US20100119445A1 - Plexin d1 as a target for tumor diagnosis and therapy - Google Patents

Plexin d1 as a target for tumor diagnosis and therapy Download PDF

Info

Publication number
US20100119445A1
US20100119445A1 US11/996,166 US99616606A US2010119445A1 US 20100119445 A1 US20100119445 A1 US 20100119445A1 US 99616606 A US99616606 A US 99616606A US 2010119445 A1 US2010119445 A1 US 2010119445A1
Authority
US
United States
Prior art keywords
plexin
molecules
binding
tumor
carcinomas
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/996,166
Other languages
English (en)
Inventor
Wilhelmus Petrus Johannes Leenders
Ilse Roodink
Jozef Maria Hendrik Raats
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Radboud Universiteit Nijmegen
Organon NV
Original Assignee
Organon NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Organon NV filed Critical Organon NV
Assigned to STICHTING KATHOLIEKE UNIVERSITEIT reassignment STICHTING KATHOLIEKE UNIVERSITEIT ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: RAATS, JOZEF MARIA HENDRIK, LEENDERS, WILHELMUS PETRUS JOHANNES, ROODINK, ILSE
Publication of US20100119445A1 publication Critical patent/US20100119445A1/en
Assigned to STICHTING KATHOLIEKE UNIVERSITEIT reassignment STICHTING KATHOLIEKE UNIVERSITEIT CORRECTIVE ASSIGNMENT TO CORRECT THE ADDRESS OF THE RECEIVING PARTY PREVIOUSLY RECORDED ON REEL 023505 FRAME 421. ASSIGNOR(S) HEREBY CONFIRMS THE NEW PATENT ASSIGNMENT FROM INVENTORS TO ASSIGNEE. Assignors: RAATS, JOZEF MARIA HENDRIK, LEENDERS, WILHELMUS PETRUS JOHANNES, ROODINK, ILSE
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6811—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
    • A61K47/6817—Toxins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04—Organic compounds
    • A61K51/08—Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
    • A61K51/10—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
    • A61K51/1018—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody against material from animals or humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®

Definitions

  • the present invention relates to the identification of a novel targetable protein that can be used in the treatment and diagnosis of tumors, in particular solid tumors, and disorders that involve inflammation, in particular rheumatoid arthritis, atherosclerosis and multiple sclerosis.
  • VEGF-A Vascular Endothelial Growth Factor-A
  • a number of compounds that target the VEGF-A signaling pathway has been developed with the aim to inhibit angiogenesis and, consequently, tumor growth.
  • tumors may have been growing for months or even years at the time of diagnosis, and a significant proportion of the vasculature may be more or less mature and thus insensitive to angiogenesis inhibition. This situation is in sharp contrast to that in most animal models in which, as a rule, aggressive, fast-growing tumors are studied.
  • patients that are candidates for anti-angiogenic therapy are typically patients with disseminated, uncontrollable cancer and growth of metastases may not always be strictly dependent on angiogenesis. Because most metastases are blood-borne, they grow out in organs with intrinsically high vessel densities like liver, lung and brain where they can grow in an angiogenesis-independent fashion by co-option of pre-existent vessels.
  • an angiogenesis inhibitor that very effectively inhibits tumor growth in a number of subcutaneous tumor models (Wedge, S R et al., Cancer Res 62:4645-4655 (2002)) does not inhibit growth of infiltrative tumors in mouse brain. Moreover, upon treatment of mice carrying highly angiogenic brain tumors, angiogenesis inhibition did not result in a halt of further tumor progression, but rather in a progression after a phenotypic shift towards co-option and infiltration (Leenders, W P et al., Clin Cancer Res 10:6222-6230 (2004)). These results imply that anti-angiogenic therapy should be supplemented by vascular targeting therapies in which the existing tumor vascular bed is attacked, resulting in secondary tumor cell death due to disruption of the tumor's blood supply.
  • RA rheumatoid arthritis
  • atherosclerosis angiogenesis and activation of the vasculature is also often part of the pathology.
  • the vasculature here paves the way for inflammatory cells to extravasate and exert their destructive action. Such diseases can thus also benefit from targeting to blood vessels.
  • plexin D1 is expressed on the luminal side of endothelial cells in tumor blood vessels, on the tumor cells themselves and on activated macrophages that are found in tumors, in inflammation and in atherosclerotic plaques.
  • the invention thus relates to plexin D1 for use as a targetable protein in the treatment or diagnosis of disorders that involve expression of plexin D1.
  • Plexins comprise a family of large, single-pass membrane proteins with homology to scatter factor receptors, encoded by the MET gene family.
  • Members of the plexin family share Sema domains, Met-related sequences (MRS), a transmembrane region and intracellular motifs that are predictive of Rac/Rho-GTPase signalling ( FIG. 1 ).
  • plexins can be regarded as regulators of migration.
  • Plexins are receptors for the semaphorins, a family of secreted, GPI-anchored or transmembrane proteins which is subdivided in seven subclasses. Each plexin has its own (set of) semaphorin binding partners, and each plexin-semaphorin combination results in a specific response. Class 3 semaphorins are potent axon repellants and are as such involved in morphogenesis of the nervous system (for review, see (Pasterkamp, R J et al., Curr Opin Neurobiol 13:79-89 (2003); Fujisawa, H, J Neurobiol 59:24-33 (2004)).
  • plexin binding partners For activation of plexins by the semaphorins, additional plexin binding partners may be required. These binding partners, neuropilin-1 and -2 (NP-1 and NP-2) have no signalling motifs in the intracellular domain and are thought of as a passive coreceptors, enabling the interaction between semaphorins and plexins.
  • plexins form yet larger membrane complexes with and activate signalling receptors as Off Track (Otk) and the scatter factor receptors Met and Ron.
  • Otk Off Track
  • Met and Ron the scatter factor receptors Met and Ron.
  • a direct interaction between plexin A1 and the angiogenic Vascular Endothelial Growth Factor-receptor-2 (VEGFR2) has also been demonstrated (Toyofuku, T et al., E-publication in Genes Dev 18:435-447 (2004)).
  • VEGFR2 Vascular Endothelial Growth Factor-receptor-2
  • VEGF-A165 Vascular Endothelial Growth Factor-A
  • VEGF-A165 the potent angiogenic factor Vascular Endothelial Growth Factor-A
  • semaphorin 3A the potent angiogenic factor Vascular Endothelial Growth Factor-A
  • VEGF-A165 binding site on NP-1 overlaps with that for semaphorin 3A (Miao, H Q et al., J Cell Biol 146:233-242 (1999)). It has been postulated that VEGF-A binding to NP-1 promotes migration of endothelial cells by competing for binding of class 3 semaphorins, which is generally followed by F-actin depolymerization and repulsion of cell extensions (Bachelder, R E, Cancer Res 63:5230-5233 (2003)).
  • VEGF-A and class 3 semaphorins Similar antagonistic behaviour of VEGF-A and class 3 semaphorins have been described in a neuronal progenitor cell line (Bagnard, D et al., J Neurosci 21:3332-3341 (2001)) and tumor cells (Bachelder (2003), supra). Since antagonistic effects were observed in tumor cells that are devoid of VEGF receptors, it is conceivable that the underlying mechanism involves members of the plexin family, establishing a further link between plexins and VEGF-A signaling.
  • plxnD1 family member plexin D1
  • plxnD1 family member plexin D1
  • Plxnd1-knockout mice and zebrafish carrying mutations in the plxnd1 gene are characterized by maldevelopment of the cardiovascular system (Gitler, A D et al. (2004), supra; Torres-Vazquez, J et al., (2004), supra).
  • Neuropilin-1 (NP-1) and NP-1/Neuropilin-2 (NP-2) double knock-out mice also suffer from lethal defects in vascularization and aortic arch malformations during embryonic development (Kawasaki, T et al., Development 126:4895-4902 (1999); Takashima, S et al., Proc Natl Acad Sci USA 99:3657-3662 (2002); Gu, C et al., Dev Cell 5:45-57 (2003)).
  • PlxnD1 is also a receptor for semaphorin 3E, and this interaction does not require neuropilins for Semaphorin 3E-mediated signalling (Gu, C et al., Science 307:265-268 (2005)).
  • plexin D1 is also involved in angiogenesis during tumor growth and is expressed on the luminal side of endothelial cells in tumor blood vessels.
  • Plexin D1 was furthermore found to be expressed by activated macrophages.
  • Plexin D1 was also found to be expressed on tumour cells in a wide variety of tumor types.
  • the present invention thus relates to plexin D1 for use as a targetable protein in the treatment or diagnosis of disorders that involve expression of plexin D1.
  • Diagnosis is effected by detecting the presence of plexin D1 or a plexin D1 encoding nucleic acid in the body or a bodily tissue or fluid.
  • Treatment is effected by targeting plexin D1 for delivery of therapeutics to the site where treatment is needed, by interfering in the interaction between plexin D1 and its ligands, by interfering in the expression of the plexin D1 gene or by capturing plexin D1 ligands to inhibit interaction with plexin D1.
  • the invention thus furthermore relates to the use of molecules that bind plexin D1, a nucleic acid encoding plexine D1 or a ligand of plexin D1 for the preparation of a therapeutical composition for the treatment or diagnosis of disorders that involve expression of plexin D1. All these molecules will be identified herein as “binding molecules” or “binding entities”.
  • the disorders comprise in particular disorders in which plexin D1 is expressed on tumor cells, tumor blood vessels or activated macrophages.
  • the tumor cells on which plexin D1 is expressed comprise brain tumors, in particular astrocytomas, oligodendrogliomas and hemangioblastomas, colon carcinomas, in particular ductal carcinomas of the colon, prostate carcinomas, renal cell carcinomas, in particular renal clear cell carcinomas, mamma carcinomas, in particular ductal carcinomas of the breast, ovary carcinomas, squamous cell carcinomas, melanomas, lung carcinomas, in particular small-cell lung carcinomas and non-small cell lung carcinomas, soft tissue sarcomas etc.
  • brain tumors in particular astrocytomas, oligodendrogliomas and hemangioblastomas
  • colon carcinomas in particular ductal carcinomas of the colon, prostate carcinomas
  • renal cell carcinomas in particular renal clear cell carcinomas
  • mamma carcinomas in particular ductal carcinomas of the breast, ovary carcinomas
  • squamous cell carcinomas melanomas
  • lung carcinomas in particular small-cell lung carcinomas and
  • disorders that are treated according to the invention are inflammatory diseases, they are in particular autoimmune disease, more in particular rheumatoid arthritis, or they are atherosclerosis or multiple sclerosis.
  • Molecules that bind plexin D1 are for example selected from antibodies, antibody fragments, proteins, protein domains, peptides, small molecules. These molecules can be used to target plexin.
  • Molecules that bind the nucleic acid encoding plexin D1 are for example oligonucleotides, such as RNA or DNA aptamers, for example selected from siRNA, antisense RNA, antisense phosphothio-oligonucleotides. These molecules can be used to interfere with the expression of plexin D1.
  • Molecules that bind a plexin D1 ligand are for example selected from antibodies against ligands, the soluble ectodomain of plexin D1 or small molecules, such as peptides, that bind plexin D1 ligands. These molecules can be used to capture circulating plexin D1 ligand, prevent binding of the ligand to plexin D1 on tumor vessel cells, tumor cells or activated macrophages and interfere with the function of plexin D1 on these cells.
  • the binding molecule is suitably labelled with a detectable marker.
  • a detectable marker is for example selected from a radioactive label, paramagnetic label, a fluorescent label, a chemiluminescent label.
  • Diagnosis can be performed in a sample of a bodily fluid or tissue in vivo, in situ or ex vivo. Examples of diagnostic techniques are in situ hybridization of for example plexin D1 mRNA or immunohistochemistry on biopsies or tumor cells.
  • the binding molecule is for example provided with an entity that damages or kills the tumor cell and/or the tumor endothelial cell, in particular a cytotoxic entity, such as a radionuclide, a toxin, boron for Boron Neutron Capture Therapy (BNCT), or a prodrug that is coupled to the binding entity via a cleavable linker, which is activated in response to cleavage of that linker, or apoptosis-inducing peptides, an example of which is the (KLAKLAK) 2 sequence.
  • a cytotoxic entity such as a radionuclide, a toxin, boron for Boron Neutron Capture Therapy (BNCT), or a prodrug that is coupled to the binding entity via a cleavable linker, which is activated in response to cleavage of that linker, or apoptosis-inducing peptides, an example of which is the (KLAKLAK) 2 sequence.
  • BNCT Boron Neutron Capture Therapy
  • therapy may be effected by inducing local thrombosis in the tumor vessels to block the blood supply to the tumor and induce cell death.
  • Tissue Factor TF
  • plexin D1 can be targeted with specific binding molecules upon intravenous administration since plexin D1 is expressed on the luminal side of endothelial cells in tumor blood vessels.
  • Therapeutic compounds for damaging or killing tumor cells that are coupled to the binding molecule can reach the tumor from within and compounds that induce thrombosis are easily delivered to their site of action.
  • Interference with plexin D1 function represents a way to inhibit angiogenesis, to inhibit tumor cell migration, and to inhibit macrophage migration.
  • the invention provides methods of treating or suppressing disorders in which plexin D1 is involved, by using the specific presence of plexin D1 to deliver therapeutics locally to diseased tissues, and/or by interference in the function of plexin D1 or in the interaction between plexin D1 and its ligands.
  • the invention is thus based on the fact that plexin D1 can be used as a targetable marker on tumor blood vessels, as a targetable protein involved in tumor angiogenesis, as a targetable marker on tumor cells and as a targetable protein involved in cellular migration.
  • the invention thus also relates to the use of molecules which bind to plexin D1, its gene or mRNA or its ligands in diagnosis and therapy.
  • All kinds of specific binding molecules, and derivatives thereof can be used in the invention, in particular proteinaceous compounds, such as, but not limited to, antibodies, antibody fragments, single domain antibody fragments, other proteinaceous binding domains, such as, but not limited to, lipocalins, and small molecules that specifically bind plexin D1 or its ligands.
  • proteinaceous compounds such as, but not limited to, antibodies, antibody fragments, single domain antibody fragments, other proteinaceous binding domains, such as, but not limited to, lipocalins, and small molecules that specifically bind plexin D1 or its ligands.
  • nucleic acid molecules such as DNA or RNA aptamers can be used.
  • plexin D1 or plexin D1 ligand binding molecules are antibodies, in particular monoclonal antibodies, more in particular human or humanized antibodies in which the constant regions of the original antibody are substituted with the constant regions of human antibodies, or fragments thereof which still bind to plexin D1 or its ligand.
  • the antibody is preferably a human IgG1 antibody.
  • human antibody isotypes are also encompassed by the invention, including IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgAsec, IgD, and IgE.
  • all animal-derived antibodies of various isotypes can be used in the invention.
  • the antibodies can be full-size antibodies or antigen-binding fragments of antibodies, including Fab, F(ab′) 2 , single chain Fv fragments, or single domain VHH, VH or VL single domains.
  • antibodies against plexin D1 are human monoclonal antibodies produced by a hybridoma cell which includes a B cell obtained from an immunized transgenic animal having a genome comprising a human heavy chain transgene and a human light chain transgene, fused to an immortalized cell, or an animal-derived antibody or antibody fragment produced by a hybridoma cell which includes a B cell obtained from an immunized animal, fused to an immortalized cell, or human and animal antibodies, produced by a eukaryotic cell transfected with the cDNA or genomic DNA encoding said antibody or antibody fragment.
  • single domain (VHH) Llama antibodies with affinity to plexin D1 are provided, more specifically Llama single domain antibodies A12 (SEQ ID NO:1) and F8 (SEQ ID NO:2), either or not displayed on M13 bacteriophages, also known to those with skill in the art as phage-display VHH antibodies.
  • a preferred single chain antibody is derived from antibody 11F5H6 and 17E9C12.
  • the sequence of the single chain antibody is shown in SEQ ID NO:3 and SEQ ID NO:4.
  • the antibodies for use according to the invention may be high affinity antibodies which are evoked in non-transgenic laboratory animals, or in a transgenic animal in which the endogenous globulin locus has been substituted for the human globulin locus, thus allowing production of human antibodies in such animals (Jakobovits, A. Curr Opin Biotechnol 6:561-566 (1995)).
  • the invention further relates to a method of producing the antibodies of the invention, comprising immunizing an animal with plexin D1, or a cell expressing plexin D1, or a nucleic acid encoding plexin D1, or parts of the extracellular domain of plexin D1, such that antibodies against plexin D1 are produced by the B cells of the animal, isolating the B cells from the animal and fusing the B cells to a myeloma cell line to obtain immortalized cells that secrete the antibody.
  • the animal is preferably a transgenic animal having a genome comprising a human heavy chain transgene and a human light chain transgene so that the resulting antibody is humanized.
  • the method includes immunizing a laboratory animal with a synthetic peptide, chosen from the plexin D1 extracellular domain, for example peptide 47-63 corresponding to the amino terminus of the mature plexin D1 amino acid sequence. Immunizations are however preferably done with recombinant extracellular domains, preferably a region with low similarity to other family members of the plexins, for example a region comprising amino acids 47-546, lacking the Met-Related-Sequences. Said recombinant plexin D1 extracellular domains can be produced in E.
  • coli cells by inserting the coding nucleic acids in a suitable prokaryotic expression vector, for instance under control of the ⁇ -galactosidase promoter, transformation of E. coli cells with said vector, and isolation of the recombinant proteins from purified inclusion bodies. It is preferred however that antibodies are evoked by immunization with said recombinant plexin D1 extracellular domain which is produced by eukaryotic cells, therefore containing posttranslational modifications which are most similar to those present in native plexin D1, for example by chinese hamster ovary (CHO) cells after transfection with a vector, containing the coding nucleic acids for said extracellular domains under the control of a cytomegalovirus promoter.
  • Recombinant extracellular plexin D1 fragments may or may not be fused to tags facilitating purification, e.g. a VSV tag or a constant region of a heavy chain of an immunoglobulin.
  • the method of producing the antibody may also comprise cloning the antibody coding regions from said plexin D1 specific B-cells into an expression vector and expressing the coding sequence.
  • the expression vector is pHENIXHISVSV, enabling expression by E. coli host cells of the antibody, flanked at the carboxyterminal end by a Vesicular Stomatis Virus (VSV-tag) and a His*8 tag.
  • VSV tag is meant to facilitate immunohistochemical detection, using specific antibodies.
  • the His*8 tag is meant to facilitate purification based on Nickel affinity chromatography.
  • Other expression vectors can likewise be used.
  • the invention provides an isolated single domain antibody A12, having a dissociation constant of less than 2 ⁇ 10 ⁇ 8 M, which binds to the amino terminus of plexin D1 and which detects plexin D1 in immunohistochemical stainings and homes to plexin D1-expressing tumor blood vessels, and also to an isolated single domain antibody F8, having a dissociation constant of less than 3 ⁇ 10 ⁇ 8 M, which binds to the amino terminus of plexin D1 and which detects plexin D1 in immunohistochemical stainings and homes to plexin D1-expressing tumor blood vessels.
  • Both isolated single domain antibody may be fused to the constant region of a human IgG1 heavy chain or the constant region of a mouse IgG1 heavy chain.
  • human antibodies are used within the scope of the invention.
  • humanised or laboratory animal-derived antibodies may be used.
  • the invention further provides bispecific antibodies that have a binding specificity for plexin D1, and a binding specificity for a human antigen presenting cell, or for an Fc receptor, wherein the Fc receptor is a Fc(gamma)R1 or a human Fc(alpha) receptor.
  • the invention provides also nucleic acid molecules encoding the preferred antibodies, or antigen-binding portions.
  • Recombinant expression vectors which include nucleic acids which encode the antibodies of the invention, as well as host cells transfected with such vectors, are also encompassed in the invention.
  • binding molecules for use in the invention are small molecules that specifically bind to Plexin D1.
  • small molecule refers often to molecules with molecular weights of 500 or below. The term is commonly used these days and thus clear to the skilled person.
  • small molecule libraries are already available or are being developed. An example of such library is the NIH Molecular Libraries Small Molecule Repository (MLSMR). Such libraries are subjected to High Throughput Screening (HTS) to identify molecules that bind to plexin D1.
  • HTS High Throughput Screening
  • the invention also relates to the small molecules that result from a screen of such libraries.
  • peptides or aptamers (Ulrich, Med. Chem. 1(2):199-208 (2005)) that bind to extracellular domains of plexin D1 and thereby interfere with binding of plexin D1 ligands to plexin D1.
  • peptides or aptamers may also bind to the plexin D1 binding sites of the plexin D1 ligands and thereby interfere with ligand binding to plexin D1.
  • siRNA small interfering RNA
  • antisense RNA or antisense phosphothio-nucleotides.
  • Small interfering RNA comprises small strands of RNA that interfere with the translation of messenger RNA. SiRNA binds to the complementary portion of the target messenger RNA and tag it for degradation thus inhibiting gene expression. This is commonly known as gene “silencing”. SiRNA is usually 21 to 23 nucleotides long.
  • Antisense RNA is an RNA molecule transcribed from the coding, rather than the template, strand of DNA, so that it is complementary to the sense mRNA.
  • Formation of a duplex between the sense and antisense RNA molecules blocks translation and may also subject both molecules to double strand-specific nucleases thus inhibiting expression of the gene. Inhibition of expression of the gene can be used to block angiogenesis and migration of tumor cells and macrophages.
  • the above described binding molecules bind to plexin D1, its gene or its ligand in eukaryotic cells. Said molecules specifically accumulate in tumors upon intravenous injection or specifically accumulate in tumor blood vessels upon intravenous injection.
  • the antibodies, fragments thereof, small molecules and other proteinaceous compounds that all bind plexin D1 can be used in various ways.
  • the invention relates to compounds that bind to the extracellular part of plexin D1 and which binding results in interference of plexin D1 function.
  • the invention relates to compounds that bind to the intracellular domain of plexin D1 and which prevent signalling by plexin D1.
  • binding molecules bind to plexin D1 to interfere with the formation of multicomponent membrane complexes by inhibiting binding of plexin D1 ligands, in particular neuropilin-1, neuropilin-2, semaphorin 3C, semaphorin 3E, VEGF-receptor 1, VEGF-receptor-2 or VEGF-A, to plexin D1.
  • plexin D1 ligands in particular neuropilin-1, neuropilin-2, semaphorin 3C, semaphorin 3E, VEGF-receptor 1, VEGF-receptor-2 or VEGF-A
  • Such binding molecules lead to inhibition of ligand-induced GTPase signalling by plexin D1 or to inhibition of migration of cells expressing plexin D1, in particular tumor-associated endothelial cells, tumor cells or macrophages.
  • the invention relates to a method of inducing lysis of a cell expressing plexin D1, comprising contacting a cell expressing plexin D1 with the binding molecules, in particular the antibodies, of the invention in the presence of human effector cells, such that lysis of the cell expressing plexin D1 occurs.
  • the binding molecule is combined with or coupled to an effector compound that can detect the presence of plexin D1 for diagnostic purposes or that can perform an effect on the cell expressing plexin D1.
  • the diagnostic or therapeutic effector compound can be directly coupled to the binding molecule or can be present in a transport vehicle, such as a nanodevice, in particular a liposome or polymersome, that is coupled to the binding molecule.
  • the binding molecule can be a bispecific antibody that binds both plexin D1 and the effector compound thus targeting the effector compound to a site or cell where plexin D1 is expressed.
  • the invention thus provides in a particular embodiment thereof the use of such binding molecules in a method of diagnosing a disease mediated by expression of plexin D1, which method comprises intravenous delivery of the proteinaceous, aptameric or small molecule plexin D1 binding molecules, conjugated to an effector compound allowing in vivo detection of the binding molecules.
  • Diagnostic effector compounds are for example radioisotopes or contrast agents for Magnetic Resonance Imaging (MRI), such as gadolinium-DTPA, or fluorescent dyes.
  • MRI Magnetic Resonance Imaging
  • radioactive substance examples include, but are not limited to technetium 99m ( 99m Tc), iodine-123 ( 123 I), iodine-131 ( 131 I), rhenium-186 or -188 ( 186/188 Re), gallium-67 ( 67 Ga) the beta-radiation emitting substances yttrium-90 ( 90 Y) or lutetium-177 ( 177 Lu), the positron emitting isotopes Fluorine-18 ( 18 F) and Carbon-11 ( 11 C).
  • Such radioisotopes can be used to either detect or damage or kill cells expressing plexin D1.
  • isotopes are used for diagnosis and therapy. The skilled person is well aware of which isotope to use for which tissue and for which type of use.
  • the proteinaceous, aptameric and small molecular binding molecules for use in the invention can be combined with or coupled to a toxic agent, such as chemotherapeutic agent either directly or in a transport vehicle, in particular a nanodevice, such as a liposome or polymersome.
  • a toxic agent such as chemotherapeutic agent either directly or in a transport vehicle, in particular a nanodevice, such as a liposome or polymersome.
  • a plexin D1 binding entity of the invention is coupled to one or more chemotherapeutic agents selected from the group consisting of nitrogen mustards (e.g., cyclophosphamide and ifosfamide), aziridines (e.g., thiotepa), alkyl sulfonates (e.g., busulfan), nitrosoureas (e.g., carmustine and streptozocin), platinum complexes (e.g., carboplatin and cisplatin), non-classical alkylating agents (e.g., dacarbazine and temozolamide), folate analogs (e.g., methotrexate), purine analogs (e.g., fludarabine and mercaptopurine), adenosine analogs (e.g., cladribine and pentostatin), pyrimidine analogs (e.g., fluorouracil (alone or in combination with
  • Chemotherapeutic agents are preferably selected from the group consisting of doxorubicin, cisplatin, bleomycin sulfate, carmustine, chlorambucil and cyclophosphamide hydroxyurea. Other compounds are known to the person skilled in the art.
  • a tumor can also be treated by blocking its blood supply by inducing local thrombosis in the tumor vasculature.
  • the binding molecules of the invention can in this embodiment be used to target thrombosis inducing molecules, such as the blood coagulation co-factor TF (Tissue Factor), a radioactive entity or a toxin, such as ricin to the site of the tumor.
  • Effector compounds can be coupled to the binding molecule, in particular a plexin D1 binding molecule, or can be present in a nanodevice, such as a liposome or polymersome, that is coupled to the plexin D1 binding molecule.
  • An alternative method of treating cancer or an inflammatory disorder according to the invention is with boron.
  • the binding molecules of the invention can be conjugated to transport vehicles, in particular nanodevices, such as liposomes or polymersomes, that are filled with boron to obtain a therapeutic composition. After delivery and accumulation of this composition in the diseased area, this area is irradiated with neutrons, resulting in emission of radioactive and cytotoxic alpha-particles that damage or kill the tumor endothelial cells, tumor cells and/or activated macrophages.
  • tumor blood vessel targeting antibodies have high affinities towards plexin D1, for example higher than 10 ⁇ 9 , preferably higher than 10 ⁇ 9 , more preferably higher than 10 ⁇ 10 M.
  • High affinity and the high molecular weight of antibodies will however restrict penetration into tumor tissue. Therefore, the nucleic acids that encode said monoclonal antibodies, obtained via RT-PCR cloning, can be used to generate antibody derivatives, for example antibodies that lack the constant region and are monovalent, or antibody fragments that are adapted to optimal affinities for blood vessel targeting or tumor penetration by mutagenic procedures. These antibody derivatives will have lower affinities and lower molecular weight and will have improved tumor cell targeting properties.
  • Different binding molecules of the invention can be combined in a mixture.
  • the members of the mixture have a varying affinity.
  • An example of such a combination is a mixture of monoclonal antibodies and/or antibody fragments or a mixture of antibodies with small molecules.
  • the monoclonal antibodies having high affinity can be used for targeting vessels, whereas the smaller fragments having a lower affinity are better able to penetrate and reach the tumor cells.
  • a mixture of plexin D1 binding molecules can be used together with plexin D1 ligand binding molecules and/or with molecules that bind nucleic acids encoding plexin D1.
  • plexin D1 ligand binding molecules can be combined with, molecules that bind nucleic acids encoding plexin D1.
  • the plexin D1 binding molecules of the invention can be used in a method of treating a disease mediated by expression of plexin D1, comprising intravenous delivery of the binding molecules of the invention at a dose, effective in treating that disease.
  • the binding molecules can also be used in a method of diagnosing a disease mediated by expression of plexin D1, comprising intravenous delivery of conjugates of plexine D1 binding molecules with a paramagnetic, fluorescent or radioactive tracer followed by magnetic resonance imaging, optical imaging, SPECT or PET.
  • the binding molecules can further be used in a method of treating or suppressing a disease mediated by expression of plexin D1, comprising intravenous delivery of the proteinaceous and small molecular binding molecules of the invention or a composition of proteinacous and small molecular binding molecules.
  • the disease to be treated or diagnosed can be cancer, an inflammatory disease, in particular an autoimmune disease, such as rheumatoid arthritis, or atherosclerosis, or multiple sclerosis.
  • an inflammatory disease in particular an autoimmune disease, such as rheumatoid arthritis, or atherosclerosis, or multiple sclerosis.
  • Diagnosis can be performed in vivo and in vitro.
  • An in vivo method is described above and can be performed with magnetic resonance imaging (MRI) or with SPECT or PET cameras after accumulation of the radioactively labelled binding molecule in the diseased tissue.
  • MRI magnetic resonance imaging
  • SPECT SPECT
  • PET PET
  • Another diagnostic method comprises detecting the presence of plexin D1 in a sample in vitro or ex vivo.
  • Such method comprises contacting the sample with binding molecules of plexine D1, or nucleic acids that bind the plexin D1 gene or its mRNA or a copy DNA derived from this mRNA, all bound to a detectable marker, under conditions that a complex between the antibody and plexin D1 forms, and detecting the formation of the complex.
  • the complex can be detected by visualising the detectable marker.
  • Samples can be bodily fluids, such as blood, serum, plasma, saliva, urine, semen, faeces, or tissues, such as biopsies of tumor cells.
  • the invention further relates to an expression vector, comprising the coding sequence for Llama antibody F8 or A12, or for the single chain antibody derived from antibody 11F5H6 and suitable regulatory sequences.
  • the invention also relates to a cell transfected with the said expression vector.
  • the invention further relates to the recombinant protein obtainable by expressing the expression vector.
  • Another aspect of the invention relates to an expression vector, comprising the coding sequence for the extracellular domain of plexin D1, optionally fused to a constant region of a human heavy chain and suitable regulatory sequences.
  • the invention also relates to a cell transfected with the said expression vector.
  • the invention further relates to the recombinant protein obtainable by expressing the expression vector.
  • the recombinant protein comprises the extracellular domain of plexin D1, which binds to plexin D1 ligands and thus prevents binding of the ligands to cell associated plexin D1.
  • the coding sequence codes for a recombinant protein comprising amino acids 47-506 of the extracellular domain of plexin D1, which binds to plexin D1 ligands and thus prevents binding of the ligands to cell-associated plexin D1, or amino acids 507-1274 of the extracellular domain of plexin D1, which binds to plexin D1 ligands and thus prevents binding of the ligands to cell associated plexin D1.
  • Such recombinant protein may carry mutations that increase the affinity for plexin D1 ligands and thereby having increased potency as decoy receptor. Such mutations are usually induced by making changes in the coding sequence used for producing the recombinant protein.
  • the invention further relates to the use of the binding molecules of the invention in a method of treating or suppressing a disease mediated by plexin D1, comprising intravenous or intratumoral delivery of decoy plexin D1 extracellular domains as described above, or in a method of treating or suppressing a disease mediated by plexin D1, comprising intravenous delivery of adenoviruses or lentiviruses, containing the coding nucleotides for the recombinant extracellular domains of plexin D1 or parts thereof as described above.
  • plexin D1 receptors interfere with the interaction between plexin D1 and its ligands, in particular neuropilin-1, semaphorin 3C and semaphorin 3E, and thereby interfere with plexin D1 function.
  • the decoy plexin D1 receptors have increased affinity towards plexin D1 ligands, as compared to plexin D1.
  • increased affinity may be obtained by creating a library of plexin D1 extracellular domains, carrying at random introduced mutations, and selecting decoy receptors with most potent antagonistic behaviour in cell migration assays.
  • the recombinant nucleic acid which encodes fragments of the extracellular domain of plexin D1 that comprise the binding sites for semaphorin 3C, semaphorin 3E and NP-1 into expression vectors.
  • the antagonists according to the invention are preferably produced from a nucleic acid or an expression vector according to the invention, preferably in a host cell.
  • the molecules of the invention may also be used in a combination of treatment methods as described above and/or with conventional therapies or anti-angiogenic therapy for further preventing the formation of a tumor neovasculature, or radiotherapy and/or adjuvant chemotherapy.
  • the invention further relates to a method of identifying molecules that are capable of binding to plexin D1, which method comprises contacting a collection of molecules with plexin D1 and selecting the molecules from the collection that show binding to plexin D1 as plexin D1 binding molecules.
  • the collection of molecules can for example be present in small molecule libraries, on a protein array, etc.
  • the techniques for screening collections of molecules are in itself known.
  • the invention resides in the identification of the target that is to be bound, which is plexin D1.
  • binding molecule is used for all types of binding molecules, i.e. the ones that bind plexin D1, the ones that bind a nucleic acid encoding the plexin D1 gene and the ones that bind plexin D1 ligands. All these types of molecules can be coupled to effector compounds as described above.
  • FIG. 1 Structural domains of plexin family members: four subfamilies have been identified, named plexin A-D. Horizontally hatched boxes indicate Sema domains, diagonally hatched boxes indicate Met-related sequences (MRS) motifs, and the clear box indicates the atypical MRS motif of PLXND1.
  • Plexin B subfamily members have a potential furin-like proteolytic site, marked by a grey ribbon. The transmembrane region is marked by a shaded box and is followed by two conserved intracellular domains, together comprising the SP-domain, marked by two ovals.
  • FIG. 2 A) In situ hybridization analysis of cerebral Mel57-VEGF-A 165 lesions using a digoxigenin-labelled mouse-specific plxnd1 RNA probe. Tumor vessels are strongly positive (arrows) whereas brain capillaries, distant from the lesions, are negative (compare the ISH profile with the CD34 staining in FIG. 2B ).
  • FIG. 4 ISH analysis using a human specific digoxigenin-labelled RNA probe (A) and immunohistochemical staining with CD31 (B) of normal brain. Note that vessels are abundantly present but these do not express the plexin D1 transcript.
  • FIG. 5 Specificity of phages (A) and corresponding single domain antibodies (sdabs) (B) A12 and F8 for peptide H 2 N-ALEIQRRFPSPTPTNC-CONH 2 .
  • A 10 10 phages were allowed to bind to PLXND1-peptide, BSA, human IgG or irrelevant peptide as described in the text. After rigorous washing, bound phages were detected using an anti-M13 antibody.
  • B similar incubations were performed but now with soluble sdabs. After washing, bound sdabs were detected and semi-quantified via the VSV-G-tag.
  • FIG. 6 The dissociation constants (kd's) of the binding between single domain antibodies A12 and F8 were determined using the Biacore 2000 (Uppsala, Sweden) biosensor.
  • the sensor chip and protein coupling chemicals were purchased from Biacore AB.
  • PLXND1-peptide-KLH conjugate 27 ⁇ g/ml in Na-Acetate, pH 4.0
  • BSA 1 ⁇ g/ml in Na-Acetate, pH 5.0
  • FIG. 7 Evaluation of plexin D1 specificity of single domain antibodies.
  • Figure A shows immunohistochemical staining of the growth plate of trabecular bone of a mouse embryo (E16.5) with single domain antibody A12, utilizing the VSV-G tag for detection of the antibody.
  • the inset shows an in situ hybridization of a similar embryonic structure using a mouse specific digoxigenin-labelled plexin D1 probe. Note the overlap of plexin D1 in situ hybridization and immunostaining.
  • FIG. 7B is a representative example of a Mel57-VEGF-A165 lesion in brain of a nude mouse. The vasculature which is also positive in plexin D1 ISH (see also FIG. 2 ) is immunopositive with single domain antibody F8.
  • FIG. 8 Immunostainings with single domain antibody A12 on a selection of human brain tumors. Tumors shown are A) glioblastoma multiforme, metastases of B) melanoma C) mammacarcinoma and D) renal cell carcinoma.
  • the insets in A and B consist of control stainings with anti-VSV antibody only, and show that the tumor staining is specific. Note that vessels and tumor cells are highly reactive with the antibody.
  • FIG. 9 Immunostainings with single domain antibody A12 on a progression series of melanoma. Immunostainings were performed on a nevus, a dysplastic nevus and horizontal and vertical growth phases of melanoma. Note that only the neoplastic cells express plexin D1.
  • FIG. 10 Immunostainings with single domain antibody A12 on sections of Mel57-VEGF-A brain tumors in mice, treated with ZD6474.
  • ZD6474-treated mice tumorvessels stain positive with this antibody.
  • ZD6474-treated mice there is a dose-dependent decrease of plexin D1 expression.
  • ZD6474 was given orally, once daily, in the dosage as indicated.
  • FIG. 11 Double immunostainings with the macrophage marker CD68 (stained blue) and single domain antibody A12 (stained red) on mammacarcinoma. A subpopulation of macrophages express plexin D1 as revealed by purple staining protein.
  • FIG. 12 In vivo homing of phage A12, F8 or an irrelevant phage to Mel57-VEGF 165 brain lesions.
  • Tumor-bearing mice were injected with 10 12 phages in the tail vein and after 5 minutes mice were anesthesized and subjected to cardiac perfusion with 15 ml of phosphate buffered saline. Mice were sacrificed, brains removed and frozen sections were analyzed for phage content and distribution.
  • the arrows point at a CD34-positive vessel, distant from the lesion, which is not highlighted by anti-M13 staining.
  • the inset in (A) shows a control experiment where an irrelevant phage was injected.
  • Tumor tissue was dissected from 10 ⁇ m frozen sections using laser capture dissection microscopy. Number of colony-forming phages (cfp) were counted after infection of TG1 cells. Twenty-fold more F8 phages were eluted from tumors than from comparable areas of unaffected brain tissue.
  • FIG. 13 Single domain antibody homes to tumor vessels that are not per se newly formed.
  • Nude mice were inoculated with a cell suspension of 1.5 ⁇ 10 5 cells of the human glioma xenograft E98, which was obtained from a subcutaneous E98 tumor. After 3 weeks, phages carrying single domain antibody F8 were injected in the tail vein, and after 5 minutes mice were anesthesized and subjected to cardiac perfusion using 15 ml of phosphate buffered saline. Mice were then sacrificed, brains removed and fixed in formalin. Serial sections were stained with antibodies against M13 p8 protein (A), the endothelial marker CD34 (B) and glut-1 (C, a marker for pre-existent brain capillaries). Comparison of A, B and C reveals that not only newly formed tumor vessels accumulate phage F8, but also non-dilated brain vessels that express glut-1 and that therefore are considered pre-existent brain vessels that had been incorporated in the tumor.
  • A M13 p8 protein
  • CD34
  • FIG. 14 Effects of extracellular domains of plexin D1 on the development of tumor vasculature.
  • FIG. 14A shows MR images of two control mice carrying Mel57 brain tumors that express VEGF-A 165 only
  • FIG. 14B shows MR images of brains of two mice carrying the double transfectant.
  • Vascular leakage tends to be less in the double transfectants, suggesting that VEGF-A-induced vascular leakage is counteracted by the plexin D1 ectodomain. More importantly, blood vessels in the double transfected tumors are activated, as indicated by upregulation of CD34, yet they express glut-1, strongly suggesting that these vessels are pre-existent vessels that are incorporated in the tumor by the phenomenon of co-option. Note that the blood vessels in the tumors expressing VEGF-A165 only, are negative for glut-1 and therefore can be considered to be newly formed.
  • FIG. 15 Western blots were generated with recombinant plexin D1 ectodomains, expressed in E. coli and encompassing amino acids 47-506 (lanes 1) or 225-388 (lanes 2). Serum of mouse 25 was tested before (panel A) and after (panel B) immunization with plexin D1 region 47-506. As shown in FIG. 15B , the mouse immune serum specifically recognized E. coli recombinant protein 47-506 (52 kDa, lane 1) and the protein encompassing plexin D1 residues 225-388 (a 18 kDa protein which lies completely within the sequence that was used for immunization, lane 2). The pre-immune serum did not show such a reactivity (panel A).
  • FIG. 16 Immunohistochemistry with monoclonal IgM antibodies, obtained from B-lymphocytes from mouse 25.
  • Antibodies 11F5H6 and 17E9C12 were selected based on reactivity against protein 47-506 in ELISA, and were analysed for their potential to detect plexin D1 in frozen sections of human tumours. These antibodies showed strong positivity in brain metastases of sarcoma and melanoma, as illustrated in the figure.
  • the insets in panels C-F represent control stainings in which the primary antibody was omitted. Panels A and B show that these antibodies do not notably recognize vessel structures in normal brain tissue.
  • FIG. 17 Tumor homing of antibody 11F5H6
  • Antibody 11F5H6 (1 mg) was injected in a lateral tail vein and allowed to circulate for 15 minutes. After this period, the mice were anaesthetized with 1.3% isoflurane and the chest was opened, upon which a cardiac perfusion was performed with 20 ml phosphate buffered saline. After this procedure, mice were decapitated, and brains removed and snap-frozen or fixed in formalin.
  • FIG. 17A Frozen sections of 4 ⁇ m were stained with anti-IgM antibody.
  • FIG. 17A it is shown that antibody 11F5H6 homes to and accumulates in tumour vessels but not in normal vessels (compare anti-IgM staining in FIG. 17A with the anti-endothelial CD31 staining in FIG. 17B ). Such staining is not seen when performing anti-IgM staining on non-injected mice.
  • 11F5H6 is a promising antibody which allows tumour targeting.
  • FIG. 18 Expression of Plexin D1 in macrophages in a mouse model of rheumatoid arthritis. Stainings were performed with single domain antibody A12
  • FIG. 19 expression of Plexin D1 in atherosclerosis.
  • a subset of macrophages in human atherosclerotic plaques expresses plexin D1. Stainings were performed with single domain antibody A12. A double staining was performed, displaying plexin D1 in red and the macrophage marker CD68 in blue. A purple color indicates co-expression.
  • Table I Analysis of different pathologies for plexin D1 expression.
  • Plexin D1 on Tumor-Associated Blood Vessels
  • Plexin D1 is expressed on neurons but also endothelial cells in angiogenic vessels during embryogenesis.
  • the present invention demonstrates that plexin D1 is expressed on tumor-associated blood vessels but not on normal blood vessels. This has been shown by in situ hybridization of mouse brains, containing angiogenic human melanoma lesions ( FIG. 2 ).
  • the animal tumor model is described in (Kusters, B et al., Cancer Res 63:5408-5413 (2003)).
  • tumor cells are injected via a microsurgical procedure in the right carotid artery, resulting in tumor growth in the parenchyma of the right brain hemisphere. After three weeks, at the onset of neurological symptoms, mice are sacrificed and brains removed and fixed in formalin.
  • RNA probes were generated by transcription using T3 and T7 RNA polymerase, respectively, from a PCR product, encompassing 600 bases in the 3′-untranslated region, and which was flanked by T7 and T3 promoters (Van der Zwaag et al. (2002), supra).
  • PBS phosphate buffered saline
  • plexin D1 RNA High levels of plexin D1 RNA were observed in vessels of angiogenic Mel57 tumors ( FIG. 2 ) using a mouse-specific plexin D1 RNA probe. Tumor cells were also positive for the transcript. The non-perfect homology between mouse and human plexin D1 results in a weaker signal in the human tumor cells using the mouse probe.
  • plexin D1 RNA expression in human tumor samples we performed in situ hybridizations with a human-specific plexin D1 RNA probe.
  • High plexin D1 RNA expression levels were found in a number of human tumors, of which (glioblastoma multiforme, brain metastases of sarcoma, renal cell carcinoma, adenocarcinoma of the colon and of the breast), both in tumor vasculature and tumor cells.
  • a summary of plexin D1-expressing tumor types is given in Table 1.
  • FIG. 3 shows some examples of in situ hybridizations, e.g. a glioblastoma, a brain metastasis of melanoma and a brain metastasis of colon carcinoma.
  • Plexin D1 RNA was found not only on the tumor vasculature, but also excessively on the tumor cells themselves. Importantly as in FIG. 4A , no plexin D1 RNA expression is observed in normal brain vasculature. In FIG. 4B a CD31 staining is shown, demonstrating that abundant vessels are present in these sections.
  • plexin D1 protein antibodies were selected with affinity towards plexin D1.
  • a M13 pHENIX phage library was constructed expressing Llama single domain V-H antibodies, constructed by RT-PCR from Llama B-lymphocytes as described (van Koningsbruggen, S et al., J Immunol Methods 279:149-161 (2003)).
  • the resulting library had a complexity of 8 ⁇ 10 8 clones.
  • Eighty percent of plasmids contained full-length sdab insert as determined by PCR analysis and immunological dot-blot-detection of the VSV-G-tag in sdabs (see below).
  • the phage library was propagated as phagemids in E. coli TG1 bacteria. Phage particles were rescued by infection with trypsin sensitive helper phage M13K07 (50). Phages were purified and concentrated from the culture supernatant by precipitation with 20% Polyethyleneglycol/2.5 M NaCl via standard methodology.
  • the eluate was used to infect log-phase TG1 cells to amplify PLXND1-binding phages and calculate number of binders.
  • PLXND1-binding phages with PCR-confirmed full-length sdab inserts were tested for specificity towards plexin D1.
  • Wells of DNA-binding plates or immunoplates (Nunc) were coated overnight at 4° C. with PLXND1-peptide or an irrelevant peptide (1 ⁇ g/well in PBS/0.5 M NaCl pH 9.0), Bovine serum albumin (1 ⁇ g/well in 50 mM NaHCO 3 pH 9.6) or human Immunoglobulin G (1 ⁇ g/well in 50 mM NaHCO 3 pH 9.6).
  • FIG. 5A shows that M13 phage associated antibodies A12 and F8 bind specifically to plexin D1 peptide, but not to bovine serum albumin, immunoglobulins or an irrelevant peptide.
  • soluble single domain antibodies was induced in log-phase E. coli TG1 cells by culturing at 30° C. in 2 ⁇ TYA medium/1 mM IPTG.
  • Sdabs were collected by osmotic lysis using ice-cold TES buffer (200 mM TrisHCl, 0.5 mM EDTA, 500 mM sucrose) containing a protease inhibitor cocktail (Roche, Basel, Switzerland).
  • Sdab concentrations were estimated via dot-blot analysis using the mouse monoclonal anti-VSV-G P5D4, alkaline phosphatase-conjugated rabbit anti-mouse immunoglobulin (Dako, Denmark) and NBT/BCIP staining.
  • PLXND1-peptide-KLH conjugate 27 ⁇ g/ml in Na-Acetate, pH 4.0
  • BSA 1 ⁇ g/ml in Na-Acetate, pH 5.0
  • Unreacted groups were inactivated by 1 M ethanolamine, pH 8.5.
  • Ni-affinity-purified sdabs Six concentrations of Ni-affinity-purified sdabs (in the range of 1 mM to 50 ⁇ M) were used to determine the dissociation constants (Kds) of the interaction with the PLXND1-peptide. After each experiment, regeneration of the sensor surface was performed with 10 mM NaOH. Specific binding, defined by binding to a PLXND1-surface minus binding to a control BSA-surface, was analyzed using the BIAevaluation 4.1 software and a 1:1 Langmuir binding model.
  • Affinities of single domain antibodies A12 and F8 were 2.1 ⁇ 10 ⁇ 8 M and 3.5 ⁇ 10 ⁇ 8 M, respectively ( FIG. 6 ).
  • the single domain antibodies are tagged at the carboxyterminal end with a VSV-His-tag, enabling immunohistochemical stainings using an anti-VSV antibody.
  • the following protocol was followed for immunohistochemical stainings with single domain antibodies A12 and F8. Following deparaffinization, endogenous peroxidase activity was blocked by incubation with 0.03% H 2 O 2 . Antigen retrieval was performed by treatment with pronase according to standard protocols. Subsequently, slides were pre-incubated with normal horse or goat serum (to block non-specific binding sites in sections of human and mouse tissues, respectively), followed by incubation with sdabs for 1 hr.
  • Sdabs were detected by sequential 1 hr incubations with a mouse or rabbit anti-VSV-G antiserum (Sigma-Aldrich Chemie B. V., Zwijndrecht, The Netherlands), biotinylated anti-mouse or anti-rabbit antibody as appropriate (Vector, Burlingame, Calif.), and avidin-biotin peroxidase complex (Vector, Burlingame, Calif.). Finally, peroxidase was visualized by the 3-amino-9-ethylcarbazole (ScyTek, Utah, USA) peroxidase reaction with haematoxylin as counterstain. All steps were performed at RT.
  • the specificity of the antibody A12 and F8 for plexin D1 in immunohistochemical stainings was first examined by staining mouse embryos in which expression patterns of plexin D1 on the RNA level were well characterized (Van der Zwaag et al. (2002), supra), and comparing profiles with immunostainings with anti-endothelial antibody anti-CD31 (DAKO, Glostrup, Denmark). In growth plate of trabecular bone of mice embryos at E16.5, immunostaining was observed on CD31-positive blood vessels. The staining profile correlated well to in situ hybridization for the plexin D1 transcript ( FIG. 7A ). The blood vessel origin of PLXND1 expression was further confirmed by performing stainings on serial sections with sdabs and anti-human anti-CD31 antibody (anti-human CD31).
  • plexin D1 occurs on premalignant cells.
  • melanoma consisting of benign nevi, dysplastic nevi, radial growth phase melanoma, invasive melanoma and disseminated melanoma.
  • Melanocytes in benign nevi and dysplastic nevi do not express the protein, whereas malignantly transformed cells, both in radially growth phase and vertical growth phase tumors are positive for the protein ( FIG. 9 and Table II).
  • Plexin D1 expression is related to the activation state of the endothelial cells in tumor blood vessels.
  • Treatment with ZD6474 resulted in a decrease of plexin D1 expression on tumor-associated blood vessels in a dose dependent manner ( FIG. 10 ).
  • plexin D1 expression is a characteristic of activated endothelial cells.
  • plexin D1 expressed in normal brain, heart, skin, kidney, spleen, intestine, endometrium was examined by immunohistochemistry using antibody A12. Vessels in proliferative myometrium expressed plexin D1, showing that plexin D1 is associated not only with pathological angiogenesis, but also with physiological angiogenesis (not shown).
  • co-immunostainings were performed with the CD68 macrophage marker. These stainings revealed that a subpopulation of macrophages expressed the protein ( FIG. 11 ). Also fibroblasts in skin and some proliferating intestinal epithelial cells were found to express plexin D1 (not shown).
  • plexin D1 protein on tumor blood vessels suggests that plexin D1 is accessible via intravenous injection.
  • PBS phosphate buffered saline
  • tumors were dissected from 10 ⁇ m brain sections using laser capture dissection microscopy (Leica laser dissection microscope). Equivalent areas were dissected from unaffected brain, contralateral to the tumor.
  • phages were eluted from dissected tissue samples using trypsin treatment and used to infect TG1 cells. Numbers of colony-forming phages were counted and used as a measure of tumor homing.
  • mice were injected transcranially with E98, a glioma xenograft line.
  • E98 tumors are maintained as subcutaneous tumors.
  • a Balbc/c nu/nu athymic mouse carrying a subcutaneous E98 tumor was killed and the tumor removed.
  • the tumor was minced with a sterile scalpel and the homogenate was passed through a sterile 70 ⁇ m mesh nylon filter.
  • M13 phages displaying single domain antibody F8 were injected intravenously, and after five minutes the mouse was subjected to cardiac perfusion with 15 ml of phosphate buffered saline.
  • mice were killed, brains removed and fixed in formalin.
  • Four ⁇ m sections were subjected to immunohistochemistry with anti-M13 antibody, and serial sections were stained immunohistochemically with antibodies against CD34 (endothelial marker) and glut-1 (a marker for pre-existent brain endothelial cells (Kusters, B et al., Cancer Res 62:341-345 (2002)).
  • CD34 endothelial marker
  • glut-1 a marker for pre-existent brain endothelial cells
  • Phages carrying anti-plexin D1 single domain antibodies accumulated specifically in tumor associated blood vessels, but not in normal vessels ( FIG. 13 ). Importantly, phages also accumulated in tumor blood vessels that were positive for glut-1, and which therefore can be considered as pre-existent blood vessels, rather than newly formed blood vessels. This indicates that not only angiogenic blood vessels are subject to targeting with anti-plexin D1 antibodies, but also non-angiogenic, yet activated blood vessels in tumors.
  • Human melanoma Mel57 cells were transfected with the VEGF-A 165 coding sequence in vector pIREShyg. Stably transfected cells were selected by culturing in 200 ⁇ g/ml hygromycin in Dulbecco's Modified Eagle medium (DMEM) supplemented with 10% fetal calf serum (FCS) and penicillin/streptomycin. Because expression of the hygromycin resistance gene is linked to that of the VEGF-A cDNA via the internal ribosomal entry site (IRES), all hygromycin-resistant cells will produce the VEGF-A protein also.
  • DMEM Dulbecco's Modified Eagle medium
  • FCS fetal calf serum
  • Stably transfected Mel57-VEGF cells were subsequently transfected with pIRESneo-PlexinD1 ED.
  • the vector contains the cDNA encoding the extracellular domain from nucleotides 1-2745, linked via the IRES to expression of the neomycin resistance gene.
  • Double transfectants were injected in the right carotid artery of nude mice, and tumors were allowed to develop.
  • mice were subjected to Gadolinium-DTPA enhanced magnetic resonance imaging. Subsequently, mice were sacrificed, brains fixed in formalin and subjected to immunohistochemical stainings to examine the tumor vasculature.
  • FIG. 14A representing two examples of Mel57-VEGF-A 16 , tumors, with 14 B representing two examples of Mel57-VEGF-A 165 /PLEXIND1-ED tumors.
  • vasculature shows upregulation of the endothelial marker CD34, (a hallmark of endothelial activation by VEGF-A 165 )
  • the vasculature in tumors expressing VEGF-A 165 only, is negative for the brain endothelial cell marker glut-1, which is consistent with the fact that these vessels are newly made and therefore lack brain-endothelial cell specific markers.
  • glut-1 the brain endothelial cell marker
  • the vessels that are associated with tumors that express the plexin D1 ectodomain too do express glut-1. This is a strong indication that these vessels are actually pre-existent.
  • the plexin D1 ectodomain does not prevent activation of endothelial cells by VEGF-A 165 , but it does prevent the formation of neovasculature.
  • the protein was used to immunize BALE c/c mouse 25 according to standard procedures.
  • FIG. 15 shows the characteristics of the mouse serum.
  • the mouse immune serum specifically recognized E. coli recombinant protein 47-506 (52 kDa, lane 1), and a second recombinant plexin D1 sequence of 18 kDa, comprising amino acids 225-388 (thus lying completely within the sequence that was used for immunization, lane 2).
  • the pre-immune serum did not show such a reactivity (panel A).
  • the mouse immune serum panel D
  • the pre-immune serum panel C
  • the B-lymphocytes of this mouse were considered suitable to generate hybridomas of spleen B-lymphocytes with myeloma cell line SP2/0.
  • Monoclonal Antibody 11F5H6 is Able to Recognize Tumour Blood Vessels
  • mice were decapitated, and brains removed and snap-frozen or fixed in formalin. Frozen sections of 4 pin were stained with anti-IgM antibody.
  • FIG. 17A it is shown that antibody 11F5H6 homes to and accumulates in tumour vessels but not in normal vessels (compare anti-IgM staining in FIG. 17A with the anti-endothelial CD31 staining in FIG. 17B ). Such staining is not seen when performing anti-IgM staining on non-injected mice. Thus, 11F5H6 is a promising antibody which allows tumour targeting.
  • Plexin D1 is expressed in macrophages in mouse models of rheumatoid arthritis ( FIG. 18 ). A subset of macrophages in human atherosclerotic plaques also expresses plexin D1 ( FIG. 19 ). Stainings were performed with single domain antibody A12. In FIG. 19 , a double staining was performed, displaying plexin D1 in red and the macrophage marker CD68 in blue. A purple color indicates co-expression.
  • A12 (SEQ ID NO: 1): ATGAAATACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCGGC CCAGCCGCATGGCCCAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTTGG TGCAGCCTGGGGGGTCTCTGAGACTCTCCTGTGCAGCCTCTGGAAGCAGT ATCAGTATCAATAACTGGGGCTGGTACCGCCAGGCTCCAGGAAAACAGCG CGAGCGGGTCGCAGCTATATCTGGTGGTGGTAAAACAGTCTATGCGGACT CCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGGTG TATCTGCAAATGAACAGCCTGAAACCTGAGGATACGGCCGTCTATTACTG TAGAGCAGTCCGGAAAAGTACGGGTTGGCTTAGGGGGCTTGACGTCTGGG GCCAGGGGACCCAGGTCACCGTCTCCGCAGAACCCAAGACACCAAAACCA CAACCAGCGGCCGCACATCATCACCATCATCACCATCATTATA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Mycology (AREA)
  • Optics & Photonics (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Dermatology (AREA)
  • Rheumatology (AREA)
  • Vascular Medicine (AREA)
  • Pain & Pain Management (AREA)
  • Urology & Nephrology (AREA)
  • Pulmonology (AREA)
US11/996,166 2005-07-21 2006-07-20 Plexin d1 as a target for tumor diagnosis and therapy Abandoned US20100119445A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP05076675.7 2005-07-21
EP05076675 2005-07-21
PCT/EP2006/007241 WO2007009816A2 (en) 2005-07-21 2006-07-20 Plexin d1 as a target for tumor diagnosis and therapy

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/007241 A-371-Of-International WO2007009816A2 (en) 2005-07-21 2006-07-20 Plexin d1 as a target for tumor diagnosis and therapy

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/541,296 Continuation US9422358B2 (en) 2005-07-21 2012-07-03 Plexin D1 as a target for tumor diagnosis and therapy

Publications (1)

Publication Number Publication Date
US20100119445A1 true US20100119445A1 (en) 2010-05-13

Family

ID=37115996

Family Applications (4)

Application Number Title Priority Date Filing Date
US11/996,166 Abandoned US20100119445A1 (en) 2005-07-21 2006-07-20 Plexin d1 as a target for tumor diagnosis and therapy
US13/541,296 Expired - Fee Related US9422358B2 (en) 2005-07-21 2012-07-03 Plexin D1 as a target for tumor diagnosis and therapy
US15/210,676 Active 2026-12-11 US9988449B2 (en) 2005-07-21 2016-07-14 Plexin D1 as a target for tumor diagnosis and therapy
US15/970,116 Abandoned US20180319882A1 (en) 2005-07-21 2018-05-03 Plexin d1 as a target for tumor diagnosis and therapy

Family Applications After (3)

Application Number Title Priority Date Filing Date
US13/541,296 Expired - Fee Related US9422358B2 (en) 2005-07-21 2012-07-03 Plexin D1 as a target for tumor diagnosis and therapy
US15/210,676 Active 2026-12-11 US9988449B2 (en) 2005-07-21 2016-07-14 Plexin D1 as a target for tumor diagnosis and therapy
US15/970,116 Abandoned US20180319882A1 (en) 2005-07-21 2018-05-03 Plexin d1 as a target for tumor diagnosis and therapy

Country Status (12)

Country Link
US (4) US20100119445A1 (https=)
EP (1) EP1907420B1 (https=)
JP (1) JP2009506985A (https=)
CN (1) CN101287758A (https=)
AU (1) AU2006271880A1 (https=)
BR (1) BRPI0613425A2 (https=)
CA (1) CA2615744C (https=)
DK (1) DK1907420T3 (https=)
ES (1) ES2632360T3 (https=)
IL (1) IL188688A0 (https=)
PL (1) PL1907420T3 (https=)
WO (1) WO2007009816A2 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2487242A1 (en) 2011-02-09 2012-08-15 Ruprecht-Karls-Universität Heidelberg B-type plexin antagonists and uses thereof
EP3693380A1 (en) 2019-02-11 2020-08-12 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Dual inhibition of plexin-b1 and plexin-b2
CN117659171A (zh) * 2022-09-07 2024-03-08 东莞市朋志生物科技有限公司 抗HBeAg抗体或其功能性片段、检测HBeAg的试剂和试剂盒

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090181035A1 (en) * 2008-01-10 2009-07-16 Genentech, Inc. Plexind1 agonists and their use
US8512944B2 (en) * 2008-08-27 2013-08-20 Oncotherapy Science, Inc. PRMT1 for target genes of cancer therapy and diagnosis
CN101914542B (zh) * 2009-04-28 2013-03-06 中国科学院化学研究所 用于不同亚型非小细胞肺癌分型的一种核酸适体及其筛选方法
EP2385121A1 (en) * 2010-05-06 2011-11-09 Netris Pharma Antagonists of Sema3E/PlexinD1 interaction as anti-cancer agents
CA2912801A1 (en) * 2013-05-17 2014-11-20 Medimmune, Llc Receptors for b7-h4
US11066462B2 (en) 2014-12-11 2021-07-20 Citryll B.V. Method for the treatment of idiopathic pulmonary fibrosis
CN106967789A (zh) * 2017-01-26 2017-07-21 上海长海医院 一种前列腺癌标志物plxna1及其应用
WO2018190365A1 (ja) * 2017-04-12 2018-10-18 国立大学法人九州大学 神経障害性疼痛マーカー及びその使用
CN116459356B (zh) * 2023-04-24 2024-03-19 中国人民解放军总医院第一医学中心 用于动脉粥样硬化斑块早期预警和动态监测的多模态分子成像纳米探针及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060127902A1 (en) * 2002-08-15 2006-06-15 Genzyme Corporation Brain endothelial cell expression patterns

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6020145A (en) * 1989-06-30 2000-02-01 Bristol-Myers Squibb Company Methods for determining the presence of carcinoma using the antigen binding region of monoclonal antibody BR96
WO2001014420A2 (en) * 1999-08-25 2001-03-01 University Of Torino Novel members of the plexin family and uses thereof
US7442776B2 (en) * 1999-10-08 2008-10-28 Young David S F Cancerous disease modifying antibodies
WO2001090190A2 (en) * 2000-05-26 2001-11-29 National Research Council Of Canada Single-domain antigen-binding antibody fragments derived from llama antibodies
SE0203137D0 (sv) * 2002-10-24 2002-10-24 Karolinska Innovations Ab Drug target in cancer therapy
AU2003292231A1 (en) * 2002-12-12 2004-06-30 Novartis Ag Methods for diagnosing and treating schizophrenia
CA2519630A1 (en) * 2003-03-20 2004-10-07 Dana-Farber Cancer Institute, Inc. Gene expression in breast cancer
EP1679372B1 (en) * 2003-10-30 2009-02-18 Kazusa DNA Research Institute Foundation Novel plexin polypeptide, dna encoding the same and use thereof
DE102004037860A1 (de) * 2004-08-04 2006-03-16 Friedrich-Alexander-Universität Erlangen-Nürnberg Turmormarker zur Diagnose von Karzinomen und/oder davon abstammender Metastasen

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060127902A1 (en) * 2002-08-15 2006-06-15 Genzyme Corporation Brain endothelial cell expression patterns

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2487242A1 (en) 2011-02-09 2012-08-15 Ruprecht-Karls-Universität Heidelberg B-type plexin antagonists and uses thereof
WO2012107531A1 (en) 2011-02-09 2012-08-16 Ruprecht-Karls-Univeristät Heidelberg B-type plexin antagonists and uses thereof
US9198966B2 (en) 2011-02-09 2015-12-01 Ruprecht-Karls-Universität Heidelberg B-type plexin antagonists and uses thereof
EP3693380A1 (en) 2019-02-11 2020-08-12 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Dual inhibition of plexin-b1 and plexin-b2
WO2020165094A1 (en) 2019-02-11 2020-08-20 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Dual inhibition of plexin-b1 and plexin-b2
CN117659171A (zh) * 2022-09-07 2024-03-08 东莞市朋志生物科技有限公司 抗HBeAg抗体或其功能性片段、检测HBeAg的试剂和试剂盒

Also Published As

Publication number Publication date
DK1907420T3 (en) 2017-07-17
EP1907420B1 (en) 2017-04-05
CA2615744C (en) 2018-03-27
US9988449B2 (en) 2018-06-05
CA2615744A1 (en) 2007-01-25
JP2009506985A (ja) 2009-02-19
PL1907420T3 (pl) 2017-09-29
WO2007009816A2 (en) 2007-01-25
US9422358B2 (en) 2016-08-23
BRPI0613425A2 (pt) 2012-10-30
US20120321554A1 (en) 2012-12-20
US20160311900A1 (en) 2016-10-27
AU2006271880A1 (en) 2007-01-25
WO2007009816A3 (en) 2007-03-29
CN101287758A (zh) 2008-10-15
IL188688A0 (en) 2008-08-07
US20180319882A1 (en) 2018-11-08
ES2632360T3 (es) 2017-09-12
EP1907420A2 (en) 2008-04-09

Similar Documents

Publication Publication Date Title
US9988449B2 (en) Plexin D1 as a target for tumor diagnosis and therapy
JP6860601B2 (ja) 改変した抗体組成物、それを作製および使用する方法
Villa et al. A high‐affinity human monoclonal antibody specific to the alternatively spliced EDA domain of fibronectin efficiently targets tumor neo‐vasculature in vivo
JP2022017219A (ja) 増殖分化因子１５（ｇｄｆ－１５）に対するモノクローナル抗体
CN103073641B (zh) 在体内具有抗肿瘤活性的抗人Dlk-1抗体
JP5957637B2 (ja) 抗ＴｉｓｓｕｅＦａｃｔｏｒモノクローナル抗体
CN101432307B (zh) 显示cd44表面表达的细胞的细胞毒性介导
Roodink et al. Plexin D1 expression is induced on tumor vasculature and tumor cells: a novel target for diagnosis and therapy?
JP2013522167A (ja) ｕＰＡＲ結合剤及びその使用方法
Brack et al. Molecular targeting of angiogenesis for imaging and therapy
KR102887692B1 (ko) 항-bcam 항체 또는 그의 항원 결합 단편
JP2014501490A (ja) 関節炎患者の滑膜の微小血管系に特異的に結合する抗体
US20220242947A1 (en) Provasopressin antagonists and uses thereof
Putelli et al. A fibrin-specific monoclonal antibody from a designed phage display library inhibits clot formation and localizes to tumors in vivo
AU2011306816A1 (en) Anti-ephrin-B2 antibody and use thereof
US9534050B2 (en) Antibodies to tumor endothelial marker 7R
MX2008000919A (en) Plexin d1 as a target for tumor diagnosis and therapy
US20100290984A1 (en) Anti-mrp3 antibodies and methods of use
WO2010037856A2 (en) DYNACTIN-1/p150glued AS A TARGET FOR TUMOR DIAGNOSIS AND THERAPY AND A METHOD FOR IDENTIFYING TARGETABLE DISEASE-RELATED PROTEINS
HK1124346A (en) Plexin d1 as a target for tumor diagnosis and therapy
US10030072B2 (en) Method of generating antibodies
US20240199735A1 (en) Microfibrillar-Associated Protein 5 (MFAP5)-Targeting Monoclonal Antibodies and Methods for Use in Treating Cancer
CN117843793A (zh) 抗间皮素抗体、抗原结合片段及其用途

Legal Events

Date Code Title Description
AS Assignment

Owner name: STICHTING KATHOLIEKE UNIVERSITEIT,NETHERLANDS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:LEENDERS, WILHELMUS PETRUS JOHANNES;ROODINK, ILSE;RAATS, JOZEF MARIA HENDRIK;SIGNING DATES FROM 20081030 TO 20081031;REEL/FRAME:023505/0421

AS Assignment

Owner name: STICHTING KATHOLIEKE UNIVERSITEIT, NETHERLANDS

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE ADDRESS OF THE RECEIVING PARTY PREVIOUSLY RECORDED ON REEL 023505 FRAME 421. ASSIGNOR(S) HEREBY CONFIRMS THE NEW PATENT ASSIGNMENT FROM INVENTORS TO ASSIGNEE;ASSIGNORS:LEENDERS, WILHELMUS PETRUS JOHANNES;ROODINK, ILSE;RAATS, JOZEF MARIA HENDRIK;SIGNING DATES FROM 20081030 TO 20081031;REEL/FRAME:025528/0838

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION