Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
  • C12N15/8206—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
  • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation

Definitions

• the present invention relates to a method for the specific and selective alteration of a nucleotide sequence at a specific site of the DNA in a target cell by the introduction into the cell of a single stranded DNA oligonucleotide mutagenic nucleobase. More in particular, the invention relates to a process of targeted mutagenesis by the introduction of a mutagenic nucleobase into plant protoplasts using polyethylene glycol (PEG). The invention further relates to kits containing a mutagenic nucleobase and PEG. The invention also relates to the use of PEG for enhancing targeted mutagenesis.
• PEG polyethylene glycol
• the process of deliberately creating changes in the genetic material of living cells has the goal of modifying one or more genetically encoded biological properties of that cell, or of the organism of which the cell forms part or into which it can regenerate. These changes can take the form of deletion of parts of the genetic material, addition of exogenous genetic material, or changes in the existing nucleotide sequence of the genetic material.
• Methods of altering the genetic material of eukaryotic organisms have been known for over 20 years, and have found widespread application in plant, human and animal cells and micro-organisms for improvements in the fields of agriculture, human health, food quality and environmental protection.
• Targeted mutagenesis is a site-directed mutagenesis method that is based on the delivery into the eukaryotic cell nucleus of synthetic mutagenic nucleobases (molecules consisting of short stretches of nucleotide-like moieties that resemble DNA in their Watson-Crick basepairing properties, but may be chemically different from DNA) (Alexeev and Yoon, Nature Biotechnol. 16: 1343, 1998; Rice, Nature Biotechnol. 19: 321, 2001; Kmiec, J. Clin. Invest. 112: 632, 2003). Once introduced into the cell, such mutagenic nucleobases basepair with the complementary sequence at the target locus.
• synthetic mutagenic nucleobases molecules consisting of short stretches of nucleotide-like moieties that resemble DNA in their Watson-Crick basepairing properties, but may be chemically different from DNA
• the mismatch may a nucleotide conversion at the corresponding position in the target genomic sequence.
• This method allows the conversion of single or at most a few nucleotides in endogenous loci, but may be applied to create stop codons in existing loci, resulting in a disruption of their function, or to create codon changes, resulting in genes encoding proteins with altered amino acid composition (protein engineering).
• Targeted mutagenesis has been described in plant, animal and yeast cells. Two different classes of synthetic mutagenic nucleobases have been used in these studies, the chimeric DNA:RNA nucleobases or single stranded nucleobases.
• the chimeric DNA:RNA nucleobases are self complementary molecules consisting of a 25 by DNA only region and a 25 bp complementary sequence made up of 5 bp of core region of DNA flanked on either side by 10 bp of 2′-O-methylated RNA that are thought to aid stability of the chimera in the cell.
• the 5 bp core region includes in its centre an engineered mismatch with the nucleotide to be altered in the genomic target DNA sequence. Both these regions are linked by 4 by thymidine hairpins.
• the chimera Upon introduction into the cell the chimera is thought form a double D-loop with its target sequence and a mismatch is formed between the chimera and the target nucleotide.
• Targeted mutagenesis has been described in a variety of patent applications of Kmiec, inter alia in WO0173002, WO03/027265, WO01/87914, WO99/58702, WO97/48714, WO02/10364.
• WO 01/73002 it is contemplated that the low efficiency of gene alteration obtained using unmodified nucleobases is largely believed to be the result of their degradation by nucleases present in the reaction mixture or the target cell.
• modified nucleotides that render the resulting nucleobases resistant against nucleases.
• Typical examples of such modified nucleotides include phosphorothioate linkages or 2′-O-methyl-analogs.
• a ss nucleobase containing modified nucleotides that enhance its binding affinity may more efficiently find its complementary target in a complex genome and/or remain bound to its target for longer and be less likely to be removed by proteins regulating DNA transcription and replication.
• An in vitro targeted mutagenesis assay has been used to test many modified nucleotides to improve the efficiency of the mutagenesis process.
• Locked nucleic acids (LNA) and C5-propyne pyrimidines have modifications of the sugar moiety and base respectively that stabilize duplex formation and raise the melting temperature of the duplex.
• the present inventors have set out to improve the frequency of targeted mutagenesis in plant cells by optimizing the method used to introduce the mutagenic nucleobases into plant cells.
• T-DNA tumour inducing plasmid
• the most widely used method for transformation of plant cells transfers a section of its tumour inducing (Ti) plasmid, the so-called T-DNA, to plant cells where it efficiently integrates into the plant genome at a random position.
• the T-DNA is flanked at either end by “border” sequences of up to 22 bps derived from the Ti plasmid which share no homology with the target sequence. Given the short length of the ss mutagenic nucleobases used for targeted mutagenesis, the border sequences would interfere with the process. Thus, targeted mutagenesis can only be achieved in plant cells through direct DNA transfer using chemical or physical methods.
• the mutagenic nucleobase is preferably introduced with a high transformation efficiency, i.e. introduced into as many plant cells as possible.
• the treatment is preferably not lethal to most of the cells, ensuring that as many cells as possible that are transformed also survive the transformation procedure (survival efficiency).
• the transformation method is preferably not detrimental to the subsequent divisions of the transformed plant cells to form microcalli (regeneration/plating efficiency) and finally it is preferably possible to identify individual regenerated plants derived from targeted mutagenesis events without application of a selection (identification efficiency).
• protoplasts derived directly from leaves (mesophyllprotoplasts) or from cell suspensions (reviewed in Sheen, J. (2001) Plant Phys. 127: 1466-1475).
• Protoplasts can be used for transient expression studies, in which case gene expression or protein localization can be assessed shortly after transformation, or for production of stably transformed plants when the protoplasts are grown on medium to promote callus formation and organogenesis.
• electroporation has been successfully applied to many plant species, it remains a difficult technique with several serious limitations (as discussed in: http://qenetics.mqh.harvard.edu/sheenweb/faq.html), in particular in terms of reproducibility. Hence electroporation is less desirable for enhancing the overall efficiency for TNE of targeted mutagenesis.
• PEG-mediated protoplast transformation in itself has been known already since 1985.
• the first method for protoplast transformation utilized PEG (Krens et al. (1982) Nature 296: 72-74; Potyrykus et al. (1985) Plant Mol. Biol.Rep. 3:117-128; Negrutiu et al. (1987) Plant Mol. Biol. 8: 363-373).
• the technique is applicable to protoplasts from many different plants (Rasmussen et al. (1993) Plant Sci. 89: 199-207).
• PEG is thought to stimulate transformation by precipitating the DNA, in the presence of divalent cations, onto the surface of the protoplasts from where it then becomes internalized (Maas & Werr (1989) Plant Cell Rep.
• PEG transformation is the method of choice for transformation of Arabidopsis protoplasts (http://qenetics.mqh.harvard.edu/sheenweb/faq.html) (Mathur et al. Methods in molecular biology, vol. 82, 267-276) and conforms well to the four requirements defined for a transformation method for efficient TNE.
• a biotin-labelled ss oligonucleotide can be detected in all cells examined. Survival, as assessed by vital staining using fluorescein diacetate, is >90% after PEG treatment. Not all protoplasts retain the ability to divide and form microcalli.
• the present inventors have set out to improve the method of direct DNA transfer to obtain efficient targeted mutagenesis in plant cells.
• the present inventors have found that from amongst the transformation technologies as described herein elsewhere, PEG protoplast transformation enhances the overall targeted mutagenesis efficiency significantly compared to electroporation and biolistics. This is surprising, as the technologies for targeted mutagenesis in plants to date appeared to favour electroporation with the associated low efficiencies. Furthermore most improvements in the technology were directed at improving the mutagenic nucleobases and not in the delivery system for delivering the mutagenic nucleobase to the genomic target DNA.
• the present inventors used ss mutagenic nucleobase designed to produce a P194Q conversion at the ALS locus leading to herbicide resistance.
• Identical ss mutagenic nucleobases were introduced into tobacco mesophyllprotoplasts using either PEG mediated transformation or electroporation and herbicide resistant cells were selected using identical selection conditions.
• PEG-mediated transformation of plant cells is the most efficient method to perform targeted mutagenesis in plant cells compared to known methods of transformation.
• the invention pertains to a method for targeted alteration of a duplex acceptor DNA sequence in a plant cell protoplast, comprising combining the duplex acceptor DNA sequence with a ss mutagenic nucleobase, wherein the duplex acceptor DNA sequence contains a first DNA sequence and a second DNA sequence which is the complement of the first DNA sequence and wherein the donor ss mutagenic nucleobase comprises at least one mismatch with respect to the duplex acceptor DNA sequence to be altered, preferably with respect to the first DNA sequence, wherein the method further comprises a step of introducing the ss mutagenic nucleobase into the cell protoplasts using polyethylene glycol (PEG) mediated transformation.
• PEG polyethylene glycol
• the ss mutagenic nucleobase is brought into contact with protoplasts of the plant to be transformed using a PEG transformation based technology.
• the PEG mediated transformation technology in itself is widely known and were necessary, small amendments to particular protocols can be made by the skilled man without departing from the gist of the present invention.
• the ss mutagenic nucleobase used in the present invention have a length that is in line with other (chimeric) ss mutagenic nucleobase used in targeted mutagenesis, i.e. typically between 10-60 nucleotides, preferably 20-55 nucleotides, more preferably 25-50 nucleotides.
• the ss mutagenic nucleobase used in the present invention can be modified, for instance by LNA and/or propynyl modifications as described in applicant's WO2007073166 and WO2007073170.
• the ss mutagenic nucleobase contains at least one LNA located at a position that is from the targeted mismatch and preferably two LNAs located at least one nucleotide removed from either side of the mismatch and.
• these LNAs are at least 3, 4 or 5 nucleotides removed form the 5′ and/or 3′ ends of the ss mutagenic nucleobase.
• the ss mutagenic nucleobase can comprise one or more propyne substitutions, essentially as described in WO2007073166 and WO2007073170.
• the donor ss mutagenic nucleobase may be conjugated to protein such as a nuclear localisation signal.
• the oligonucleotide used in the present invention is coupled via conventional (linker) technology to a nuclear localisation signal such as the known (NLS) peptide of the SV40 large T antigen, GATA transcription factor 11, DNA repair helicase XBP1, Light mediated protein DET1, ERF transcription factor, PR-related transcript activator PTI6 and nuclear coiled protein, essentially as described in applicants co-pending application PCT/NL2007/000279.
• the oligonucleotide-nuclear localisation signal conjugate can be used in the PEG-based transformation methodology described herein.
• the alteration produced by the method of the present invention is a deletion, a substitution or an insertion of at least one nucleotide.
• the alteration is a substitution. More nucleotides may be altered in one oligonucleotide, but it is expected that efficiency will diminish, hence there is a preference for altering one nucleotide.
• the target DNA can be from any source, but preferably the target DNA is from a plant.
• the target DNA is from genomic DNA, linear DNA, artificial chromosomes, nuclear chromosomal DNA, organelle chromosomal DNA, episomal DNA.
• the method according to the invention can be used for altering a cell, correcting a mutation by restoration to wild type, inducing a mutation, inactivating an enzyme by disruption of coding region, modifying bioactivity of an enzyme by altering coding region, modifying a protein by disrupting the coding region.
• the invention relates to the use of PEG mediated transformation for enhancing the efficiency of targeted mutagenesis in plant protoplasts.
• the use of PEG mediated transformation precipitates the DNA on the cell membrane of the protoplast.
• the precipitated DNA is encapsulated by the cell membrane and introduced into the protoplast in a shielded form.
• the protoplast will, in the course of its normal cell cycle, directly after its formation by removal of the cell wall, start its normal cell wall regeneration process.
• the cell division typically starts later (from several hours up to a few days).
• the targeted nucleotide exchange generally takes place during the cell division, using the cell's repair mechanism.
• the donor DNA is prone to attack form the cells defence mechanism such as exonucleases and is likely to be degenerated and hence become ineffective for TNE.
• the donor DNA is encapsulated via endocytosis and is in this way at least temporarily shielded from the degenerative action of endonucleases.
• the DNA is released from its encapsulated form, it has an increased chance of being present at or around the moment of the cell division, during which the DNA (i.e. the ss mutagenic nucleobase) is available to find its complement in the DNA of the acceptor cell and exchange the nucleotide as in common targeted mutagenesis mechanisms.
• MS20 medium In vitro shoot cultures of Nicotiana tabacum cv Petit Havana line SR1 are maintained on MS20 medium with 0.8% Difco agar in high glass jars at 16/8 h photoperiod of 2000 lux at 25° C. and 60-70% RH.
• MS20 medium is basic Murashige and Skoog's medium (Murashige, T. and Skoog, F., Physiologia Plantarum, 15: 473-497, 1962) containing 2% (w/v) sucrose, no added hormones and 0.8% Difco agar. Fully expanded leaves of 3-6 week old shoot cultures are harvested.
• MDE basal medium contained 0.25 g KCl, 1.0 g MgSO 4 .7H 2 O, 0.136 g of KH 2 PO 4 , 2.5 g polyvinylpyrrolidone (MW 10,000), 6 mg naphthalene acetic acid and 2 mg 6-benzylaminopurine in a total volume of 900 ml.
• the osmolality of the solution is adjusted to 600 mOsm.kg ⁇ 1 with sorbitol, the pH to 5.7.
• enzyme stock SR1 5 mL of enzyme stock SR1 are then added.
• the enzyme stock consists of 750 mg Cellulase Onozuka R10, 500 mg driselase and 250 mg macerozyme R10 per 100 ml, filtered over Whatman paper and filter-sterilized. Digestion is allowed to proceed overnight in the dark at 25° C. The digested leaves are filtered through 50 ⁇ m nylon sieves into a sterile beaker. An equal volume of cold KCl wash medium is used to wash the sieve and pooled with the protoplast suspension.
• KCl wash medium consisted of 2.0 g CaCl 2 .2H 2 O per liter and a sufficient quantity of KCl to bring the osmolality to 540 mOsm.kg ⁇ 1 .
• the suspension is transferred to 10 mL tubes and protoplasts are pelleted for 10 min at 85 ⁇ g at 4° C. The supernatant is discarded and the protoplast pellets carefully resuspended into 5 mL cold MLm wash medium, which is the macro-nutrients of MS medium (Murashige, T.
• the content of 2 tubes is pooled and 1 mL of KCl wash medium added above the sucrose solution care being taken not to disturb the lower phase.
• Protoplasts are centrifuged for 10 min at 85 ⁇ g at 4° C.
• the interphase between the sucrose and the KCl solutions containing the live protoplasts is carefully collected.
• An equal volume of KCl wash medium is added and carefully mixed.
• the protoplast density is measured with a haemocytometer.
• the protoplast suspension is centrifuged at 85 ⁇ g for 10 minutes at 5° C. The supernatant is discarded and the protoplast pellet resuspended to a final concentration of 10 6 .mL ⁇ 1 in KCl wash medium.
• 250 ⁇ L of protoplast suspension 250 ⁇ L of protoplast suspension, 1.6 nmoles of ss mutagenic nucleobase and 250 ⁇ l of PEG solution are gently but thoroughly mixed. After 20 min. incubation at room temperature, 5 mL cold 0.275 M Ca(NO 3 ) 2 are added dropwise. The protoplast suspension is centrifuged for 10 min at 85 ⁇ g at 4° C.
• ss mutagenic nucleobase culture medium contained (per liter, pH 5.7) 950 mg KNO 3 , 825 mg NH 4 NO 3 , 220 mg CaCl 2 .2H 2 O, 185 mg MgSO 4 .7H 2 O, 85 mg KH 2 PO 4 , 27.85 mg FeSO 4 .7H 2 O, 37.25 mg Na 2 EDTA.2H 2 O, the micro-nutrients according to Heller's medium (Heller, R., Ann Sci Nat Bot Biol Veg 14: 1-223, 1953), vitamins according to Morel and Wetmore's medium (Morel, G. and R. H. Wetmore, Amer. J. Bot.
• the protoplasts are centrifuged at 85 ⁇ g for 10 minutes at 5° C. The supernatant is discarded and the pellet resuspended in ice-cold electroporation buffer consisting of 10 mM HEPES, 80 mM NaCl, 0.04 mM CaCl 2 , 0.4M mannitol, pH 5.7 adjusted to 540 mOsm.Kg ⁇ 1 with mannitol to a final concentration of 10 6 mL ⁇ 1 .
• Protoplasts are kept on ice throughout the entire procedure. To a 0.4 cm wide electroporation cuvette, 4.5 nmoles ss mutagenic nucleobase and 700 ⁇ L of protoplast suspension are added. A single exponential decay pulse is delivered to the cell suspension using a Biorad GenePulser XCell electroporation system equipped with a PC and CE module according to the following parameters:
• the sample resistance is approximately 30 ohms and the resulting time constant approximately 30 ms.
• These parameters were selected as the parameters giving the highest level of transient expression of GFP in tobacco protoplasts, 24 hrs after electroporation. After pulsing, protoplasts are allowed to recover in the cuvette at room temperature for 30 min. The protoplasts are then recovered in 1 mL T 0 culture medium and transferred to a 10 mL tube. The cuvette is washed with an additional 5 mL T 0 culture medium which is pooled with the protoplast suspension.
• the agarose slab is cut into 6 equal parts and transferred to a Petri dish containing 22.5 mL MAP1AO medium supplemented with 20 nM chlorsulfuron.
• This medium consisted of (per liter, pH 5.7) 950 mg KNO 3 , 825 mg NH 4 NO 3 , 220 mg CaCl 2 .2H 2 O, 185 mg MgSO 4 .7H 2 O, 85 mg KH 2 PO 4 , 27.85 mg FeSO 4 .7H 2 O, 37.25 mg Na 2 EDTA.2H 2 O, the micro-nutrients according to Murashige and Skoog's medium (Murashige, T.
• MAP 1 medium has the same composition as MAP 1 AO medium, with however 3% (w/v) mannitol instead of 6%, and 46.2 mg.l ⁇ 1 histidine (pH 5.7). It was solidified with 0.8% (w/v) Difco agar. Calli are then transferred to RP medium using sterile forceps.
• RP medium consisted of (per liter, pH 5.7) 273 mg KNO 3 , 416 mg Ca(NO 3 ) 2 .4H 2 O, 392 mg Mg(NO 3 ) 2 .6H 2 O, 57 mg MgSO 4 .7H 2 O, 233 mg (NH 4 ) 2 SO 4 , 271 mg KH 2 PO 4 , 27.85 mg FeSO 4 .7H 2 O, 37.25 mg Na 2 EDTA.2H 2 O, the micro-nutrients according to Murashige and Skoog's medium at one fifth of the published concentration, vitamins according to Morel and Wetmore's medium (Morel, G. and R. H. Wetmore, Amer. J. Bot.
• ss mutagenic nucleobase All ss mutagenic nucleobase were synthesized by Eurogentec (Seraing, Belgium), purified by reverse phase HPLC and resuspended into sterile milliQ water. Prior to use, ss mutagenic nucleobase were heated up to 95° C. for 5 min. ss mutagenic nucleobase 06Q262 was designed to introduce a single mismatch (nucleotide underlined) in the tobacco ALS gene (accession number X07644) at codon position P194 which would result in a CCA to CAA (P194Q) conversion. The 06Q261 ss mutagenic nucleobase is the exact match to the tobacco ALS gene sequence and serves as negative control. The 06Q263 ss mutagenic nucleobase consists of a random combination of 40 nucleotides and serves as negative control.
• Protoplast survival after both PEG transformation and electroporation is assessed by esterase activity using the fluorescent vital dye fluorescein diacetate (FDA), 24 hrs after transformation.
• FDA fluorescent vital dye fluorescein diacetate
• Two ⁇ L of a 5 mg.mL ⁇ 1 stock FDA in acetone are added to 1 mL of transformed protoplasts.
• the proportion of fluorescing protoplasts in the entire population is counted with a haemocytometer.
• Observations are carried out with a Nikon Eclipse E600 upright epifluorescence microscope equipped with a GFP LP (EX480/40, DM505, BA510) filter set. Excitation is provided by a 100W super high pressure mercury lamp. Images are acquired using a DS-2 MBWc CCD camera connected to a DS-U1 controller attached to a PC running the NIS Element image acquisition/analysis software.
• DNA is isolated from chlorsulfuron resistant tobacco microcolonies using the DNeasy kit (Qiagen), and used as a template in a PCR reaction. Conversions of the targeted codons in the tobacco ALS gene are detected using the primers 5′GGTCAAGTGCCACGTAGGAT [SEQ ID 4] & 5′GGGTGCTTCACTTTCTGCTC [SEQ ID 5] that amplify a 776 by fragment of this gene, including codon 194. Nucleotide conversion in the herbicide resistant tobacco callus is confirmed by cloning the PCR products into pCR2.1::TOPO (Invitrogen) and sequencing individual plasmids. Tobacco contains 2 alleles of ALS (SurA and SurB).
• Nucleotide conversion at the P194 codon of either of these loci is sufficient to confer resistance to chlorsulfuron.
• tobacco is an allotetraploid species, there are eight possible targets in tobacco at which TNE may have occurred. In line with this, it was necessary to sequence >10 plasmid clones containing the PCR product to detect one with a CCA to CAA conversion. This suggests that in each resistant callus only 1 out of the 8 ALS alleles had undergone a targeted mutagenesis mediated nucleotide conversion. For all the calli produced in this study, we observed the expected CCA to CAA nucleotide conversion.

Priority Applications (3)

Applications Claiming Priority (1)

Related Parent Applications (1)

Related Child Applications (1)

Publications (1)

Family

ID=39745349

Family Applications (4)

Family Applications After (3)

Country Status (16)

Families Citing this family (10)

Citations (3)

Family Cites Families (21)

• 2007
  • 2007-12-21 KR KR1020107016236A patent/KR101452818B1/ko active IP Right Grant
  • 2007-12-21 WO PCT/NL2007/000326 patent/WO2009082190A1/en active Application Filing
  • 2007-12-21 HU HUE12193811A patent/HUE025914T2/en unknown
  • 2007-12-21 US US12/809,384 patent/US20100291684A1/en not_active Abandoned
  • 2007-12-21 EP EP12193811.2A patent/EP2562261B1/de active Active
  • 2007-12-21 JP JP2010539319A patent/JP5731201B2/ja active Active
  • 2007-12-21 BR BRPI0722219-0A2A patent/BRPI0722219A2/pt not_active IP Right Cessation
  • 2007-12-21 ES ES07860889.0T patent/ES2450743T3/es active Active
  • 2007-12-21 EP EP07860889.0A patent/EP2235187B1/de active Active
  • 2007-12-21 DK DK12193811.2T patent/DK2562261T3/en active
  • 2007-12-21 CA CA2710262A patent/CA2710262C/en active Active
  • 2007-12-21 CN CN2007801017879A patent/CN101883855B/zh active Active
  • 2007-12-21 NZ NZ586846A patent/NZ586846A/en not_active IP Right Cessation
  • 2007-12-21 DK DK07860889.0T patent/DK2235187T3/en active
  • 2007-12-21 ES ES12193811.2T patent/ES2551256T3/es active Active
  • 2007-12-21 RU RU2010130453/10A patent/RU2515110C2/ru not_active IP Right Cessation
  • 2007-12-21 AU AU2007362895A patent/AU2007362895B2/en active Active
  • 2007-12-21 KR KR1020147010128A patent/KR20140050759A/ko not_active Application Discontinuation
• 2010
  • 2010-06-21 IL IL206513A patent/IL206513A/en active IP Right Grant
  • 2010-07-12 ZA ZA2010/04891A patent/ZA201004891B/en unknown
• 2012
  • 2012-07-17 US US13/551,143 patent/US9365860B2/en active Active
• 2013
  • 2013-08-13 IL IL227942A patent/IL227942A/en active IP Right Grant
• 2016
  • 2016-03-30 US US15/084,935 patent/US11008579B2/en active Active
• 2021
  • 2021-05-11 US US17/316,758 patent/US20210324393A1/en active Pending

Patent Citations (3)

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events