatively, cytosine conversion-based technology can be used. Such technology relies on methylation status-dependent chemical modification of CpG islands (i.e., deamination of unmethylated cytosines in CpG islands) within isolated genomic DNA or fragments thereof followed by DNA sequence analysis. Such methods employ reagents like hydrazine and bisulfite. Bisulfite treatment followed by alkaline hydrolysis is described by Olek et al., Nucl. Acids Res., 24: 5064-5066 (1996); and Frommer et al., PNAS USA, 89: 1827-1831 (1992). The use of methylation-sensitive primers to assay methylation of CpG islands in isolated genomic DNA is described by Herman et al., PNAS USA, 93: 9821-9826 (1996), and in U.S. Pat. Nos. 5,786,146 and 6,265,171. Bisulfite-treated DNA can be subsequently analyzed by conventional molecular techniques, such as PCR amplification, fluorescence-based, real-time PCR (see, e.g., Eads et al., Cancer Res., 59: 2302-2306 (1999); Heid et al., Genome Res., 6: 986-994 (1996); and U.S. Pat. No. 6,331,393), sequencing, oligonucleotide hybridization detection, and methylation-sensitive single nucleotide primer extension (Ms-SNuPE; see, e.g., Gonzalgo et al., Nucl. Acids Res., 25: 2529-2531 (1997); and U.S. Pat. No. 6,251,594).
- A preferred method of assaying for methylation of a CpG island includes isolating genomic DNA (and/or fragments thereof) from a biological sample, treating the DNA under deaminating conditions that convert unmethylated cytosines to uracil, using the treated DNA as a template in a PCR reaction to amplify a target sequence that includes the CpG-island of interest, thereby producing an amplified sequence. Unmethylated cytosines in the target sequence, which are converted to uracils by the deaminating treatment, are amplified as thymines in the corresponding position of the amplified sequence. Since the sequence of the forward and the reverse strand of the CpG island lose their complimentarity after the deamination reaction, the methylation status of the CpG island can be determined by assaying one or both of the original strands by utilizing primers capable of annealing to the strand of interest.
- The deamination reaction may not proceed to completion, which results in false positives. For example, deamination of DNA sequences using bisulfite salt is sensitive to the purity of the DNA, length of incubation, and the secondary structure of the denatured templates. Quantitative PCR methods can be used to assay for the efficiency of deamination. However, quantitative PCR methods are limited to assaying the conversion status within the sites where the primers and probes anneal to the template.
- Quantitative PCR methods are also limited to assaying for the methylation of cytosines within the sites where the primers and probes anneal to the template. The primers and the probe only anneal efficiently to the templates that are fully converted and contain methylation at the appropriate cytosine nucleotides. Thus, they fail to provide methylation information for CpG dinucleotides that are not assayed for. The CpG islands may also be analyzed using direct sequencing following the deamination treatment. However, due to the heterogeneity of the methylation pattern within a CpG island and the presence of homopolymeric stretches within the sequence, direct sequencing of CpG islands can yield a sequencing pattern that is too noisy and complex for the available sequencing software.
- To overcome these disadvantages and to minimize the overall cost of analysis for a clinical test, we developed a method to analyze the amplified sequences by termination-coupled linear amplification. The DNA is linearly amplified using a forward or a reverse primer in the presence of dNTPs and one or two dideoxynucleotides such as dideoxycytidine or dideoxyguanine. The amplified sequence can, optionally, be analyzed using only thymine and/or cytosine terminators when assaying for a methylated CpG dinucleotide (or adenine and/or guanine terminators when analyzing the amplified strand opposite to the CpG dinucleotide of interest) to make extension reaction products that terminate at thymines and/or cytosines nucleotides (or at guanine and/or adenine when assaying the opposite strand). The amplification reaction results in the generation of fragments with multiple lengths, each length of which corresponds to the distance in bases between the primer used for amplification and the position within the target sequence of a nucleotide that is complementary to the dideoxynucleotide added to the amplification reaction. Such amplification can result in the generation of 10 to 20 fragments from an average CpG island-containing amplicon of 100 to 150 bp. The extension products can be separated by size on an acrylamide gel and compared to (a) a size standard and/or (b) by comparing the fragments to those generated when fully unmethylated (PCR generated template or clones in E. coli) or fully methylated (enzymatically methylated in vitro) template to thereby determine the presence of cytosine (or guanine on the opposite strand) or the presence of thymine (or adenine on the opposite strand) in the amplified CpG island-containing sequence. When bisulfite is used as the deaminating agent, the amplified sequence may contain large stretches of thymine or adenine which may result in additional fragments due to the DNA polymerase slippage during amplification. Such “stutter” patterns may be minimized by selectively analyzing segments of the CpG islands that have shorter homopolymeric sequences. Stutter fragments can also be identified by analyzing the control templates.
- When a fluoresent label is used to tag the primers or the dideoxynucleotides used in the terminator-coupled linear amplification, the resulting fragments may be analyzed using automated sequencing machines and software designed for determining the size of DNA fragments. In this regard, commercially available software such as GENESCAN (Applied Biosystems, Foster City, Calif.) and GENEMAPPER (Applied Biosystems) are trained to recognize and account for stutter patterns due to DNA polymerase slippage during the amplification of microsatellite repeats. Such software may also be used to account for the stutter pattern that is observed when amplifying homopolymeric stretches of DNA, as might be seen after bisulfite conversion of CpG islands. There are a number of fluorescent dyes available for the automated analysis of DNA such as but not limited to 6-carboxyfluorescein (6-FAM), Hexachlorofluorescein (HEX), VIC dye, 5-carboxytetramethylrhodamine (TAMRA), 5-carboxy-X-rhodamine, succinimidyl ester (5-ROX), 6-carboxy-2′,4,7,7′-tetrachlorofluorescein (TET). The methods and equipment to determine amplicon size have been available for over a decade and in use for genetic linkage mapping, DNA identity, and forensic. For example, Applied Biosystems has a set of 5 dyes that can be used to multiplex fragments from 4 separate amplification reaction and one standard for use in linkage mapping on the ABI sequencers. Four different CpG islands from a single individual can be linearly amplified using fluorescently tagged primers, and the products pooled before analysis. Alternatively, different CpG islands from different individuals can be linearly amplified using fluorescently tagged primers, and the products pooled before analysis.
- Since methylation of a particular CpG dinucleotide is not always complete in a sample, i.e., the CpG sequence is heterogenous, the methods provided herein can be advantageously used to analyze the extent of or percent methylation of a particular CpG dinucleotide site within a sample. In a preferred method, two different fluorescent-dye terminators are used for thymine and cytosine, respectively (or adenine and guanine, respectively, when analyzing the opposite strand) in a fluorescent dideoxy sequencing reaction. The relative abundance of the two dyes in same-size extension products are indicative of the relative abundance of the two nucleotides at a particular sequence position, and can thereby indicate the percent methylation of a particular CpG dinucleotide site within a CpG island. To determine the expected relative abundance of the two dyes, control reactions with a range of known ratios of fully methylated to fully unmethlylated templates can be used. The data obtained from the control reactions can be used as a reference to estimate relative abundance of methylated and unmethylated cytosines in a sample.
- The levels of methylation or patterns of methylation at given CpG islands can be assayed as appropriate. The assay can employ the use of a reference standard when appropriate to enable the determination of abnormal methylation. A reference standard can be determined based on reference samples obtained from age-matched noncancerous classes of adjacent tissues, and with normal peripheral blood lymphocytes. When, for example, efficacy of treatment is being assessed, the assay results of biological samples taken over the course of treatment can be compared without the use of a reference standard.
- When the DNA obtained from a biological sample is in limited quantities and is not sufficient for the analysis of multiple markers, the methods described herein can include amplifying the DNA from the sample. Amplification can be done using PCR amplification or isothermal amplification methods, for example, those described in U.S. Pat. Nos. 5,854,033; 6,124,120; 6,143,495; 6,210,884; 6,642,034; 6,280,949; 6,632,609; and 6,642,034; and U.S. Pat. App. Pub. Nos. 2003/0032024; 2003/0143536; 2003/0235849; 2004/0063144; and 2004/0265897, which are incorporated herein by reference in their entirety. Isothermal amplification can include rolling circle or strand displacement amplification. Methods that combine PCR and isothermal amplification have also been described (U.S. Pat. Nos. 6,777,187; and 6,828,098; and U.S. Pat. App. Pub. Nos. 2004/0209298; 2005/0032104; and 2006/0068394, each of which is incorporated herein by reference in its entirety). U.S. Pat. App. Pub. No. 2005/0202490, which is incorporated herein by reference in its entirety, describes the use of such methods in combination with methylation-sensitive restriction enzymes to study the methylation pattern of DNA. DNA amplification can also include methylation-coupled whole genomic amplification to generate the DNA needed, such as described in U.S. Pat. App. Pub. No. 2006/0257905, which is incorporated by reference herein in its entirety. The methylation-coupled whole genomic amplification can be especially advantageous when DNA is recovered from minute biological samples or from bodily fluids such as urine or plasma.
- Skilled artisans will appreciate that the various amplification methods described herein, e.g., the PCR amplification, isothermal amplification, and termination-coupled linear amplification method, can employ nucleotides, nucleotide analogues, nucleotide or nucleotide analogue derivatives, and/or combinations thereof.
- If desired, mRNA and protein levels can be assayed, and alterations in their expression levels can be indicative of a change in the level of methylation or the patterns of methylation at given CpG islands. Such methods of assaying mRNA and protein levels are also within the skill in the art. For example, the mRNA assay methods described in U.S. Provisional Patent Application No. 60/705,964 filed on Aug. 5, 2005 and International Patent Publication No. WO 2007/019444, which are hereby incorporated by reference, can be used. Such methods are particularly useful if a degraded tissue sample is used as the biological sample. Alternatively, reverse transcription with gene-specific primers can be used to assay mRNA levels. Proteins levels can be assayed, for example, using antibody and staining techniques.
- It is important to note that even though aberrant methylation of a CpG island can affect expression of the associated gene, the methods described herein are not dependent on a biological role for the hypermethylation. That is a hypermethylated CpG island can be useful in the methods of the invention regardless of its effect on gene expression. Accordingly, the only requirement is that there be a correlation between the methylated state of a CpG island and the presence of cancer.
- The invention further provides target sequences and corresponding primers or probes that are useful in the above methods. The target sequences provide the context for the selection of CpG islands to assay for methylation. If a given target sequence contains more than one CpG island, all or less than all of the CpG islands, even one CpG dinucleotide, can be assayed for methylation with respect to that particular target sequence. In this regard, a target sequence can include a genomic sequence that is fully methylated and fully deaminated such as SEQ ID NO: 1 or 2 [NRG1], SEQ ID NO: 3 or 4 [ADRB3], SEQ ID NO: 5 or 6 [GFRA2], SEQ ID NO: 7 or 8 [KIF13B], SEQ ID NO: 9 or 10 [RET], SEQ ID NO: 11 or 12 [GPR147], SEQ ID NO: 13 or 14 [NEUROG3], SEQ ID NO: 15 or 16 [PALD], SEQ ID NO: 17 or 18 [HEMK1], SEQ ID NO: 19 or 20 [FGF4], SEQ ID NO: 23 or 24 [HTR1A], SEQ ID NO: 25 or 26 [RNF180], SEQ ID NO: 27 or 28 [ECOP], SEQ ID NO: 29 or 30 [ZNF596], SEQ ID NO: 33 or 34 [LOC441320], SEQ ID NO: 35 or 36 [TDH], SEQ ID NO: 37 or 38 [FLJ36980], SEQ ID NO: 39 or 40 [FGF20], SEQ ID NO: 41 or 42 [EFHA2], SEQ ID NO: 43 or 44 [ASAH1], SEQ ID NO: 45 or 46 SEQ ID NO: 49 or 50 [NODAL], SEQ ID NO: 51 or 52 [LOC399783], SEQ ID NO: 53 or 54 [ISL2]. These fully methylated and deaminated sequences are used for illustrative purposed and do not exclude the use of partially methylated and deaminated sequences in the methods of the invention. A target sequence can include a genomic sequence that is partially methylated, such as in DNA obtained from a tumor, and then deaminated such that the target differs from the sequence listed above. Persons of skill in the art will appreciate that a target sequence that includes a partially methylated and deaminated CpG island will result in a population of DNA molecules that differ at one or more positions that correspond to the cytosine residues in one or more CpG dinucleotides. Thus, a target sequence can include a variety of partially methylated and deaminated sequences based on the following genomic sequences SEQ ID NOS: 119 or 220 [KIFC2], SEQ ID NOS: 121 or 122 [C20ORF23], SEQ ID NOS: 123 or 124 [GFRA1], SEQ ID NOS: 129 or 130 [DKK2], SEQ ID NOS: 133 or 134 [RASSF5], SEQ ID NOS: 135 or 136 [NTN1], SEQ ID NOS: 139 or 140 [GPR147], SEQ ID NOS: 141 or 142 [NEUROG3], SEQ ID NOS: 143 or 144 [NODAL], SEQ ID NOS: 145 or 146 [PALD], SEQ ID NOS: 147 or 148 [LOC399783], SEQ ID NOS: 151 or 152 [LOC441320], SEQ ID NOS: 153 or 154 [ZNF596], SEQ ID NOS: 155 or 156 [TDH], SEQ ID NOS: 157 or 158 [ASAH1], SEQ ID NOS: 159 or 160 [FGF20], SEQ ID NOS: 161 or 162 [FLJ36980], SEQ ID NOS: 163 or 164 [GFRA2], SEQ ID NOS: 165 or 166 [EFHA2], SEQ ID NOS: 171 or 172 [KIF13B], SEQ ID NOS: 173 or 174 [ADRB3], SEQ ID NOS: 175 or 176 [NRG1], SEQ ID NOS: 177 or 178 [ECOP], SEQ ID NOS: 179 or 180 [HTR1A], SEQ ID NOS: 181 or 182 [ISL2], SEQ ID NOS: 183 or 184 [LOC285671], SEQ ID NOS: 185 or 186 [FGF4], SEQ ID NOS: 189 or 190, [HEMK1], SEQ ID NOS: 191 or 192 [RET] SEQ ID NOS: 193 or 194 [HTRA4], SEQ ID NO: 195 [RHOD], SEQ ID NO: 196[TNFSF11], SEQ ID NO: 197 [MMP9], and SEQ ID NO: 198 [LRRC49].
- These targets can be used in combination with known targets (for example known CpG islands associated with GSTP1, GPX3, GSTM1, GSTM4, CSMD1, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, SFRP1, SFRP2, DKK3, PTGS2, CDKN1C/p57, RASSF1, and GPR62. For example, fully methylated and deaminated sequences for some of these genes are provided in SEQ ID NO: 31 or 32 [CSMD1], SEQ ID NO: 45 or 46 [TNFRSF10C], SEQ ID NO: 47 or 48 [TNFRSF10B] SEQ ID NO: 21 and 22 [GPR62]. Also for example, a target sequence can include fully or partially methylated and (subsequently) deaminated sequences based on the following genomic sequences SEQ ID NOS: 131 or 132 [GPX3], SEQ ID NOS: 125 or 126 [GPX7], SEQ ID NOS: 127 or 128 [GSTM4], SEQ ID NOS: 137 or 138 [SFRP2], SEQ ID NOS: 149 or 150 [CSMD1], SEQ ID NOS: 167 or 168 [TNFRSF10B], SEQ ID NOS: 169 or 170 [TNFRSF10C], and SEQ ID NOS: 187 or 188 [GPR62]. Such target sequences can be isolated or purified in accordance with methods known in the art.
- Also provided are isolated or purified primers derived from and suitable for amplifying sequences internal to the above isolated or purified nucleic acid molecules. The isolated or purified primers can be DNA, RNA, PNA, and the like. It will be understood by one of ordinary skill in the art, however, that one type of nucleic acid can be preferred over another, depending on the particular biological sample, the methodology employed in assaying CpG islands for methylation, and the ability of the particular type of nucleic acid to detect methylation. One or more (e.g., two, three four, four, five, six, seven, eight, nine ten or more) isolated pairs of primers can be provided. Optionally, primers are provided as part of a kit useful in the methods disclosed herein. The pair of primers can consist essentially of SEQ ID NOS: 55 and 56, SEQ ID NOS: 57 and 58, SEQ ID NOS: 59 and 60, SEQ ID NOS: 61 AND 62, SEQ ID NOS: 63 and 64, SEQ ID NOS: 65 and 66, SEQ ID NOS: 67 and 68, SEQ ID NOS: 69 and 70, SEQ ID NOS: 71 and 72, SEQ ID NOS: 73 and 74, SEQ ID NOS: 75 and 76, SEQ ID NOS: 77 and 78, SEQ ID NOS: 79 and 80, SEQ ID NOS: 81 and 82, SEQ ID NOS: 83 and 84, SEQ ID NOS: 85 and 86, SEQ ID NOS: 87 and 88, SEQ ID NOS: 89 and 90, SEQ ID NOS: 91 and 92, SEQ ID NOS: 93 and 94, SEQ ID NOS: 95 and 96, SEQ ID NOS: 97 and 98, SEQ ID NOS: 99 and 100, SEQ ID NOS: 101 and 102, SEQ ID NOS: 103 and 104, SEQ ID NOS: 105 and 106, or SEQ ID NOS: 107 and 108. It is understood that these primer pairs are examples of suitable primers for use in the context of the invention. For example, each primer can be between 10 and 40 nucleotides and together the pair of primers can flank a region of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 140, 150, 200, 250, 300 bp in length that includes one or more CpG dinucloetides in a CpG island of interest. Primer pairs can be modified in various ways, such as by chemical modification of a base, and still be useful in the context of the invention. Other primers derived from the target sequences, namely SEQ ID NOS: 1-54 and 119-198, and variants thereof, also can be used in the context of the invention. The only requirement is that such primers function to assay for methylation of a given CpG island. Thus, for example, alternate primers can be selected or the provided primers can be modified or provided in degenerate form to account for target sequence polymorphisms within a given population, so long as the primers are still suitable for assaying modification of CpG islands associated with the genes disclosed herein.
- Like the target sequences, the primer pairs can be isolated or purified in accordance with methods known in the art. Alternatively, they can be synthesized using routine methods.
- The primers can be part of a kit. Preferably, the kit comprises at least three pairs of primers, wherein each primer pair is specific for a CpG island associated with a different gene. However, the kit can comprise additional primer pairs, such as primer pairs for other CpG islands associated with the same gene or primer pairs for amplifying CpG islands associated with four, five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or even more genes. The kit can further comprise one or more reagents for assaying for methylation of CpG islands, instructions for use, and/or other components as are typically found in kits. For example, the kit can comprise a buffer suitable for (a) isolating genomic DNA comprising a target sequence from a biological sample, (b) amplifying a portion of the target sequence, and/or (c) deaminating a target sequence. In embodiments directed to the evaluation of prostate cancer, a kit can comprise one or more buffers suitable for preparing genomic DNA from serum and/or urine samples.
- The following examples serve to illustrate the invention. The examples are not intended to limit the scope of the invention.
- This example demonstrates the determination of the methylation status of markers based on methylation-specific PCR amplification. Paraffin-embedded prostate tissues were obtained following radical prostatectomies. The tissue samples were sectioned into 23 10-micron sections and
slide - Following bisulfite treatment, the DNA was purified using the QIAEX II purification kit (Qiagen, Valencia, Calif.) according to the manufacturer's recommendations and eluted in 50 μl of TE8. Sodium hydroxide (5.5 μl of 2 N) was added, and the DNA was incubated at RT for 15 min. The DNA was then precipitated with 3 volumes of ethanol and 0.3 volumes of 5 M NH4OAC. The DNA was resuspended in 50 μl of TE8 and stored at −20° C.
- In order to determine if a specific CpG position is methylated in genomic DNA isolated from tumor tissue, methylation-specific polymerase chain reaction (PCR) was performed, using primers designed to overlap the position of the CpG island of interest. All PCR reactions were performed in a MASTERCYCLER thermocycler (Eppendorf, Westbury, N.Y.) for 42 cycles of 95° C. for 15 seconds, 63° C. for 30 seconds, and 72° C. for 10 seconds. Each reaction was carried out in 30 μl of 1× PLATINUM Taq PCR buffer containing 1.5 mM magnesium chloride, 0.25 mM dNTPS, 12.5 pmoles of each primer, and 0.5 units of PLATINUM Taq enzyme (Invitrogen, Carlsbad Calif.). The primers used for each CpG island and the size of the product are shown in Table 1, wherein “F” indicates forward primer, “R” indicates reverse primer, “m” indicates methylated, and “u” indicates unmethylated.
-
TABLE 1 An- neal- ing Gene as- temp- Pro- sociated era- duct with CpG ture size island Primer sequences (° C.) (bp) NIRG1 mF: GAGCGGGTAGCGAGAGTTTCGG 63 119 [SEQ ID NO: 55] mR: TAACGACGCGACTACCGAAAACC [SEQ ID NO: 56] ADRB3 mF: GATTAACGTGTTCGTGATTTCGTT 63 102 [SEQ ID NO: 57] mR: CAACGACCAATAACCAATCAACGCC [SEQ ID NO: 58] GFRA2 mF: ATACGTCGGTGAGTTCGGTTTATC 63 101 [SEQ ID NO: 59] mR: ACTCCCGACTCCCTAAACTCCGAA [SEQ ID NO: 60] KIF13b mF: TGAATCGGCGAGGTGAGAGTCG 65 179 [SEQ ID NO: 61] mR: ACCGAACGTCTCAACGCGAAAACG [SEQ ID NO: 62] RET mF: TATCGTTAGCGTCGTGGTGGAGTT 63 120 [SEQ ID NO: 63] mR: CTACACGAACACTAAACCGACCGA [SEQ ID NO: 64] GPR147 mF: TCGGTCGTTACGTTGATCGTTATTC 63 119 [SEQ ID NO: 65] mR: ACCCTACGCATACCCTTCTCGAAC [SEQ ID NO: 66] NEUROG3 mF: GTTTCGAGGAAGTTTCGGGTACGG 63 103 [SEQ ID NO: 67] mR: GATCGTTAACCTTCTTTCGCCGAC [SEQ ID NO: 68] PALD mF: CGAAGTTGGGAGGAGCGAGTT 63 115 [SEQ ID NO: 69] mR: AAACATCCGTACTCCTACGACCGA [SEQ ID NO: 70] HEMK [tiF: 63 99 CGTATTAGTCGTATTCGCGAGCGT [SEQ ID NO: 71] mR: CGAAACTACTCGACCCGACCC [SEQ ID NO: 72] FGF4 mF: TAACGGTACGTTGGAGGTCGAGTT 63 102 [SEQ ID NO: 73] mR: ACGACCGCCTCCTTAAACTACGCT [SEQ ID NO: 74] GPR62 mR: TATCGTGTATTCGTTGCGGTTAGG 63 120 [SEQ ID NO: 75] mR: AACGATACGAACGACGTACCGAA [SEQ ID NO: 76] HTR1A mF: TACGTGAATAAGAGGACGTTTCGG 63 115 [SEQ ID NO: 77] mR: AACGATCTTCCGAAATACGCCAA [SEQ ID NO: 78] RNF180 mF: TCGTCGAATCGGTATCGTCGTC 63 118 [SEQ ID NO: 79] mR: ACCTATATCCACGTCCCGAAACCT [SEQ ID NO: 80] ECOP mF: CGGTTGTAGTTTGTTCGTTCGTTTC 63 108 [SEQ ID NO: 81] mR: CTAACGCCTCATAACTCCTCGCGT [SEQ ID NO: 82] ZNF596 mF: GCGTCGATTCGGGAGTAGTATCGT 63 96 [SEQ ID NO: 83] mR: ATACCGTAAATCCGCGCTACTTCC [SEQ ID NO: 84] CSMD1 mF: CGTTGAGGTCGAATGAAGCGTAGT 63 96 [SEQ ID NO: 85] mR: AACCGAAACTAAACACGACGCAA [SEQ ID NO: 86] LOC441320 mF: AAGCGTATAGTTCGAGGATTGCGA 63 107 [SEQ ID NO: 87] mR: CCGCGTCACTTACTCCTCTACGA [SEQ ID NO: 88] TDH mF: CGTTGGGTGCGTAGGAAGGTTAGT 63 120 [SEQ ID NO: 89] mR: GACCGACCCTAAACAACCCGCT [SEQ ID NO: 90] FLJ36980 mF: GTTGCGGGATAGCGTTGTGATT 63 96 [SEQ ID NO: 91] mR: ACCATTATCAATACTCCGATCGCC [SEQ ID NO: 92] FGF20 mF: TTTGTTTGTTAAGGGCGTTATCGT 63 105 [SEQ ID NO: 93] mR: CCGCGACTACTCTAACCAACCC [SEQ ID NO: 94] EFHA2 mF: GGGCGTTGAGTTTAGTTCGGAGA 63 108 [SEQ ID NO: 95] mR: ACGAACACAACCGAATCAACGTAA [SEQ ID NO: 96] ASHA1 mF: GGCGTTGGTTGTTAGAGCGATG 63 114 [SEQ ID NO: 97] mR: GACTCAAACTCACTCACCGACGAC [SEQ ID NO: 98] TNFRSF10C mF: GGTGCGATTTAGGATTTAGGACGG 63 115 [SEQ ID NO: 99] mR: GCGACCGAAACTCACTAACAACAA [SEQ ID NO: 100] TNFRSF10B mF: GCGATTTGGGTCGTTAGGGAATAG 63 119 [SEQ ID NO: 101] mR: ACCTCTCCGTAACTTCACGCAACTT [SEQ ID NO: 102] NODAL mF: GGTAGTCGCGGTCGTTTACGTT 63 111 [SEQ ID NO: 103] mR: ACGAACAAACGACAAATCGAATCA [SEQ ID NO: 104] LOC399783 mF: TACGTTGAGTTCGGTTTGGTTTGT 63 103 [SEQ ID NO: 105] mR: CGCGCCTCCGTAATCTAAACTAA [SEQ ID NO: 106] ISL2 mF: GTGCGTGTTGACGTTATGTTGCGT 63 99 [SEQ ID NO: 107] mR: CGCCCGACCTCGACTCTTTACT [SEQ ID NO: 108] GSTP1 mF: CGGCGATTTCGGGGATTTTAGGGC 63 109 [SEQ ID NO: 109] mR: GACCGCTCTTCTAAAAAATCCCGC G [SEQ ID NO: 110] GSTP1 mF: ACGTTCGGGGTGTAGCGGTCGTC 63 93 [SEQ ID NO: 111] mR: CCCCAATACTAAATCACGACGCCG [SEQ ID NO: 112] GSTP1 mF: GGTCGGCGTCGTGATTTAGTATTGG 63 99 [SEQ ID NO: 113] mR: ACTACGACGACGAAACTCCAACGA [SEQ ID NO: 114] GSTP1 uF: 63 113 TGTGGTGATTTTGGGGATTTTAGGGT [SEQ ID NO: 115] uR: CCAACCACTCTTCTAAAAAATCCCACA [SEQ ID NO: 116] GSTP1 uF: GATGTTTGGGGTGTAGTGGTTGTTG 63 99 [SEQ ID NO: 117] uR: CTCCACCCCAATACTAAATCACAACA [SEQ ID NO: 118] KIFC2 mF: TGATGGTCGTATTGCGGGTTTATC 62 91 [SEQ ID NO: 199] mR: ATACCTAAACCCAACGCCGACTAC [SEQ ID NO: 200] C20orf23 mF: CGCGATTTGAGTAGTTAGCGTCGT 62 90 [SEQ ID NO: 201] mR: AACCAACGCGACGACCTAACTAAC [SEQ ID NO: 202] GFRA1 mF: TAGATTTCGGTGTTTCGGGCGTT 62 98 [SEQ ID NO: 203] mR: CCGCTAATTCCCAATCGTACTACTCA [SEQ ID NO: 204] GPX7 mF: TTCGTTTCGTTCGGTCGTGATT 62 116 [SEQ ID NO: 205] mR: GACTACGAACGCTTCGAATTCCTC [SEQ ID NO: 206] DKK2 mF: GTTGCGTTGGTAGCGATTCGTTGT 62 117 [SEQ ID NO: 207] mR: CCCGAACCGAATCCTCGAAATCT [SEQ ID NO: 208] NTN1 mF: 62 103 GACGTAGTATGATGCGCGTAGTGTG [SEQ ID NO: 209] mR: GCGAACATACTAAACCCGAACCC [SEQ ID NO: 210] HTRA4 mF: GGATTACGTCGGTGTTCGATTTGT 62 95 [SEQ ID NO: 211] mR: AACGCACGATTAACCCTACGCC [SEQ ID NO: 212] MMP9 mF: TCGGATTAAGGTAGGCGTGGTTTC 62 102 [SEQ ID NO: 213] mR: AACGTAAACGCCGAACCGAAC [SEQ ID NO: 214] RHOD mF: GGAAGACGTCGTTGTTGATGGTTT 62 120 [SEQ ID NO: 215] mR: ACCGCTCCGACACGAACCTATAC [SEQ ID NO: 216] TNSF11 mF: AGCGTTATGCGTCGCGTTAGTAG 62 116 [SEQ ID NO: 217] mR: GCAAACGACGACGAAACGTACA [SEQ ID NO: 218] SFRP2 mF: GAAGAGAGCGGGTTCGGGATAAG 62 101 [SEQ ID NO: 219] mR: CTACAACATCGTAAACGCGCGAC [SEQ ID NO: 220] - The products of the PCR reactions were separated on 8% acrylamide gel. Only templates that exhibited methylation at all of the CpG islands that were present within the primers could serve as efficient templates for the amplification reactions. Control reactions were performed using fully methylated templates that were methylated in vitro using SS1 (CpG) methylase (NEB, Beverly, Mass.) according to the manufacturer's protocol. All primer pairs listed in Table 1 yielded a product of the correct size from fully methylated control template. Two negative controls (water and DNA isolated from white blood cells) were included for each target PCR amplification, which did not yield a PCR product. When a CpG island is methylated in a DNA sample, an amplification product of the expected size is obtained. This example demonstrates that the above primers can be used to assay for methylation of CpG islands in prostate cancer and that the CpG islands exhibit methylation in prostate cancer.
- This example demonstrates the determination of the methylation status of CpG islands at the ADRB3 locus by DNA sequencing. DNA is obtained from tumor samples and treated with sodium bisulfite as described in example 1. Two microliters of the bisulfite treated DNA are amplified with the following primers: ADRB3-F1: GAGAAGAGGAAGGTAGAAGGAG [SEQ ID NO: 221] and ADRB3-R1: CTACCTAACTATAACCAACCC [SEQ ID NO: 222] for 40 cycles as described in example 1 except for the annealing temperature, which is lowered to 55° C. The amplified 250 bp product is purified using QIAquick PCR purification kit (Qiagen, Valencia Calif.) and recovered in TE8. Fifty nanograms of the ADRB3 amplified product is sequenced using 1.25 pmole of ADRB3-F2:ACGGAGGAGGATAGTAGTACG [SEQ ID NO: 223] using BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) and the sequencing reaction is purified using Centri-Sep columns (Applied Biosystems) according to the manufacturer's protocols. The products of the sequencing reaction are analyzed using an ABI 3700 sequencer according to manufacturer's specification. The resulting DNA sequence shows one or more sequence peaks corresponding to cytosine base or a mixed cytosine/thymidine base at the cytosine residue position of CpG dinucleotides that are fully or partially methylated in the original tumor DNA.
- Alternatively, a more detailed sequence analysis is obtained by cloning the product of the amplification reaction using a TOPO TA cloning kit (Invitrogen, Carlsbad Calif.) according to supplier's protocol. Approximately 20 colonies are chosen for further analysis. Each colony is grown in 3 ml of LB media for 16 hours. DNA is isolated from 1.5 ml aliquot using plasmid preparation kit from Qiagen. The plasmid DNA is quantitated using spectrophotometer and 1 microgram aliquot is sequenced as described above. The sequence of the 20 individual clones is compared to determine which cytosines are methylated and to provide an estimate of their rate of methylation in the tumor sample. This example shows that the methylation status of cytosines within CpG islands can be determined using a sequencing approach.
- This example demonstrates the determination of the methylation pattern of multiple CpG islands associated with KIFC2, GFRA1 and GPX7 using terminator-coupled linear amplification. From DNA from tumor samples prepared as described in example 1, fragments of the CpG islands associated with KIFC2, GFRA1, GPX7 are amplified individually using the mF1 and mR1 primers shown below for each CpG island. The amplification reactions are performed for 42 cycles as described in example 1 except for the annealing temperature, which was lowered to 58° C. An aliquot of the amplification reaction is separated on an 8% acrylamide gel to verify that fragments of the appropriate length are obtained (264 bp for KIFC2, 326 bp for GFRA1, 367 bp for GPX7). The product of the PCR reaction were purified using QIAQUICK PCR purification kit (Qiagen).
- Each amplification product (25 nanograms) is subjected to linear terminator-coupled amplification using 1.5 pmoles of the fluorescently labeled F2 primer shown below for the corresponding amplicon. The amplification reaction includes 1× VentR (exo−) DNA polymerase (New England Biolabs, Beverly Mass.), 30 μM dATP, 37 μM dCTP, 100 μM dGTP, 100 M dTTP, 480 μM ddCTP and 2 units of VentR (exo−) DNA polymerase. Reactions are performed in an MASTERCYCLER thermocycler (Eppendorf) for 30 cycles of 95° C. for 15 seconds, 58° C. for 30 seconds, and 72° C. for 30 seconds. Following amplification, the reaction products are pooled into a single tube and purified using Centri-Sep columns (Applied Biosystems) according to the manufacturer's protocols. One microliter of GENESCAN 500 LIZ standard (Applied Biosystems) is added to one tenth of the purified fragment and the DNA separated using the ABI Prism 3100 Genetic Analyzer (Applied Biosystems) according to manufacture's instructions. The data is analyzed using the GENESCAN and the GENEMAPPER software (Applied Biosystems).
- The following primers are used for the amplifications:
-
KIFC2-F1: AGGTA(C/T)GTTGTATTTGGTGGATTTGG [SEQ ID NO: 224] KIFC2-R1: CCCACCTACAACAACAACACC [SEQ ID NO: 225] KIFC2-F2: 6FAM-GAACGCGTACGGAAGGTAGG [SEQ ID NO: 226] GFRA1-F1: GTGATAGGTTTGTAGATTTGATAGTTG [SEQ ID NO: 227] GFRA1-R1: AACTAACCTCCATTTTAACTATTTC [SEQ ID NO: 228] GFRA1-F2: NED-GAGAGATGAATTTGGATATTAGT [SEQ ID NO: 229] GPX7-F1: GGTAAATTGGTGT(C/T)GTTGGAGAAG [SEQ ID NO: 230] GPX7-R1: ACTAAACAATAATACCC(A/G)ACCTC [SEQ ID NO: 231] GPX7-F2: VIC-GTCGTTGGGTTCGGTTTCGTTTTG [SEQ ID NO: 232] - The F1 and R1 primers are used for the amplification of a fragment of a CpG island from the tumor DNA. The F2 primers are used for termination-coupled linear amplification.
- This example shows that termination-coupled linear amplification fragment lengths can be analyzed to (i) determine the presence and/or the positions of methylated cytosines in CpG islands in a sequence of interest as well as (ii) provide information about the efficiency of the deamination reaction, since incomplete deamination results in fragments with length that differ than what is expected from the positions of the CpG dinucleotides within the sequence.
- This example demonstrates the use of methylation-coupled whole genome amplification on DNA recovered from urine samples to increase the amount of DNA available for CpG island marker assays. Urine samples were obtained from 4 patients that were recently diagnosed with prostate cancer. 50 ml samples were spun down at 4000 rpm for 15 min, transferred to 1.5 ml tubes and washed twice with PBS. The DNA was extracted using proteinase K digest (100 μl of 25 mM Tris pH8.0, 100 mM NaCL, 1% SDS, 5 mM EDTA and 10 μg of Proteinase K followed by phenol/chloroform extraction and ethanol precipitation. The DNA was resuspended in 10 μl TE8 buffer (10 mM Tris, pH 8.0, 1 mM EDTA).
- A partially random primer with the sequence GGGN6 (50 ng) was added to 5 μl of DNA. 12 μl of a denaturing solution (50 mM KOH, 0.1 mM EDTA) was added to the DNA/random primer mix. After a five-minute incubation at room temperature, 12 μl of a neutralization solution (60 mM Tris (pH 7.5), 50 mM HCl) was added to neutralize the reaction. The DNA/primer mix was denatured at 94° C. for 5 minutes, incubated at room temperature for 10 minutes, and then placed on ice.
- The amplification reaction was set up in a final volume of 30 μl. The following reagents were added to give the indicated final concentrations: (a) 1×NEB buffer 2 (1×NEB buffer 2: 50 mM NaCl, 10 mM Tris-HCl, pH 7.9, 10 mM MgCl2, 1 mM dithiothreitol), 333 μM dATP, dCTP, dGTP, dTTP, 160 μM S-adenosylmethionine, and 10 ng/μl of bovine serum albumin (BSA) were combined and to which was added (b) DNA methyltransferase enzyme 1 (0.15 units/μl) (New England Biolabs) and incubated at 37° C. for 10 minutes, and followed by (c) adding Klenow polymerase to a final concentration of 0.167 units/μl, and Klenow exo− to a final concentration of 0.167 units/μl (New England Biolabs).
- The reaction was incubated at 37° C. for 16 hours, and the reaction was stopped by the addition of EDTA to a final concentration of 5 mM, phenol/chloroform extracted, and ethanol precipitated. The DNA was resuspended in 40 μl of TE8 and 2 μl were separated on agarose gel to verify the presence of DNA.
- The DNA was treated with sodium bisulfite and analyzed by methylation specific PCR as described in Example 1 using the GPR147 and RET assays. The presence of a band of the expected size for either marker indicated the methylation of the associated marker in the input DNA.
- All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
- The use of the terms “a,” “an,” “the,” and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
- Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. It should be understood that the illustrated embodiments are exemplary only, and should not be taken as limiting the scope of the invention.
Claims (34)
1. A method of detecting the methylation status of one or more CpG islands indicative of cancer, which method comprises:
providing a biological sample from a subject in need of cancer evaluation; and
assaying the biological sample for methylation of a CpG island associated with at least one gene selected from the group consisting of neuregulin cell-surface ligand (NRG1), kinesin family member 13B (KIF13B), adrenergic B3 receptor (ADRB3), glycosylphosphatidylinositol cell-surface receptor (GFRA2), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (predicted protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1), fibroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1A (HTR1A), ring finger protein 180 (RNF180), EGFR-co-amplified and overexpressed (DKFZP564K0822 or ECOP), zinc finger protein 596 (ZNF596), similar to 7 transmembrane helix receptor (LOC441320), L-threonine dehydrogenase (TDH), hypothetical protein C8orf79 (C8orf79/FLJ36980), fibroblast growth factor receptor 20 (FGF20), EF-hand domain family member 2A (LOC286097/EFHA2), N-acylsphingosine amidohydrolase (acid ceraminase) 1 (ASAH1), nodal homolog (NODAL), hypothetical protein similar to zinc finger protein 532 (LOC399783), transcription factor LIM homeodomain (ISL2), matrix metallopeptidase 9 (MMP9), leucine rich repeat containing 49 (LRRC49), tumor necrosis factor (ligand) superfamily member 11 (TNFSF11), ras homolog gene family member D (RHOD), Kinesin family member C2 (KIFC2), chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), matrix metallopeptidase 9 (MMP9), tumor necrosis factor superfamily member 11 (TNFSF11), ras homolog gene family member D (RHOD), and leucine rich repeat containing 49 (LRRC49), wherein methylation of the assayed CpG island is indicative of cancer.
2. A method of detecting the methylation status of one or more CpG islands indicative of prostate cancer, which method comprises
providing a biological sample from a male mammal in need of prostate cancer evaluation; and
assaying the biological sample for methylation of a CpG island associated with at least one gene selected from the group consisting of neuregulin cell-surface ligand (NRG1), kinesin family member 13B (KIF13B), adrenergic B3 receptor (ADRB3), glycosylphosphatidylinositol cell-surface receptor (GFRA2), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1), flbroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1A (HTR1 A), ring finger protein 180 (LOC 285671 or RNF180), EGFR-co-amplified and overexpressed (DKFZP5640822 or ECOP), zinc finger protein 596 (ZNF596), similar to 7 transmembrane helix receptor (LOC441320), L-threonine dehydrogenase (TDH), hypothetical protein FLJ36980 (FLJ36980), fibroblast growth factor receptor 20 (FGF20), EF-hand domain family member 2A (LOC2 86097) (EFHA2), N-acylsphingosine amidohydrolase (acid ceraminase) 1 (ASAH1), nodal homolog (TGF-β signaling pathway) (NODAL), hypothetical protein similar to zinc finger protein 532 (LOC399783), and transcription factor LIM homeodomain (ISL2), matrix metallopeptidase 9 (MMP9), leucine rich repeat containing 49 (LRRC49), tumor necrosis factor (ligand) superfamily member 11 (TNFSF11), ras homolog gene family member D (RHOD), Kinesin family member C2 (KIFC2), chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), Ras association (RalGDS/AF-6) domain family 5 (RASSF5), and HtrA serine peptidase 4 (HTRA4); and
optionally, further assaying the biological sample for methylation of a CpG island associated with at least one gene that is known to be methylated in prostate cancer and that is known not to be detectably methylated or methylated at a lower level in benign prostate hyperplasia (BPH); wherein methylation of the assayed CpG island or islands is indicative of prostate cancer.
3. The method of claim 2 , wherein the method comprises:
assaying the biological sample for methylation of CpG islands associated with at least three genes, at least one of the genes being selected from the group consisting of neuregulin cell-surface ligand (NRG1), kinesin family member 13B (KIF13B), adrenergic B3 receptor (ADRB3), glycosylphosphatidylinositol cell-surface receptor (GFRA2), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1), fibroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1A (HTR1 A), ring finger protein 180 (LOC 285671 or RNF180), EGFR-co-amplified and overexpressed (DKFZP5640822 or ECOP), zinc finger protein 596 (ZNF596), similar to 7 transmembrane helix receptor (LOC441320), L-threonine dehydrogenase (TDH), hypothetical protein FLJ36980 (FLJ36980), fibroblast growth factor receptor 20 (FGF20), EF-hand domain family member 2A (LOC2 86097 or EFHA2), N-acylsphingosine amidohydrolase (acid ceraminase) 1 (ASAH1), nodal homolog (TGF-β signaling pathway) (NODAL), hypothetical protein similar to zinc finger protein 532 (LOC399783), and transcription factor LIM homeodomain (ISL2);
the CpG island associated with a gene that is known to be methylated in prostate cancer is also known to be not methylated in BPH or methylated at a level of about 10% or less in BPH; and
wherein methylation of the CpG islands associated with the at least three genes is indicative of prostate cancer;
4. The method of claim 2 , wherein the at least one CpG island that is known to be methylated in prostate cancer and that is known to be unmethylated or methylated at a lower level in BPH is or includes one or more CpG island associated with glutathione S-transferase P1 (GSTP1), glutathione peroxidase 3 (GPX3), glutathione S-transferase M1 (GSTM1), Cub and Sushi multiple domains1 (CSMD1), tumor necrosis factor receptor superfamily member 10C (TNFRSF10C), tumor necrosis factor receptor superfamily 10D (TNFRSF10D), secreted frizzled-related protein 1 (SFRP1), secreted frizzled-related protein 2 (SFRP2), dickkopf homolog 3 (DKK3), prostaglandin-endoperoxide synthase 2 (PTGS2), cyclin-dependent kinase inhibitor 1C (CDKN1C/p57), Ras association (RalGDS/AF-6) domain family 1 (RASSF1), G-protein coupled receptor 62 (GPR62).
5. The method of claim 4 , wherein the at least one CpG island that is known to be methylated in prostate cancer and that is known to be unmethylated or methylated at a lower level in BPH is or includes one or more CpG island associated with glutathione S-transferase P1 (GSTP1).
6. The method of claim 1 , wherein the method comprises assaying for methylation of CpG islands associated with at least 4 genes.
7. The method of claim 1 , wherein the method comprises assaying for methylation of CpG islands associated with at least 5 genes.
8. The method of claim 1 , wherein the method comprises assaying for methylation of CpG islands associated with at least 6 genes.
9. The method of claim 1 , wherein the method comprises assaying for methylation of CpG islands associated with at least 7 genes.
10. The method of claim 1 , wherein the method comprises assaying for methylation of CpG islands associated with at least 8 genes.
11. The method of claim 1 , wherein the method comprises assaying for methylation of CpG islands associated with at least 9 genes.
12. The method of claim 1 , wherein the assaying for methylation of a CpG island comprises amplifying a target sequence that includes at least one CpG dinucleotide in a target sequence selected from the group consisting of (a) SEQ ID NO: 1 and 2 [NRG1], SEQ ID NO: 3 and 4 [ADRB3], SEQ ID NO: 5 and 6 [GFRA2], SEQ ID NO: 7 and 8 [KIF13B], SEQ ID NO: 9 and 10 [RET], SEQ ID NO: 11 and 12 [GPR147], SEQ ID NO: 13 and 14 [NEUROG3], SEQ ID NO: 15 and 16 [PALD], SEQ ID NO: 17 and 18 [HEMK1], SEQ ID NO: 19 and 20 [FGF4], SEQ ID NO: 21 and 22 [GPR62], SEQ ID NO: 23 and 24 [HTR1A], SEQ ID NO: 25 and 26 [RNF180], SEQ ID NO: 27 and 28 [DKFZP5640822], SEQ ID NO: 29 and 30 [ZNF596], SEQ ID NO: 33 and 34 [LOC441320], SEQ ID NO: 35 and 36 [TDK], SEQ ID NO: 37 and 38 [FLJ36980], SEQ ID NO: 39 and 40 [FGF20], SEQ ID NO: 41 and 42 [EFHA2], SEQ ID NO: 43 and 44 [ASAH1], SEQ ID NO: 49 and 50 [NODAL], SEQ ID NO: 51 and 52 [LOC399783], SEQ ID NO: 53 and 54 [ISL2] and (b) fully or partially methylated derivatives of (a).
13. The method of claim 1 , wherein the assaying for methylation of a CpG island comprises amplifying a target sequence that includes at least one CpG dinucleotide or a deaminated derivative thereof in a target sequence selected from the group consisting of (a) SEQ ID NOS: 119 and 220 [KIFC2], SEQ ID NOS: 121 and 122 [C20ORF23], SEQ ID NOS: 123 and 124 [GFRA1], SEQ ID NOS: 129 and 130 [DKK2], SEQ ID NOS: 135 and 136 [NTN1], SEQ ID NO: 195 [RHOD], SEQ ID NO: 196[TNFSF11], SEQ ID NO: 197 [MMP9], and SEQ ID NO: 198 [LRRC49] (b) fully or partially methylated cytosine derivatives of (a), and (c) deaminated derivatives of (b).
14. The method of claim 2 , wherein the assaying for methylation of a CpG island comprises amplifying a target sequence that includes at least one CpG dinucleotide or a deaminated derivative thereof in a target sequence selected from the group consisting of (a) SEQ ID NOS: 119 and 220 [KIFC2], SEQ ID NOS: 121 and 122 [C20ORF23], SEQ ID NOS: 123 and 124 [GFRA1], SEQ ID NOS: 129 and 130 [DKK2], SEQ ID NOS: 135 and 136 [NTN1], SEQ ID NOS: 133 and 134 [RASSF5] and SEQ ID NOS: 193 and 194 [HTRA4], (b) fully or partially methylated cytosine derivatives of (a), and (c) deaminated derivatives of (b).
15. The method of claim 12 , wherein the assaying for methylation comprises performing terminator-coupled linear amplification in the presence of at least one dideoxynucleotide and determining the size of the amplified fragments to thereby determine the methylation status of the cytidine residues.
16. The method of claim 15 , wherein the assaying comprises performing linear amplification in the presence of only one dideoxynucleotide.
17. The method of claim 15 , wherein the assaying comprises performing linear amplification in the presence of only two dideoxynucleotides.
18. The method of claim 15 , wherein the at least one dideoxynucleotide is chosen from the group consisting of dideoxyadenine, dideoxcytidine, dideoxguanine, and dideoxthymidine.
19. A terminator-coupled linear amplification method of determining the methylation status of a CpG island, wherein the method comprises
(a) providing a DNA sample;
(b) incubating the DNA sample under deaminating conditions to thereby produce a deaminated DNA sample;
(c) optionally, purifying the deaminated DNA sample;
(d) amplifying a target sequence or target sequences that include one or more CpG islands or portions of one or more CpG islands to thereby produce one or more amplified target sequences;
(e) optionally, purifying the one or more amplified target sequences;
(f) linearly amplifying the one or more amplified target sequences of step (d) or (e) in the presence of a primer and 1 to 3 dideoxynucleotides to generate one or more fragments of different lengths, wherein each length corresponds to the distance in bases from the 5′ end of the primer to the position where the dideoxynucleotide was incorporated;
(g) optionally, purifying the one or more fragments; and
(h) analyzing the one or more fragments to determine their lengths and thereby determine the methylation status of methylated cytosines within the one or more amplified target sequences.
20. A pair of primers suitable for amplifying at least a portion of one or more CpG-islands associated with a gene selected from the group consisting of neuregulin cell-surface ligand (NRG1), adrenergic B3 receptor (ADRB3), glycosylphosphatidylinositol cell-surface receptor (GFRA2), kinesin family member 13B (KIF13B), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1), fibroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1A (HTR1 A), ring finger protein 180 (LOC 285671) (RNF180), EGFR-co-amplified and overexpressed (ECOP) (DKFZP5640822), zinc finger protein 596 (ZNF596), similar to 7 transmembrane helix receptor (LOC441320), L-threonine dehydrogenase (TDH), hypothetical protein FLJ36980 (FLJ36980), fibroblast growth factor receptor 20 (FGF20), EF-hand domain family member 2A (LOC2 86097) (EFHA2), N-acylsphingosine amidohydrolase (acid ceraminase) 1 (ASAH1), nodal homolog (TGF-B signaling pathway) (NODAL), hypothetical protein similar to zinc finger protein 532 (LOC399783), transcription factor LIM homeodomain (ISL2), kinesin family member C2 (KIFC2), chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), matrix metallopeptidase 9 (MMP9), tumor necrosis factor superfamily member 11 (TNFSF11), ras homolog gene family member D (RHOD), and leucine rich repeat containing 49 (LRRC49).
21. A set of primers comprising:
(i) at least one pair of primers of claim 20 ; and
(ii) at least one pair of primers suitable for amplifying at least a portion of a CpG island associated with at least one other gene that is known to be methylated in prostate cancer but not methylated or methylated at a low level in BPH.
22. A set of primers comprising:
(i) a first pair of primers of claim 20 ; and
(ii) a second pair of primers of claim 20 , wherein the second pair of primers is suitable for amplifying at least a portion of a different CpG island than the first pair of primers.
23. The set of primers of claim 22 , wherein the CpG island amplified by the first pair of primers is associated with a first gene, the CpG island amplified by the second pair of primers is associated with a second gene, and the first and second genes are different genes.
24. The set of primers of claim 21 , wherein the set further comprises a third pair of primers selected from the group consisting of
(i) a pair of primers suitable for amplifying at least a portion of one or more CpG-islands associated with a gene selected from the group consisting of neuregulin cell-surface ligand (NRG1), adrenergic B3 receptor (ADRB3), glycosylphosphatidylinositol cell-surface receptor (GFRA2), kinesin family member 13B (KIF13B), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1), fibroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1A (HTR1 A), ring finger protein 180 (LOC 285671) (RNF180), EGFR-co-amplified and overexpressed (ECOP) (DKFZP5640822), zinc finger protein 596 (ZNF596), similar to 7 transmembrane helix receptor (LOC441320), L-threonine dehydrogenase (TDH), hypothetical protein FLJ36980 (FLJ36980), flbroblast growth factor receptor 20 (FGF20), EF-hand domain family member 2A (LOC2 86097) (EFHA2), N-acylsphingosine amidohydrolase (acid ceraminase) 1 (ASAH1), nodal homolog (TGF-B signaling pathway) (NODAL), hypothetical protein similar to zinc finger protein 532 (LOC399783), transcription factor LIM homeodomain (ISL2), kinesin family member C2 (KIFC2), chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), matrix metallopeptidase 9 (MMP9), tumor necrosis factor superfamily member 11 (TNFSF11), ras homolog gene family member D (RHOD), and leucine rich repeat containing 49 (LRRC49), and
(ii) a pair of primers suitable for amplifying a CpG island known to be methylated in prostate cancer but not methylated or methylated at a low level in BPH, wherein the third pair of primers is suitable for amplifying a different CpG island than that suited for amplification by the first or second pair of primers.
25. The set of primers of claim 24 , wherein the set further comprises a fourth pair of primers selected from the group consisting of
(i) a pair of primers suitable for amplifying at least a portion of one or more CpG-islands associated with a gene selected from the group consisting of neuregulin cell-surface ligand (NRG1), adrenergic B3 receptor (ADRB3), glycosylphosphatidylinositol cell-surface receptor (GFRA2), kinesin family member 13B (KIF13B), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1), fibroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1A (HTR1 A), ring finger protein 180 (LOC 285671) (RNF180), EGFR-co-amplified and overexpressed (ECOP) (DKFZP5640822), zinc finger protein 596 (ZNF596), similar to 7 transmembrane helix receptor (LOC441320), L-threonine dehydrogenase (TDH), hypothetical protein FLJ36980 (FLJ36980), fibroblast growth factor receptor 20 (FGF20), EF-hand domain family member 2A (LOC2 86097) (EFHA2), N-acylsphingosine amidohydrolase (acid ceraminase) 1 (ASAH1), nodal homolog (TGF-B signaling pathway) (NODAL), hypothetical protein similar to zinc finger protein 532 (LOC399783), transcription factor LIM homeodomain (ISL2), kinesin family member C2 (KIFC2), chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), matrix metallopeptidase 9 (MMP9), tumor necrosis factor superfamily member 11 (TNFSF11), ras homolog gene family member D (RHOD), and leucine rich repeat containing 49 (LRRC49), and
(ii) a pair of primers suitable for amplifying a CpG island known to be methylated in prostate cancer but not methylated or methylated at a low level in BPH, wherein the third pair of primers is suitable for amplifying a different CpG island than that suited for amplification by the first, second, or third pair of primers.
26. The set of primers of claim 25 , wherein the set further comprises a fifth pair of primers selected from the group consisting of
(i) a pair of primers suitable for amplifying at least a portion of one or more CpG-islands associated with a gene selected from the group consisting of neuregulin cell-surface ligand (NRG1), adrenergic B3 receptor (ADRB3), glycosylphosphatidylinositol cell-surface receptor (GFRA2), kinesin family member 13B (KIF13B), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1), flbroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1A (HTR1 A), ring finger protein 180 (LOC 285671) (RNF180), EGFR-co-amplified and overexpressed (ECOP) (DKFZP5640822), zinc finger protein 596 (ZNF596), similar to 7 transmembrane helix receptor (LOC441320), L-threonine dehydrogenase (TDH), hypothetical protein FLJ36980 (FLJ36980), flbroblast growth factor receptor 20 (FGF20), EF-hand domain family member 2A (LOC2 86097) (EFHA2), N-acylsphingosine amidohydrolase (acid ceraminase) 1 (ASAH1), nodal homolog (TGF-B signaling pathway) (NODAL), hypothetical protein similar to zinc finger protein 532 (LOC399783), transcription factor LIM homeodomain (ISL2), kinesin family member C2 (KIFC2), chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), matrix metallopeptidase 9 (MMP9), tumor necrosis factor superfamily member 11 (TNFSF11), ras homolog gene family member D (RHOD), and leucine rich repeat containing 49 (LRRC49), and
(ii) a pair of primers suitable for amplifying a CpG island known to be methylated in prostate cancer but not methylated or methylated at a low level in BPH, wherein the third pair of primers is suitable for amplifying a different CpG island than that suited for amplification by the first, second, third, or fourth pair of primers.
27. The set of primers of claim 26 , wherein the set further comprises a sixth pair of primers selected from the group consisting of
(i) a pair of primers suitable for amplifying at least a portion of one or more CpG-islands associated with a gene selected from the group consisting of neuregulin cell-surface ligand (NRG1), adrenergic B3 receptor (ADRB3), glycosylphosphatidylinositol cell-surface receptor (GFRA2), kinesin family member 13B (KIF13B), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1), fibroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1A (HTR1 A), ring finger protein 180 (LOC 285671) (RNF180), EGFR-co-amplified and overexpressed (ECOP) (DKFZP5640822), zinc finger protein 596 (ZNF596), similar to 7 transmembrane helix receptor (LOC441320), L-threonine dehydrogenase (TDH), hypothetical protein FLJ36980 (FLJ36980), flbroblast growth factor receptor 20 (FGF20), EF-hand domain family member 2A (LOC2 86097) (EFHA2), N-acylsphingosine amidohydrolase (acid ceraminase) 1 (ASAH1), nodal homolog (TGF-B signaling pathway) (NODAL), hypothetical protein similar to zinc finger protein 532 (LOC399783), transcription factor LIM homeodomain (ISL2), kinesin family member C2 (KIFC2), chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), matrix metallopeptidase 9 (MMP9), tumor necrosis factor superfamily member 11 (TNFSF11), ras homolog gene family member D (RHOD), and leucine rich repeat containing 49 (LRRC49), and
(ii) a pair of primers suitable for amplifying a CpG island known to be methylated in prostate cancer, wherein the fourth pair of primers is suitable for amplifying a different CpG island than that suited for amplification by the first, second, third, fourth or fifth pair of primers.
28. The set of primers of claim 27 , wherein the set further comprises from one to four additional pairs of primers selected from the group consisting of
(i) a pair of primers suitable for amplifying at least a portion of one or more CpG-islands associated with a gene selected from the group consisting of neuregulin cell-surface ligand (NRG1), adrenergic B3 receptor (ADRB3), glycosylphosphatidylinositol cell-surface receptor (GFRA2), kinesin family member 13B (KIF13B), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1), fibroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1A (HTR1 A), ring finger protein 180 (LOC 285671) (RNF180), EGFR-co-amplified and overexpressed (ECOP) (DKFZP5640822), zinc finger protein 596 (ZNF596), similar to 7 transmembrane helix receptor (LOC441320), L-threonine dehydrogenase (TDH), hypothetical protein FLJ36980 (FLJ36980), fibroblast growth factor receptor 20 (FGF20), EF-hand domain family member 2A (LOC2 86097) (EFHA2), N-acylsphingosine amidohydrolase (acid ceraminase) 1 (ASAH1), nodal homolog (TGF-B signaling pathway) (NODAL), hypothetical protein similar to zinc finger protein 532 (LOC399783), transcription factor LIM homeodomain (ISL2), kinesin family member C2 (KIFC2), chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), matrix metallopeptidase 9 (MMP9), tumor necrosis factor superfamily member 11 (TNFSF11), ras homolog gene family member D (RHOD), and leucine rich repeat containing 49 (LRRC49), and
(ii) a pair of primers suitable for amplifying a CpG island known to be methylated in prostate cancer, wherein each pair of primers in the set amplifies a different CpG island.
29. The set of primers of claim 28 , wherein the set further comprises one or more additional pairs of primers selected from the group consisting of
(i) a pair of primers suitable for amplifying at least a portion of one or more CpG-islands associated with a gene selected from the group consisting of neuregulin cell-surface ligand (NRG1), adrenergic B3 receptor (ADRB3), glycosylphosphatidylinositol cell-surface receptor (GFRA2), kinesin family member 13B (KIF13B), RET proto-oncogene (RET), G-protein-coupled protein receptor 147 (GPR147), neurogenin 3 transcription factor (NEUROG3), paladin (protein tyrosine phosphatase) (PALD), methyltransferase family member 1 (HEMK1), flbroblast growth factor 4 oncogene (FGF4), 5-hydroxytryptamine (serotonin) receptor 1A (HTR1 A), ring finger protein 180 (LOC 285671) (RNF180), EGFR-co-amplified and overexpressed (ECOP) (DKFZP5640822), zinc finger protein 596 (ZNF596), similar to 7 transmembrane helix receptor (LOC441320), L-threonine dehydrogenase (TDH), hypothetical protein FLJ36980 (FLJ36980), flbroblast growth factor receptor 20 (FGF20), EF-hand domain family member 2A (LOC2 86097) (EFHA2), N-acylsphingosine amidohydrolase (acid ceraminase) 1 (ASAH1), nodal homolog (TGF-B signaling pathway) (NODAL), hypothetical protein similar to zinc finger protein 532 (LOC399783), transcription factor LIM homeodomain (ISL2), kinesin family member C2 (KIFC2), chromosome 20 open reading frame 23 (Kinesin-like motor protein) (C20orf23), GDNF family receptor alpha 1 (GFRA1), Glutathione peroxidase 7 (GPX7), Dickkopf homolog 2 (DKK2), netrin 1 (NTN1), matrix metallopeptidase 9 (MMP9), tumor necrosis factor superfamily member 11 (TNFSF11), ras homolog gene family member D (RHOD), and leucine rich repeat containing 49 (LRRC49), and
(ii) a pair of primers suitable for amplifying a CpG island known to be methylated in prostate cancer, wherein each pair of primers in the set amplifies a different CpG island.
30. A pair of primers or set of primers of claim 20 , wherein the pair or set of primers have sequences selected from the group consisting of SEQ ID NOs: 55 to 118.
31. The primer or set of primers of claim 20 , wherein the pair of primers or the set of primers includes two primers suitable for amplifying a CpG island associated with NRG1 or KIF13b.
32. The primer or set of primers of claim 20 , wherein the pair of primers or the set of primers includes two primers suitable for amplifying a CpG island associated with TDH, ASAH1, FGF20, HEMK1, PALD NEUROG, EFHA2, KIFC2, GFRA1, DKK2, TNFSF11, NTN1, or RHOD.
33. A kit for detecting the methylation status of a CpG island indicative of cancer, the kit comprising:
(i) a pair of primers or set of primers of claim 20 ; and
(ii) instructions for using the primers to amplify at least one CpG island from a biological sample.
34. The kit of claim 33 , further comprising a buffer selected from the group consisting of (a) a buffer for amplifying genomic DNA, (b) a buffer for preparing genomic DNA from a biological sample, and (c) a buffer for preparing genomic DNA from plasma or urine.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US12/115,674 US20080213791A1 (en) | 2005-11-08 | 2008-05-06 | Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer |
US12/983,738 US8546078B2 (en) | 2005-11-08 | 2011-01-03 | Materials and method for assaying for methylation of CpG islands associated with genes in the evaluation of cancer |
US13/973,540 US20140057260A1 (en) | 2005-11-08 | 2013-08-22 | MATERIALS AND METHOD FOR ASSAYING FOR METHYLATION OF CpG ISLANDS ASSOCIATED WITH GENES IN THE EVALUATION OF CANCER |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US73457705P | 2005-11-08 | 2005-11-08 | |
PCT/US2006/060685 WO2007102891A2 (en) | 2005-11-08 | 2006-11-08 | Materials and methods for assaying for methylation of cpg islands associated with genes in the evaluation of cancer |
US12/115,674 US20080213791A1 (en) | 2005-11-08 | 2008-05-06 | Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2006/060685 Continuation WO2007102891A2 (en) | 2005-11-08 | 2006-11-08 | Materials and methods for assaying for methylation of cpg islands associated with genes in the evaluation of cancer |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/983,738 Division US8546078B2 (en) | 2005-11-08 | 2011-01-03 | Materials and method for assaying for methylation of CpG islands associated with genes in the evaluation of cancer |
Publications (1)
Publication Number | Publication Date |
---|---|
US20080213791A1 true US20080213791A1 (en) | 2008-09-04 |
Family
ID=38445636
Family Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/115,674 Abandoned US20080213791A1 (en) | 2005-11-08 | 2008-05-06 | Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer |
US12/983,738 Expired - Fee Related US8546078B2 (en) | 2005-11-08 | 2011-01-03 | Materials and method for assaying for methylation of CpG islands associated with genes in the evaluation of cancer |
US13/973,540 Abandoned US20140057260A1 (en) | 2005-11-08 | 2013-08-22 | MATERIALS AND METHOD FOR ASSAYING FOR METHYLATION OF CpG ISLANDS ASSOCIATED WITH GENES IN THE EVALUATION OF CANCER |
Family Applications After (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/983,738 Expired - Fee Related US8546078B2 (en) | 2005-11-08 | 2011-01-03 | Materials and method for assaying for methylation of CpG islands associated with genes in the evaluation of cancer |
US13/973,540 Abandoned US20140057260A1 (en) | 2005-11-08 | 2013-08-22 | MATERIALS AND METHOD FOR ASSAYING FOR METHYLATION OF CpG ISLANDS ASSOCIATED WITH GENES IN THE EVALUATION OF CANCER |
Country Status (6)
Country | Link |
---|---|
US (3) | US20080213791A1 (en) |
EP (2) | EP2186912A3 (en) |
JP (1) | JP2009514555A (en) |
AU (1) | AU2006339538A1 (en) |
CA (1) | CA2629008A1 (en) |
WO (1) | WO2007102891A2 (en) |
Cited By (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20090197263A1 (en) * | 2006-01-04 | 2009-08-06 | Nelson William G | Compare-MS: Method Rapid, Sensitive and Accurate Detection of DNA Methylation |
US20100009382A1 (en) * | 2004-06-09 | 2010-01-14 | The Regents Of The University Of Michigan | Methods and compositions for diagnosing lung cancer |
US20100105063A1 (en) * | 2007-07-02 | 2010-04-29 | Euclid Diagnostics Llc | Methods for evaluating the methylation status of a polynucleotide |
US20110112280A1 (en) * | 2000-12-22 | 2011-05-12 | Mueller Bernhard K | Use of rgm and its modulators |
US20110237457A1 (en) * | 2010-03-26 | 2011-09-29 | Armune Biosciences, Inc. | Method and system of particle-coupled phage epitope |
US20110237461A1 (en) * | 2010-03-17 | 2011-09-29 | The Regents Of The University Of Michigan | Using phage epitopes to profile the immune response |
WO2014160114A1 (en) * | 2013-03-14 | 2014-10-02 | Hudsonalpha Institute For Biotechnology | Differential methylation level of cpg loci that are determinative of a biochemical reoccurrence of prostate cancer |
US8906864B2 (en) | 2005-09-30 | 2014-12-09 | AbbVie Deutschland GmbH & Co. KG | Binding domains of proteins of the repulsive guidance molecule (RGM) protein family and functional fragments thereof, and their use |
US8962803B2 (en) | 2008-02-29 | 2015-02-24 | AbbVie Deutschland GmbH & Co. KG | Antibodies against the RGM A protein and uses thereof |
US9102722B2 (en) | 2012-01-27 | 2015-08-11 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of diseases associated with neurite degeneration |
US9175075B2 (en) | 2009-12-08 | 2015-11-03 | AbbVie Deutschland GmbH & Co. KG | Methods of treating retinal nerve fiber layer degeneration with monoclonal antibodies against a retinal guidance molecule (RGM) protein |
US20160040243A1 (en) * | 2012-02-13 | 2016-02-11 | Beijing Institute For Cancer Research | Methods and nucleotide fragments of predicting occurrence, metastasis of cancers and patients' postoperative survival in vitro |
US10196697B2 (en) | 2013-12-12 | 2019-02-05 | Almac Diagnostics Limited | Prostate cancer classification |
US10260104B2 (en) | 2010-07-27 | 2019-04-16 | Genomic Health, Inc. | Method for using gene expression to determine prognosis of prostate cancer |
US10968486B2 (en) * | 2014-08-08 | 2021-04-06 | Biochain Institute, Inc. | Gene composition for detecting cell proliferative abnormality or grading disease degree and use thereof |
Families Citing this family (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110151443A1 (en) * | 2009-12-23 | 2011-06-23 | The Chinese University of Hong Kong Room 328, Pi Ch'iu Building | Marker for gastric cancer |
JP5236684B2 (en) * | 2010-04-30 | 2013-07-17 | 株式会社エヌ・ティ・ティ・ドコモ | Portable terminal device, base station device, exchange station device, and mobile communication method |
WO2011157678A1 (en) * | 2010-06-14 | 2011-12-22 | Qiagen Gmbh | Method for determination of target cells or tissue for extraction of biomolecules from fixed biological samples |
JP6081366B2 (en) * | 2010-10-29 | 2017-02-15 | アスラジェン, インコーポレイテッド | MPCR method for analyzing repeat sequences |
WO2014064526A2 (en) * | 2012-10-25 | 2014-05-01 | Mdxhealth Sa | Methylation markers predictive for drug response |
HUE057564T2 (en) * | 2014-09-22 | 2022-06-28 | Univ Groningen | Biomarkers for cervical cancer. |
CN112567049A (en) * | 2018-07-26 | 2021-03-26 | 北京艾克伦医疗科技有限公司 | Method and kit for identifying gastric cancer status |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20030198972A1 (en) * | 2001-12-21 | 2003-10-23 | Erlander Mark G. | Grading of breast cancer |
US20050196792A1 (en) * | 2004-02-13 | 2005-09-08 | Affymetrix, Inc. | Analysis of methylation status using nucleic acid arrays |
US20050214812A1 (en) * | 2003-12-16 | 2005-09-29 | Bayer Healthcare, Llc | Assay for detecting methylation status by methylation specific primer extension (MSPE) |
US20060024676A1 (en) * | 2003-04-14 | 2006-02-02 | Karen Uhlmann | Method of detecting epigenetic biomarkers by quantitative methyISNP analysis |
Family Cites Families (27)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5854033A (en) | 1995-11-21 | 1998-12-29 | Yale University | Rolling circle replication reporter systems |
US6143495A (en) | 1995-11-21 | 2000-11-07 | Yale University | Unimolecular segment amplification and sequencing |
US5786146A (en) | 1996-06-03 | 1998-07-28 | The Johns Hopkins University School Of Medicine | Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids |
US6017704A (en) * | 1996-06-03 | 2000-01-25 | The Johns Hopkins University School Of Medicine | Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids |
AU7829398A (en) | 1997-06-09 | 1998-12-30 | University Of Southern California | A cancer diagnostic method based upon dna methylation differences |
US6124120A (en) | 1997-10-08 | 2000-09-26 | Yale University | Multiple displacement amplification |
WO2000060085A1 (en) | 1999-04-02 | 2000-10-12 | Millennium Pharmaceuticals, Inc. | Fibroblast growth factor-20 |
US6331393B1 (en) * | 1999-05-14 | 2001-12-18 | University Of Southern California | Process for high-throughput DNA methylation analysis |
US7611869B2 (en) | 2000-02-07 | 2009-11-03 | Illumina, Inc. | Multiplexed methylation detection methods |
DE10019058A1 (en) * | 2000-04-06 | 2001-12-20 | Epigenomics Ag | Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle |
US6828098B2 (en) | 2000-05-20 | 2004-12-07 | The Regents Of The University Of Michigan | Method of producing a DNA library using positional amplification based on the use of adaptors and nick translation |
WO2002000926A2 (en) * | 2000-06-30 | 2002-01-03 | Epigenomics Ag | Diagnosis of diseases associated with signal transduction |
DE10104938B4 (en) * | 2001-01-29 | 2005-06-23 | Epigenomics Ag | Fluorescence Polarization 1 |
WO2002086163A1 (en) | 2001-04-20 | 2002-10-31 | Karolinska Innovations Ab | Methods for high throughput genome analysis using restriction site tagged microarrays |
US6777187B2 (en) | 2001-05-02 | 2004-08-17 | Rubicon Genomics, Inc. | Genome walking by selective amplification of nick-translate DNA library and amplification from complex mixtures of templates |
US7045319B2 (en) * | 2001-10-30 | 2006-05-16 | Ribomed Biotechnologies, Inc. | Molecular detection systems utilizing reiterative oligonucleotide synthesis |
JP4381142B2 (en) * | 2001-11-16 | 2009-12-09 | ザ ジョーンズ ホプキンス ユニバーシティー スクール オブ メディシン | Prostate cancer detection |
ITMI20021487A1 (en) | 2002-07-05 | 2004-01-05 | Colnago Ernesto & C Srl | BICYCLE FRAME WITH IMPROVED MECHANICAL RESISTANCE |
DE10304219B3 (en) * | 2003-01-30 | 2004-08-19 | Epigenomics Ag | Method for the detection of cytosine methylation patterns with high sensitivity |
DK2374900T3 (en) | 2003-03-07 | 2016-10-17 | Rubicon Genomics Inc | Polynucleotides for amplification and analysis of the total genomic and total transcription libraries generated by a DNA polymerization |
DE10331107B3 (en) | 2003-07-04 | 2004-12-02 | Epigenomics Ag | Detecting cytosine methylation in DNA, useful e.g. for diagnosis of cancer, comprises using a cytidine deaminase selective for unmethylated residues, and detecting presence or amount of deaminated residues |
WO2005007830A2 (en) * | 2003-07-14 | 2005-01-27 | Mayo Foundation For Medical Education And Research | Methods and compositions for diagnosis, staging and prognosis of prostate cancer |
WO2005042713A2 (en) * | 2003-10-28 | 2005-05-12 | The Johns Hopkins University | Quantitative multiplex methylation-specific pcr |
ES2801379T3 (en) * | 2003-12-01 | 2021-01-11 | Epigenomics Ag | Methods and nucleic acids for the analysis of gene expression associated with the development of proliferative disorders of prostate cells |
CA2902980A1 (en) | 2004-03-08 | 2005-09-29 | Rubicon Genomics, Inc. | Methods and compositions for generating and amplifying dna libraries for sensitive detection and analysis of dna methylation |
ITMI20050334A1 (en) * | 2004-03-11 | 2005-09-12 | Leuze Electronic Gmbh Co Kg | OPTICAL SENSOR FOR DETECTION OF OBJECTS IN A MONITORING AREA |
US20070059720A9 (en) | 2004-12-06 | 2007-03-15 | Suzanne Fuqua | RNA expression profile predicting response to tamoxifen in breast cancer patients |
-
2006
- 2006-11-08 CA CA002629008A patent/CA2629008A1/en not_active Abandoned
- 2006-11-08 EP EP10153479A patent/EP2186912A3/en not_active Withdrawn
- 2006-11-08 WO PCT/US2006/060685 patent/WO2007102891A2/en active Application Filing
- 2006-11-08 JP JP2008540330A patent/JP2009514555A/en active Pending
- 2006-11-08 AU AU2006339538A patent/AU2006339538A1/en not_active Abandoned
- 2006-11-08 EP EP06850126A patent/EP1951911A2/en not_active Withdrawn
-
2008
- 2008-05-06 US US12/115,674 patent/US20080213791A1/en not_active Abandoned
-
2011
- 2011-01-03 US US12/983,738 patent/US8546078B2/en not_active Expired - Fee Related
-
2013
- 2013-08-22 US US13/973,540 patent/US20140057260A1/en not_active Abandoned
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20030198972A1 (en) * | 2001-12-21 | 2003-10-23 | Erlander Mark G. | Grading of breast cancer |
US20060024676A1 (en) * | 2003-04-14 | 2006-02-02 | Karen Uhlmann | Method of detecting epigenetic biomarkers by quantitative methyISNP analysis |
US20050214812A1 (en) * | 2003-12-16 | 2005-09-29 | Bayer Healthcare, Llc | Assay for detecting methylation status by methylation specific primer extension (MSPE) |
US20050196792A1 (en) * | 2004-02-13 | 2005-09-08 | Affymetrix, Inc. | Analysis of methylation status using nucleic acid arrays |
Cited By (33)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110112280A1 (en) * | 2000-12-22 | 2011-05-12 | Mueller Bernhard K | Use of rgm and its modulators |
US8680239B2 (en) | 2000-12-22 | 2014-03-25 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Use of RGM and its modulators |
US7981420B2 (en) | 2000-12-22 | 2011-07-19 | Max-Planck-Gesellschaft Zur Foederung Der Wissenschaften E.V. | Therapeutic use of antibodies directed against repulsive guidance molecule (RGM) |
US20110070652A1 (en) * | 2004-06-09 | 2011-03-24 | The Regents Of The University Of Michigan | Phage microarray profiling of the humoral response to disease |
US8617547B2 (en) | 2004-06-09 | 2013-12-31 | The Regents Of The University Of Michigan | Methods and compositions for diagnosing prostate cancer |
US9267133B2 (en) | 2004-06-09 | 2016-02-23 | The Regents Of The University Of Michigan | Phage microarray profiling of the humoral response to disease |
US20100009382A1 (en) * | 2004-06-09 | 2010-01-14 | The Regents Of The University Of Michigan | Methods and compositions for diagnosing lung cancer |
US10006023B2 (en) | 2004-06-09 | 2018-06-26 | The Regents Of The University Of Michigan | Phage microarray profiling of the humoral response to disease |
US8906864B2 (en) | 2005-09-30 | 2014-12-09 | AbbVie Deutschland GmbH & Co. KG | Binding domains of proteins of the repulsive guidance molecule (RGM) protein family and functional fragments thereof, and their use |
US20090197263A1 (en) * | 2006-01-04 | 2009-08-06 | Nelson William G | Compare-MS: Method Rapid, Sensitive and Accurate Detection of DNA Methylation |
US7906288B2 (en) * | 2006-01-04 | 2011-03-15 | The Johns Hopkins University | Compare-MS: method rapid, sensitive and accurate detection of DNA methylation |
US8361724B2 (en) * | 2007-07-02 | 2013-01-29 | Euclid Diagnostics Llc | Methods for evaluating the methylation status of a polynucleotide |
US8658369B2 (en) | 2007-07-02 | 2014-02-25 | Euclid Diagnostics Llc | Methods for evaluating the methylation status of a polynucleotide |
US20100105063A1 (en) * | 2007-07-02 | 2010-04-29 | Euclid Diagnostics Llc | Methods for evaluating the methylation status of a polynucleotide |
US9605069B2 (en) | 2008-02-29 | 2017-03-28 | AbbVie Deutschland GmbH & Co. KG | Antibodies against the RGM a protein and uses thereof |
US8962803B2 (en) | 2008-02-29 | 2015-02-24 | AbbVie Deutschland GmbH & Co. KG | Antibodies against the RGM A protein and uses thereof |
US9175075B2 (en) | 2009-12-08 | 2015-11-03 | AbbVie Deutschland GmbH & Co. KG | Methods of treating retinal nerve fiber layer degeneration with monoclonal antibodies against a retinal guidance molecule (RGM) protein |
US20110237461A1 (en) * | 2010-03-17 | 2011-09-29 | The Regents Of The University Of Michigan | Using phage epitopes to profile the immune response |
EP3450979A2 (en) | 2010-03-17 | 2019-03-06 | The Regents of The University of Michigan | Using phage epitopes to profile the immune response |
US11307203B2 (en) | 2010-03-17 | 2022-04-19 | The Regents Of The University Of Michigan | Using phage epitopes to profile the immune response |
US9658231B2 (en) | 2010-03-17 | 2017-05-23 | The Regents Of The University Of Michigan | Using phage epitopes to profile the immune response |
US20110237457A1 (en) * | 2010-03-26 | 2011-09-29 | Armune Biosciences, Inc. | Method and system of particle-coupled phage epitope |
US10260104B2 (en) | 2010-07-27 | 2019-04-16 | Genomic Health, Inc. | Method for using gene expression to determine prognosis of prostate cancer |
US9102722B2 (en) | 2012-01-27 | 2015-08-11 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of diseases associated with neurite degeneration |
US9365643B2 (en) | 2012-01-27 | 2016-06-14 | AbbVie Deutschland GmbH & Co. KG | Antibodies that bind to repulsive guidance molecule A (RGMA) |
US10106602B2 (en) | 2012-01-27 | 2018-10-23 | AbbVie Deutschland GmbH & Co. KG | Isolated monoclonal anti-repulsive guidance molecule A antibodies and uses thereof |
US10214778B2 (en) | 2012-02-13 | 2019-02-26 | Beijing Institute For Cancer Research | Methods and nucleotide fragments of predicting occurrence, metastasis of cancers and patients' postoperative survival in vitro |
US20160040243A1 (en) * | 2012-02-13 | 2016-02-11 | Beijing Institute For Cancer Research | Methods and nucleotide fragments of predicting occurrence, metastasis of cancers and patients' postoperative survival in vitro |
US9637797B2 (en) * | 2012-02-13 | 2017-05-02 | Beijing Institute For Cancer Research | Methods and nucleotide fragments of predicting occurrence, metastasis of cancers and patients' postoperative survival in vitro |
WO2014160114A1 (en) * | 2013-03-14 | 2014-10-02 | Hudsonalpha Institute For Biotechnology | Differential methylation level of cpg loci that are determinative of a biochemical reoccurrence of prostate cancer |
US10196697B2 (en) | 2013-12-12 | 2019-02-05 | Almac Diagnostics Limited | Prostate cancer classification |
US10968486B2 (en) * | 2014-08-08 | 2021-04-06 | Biochain Institute, Inc. | Gene composition for detecting cell proliferative abnormality or grading disease degree and use thereof |
US11840739B2 (en) | 2014-08-08 | 2023-12-12 | Biochain(Beijing) Science & Technology, Inc. | Gene composition for detecting cell proliferative abnormality or grading disease degree and use thereof |
Also Published As
Publication number | Publication date |
---|---|
AU2006339538A1 (en) | 2007-09-13 |
US20140057260A1 (en) | 2014-02-27 |
AU2006339538A2 (en) | 2008-07-10 |
JP2009514555A (en) | 2009-04-09 |
EP1951911A2 (en) | 2008-08-06 |
US20110097728A1 (en) | 2011-04-28 |
EP2186912A3 (en) | 2011-01-19 |
WO2007102891A2 (en) | 2007-09-13 |
EP2186912A2 (en) | 2010-05-19 |
CA2629008A1 (en) | 2007-09-13 |
US8546078B2 (en) | 2013-10-01 |
WO2007102891A3 (en) | 2008-01-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US8546078B2 (en) | Materials and method for assaying for methylation of CpG islands associated with genes in the evaluation of cancer | |
EP2250287B1 (en) | Detection and prognosis of lung cancer | |
US8658369B2 (en) | Methods for evaluating the methylation status of a polynucleotide | |
EP3269826B1 (en) | Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders | |
AU2012300196B2 (en) | DNA methylation in colorectal and breast cancer diagnostic methods | |
US20160369356A1 (en) | Methods and nucleic acids for analyses of cell proliferative disorders | |
US20180023144A1 (en) | Methods and nucleic acids for analyses of cell proliferative disorders | |
WO2009153667A2 (en) | Method for the detection of ovarian cancer | |
EP1636387A2 (en) | Methods and nucleic acids for the analysis of colorectal cell proliferative disorders | |
CN114207153A (en) | Method and kit for screening colorectal tumors | |
US20130288967A1 (en) | Materials and methods for cancer diagnosis by evaluation of the methylation status of cpg islands on chromosomes 6 and 8 | |
EP2044214A2 (en) | A method for determining the methylation rate of a nucleic acid | |
US20100003680A1 (en) | Method For Determining The Methylation Rate of a Nucleic Acid | |
CN117721203A (en) | Composition for detecting thyroid cancer and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: EUCLID DIAGNOSTICS LLC, INDIANA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FREIJE, WADIHA;NUSSKERN, DEBORAH;REEL/FRAME:020905/0577 Effective date: 20080505 |
|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |