WO2001014420A2 - Novel members of the plexin family and uses thereof - Google Patents

Novel members of the plexin family and uses thereof Download PDF

Info

Publication number
WO2001014420A2
WO2001014420A2 PCT/US2000/023365 US0023365W WO0114420A2 WO 2001014420 A2 WO2001014420 A2 WO 2001014420A2 US 0023365 W US0023365 W US 0023365W WO 0114420 A2 WO0114420 A2 WO 0114420A2
Authority
WO
WIPO (PCT)
Prior art keywords
plexin
seq
nucleic acid
cell
amino acid
Prior art date
Application number
PCT/US2000/023365
Other languages
French (fr)
Other versions
WO2001014420A3 (en
Inventor
Stefania Artigiani
Paolo M. Comoglio
Corey S. Goodman
Marc Tesier-Lavigne
Luca Tamagnone
Original Assignee
University Of Torino
Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Torino, Regents Of The University Of California filed Critical University Of Torino
Priority to AU70738/00A priority Critical patent/AU7073800A/en
Publication of WO2001014420A2 publication Critical patent/WO2001014420A2/en
Publication of WO2001014420A3 publication Critical patent/WO2001014420A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the invention relates to the identification and characte ⁇ zation of four novel proteins that are members of the plexin family. Summary of the Related Art
  • Plexin family members encode large transmembrane proteins, whose cysteme- ⁇ ch extracellular domains share regions of homology with the Scatter Factor receptors (encoded by the Met gene family).
  • the extracellular domains of plexins also contain -500 amino acid Semapho ⁇ n domains (see below).
  • the highly conserved cytoplasmic moieties of plexins (approx. 600 ammo acids), however, have no homology with the Met tyrosine kinase domain, nor with any other known protein. Met- ke receptors and their ligands, the Scatter Factors, mediate a complex biological program including dissociation of cell-cell contacts, motility and invasion (for a review see Tamagnone, L.
  • HGF hepatocyte growth factor
  • Du ⁇ ng embryogenesis Scatter Factor- 1 and Met promote the dissociation of cell layers in the somites and dnve the migration of myogemc cells to their approp ⁇ ate location (Bladt, F., Riethmacher, D., Isenmann, S., Aguzzi, A., and Birchmeier, C.
  • Met and Scatter Factor- 1 are also involved in controlling neu ⁇ te outgrowth and axonal guidance (Ebens, A., Brose, K., Leonardo, E.D., Hanson, M.G.J., Bladt, F., Birchmeier, C, Barres, B.A., and Tessier-Lavigne, M. (1996) "Hepatocyte growth factor/scatter factor is an axonal chemoattractant and a neurotrophic factor for spinal motor neurons.” Neuron 17, 1157-1172, Maina, F., Hilton, M.C , Ponzetto, C, Davies, A.M., and Klem, R.
  • Semaphorins are a large family of secreted and membrane-bound molecules that are characterized by an extracellular domain containing a -500 amino acid Semaphorin domain (Kolodkin et al. (1993) "The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules.” Cell 75, 1389-1399). As noted above, plexins contain a more divergent but nevertheless conserved Semaphorin domain.
  • Semaphorins were originally characterized in the nervous system, where they have been implicated in repulsive axon guidance (Kolodkin et al. (1993) supra; Luo, Y., Raible, D., and Raper, J.A. (1993) "Collapsin: a protein in brain that induces the collapse and paralysis of neuronal growth cones.” Cell 75, 217-227; Tessier-Lavigne, M. and Goodman, C.S. (1996) "The molecular biology of axon guidance.” Science 274, 1123-1133).
  • semaphorins have been furthermore implicated in cardiac and skeletal development (Behar, O., Golden, J.A., Mashimo, H., Schoen, F.J., and Fishman, M.C. (1996) "Semaphorin UI is needed for normal patterning and growth of nerves, bones and heart.” Nature 383, 525-528), in the immune response (Hall, K.T., Boumsell, L., Schultze, J.L., Boussiotis, V.A., Dorfman, D.M., Cardoso, A.A., Bensussan, A., Nadler, L.M., and Freeman, G.J. (1996) "Human CD100, a novel leukocyte semaphorin that promotes B-cell aggregation and differentiation.”
  • Plexin-A is a receptor for class 1 semaphorins (Sema-la and Sema-lb). Moreover, Plexin-A has been shown via genetic analysis to control motor and CNS axon guidance induced by semaphorins (Winberg, M.L., Noordermeer, J.N., Tamagnone, L., Comoglio, P.M., Spriggs, M.K., Tessier-Lavigne, M., and Goodman, C.S. (1998). Plexin A is a neuronal semaphorin receptor that controls axon guidance. Cell 95, 903-916). Thus a need exists for discovery of other members of the plexin family of proteins.
  • the present invention provides four novel plexin family members.
  • the invention provides an isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence that encodes an amino acid sequence selected from the group consisting of the amino acid sequence shown in (SEQ ID NO: 2), (SEQ ID NO: 4), (SEQ ID NO: 6) and (SEQ ID NO: 8).
  • the invention provides isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence selected from the group consisting of the nucleotide sequence shown in (SEQ ID NO: 1), (SEQ ID NO: 3), (SEQ ID NO: 5) and (SEQ ID NO: 7).
  • the invention provides a vector comprising the nucleic acid of the above-aspects.
  • the invention also provides an isolated polypeptide the amino acid sequence of which comprises residues 1-18, 19-518, 451-530, 601-680, 751-830, 800-1010, or 1196-1215 of SEQ ID NO: 2; 1-23, 24-507 or 1100-1119 of SEQ ID NO: 4; or 1-42, 43-600, 541-620, 691-770, 831-910, 900-1110 or 1270-1293 of SEQ ID NO: 6; or 8-49, 154-199 or 1-199 of SEQ ID NO: 8.
  • the invention provides an isolated polypeptide having at least 80% amino acid sequence identity to an amino acid sequence selected from the group consisting of the amino acid sequence shown in (SEQ ID NO: 2), (SEQ ID NO: 4), (SEQ ID NO: 6) and (SEQ LD NO: 8)
  • the invention also provides a chimeric molecule comprising a polypeptide of the above aspects fused to a heterologous amino acid sequence.
  • the heterologous amino acid sequence is a Fc region of an immunoglobulin.
  • the invention provides an antibody that specifically binds to the polypeptides of the above aspects.
  • the invention also provides a method of treating, suppressing or altering a disorder involving abe ⁇ ant immune regulation involving a signaling pathway between a plexin and a neuropilin in a mammal comprising the step of administering an effective amount of an agent to said mammal capable of interfering with the association between the plexin and neuropilin.
  • Contemplated agents include a chimeric molecule or an antibody of the above aspects.
  • A Phylogenetic tree of human plexins. Known family members cluster in two major groups: plexin A and plexin-B subfamilies.
  • B Structural features of plexins, Met-like receptors and semaphorins. In the extracellular moieties, yellow boxes indicate the "sema" domains and blue boxes mark the cysteine-rich MRS motifs, some of which are stippled to indicate their atypical sequence; atypical MRS are also found in the sema domain of semaphorins. Sequence identity among sema domains ranges from 15-50%, as previously described (see Winberg et al., 1998 supra). Potential furin-like proteolytic sites are marked by red ribbons.
  • plexin-B 1 "truncated" is the product of a splicing variant (see text).
  • plexin-Dl and plexin-Cl are more distant family members, since they include atypical features in their extracellular domains.
  • the intracellular domain of plexins (SP domain) is highly conserved through all family members, and it includes two separate regions of high homology (Maestrini, E.,
  • Tamagnone, T., Longati, P., Cremona, O., Gulisano, M., Bione, S., Tamanini, F., Neel, B.G., Toniolo, D., and Comoglio, P.M. (1996) "A family of transmembrane proteins with homology to the MET-hepatocyte growth factor receptor.” Proc. Natl. Acad. Sci. USA 93, 674-678) (green oval and box). Met-like receptors are disulfi de-bound heterodimers and include a cytoplasmic tyrosine kinase domain (red box). Mammalian semaphorins can be either secreted or cell surface proteins.
  • Molecular weights of representative proteins are Plexin-A 1 220 kDa, Plexin-B 1 250 kDa, Plexin-Cl 200 kDa, HGF-R/Met 145+45 kDa (heterodimer), Sem 4D 150 kDa (transmembrane), Sema7A approx 100 kDa (membrane GPI-hnked).
  • Figure 2. (a) Cell surface semaphonns specifically bind human plexins.
  • Micropraphs of the binding assays done testing I) the extracellular domain of semapho ⁇ n CD 100 fused to alkaline phosphatase (CD100-AP) on COS cells transfected with plexin-Bl cDNA; n) control AP on plexin-B l ; in) CD100-AP on plex ⁇ n-B2; iv) CD100-AP on the entire extracellular domain of plexin-B l ; v) CD100-AP on isolated "plexin-B l truncated" (including sema domain, 1° and 2° MRS); vi) CD100-AP on a "plex -B l- ⁇ sema" (including 2° and 3° MRS; vn) extracellular domain of semapho ⁇ n A39R fused to AP, on plexin-Cl (Vespr); vin) SemaKl-AP on plexin-Cl .
  • CD100-AP alkaline phosphat
  • Plexins associate with neuropihns via specific extracellular domains.
  • Specific MoAbs were used, directed against the VSV-tag included in plexms or the myc-tag included in neurop ⁇ lm-2 (Np2, 130 kDa).
  • Np2 co-immunoprecipitates with plexins, such as plex ⁇ n-A3 (220 kDa), the extracellular domain of plexmAl
  • Np2 can also associate a truncated form of the extracellular moiety of plex -Bl ("plex-B l trunc ", approx. 110 kDa), containing the sema domain Figure 4.
  • plex-B l trunc a truncated form of the extracellular moiety of plex -Bl
  • plex-B l trunc a truncated form of the extracellular moiety of plex -Bl
  • plex-B l trunc approx. 110 kDa
  • a control spinal neuron exposed to a gradient of Sema3A emanating from a pipette (A) is repelled away over a pe ⁇ od of 1 hr (B)
  • a GFP-expressmg spinal neuron from an embryo injected with mRNA for the truncated plexin-Al construct (C) is not affected by Sema3A (D).
  • a similar neuron (E) shows a normal attractive response to netrin-1 (F).
  • (H) Mean turning angle under all the conditions just mentioned.
  • Plexin-A3 overexpression mediates cell repelling cues
  • Epithelial kidney MDCK cells transfected to overexpress plexin-A3 were cocultured with mesenchymal KJ-29 or NIH-3T3 cells. After 16-30 hours, mixed cultures of control cells (upper panels) reached confluency and stopped growing: typically the epithelial cells formed islets (circled) surrounded by a fibroblasts lawn.
  • MDCKs overexpressing plexin- A3 (lower panels) overwhelmed the adjacent mesenchymal cells. The latter withdrew and selectively detached from the culture dish (dying cell clusters are indicated by arrowheads), and eventually epithelial cells only survived.
  • Plexin-A3 expressing cells do not induce apoptotic signal on repelled fibroblasts.
  • Mixed cultures of NLH 3T3 and control or plexin-A3 overexpressing MDCKs were tested for the presence of TUNEL-AP positive cells.
  • Plex ⁇ n-A4 is located on human chromosome 7 and is a family member of the plexin-A subfamily which also includes plexm-Al (alternatively named plexm- 1/NOV), plex ⁇ n-A2 (alternatively named plexm-2/OCT) and plex ⁇ n-A3 (alternatively named plexm-2/SEX)
  • Plex ⁇ n-B2 and plex ⁇ n-B3 are located on human chromosome 22 and chromosome X, respectively, and are family members of the plexm-B subfamily which also includes plexin-Bl (alternatively named SEP)
  • Plex ⁇ n-B3 maps very close to the plex ⁇ n-A3 genomic locus on Xq28
  • Plexm-Dl is the first identified member of the plexin-D subfamily and is atypical of any of the
  • plexins and Met- like receptors contain short cysteine-rich motifs, termed "Met Related Sequences" (MRS), whose minimal consensus is: C-X(5-6)-C-X(2)-C-X(6-8)-C-X(2)-C-X(3-5)-C (Maestrini et al., 1996 supra); Tamagnone and Comoglio, 1997 supra); blue boxes in Fig. IB).
  • MRS Metal Related Sequences
  • the proteins of the Met family contain a single MRS (in their receptor ⁇ chains), whereas in plexin family members there are two/three repeated MRS motifs.
  • plexin family members contain in their extracellular moiety a 500 amino acid region similar to the sema domain of semaphorins (Kolodkin et al. (1993) supra; Winberg et al., 1998 supra); yellow boxes in Fig. IB.
  • the MRS motif is proposed to function as protein-protein interaction domain.
  • the cytoplasmic domain of plexins contains a -600 amino acid domain which we term the SP domain ("Sex and Plexins", marked in green in Fig. IB) that is highly conserved within the family (57-97% similarity) and in evolution (over 50% similarity between invertebrates and humans).
  • the SP domain does not share homology with any known protein. It includes a number of potential tyrosine phosphorylation sites, but lacks the typical motifs of catalytic tyrosine kinases.
  • the predicted secondary structure of the SP domain includes long conserved alpha helices, typically found in protein-protein interaction modules.
  • the present invention also demonstrates that plexins can form complexes with neuropihns, which in turn demonstrates that a receptor for semaphorins can be hetero- oligomers of plexins and neuropihns.
  • a receptor for semaphorins can be hetero- oligomers of plexins and neuropihns.
  • plexins and neuropihns are in fact simultaneously expressed in several neuronal populations during embryonic development.
  • the plexin-neuropilin complex predates ligand binding, since the association is not influenced by the presence of class 3 semaphorins. That the observed plexin-neuropilin complexes are formed in cis is furthermore supported by the experimental conditions used (cotransfection of isolated cells with the two constructs).
  • Neuropihns the main semaphorin binding domain of neuropihns (CUB domain (Giger, R.J., Urquhart, E.R., Gillespie, S.K., Levengood, D.V., Ginty, D.D., and Kolodkin, A.L. (1998) "Neuropilin-2 is a receptor for semaphorin IV: insight into the structural basis of receptor function and specificity.” Neuron 21, 1079-1092; Nakamura, F., Tanaka, M., Takahashi, T., Kalb, R.G., and Strittmatter, S.M.
  • Neuropilin- 1 extracellular domains mediate semaphorin D/LU-induced growth cone collapse [In Process Citation]. Neuron 21, 1093-1100; Chen et al. 1998 supra) is not required for the interaction with plexins, as indicated by the association of the relevant Neuropilin-2 deletion construct with plexin-Bl (not shown).
  • a ternary complex, where neuropihns use two distinct protein modules to form a bridge between the sema domain of semaphorins and the sema domain of plexins is thus contemplated.
  • plexins are the functional partners of neuropihns, required for transducing signals mediated by semaphorins, preferably class 3 semaphorins.
  • semaphorins preferably class 3 semaphorins.
  • D Plex A appears sufficient as a functional receptor for Sema la, a transmembrane class 1 semaphorin (Winberg et al., 1998 supra).
  • plexins are functional co- receptors for secreted semaphorins.
  • plexins The intracellular signals transduced by plexins are still largely obscure.
  • the cytoplasmic domain of plexins is large and highly conserved within and across species and contains stretches of alpha helices, which are putative protein-protein interaction domains, and could thus mediate the association with cytosolic partners.
  • the alphas, betas, and kinases of cytokine receptor complexes The alphas, betas, and kinases of cytokine receptor complexes.
  • the invention provides an isolated nucleic acid molecule encoding a novel human plexin polypeptide.
  • plexin polypeptide is meant a member of the plexin family compnsmg an amino acid sequence that shares at least 60% ammo acid sequence homology with SEQ ID NOS: 2 (plexin B-2), 4 (plexin B-3), 6 (plexm D-l) or 8 (plexm A-4), preferably, at least 65% sequence homology, more preferably, at least 70% sequence homology, more preferably, at least at least 75% sequence homology, more preferably, at least 80% sequence homology, still more preferably at least 85% sequence homology, even more preferably, at least 90% sequence homology, and most preferably at least 95% sequence homology with SEQ ID NOS: 2, 4, 6 or 8.
  • Plexin polypeptides of the invention are useful for modulating cell growth (i.e nerve) and immune regulation.
  • moduleating is meant increasing or decreasing cell growth
  • cell growth is meant any change in cell number or size, including, without limitation, increase or decrease in cell number, increase or decrease in rate of cell division, increase or decrease in rate of cell death, and/or increase or decrease in cell size.
  • Standard methods for measu ⁇ ng cell growth include standard apoptosis assays (e.g., TUNEL assays, DNA fragmentation, trypan blue exclusion) and cell proliferation assays (e.g., H-thymidine incorporation).
  • Immune regulation is meant increasing or decreasing the biological functions of immune cells (i.e., cells involved in an immune response).
  • Immune cells include, without limitation, lymphocytes (T and B), NK cells, dendritic cells, myeloid cells (e.g., macrophages and neutrophils), and other hematopoietic cells involved in an immune response.
  • nucleic acid molecule or “nucleic acid” as used herein, is meant any deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), including, without limitation, complementary DNA (cDNA), genomic DNA, RNA, heteronuclear RNA (hnRNA), messenger RNA (mRNA), DNA/RNA hybrids, or synthetic nucleic acids (e.g., an oligonucleotide) comprising ribonucleic and/or deoxyribonucleic acids or synthetic variants thereof.
  • the nucleic acid of the invention includes, without limitation, an oligonucleotide or a polynucleotide.
  • the nucleic acid can be single stranded, or partially or completely double stranded (duplex).
  • Duplex nucleic acids can be homoduplex or heteroduplex.
  • polypeptide any molecule comprising two or more amino acids joined together with a peptide bone, regardless of length or post-translational modifications (e.g., without limitation, glycosylation, lipidation, acetylation, or phosphorylation).
  • Useful plexin polypeptides of the invention include, without limitation, the full length plexin polypeptides having the amino acid sequence of SEQ ID NOS: 2, 4 , 6, 8 or 10,; an extracellular domain of the polypeptide having the amino acid sequence 1 to 1199 of SEQ ID NO: 2; 1 to 1099 of SEQ ID NO: 4; 1 to 1270 of SEQ ID NO: 6 or 1 to 199 of SEQ ID NO: 8, with its associated signal peptide; or an extracellular domain of the polypeptide having the amino acid sequence 19 to 1199 of SEQ ID NO: 2; 24 to 1099 of SEQ ID NO: 4; or 43 to 1270 of SEQ ID NO: 6, lacking its associated signal peptide; an intracellular domain of the polypeptide having the amino acid sequence of SEQ ID NOS: 2, 4, 6 or 8; and polypeptides, the amino acid sequence of which comprises about residues 1-18 (putative signal sequence), 19- 518 (sema domain), 451-530 (1° MRS), 601-680 (2° MRS
  • an isolated compound is meant a compound (e g , a nucleic acid molecule or a protein) that has been separated from components (e g , nucleic acid molecules, proteins, hpids, and/or carbohydrates) which naturally accompany it Water, buffers, and other small molecules (e g , molecules having a molecular weight of less than about 1000 daltons) may accompany an isolated compound of the invention
  • an isolated compound is at least 70%, by weight, free from components which naturally accompany it More preferably, an isolated is at least 75%, by weight, free from components which naturally accompany it, still more preferably, at least 80%, by weight, free, even more preferably, at least 85%, by weight, free, and even more preferably, at least 90%, by weight, free from components which naturally accompany it
  • a substantially pu ⁇ fied compound is at least 95%, by weight, free from components which naturally accompany it
  • the isolated nucleic acid molecule is separated from other nucleic acids (e g , genes or transc ⁇ pts) or proteins which, in the naturally-occur ⁇ ng genome of the organism from which the nucleic acid molecule was de ⁇ ved, flanked the nucleic acid molecule
  • Isolated nucleic acid molecules therefore include, without limitation, a recombinant nucleic acid molecule mco ⁇ orated into a plasmid or other vector (e g , a replication-defective virus), a recombinant nucleic acid molecule inco ⁇ orated into the genome of a prokaryotic or eukaryotic organism, or a nucleic acid molecule which exists as a separate molecule independent of other nucleic acids (e g , a PCR product, a chemically synthesized nucleic acid molecule, or a nucleic acid molecule produced by rest ⁇ ction endonuclease digestion)
  • Pu ⁇ a recombinant nucle
  • a nucleic acid molecule is chemically synthesized on a standard oligonucleotide synthesis machine. The resulting single stranded molecule is then subjected to second strand synthesis to form a duplex DNA molecule, which is then ligated into a plasmid capable of replication in a prokaryotic or eukaryotic cell. The nucleic acid molecule is then replicated in the cell, purified (e.g., by CsCl gradient), and subjected to sequence analysis.
  • the nucleic acid molecule has a nucleic acid sequence comprising SEQ ID NOS: 1, 3, 5, 7 or 9.
  • the nucleic acid molecule of the invention has not more than 500 nucleotides flanking each of the 5' and 3' ends of SEQ ID NOS: 1, 3, 5, 7 or 7.
  • the plexin polypeptide has an amino acid sequence that comprises SEQ ID NOS: 2, 4, 6, 8 or 10.
  • the plexin polypeptide of the invention has not more than 50 amino acid residues flanking each of the N-terminal and C-terminal ends of SEQ ID NOS: 2, 4, 6, 8 or 10.
  • the nucleic acid molecule hybridizes under stringent conditions (as defined herein) to SEQ ID NOS: 1, 3, 5, 7 or 9.
  • the invention also includes nucleic acid molecules that hybridize under stringent hybridization conditions (as defined herein) to all or a portion of the nucleotide sequence represented by SEQ ID NOS: 1, 3, 5, 7 or 9 or its complement.
  • the hybridizing portion of the hybridizing nucleic is at least 80%, e.g., at least 95%, or at least 98%, homologous to the sequence of a portion or all of a nucleic acid encoding a polypeptide having the amino acid sequence of SEQ ID NOS: 2, 4, 6, 8 or 10, or its complement.
  • Hybridizing nucleic acids of the type described herein can be used, for example , as a cloning probe, a primer (e.g., a PCR primer) or a diagnostic probe.
  • Hybridization of the oligonucleotide probe to a nucleic acid sample typically is performed under stringent conditions.
  • Nucleic acid duplex or hybrid stability is expressed as the melting temperature or Tm, which is the temperature at which a probe dissociates from a target DNA. This melting temperature is used to define the required stringency conditions. If sequences are to be identified that are related and substantially identical, rather than identical, then it is useful to first establish the lowest temperature at which only homologous hybridization occurs with a particular concentration of salt (e.g., SSC or SSPE).
  • salt e.g., SSC or SSPE
  • the temperature of the final wash in the hybridization reaction is reduced accordingly (for example, if the sequences have > 95% identity with the probe are sought, the final wash temperature is decreased 5°C).
  • the change in the Tm can be between 0.5 C and 1.5 C per 1% mismatch.
  • “Stringent conditions” involve hybridization at 68°C in 5x SSC/5x Denhardt's solution/1.0% SDS, and washing in 0.2xSSC/0.1% SDS at room temperature.
  • “Moderately stringent conditions” include washing in 3xSSC at 42°C.
  • the parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid. Additional guidance regarding such conditions is readily available in the art, for example, by Sambrook et al, supra; and Ausubel et al, supra.
  • Nucleic acid sequence homology (as well as amino acid sequence homology) can be measured according to standard methods. Unless otherwise specified, as used herein used herein, "percent homology" of two amino acid sequences or of two nucleic acids is determined using the algorithm of Karlin and Altshul (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990), modified as in Karlin and Altschul (Proc. Natl. Acad. Sci. USA 90: 5873-5877, 1993). Such an algorithm is inco ⁇ orated into the NBLAST and XBLAST programs of Altschul et al. (J. Mol. Biol. 215: 403-410, 1990).
  • Gapped BLAST is utilized as described in Altschul et al. (Nucleic Acids Res. 25: 3389-3402, 1997).
  • the default settings of BLAST emphasize regions of local alignment to detect relationships among sequences which share only isolated regions of similarity (Altschul et al., J. Mol. Biol. 215: 403-410 (1990). See http://www.ncbi.nlm.nih.gov.
  • a nucleic acid molecule having the sequence of SEQ ID NOS: 1, 3, 5 or 7 is used to probe a cDNA library under stringent conditions according to standard techniques (see., e.g., Ausubel et al, supra).
  • a positive clone i.e., a clone that hybridizes to SEQ ID NOS: 1, 3, 5 or 7 under stringent conditions
  • that clone is expanded and subjected to sequence analysis.
  • a nucleic acid molecule having a nucleic acid sequence that is at least 70% identical, preferably at least 75% identical, more preferably, at least 80% identical, still more preferably at least 85% identical, even more preferably, at least 90% identical, and most preferably at least 95% identical (as measured by the basic BLAST program of NCBI on default settings) to SEQ ID NOS: 1, 3, 5 or 7 is a nucleic acid molecule of the invention.
  • the invention provides four novel isolated plexin polypeptides.
  • isolated is as defined for the first aspect of the invention.
  • the isolated polypeptide is separated from organic molecules, such as nucleic acid molecules, polypeptides, and/or carbohydrates, which, in the naturally-occurring organism from which the polypeptide was derived, accompany the polypeptide.
  • Isolated polypeptides therefore also include a recombinant polypeptide (e.g., a human polypeptide expressed in an insect cell), or a chemically synthesized polypeptide.
  • Purification of a polypeptide can be accomplished and measured by any standard method including, without limitation, chemical synthesis, recombinant polypeptide expression in prokaryotic or eukaryotic cells, affinity chromatography, Western blotting analysis, SDS-PAGE analysis, and/or HPLC.
  • the invention provides all derivatives, mutants, truncations, and/or splice variants of the four novel plexin polypeptides, so long as these derivatives, mutants, truncations, and/or splice variants share at least 60% amino acid sequence homology with SEQ ID NOS: 2 ,4 ,6 or 8, preferably, at least 65% sequence homology, more preferably, at least 70% sequence homology, more preferably, at least at least 75% sequence homology, more preferably, at least 80% sequence homology, still more preferably at least 85% sequence homology, even more preferably, at least 90% sequence homology, and most preferably at least 95% sequence homology with SEQ ID NOS: 2 ,4 ,6 or 8 as determined using the basic BLAST program of the National Center for Biotechnology (NCBI; National Library of Medicine, Bethesda, MD), using the default settings defined therein using the sequence of the four novel plexin derivative, mutant, truncation and/or
  • Preferred plexin polypeptide derivatives include polypeptides whose sequences differ from the sequence given in SEQ ID NOS: 2 ,4 ,6 or 8, by one or more conservative amino acid substitutions, or by one or more non-conservative amino acid substitutions, deletions or insertions which do not abolish the biological activity of the plexins.
  • Conservative amino acid substitutions typically include the substitution of one amino acid for another with similar biochemical characteristics, such as polarity, size, and/or charge.
  • Non-limiting examples of conservative substitutions are substitutions within the following groups: valine, glycine, glycine, alanine, valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine, phenylalanine, and tyrosine.
  • the plexin polypeptide has a sequence comprising the sequence of SEQ ID NOS: 2 ,4 ,6 or 8.
  • an isolated plexin polypeptide comprising the sequence of SEQ ID NOS: 2 ,4 ,6 or 8 can chemically synthesized according to standard techniques (e.g., at a commercial peptide generating facility). For example, a putative plexin polypeptide is purified and subjected to N- terminal sequencing to determine its amino acid sequence. The amino acid sequence of the polypeptide is then compared to SEQ ID NOS: 2 ,4 ,6, 8 or 10 (as measured by the basic BLAST program of NCBI on default settings).
  • a polypeptide that shares at least 60% homology with SEQ ID NOS: 2 ,4 ,6, 8 or 10 is a plexin polypeptide of the invention.
  • a tag in another example, purification of a plexin polypeptide is facilitated by the addition of a tag to the polypeptide that enables purification of the tagged polypeptide.
  • a tag include a hemagglutinin (HA) tag, a his tag, a GST tag, a FLAG-tag, and a myc tag.
  • a nucleic acid molecule of the first aspect is engineered using standard molecular biology techniques to inco ⁇ orate the nucleic acid sequence encoding the tag. The engineered nucleic acid molecule is then introduced and positioned for expression in an appropriate cell to produce the recombinant tagged polypeptide, which can then be readily purified by binding of the tag to its substrate.
  • the his tag binds to Ni-NTA agarose.
  • a GST (glutathione S- transferase) tag binds to glutathione agarose beads.
  • His tag and GST tag expression and purification kits are commercially available from PharMingen (San Diego, CA).
  • myc-tagged plexin polypeptide are produced by cells introduced with a nucleic acid molecule encoding the tagged protein and positioned for expression in the cell. It will be appreciated that particularly useful polypeptides of this aspect of the invention are secreted by the cell in which they are produced, thus facilitating purification of the polypeptide from the culture media in which the cells have been maintained, without requiring lysis of the cell.
  • the invention provides a cell engineered to comprise a nucleic acid molecule encoding one of the four plexin polypeptides.
  • engineered is meant that the cell of the invention has been modified by standard molecular biology techniques. Where the cell is "engineered to comprise a nucleic acid molecule,” standard molecular biology techniques have been employed to introduce the indicated nucleic acid molecule into the cell, either by transformation or transfection of the cell with a plasmid, or by infection or transduction of the cell with a recombinant virus.
  • the nucleic acid molecule of the first aspect of the invention is preferably subcloned into a plasmid or vector (for example, but not limited to, a vector used to generate a recombinant virus), wherein the nucleic acid molecule is positioned for expression in the plasmid or vector.
  • a plasmid or vector for example, but not limited to, a vector used to generate a recombinant virus
  • the plasmid or vector is then introduced into a cell by standard techniques to produce an engineered cell in accordance with the third aspect of the invention.
  • the cell is a prokaryotic cell (e.g., a bacterium).
  • E. coli cells e.g., DH5 ⁇
  • a bacterial plasmid i.e., a plasmid containing an E. coli origin of replication
  • the transformed bacteria are selected using, for example, an antibiotic-resistance encoding nucleic acid molecule (e.g., ampicillin resistance) on the plasmid such that the antibiotic resistance protein is expressed by the transformed bacteria.
  • the transformed bacteria are then propagated, and can be cryopreserved and stored frozen in glycerol.
  • a nucleic acid molecule encoding one of the four plexin polypeptides may be introduced into a large variety of cells.
  • a nucleic acid molecule encoding one of the four plexin polypeptides can be introduced into prokayotic cells (e.g., bacteria), and any eukaryotic cell into which an exogenous nucleic acid molecule may be introduced.
  • the cell is a eukaryotic cell.
  • Eukaryotic cells that comprise a nucleic acid molecule encoding one of the four plexin polypeptides include, without limitation, yeast cells, plant cells, insect cells, and mammalian cells.
  • mammalian cells include cells from any mammalian species (including, without limitation, mouse, hamster, monkey, human), of any lineage (including, without limitation, lymphocyte, fibroblast, stem cell), and may be an immortalized cell, or a non- immortalized cell.
  • Cells, as well as plasmids and/or vectors are commercially available, for example, from the American Type Culture Collection ("ATCC"; Manassas, VA).
  • the nucleic acid molecule is positioned for expression in the cell.
  • positioned for expression is meant that the nucleic acid molecule is operably linked to at least one regulatory sequence which directs the transcription and translation of the nucleic acid molecule in a cell, such that the cell engineered to comprise the nucleic acid molecule produces (i.e., expresses) the protein encoded by the nucleic acid molecule.
  • operably linked is meant that the nucleic acid molecule and the regulatory sequence are connected in a such a way as to permit expression of the nucleic acid molecule when the nucleic acid molecule is present in a cell.
  • Regulatory sequences include, without limitation, promoters, enhancers, IRES sequences, and polyadenylation signals. Since plexin polypeptides are involved in immune regulation and the modulation of cell growth, it may be desirable to operably link a nucleic acid molecule encoding one of the four plexin polypeptides to an inducible promoter.
  • the four plexin polypeptides that are encoded by the nucleic acid molecules do not necessarily include the transmembrane domain of the four plexin polypeptides, and so may be produced by the cell as an intracellular polypeptide or a soluble secreted polypeptide.
  • the polypeptide fragment is secreted by the cell, it can be pu ⁇ fied from the conditioned growth media of the transfected cells, without having to lyse the cells.
  • a soluble intracellular polypeptide fragment is pu ⁇ fied from only lysed cells, the fragment, being soluble, does not have to be extracted from the cell membrane; thus, different lysis conditions may be used to obtain pu ⁇ fied soluble intracellular polypeptide fragment as compared to the lysis conditions required to obtain pu ⁇ fied full length plexin polypeptides (which has a transmembrane domain).
  • Protein expression systems have been established for a va ⁇ ety of cells and are known to those of skill in the art.
  • Cells are also commercially available from the ATCC, and a va ⁇ ety of protein expression system kits are commercially available from, for example, Invitrogen Co ⁇ . (Carlsbad, CA), Clontech Laborato ⁇ es (Palo Alto, CA), PharMmgen (San Diego, CA), Promega Co ⁇ . (Madison, WI), and Stratagene (La Jolla, CA).
  • a nucleic acid molecule encoding one of the four plexin polypeptides is operably linked to bacte ⁇ al regulatory sequences (e.g., T7 late promoter or bacte ⁇ ophage regulatory sequences), and the resulting nucleic acid molecule is used to transform bacte ⁇ al cells, where the transformed bacte ⁇ al cells produce one of the four plexm polypeptides.
  • a nucleic acid molecule encoding one of the four plexin polypeptides is operably linked to baculovirus regulatory sequences in a baculovirus vector.
  • Recombinant baculovirus are then generated and used to transduce insect cells (using, for example, the expression kit commercially available from Clontech Laborato ⁇ es.
  • the transduced insect cells comp ⁇ se a nucleic acid molecule encoding one of the four plexin polypeptides positioned for expression in the insect cell, and thus produce one of the four plexin polypeptides.
  • Mammalian cells are widely used as protein expression systems.
  • a mammalian cell may be transduced with a recombinant retrovirus or adenovirus compnsmg a nucleic acid molecule encoding one of the four plexin polypeptides operably linked to regulatory sequences that are either endogenous to the particular virus or exogenous to the virus (e.g., a CMV promoter in a retroviral vector).
  • the transduced mammalian cell is then propagated in vitro in tissue culture, in vivo (e.g., in an immunocompromised animal), and/or cryopreserved and stored frozen in DMSO.
  • mammalian cells are transfected with an expression plasmid compnsmg a nucleic acid molecule encoding one of the four plexin polypeptides operably linked to one or more regulatory sequences on the plasmid.
  • expression plasmid is meant a plasmid in which an inserted nucleic acid molecule of interest (e.g., encoding one of the four plexin polypeptides, a plexin chimeric molecule, or tagged plexin polypeptide) is operably linked to at least one regulatory sequence such that when the expression plasmid containing the inserted nucleic acid molecule of interest is introduced (e.g., by transfection) into a cell, the inserted nucleic acid molecule is positioned for expression in that cell.
  • the nucleic acid molecule in the expression plasmid upon being introduced into the cell, is thus positioned for expression in that cell, and enables the cell to produce one of the four plexin polypeptides encoded by the nucleic acid molecule.
  • a nucleic acid molecule according to the first aspect of the invention is inserted into a standard mammalian expression plasmid (e.g., pcDNA3.1 commercially available from Invitrogen Co ⁇ ., Carlsbad, California), such that the inserted nucleic acid molecule encoding one of the four plexin polypeptides is operably linked to the regulatory sequences in the mammalian expression plasmid.
  • a standard mammalian expression plasmid e.g., pcDNA3.1 commercially available from Invitrogen Co ⁇ ., Carlsbad, California
  • Mammalian cells are then transfected with this expression plasmid (using, e.g., CaPO or DEAE-dextran).
  • the expression plasmid contains an antibiotic-resistance encoding nucleic acid molecule (e.g., neomycin resistance on the pCDNA3.1 plasmid) such that the antibiotic resistance protein is expressed by the transfected cells
  • transfected cells may be selected for the ability to grow in the presence of the antibiotic.
  • the transfected cells may then be propagated and cryopreserved and stored in frozen in DMSO.
  • the invention provides an isolated nucleic acid molecule encoding a chimeric molecule comprising at least two segments, wherein one of the segments comprises one of the four plexin polypeptides.
  • chimeric molecule is meant a protein that comprises at least two segments of polypeptide joined together by any means, including, without limitation, a covalent bond (e.g., peptide bond), a non- covalent bond (e.g., ionic bond or hydrogen bond) or by a chemical crosslinker. It should be noted that one of the four plexin polypeptides that has been tagged is within the definition of a chimeric molecule.
  • the nucleic acid molecule encoding the segment of a chimeric molecule comprising one of the four plexin polypeptides hybridizes under stringent conditions to SEQ ID NO: 1, 3, 5 or 7.
  • Stringent conditions are as described above for the first aspect of the invention.
  • Standard molecular biology techniques may be employed to generate nucleic acid molecules encoding chimeric molecules according to the fourth aspect of the invention.
  • a nucleic acid molecule encoding the extracellular domain of one of the four plexin polypeptides may be joined, in frame, to a nucleic acid molecule encoding the constant region of an immunoglobulin molecule (see, e.g., Chamow S.M., Antibody Fusion Proteins, John Wiley & Sons, New York, 1999).
  • in frame is meant that a first nucleic acid molecule is ligated to a second nucleic acid molecule such that the each of the amino acid sequences of the polypeptides encoded by each of the first and the second nucleic acid molecules is not frame-shifted.
  • a chimeric molecule comprising the extracellular domain of one of the four plexin polypeptides including the amino acid sequence of SEQ ID NOS: 2, 4, 6 or 8 is generated.
  • a nucleic acid molecule encodes amino acid residue number 1(19) through about amino acid residue number 1199 of SEQ ID NO: 2; amino acid residue number 1(24) through about amino acid residue number 1099 of SEQ ID NO: 4; amino acid residue number 1(43) through about amino acid residue number 1270 of SEQ ID NO: 6 and amino acid residue number 1 through about amino acid residue number 199 of SEQ ID NO: 8 with its associated signal peptide (parenthesis depicts about the beginning of the amino acid sequence of the extracellular domain lacking its signal peptide).
  • This nucleic acid molecule is fused in frame with a nucleic acid molecule encoding the constant region of an immunoglobulin, such that the chimeric molecule encoded by the resulting nucleic acid molecule generally has the following structure:
  • the heavy chain class (e.g., IgG, IgA, IgM, IgD, or IgE) can be varied in this chimeric molecule depending upon which constant region is used.
  • Nucleic acid molecules encoding the constant region of various immunoglobulin (Ig) heavy chains are known (see, e.g., Zettlmeissl et al., DNA Cell Biol.
  • expression plasmids are available, into which the nucleic acid molecule of interest (i.e., a nucleic acid molecule encoding an extracellular domain of the polypeptide of SEQ ID NO: 2; SEQ LO NO: 4; SEQ ID NO: 6; or SEQ ID NO: 8) can be inserted, and the resulting plasmid introduced into a cell to produce one of the four extracellular plexin-Ig chimeric molecule s (see, e.g., Zettlmeissl et al., supra; Miller et al., J. Exp. Med. 178 (1): 211- 222, 1993).
  • any variety of chimeric molecule carrying the extracellular domains of one of the four plexin polypeptide may be generated.
  • the extracellular domain of one of the four plexin polypeptides can be myc-tagged, his-tagged, or FLAG tagged according to standard molecular biology techniques.
  • extracellular proteins are particularly useful for identifying ligands to which the extracellular domain of one of the four plexin polypeptides bind.
  • extracellular plexin-Dl-Ig chimera can be immobilized on a protein A-sepharose column. Molecules suspected of binding the extracellular domain of plexin-Dl are added to the column, to which the molecule that binds to the extracellular domain of plexin-Dl adhere, and the non-binding molecules flow through the column.
  • the extracellular plexin-Dl -binding molecules are readily eluted, for example, by changing the pH or ion concentration of the elution buffer.
  • Extracellular plexin proteins are also used to identify cells expressing the ligand of plexin extracellular domain on their cell surface (and thereby also identify the ligand itself). For example, cells are incubated with a FLAG-tagged plexin extracellular domain chimeric molecule. A FLAG-tagged plexin extracellular domain chimeric molecule is generated. An anti-FLAG antibody that is detectably labeled is then added to the cells.
  • detectably labeled is meant any means for marking and identifying the presence of a molecule. Detectable labels include, without limitation, radioactive labels (e.g., 32 P or 35 S) and fluorophore labels (e.g., FITC, phycoerythrin, or rhodamine).
  • FTTC-labeled anti-FLAG antibodies are commercially available from Babco, Richmond, CA
  • the "stained" cells i.e., cells incubated first with the FLAG-tagged plexin extracellular domain chime ⁇ c molecule and then with the FITC-labeled anti-FLAG antibody
  • the "stained" cells are then subjected to flow cytometry analysis to select those cells that are labeled with FITC, and so express a molecule that binds to the extracellular domain of one of the four plexin polypeptides
  • the FITC labeled cells are then further manipulated (e g., characterized to determine which cells express the plexin polypeptide ligand)
  • the ligand of the plexin extracellular domain is itself identified, for example, by lysmg the cells, adding the lysate to one of the four plexin extracellular domam-Ig chime ⁇ c molecule columns desc ⁇ bed above, and pu ⁇ fying the ligand The ligand is then sequenced by N-terminal sequencing.
  • the intracellular domain of one of the four plexin polypeptides is used as "bait" in a yeast two-hyb ⁇ d system to identify ligands that interact with the intracellular domain of one of the four plexins desc ⁇ bed herein.
  • a yeast two-hyb ⁇ d system For general desc ⁇ ption of the two-hyb ⁇ d system, see U.S. Patent Nos.
  • a nucleic acid molecule encoding from about amino acid residue number 143 through at least amino acid residue number 214 of SEQ ID NO 2 is inserted into a standard DNA binding domain expression plasmid (e.g., the GAL4 DNA binding domain plasmid in the Interactor kit commercially available from PharMingen (San Diego, CA).
  • a standard DNA binding domain expression plasmid e.g., the GAL4 DNA binding domain plasmid in the Interactor kit commercially available from PharMingen (San Diego, CA).
  • a va ⁇ ety of cDNA hbra ⁇ es in transc ⁇ ptional activation domain vectors are available (e.g., from Clontech, Palo Alto CA).
  • the cDNA hbra ⁇ es are screened employing standard methods (see, e.g., the methods employed in U.S. Patent No. 5,780,262) to identify cDNA clones encoding a ligand that binds to the intracellular domain of one of the four plexin polypeptides.
  • One preferable cDNA library screened in this example is a cDNA library generated from an immune cell (e.g., a lymphocyte or NK cell).
  • the invention provides a pu ⁇ fied chime ⁇ c molecule compnsmg one of the four plexm polypeptides.
  • Methods for pu ⁇ fying proteins are as desc ⁇ bed for the second aspect of the invention
  • the invention provides a cell engineered to comp ⁇ se a nucleic acid molecule encoding a chime ⁇ c molecule compnsmg at least two segments, wherein one of the segments comp ⁇ ses one of the four plexin polypeptides.
  • a nucleic acid encoding a chimeric molecule comprising one of the four plexin polypeptides may be introduced into any variety of cells.
  • the cell is a prokaryotic cell or a eukaryotic cell.
  • the eukaryotic cell is a yeast cell or a mammalian cell (e.g., a human cell).
  • the invention provides an isolated binding agent that specifically binds one of the four plexin polypeptides, or specifically binds a chimeric molecule comprising a segment comprising one of the four plexin polypeptides.
  • the plexin protein has an amino acid sequence comprising SEQ ID NOS:2, 4, 6 or 8.
  • binding agent e.g., an antibody
  • binds to its specific target e.g., one of the four plexin polypeptides
  • the binding agent is an antibody
  • the antibody preferably specifically binds to its specific target with a dissociation constant (K D) of at least 10 "5 M, more preferably, 10 "6 M, even more preferably 10 "7 M, and most preferably, the binding agent specifically binds to its specific target with a K D of at least 10 "8 M.
  • K D dissociation constant
  • the binding agent of this aspect of the invention is an antibody, such as a monoclonal antibody or a polyclonal antibody, or a fragment of an antibody that specifically binds one of the four plexin polypeptides.
  • Standard methods may be employed to generated both monoclonal and polyclonal antibodies that specifically bind to one of the four plexin polypeptides of the invention. See, e.g., Ausubel et al., supra; Coligan, J.E. et al., Current Protocols in Immunology, John Wiley & Sons, New York (1991); and Delves, P.J., Antibody Production: Essential Techniques, John Wiley & Sons, New York (1997).
  • the plexin polypeptides of the present invention purified according to the methods described for the second aspect of the invention, are used to immunize rabbits (e.g., for polyclonal antibodies) or mice (e.g., for monoclonal antibodies) to generate antibody-mediated immunity to the four plexin polypeptides used to immunize the animal.
  • antibodies can be screened by, e.g., ELISA, to identify those antibodies that show the highest affinity for the immunizing plexin protein of polypeptide fragment.
  • the cloned cell producing the high affinity monoclonal antibody can then propagated in vitro (where the antibody is purified from the culture supernatant) or in vivo (where the antibody is purified from ascites fluid), and can also be cryopreserved and stored frozen at, e.g., -70°C in DMSO, to provide a potentially limitless supply of monoclonal antibody.
  • the invention also provides various antibody fragments, such as Fab, F(ab') 2 , Fv, and sFv fragments. Recombinant, chimeric, and humanized antibodies are also provided.
  • Humanized antibodies which specifically bind to one of the four plexin polypeptides can be synthesized according to methods known in the art (see, e.g., Green L.L. et al., Nature Genetics 7: 13-21, 1994 for fully humanized antibodies expressed in transgenic animals; see also U.S. Patent Nos: 5,693,761 ; 5,777,085; and 5,585,089).
  • Humanized antibodies are chimeras comprising mostly human IgG sequences into which at least portions of the regions responsible for specific antigen- binding (e.g., CDR's) have been inserted.
  • Animals are immunized with the desired antigen, the co ⁇ esponding antibodies are isolated, and the portion of the variable region sequences responsible for specific antigen binding are removed.
  • the animal-derived antigen binding regions are then cloned into the appropriate position of human antibody genes in which the antigen binding regions have been deleted.
  • Humanized antibodies minimize the use of heterologous (i.e., inter-species) sequences in human antibodies, and thus are less likely to elicit immune responses in the treated subject (see also, e.g., U.S. Patent No. 5,807,715).
  • ком ⁇ онентs can also be accomplished by making chimeric or humanized antibodies comprising nonhuman variable domains and human constant domains (CHI, CH2, CH3) isolated from different classes of immunoglobulins.
  • CHI, CH2, CH3 human constant domains
  • antibodies with increased antigen binding site valencies can be recombinantly produced by cloning the antigen binding site into vectors ca ⁇ ying the human chain constant regions (see, e.g., Arulanandam et al., J. Exp. Med. 177: 1439-1450, 1993).
  • standard recombinant DNA techniques can be used to alter the binding affinities of recombinant antibodies with their antigens by altering amino acid residues in the vicinity of the antigen binding sites.
  • the antigen binding affinity of a humanized antibody can be increased by mutagenesis based on molecular modeling (see, e.g., Queen et al., Proc. Natl. Acad. Sci. 86: 10029-10033, 1989).
  • plexin polypeptide-specific single polypeptide chain antibodies see general methods in U.S. Patent Nos. 4,946,788 and 4,704,692; single domain antibodies (Ward, E.S. et al., Nature 341: 544-546, 1989); and chimeric antibodies (U.S. Patent No. 4,816,567).
  • Binding agents that specifically bind the plexin polypeptides of the present invention are useful, for example, in determining expression levels of the plexin polypeptides in various tissues of the body, Western blotting analysis, and immunochromatography. Particularly, binding agents that specifically bind the plexin polypeptides are useful for binding the plexin polypeptide on a cell expressing the plexin polypeptide, thereby activating the cell.
  • a binding agent that specifically binds one of the four plexin polypeptides is effective as an immune modulator.
  • Additional applications include, without limitation, an injectable formulation comprising a binding agent that specifically binds one of the four plexin polypeptides that is useful to antagonize activity in a disease involving aberrant immune regulation or a disease involving aberrant cell growth.
  • the invention provides an isolated antisense oligonucleotide complementary to a portion of a nucleic acid molecule encoding one of the four plexin polypeptides.
  • hybridization of the antisense oligonucleotide to the nucleic acid molecule inhibits transcription or translation of the nucleic acid molecule.
  • the first nucleic acid molecule is thus a "complement" of the second nucleic acid molecule.
  • the antisense oligonucleotides according to the invention are complementary to a region of a nucleic acid molecule (or a region at the intron/exon boundary of DNA or RNA) that encodes one of the four plexin polypeptides.
  • Preparation of antisense oligonucleotides is well known (see, e.g., Agrawal et al, Trends Biotechnol. 10:152-158, 1992; U.S. Patent No. 5,149,798; Agrawal et al, Proc. Natl Acad. Sci. USA 85:7079- 7083, 1988; Froehler, Tetrahedron Lett. 27:5575-5578, 1986; and Bergot et al., J. Chromatog. 559:35-42, 1992.
  • the invention provides a method for identifying a nucleic acid molecule encoding one of the four plexin polypeptides, comprising contacting a pool of candidate nucleic acid molecules with a nucleic acid molecule encoding one of the four plexin polypeptides, wherein hybridization of the nucleic acid molecule encoding one of the four plexin polypeptides under stringent conditions to a candidate nucleic acid molecule identifies the candidate nucleic acid molecule as a nucleic acid molecule that encodes one of the four plexin polypeptides.
  • “hybridization” and “stringent conditions” are as defined above for the first aspect of the invention.
  • the nucleic acid molecule encoding one of the four plexin polypeptides has a nucleic acid sequence comprising SEQ ID NOS: 1, 3, 5 or 7.
  • the isolated plexin polypeptides according to the second aspect of the invention, the plexin chimeric molecules according to the fifth aspect of the invention, and binding agents that specifically bind the plexin polypeptides according to the seventh aspect of the invention are useful as therapeutics to treat an individual suffering from, or suspected of having, a disease or disorder involving aberrant immune regulation or an individual suffering from, or suspected of having, a disease or disorder involving aberrant cell growth, particularly nerve cell growth.
  • disease or disorder involving aberrant immune regulation is meant any disease or disorder in which an abnormal immune response is generated in response to either self or foreign antigens.
  • this definition includes, without limitation, autoimmune diseases (e.g., lupus, inflammatory bowel disease, or Diabetes Type 1) and immunosuppressive diseases (e.g., multiple sclerosis or rheumatoid arthritis).
  • disease or disorder involving abe ⁇ ant cell growth is meant any disease or disorder in which an abnormal amount of cell growth is observed.
  • Cell growth is defined above.
  • diseases and disorders involving aberrant cell growth include hype ⁇ lasia, neoplasia, and cancer, as well as degenerative diseases, such as neurodegenerative diseases.
  • Preferable therapeutically useful plexin polypeptides are soluble polypeptides
  • the soluble plexin polypeptides are selected from the group consisting of plexin-A-1 (Maestrini et al. 1996 supra), plexin-A- 2 (Maestrini et al. 1996 supra), plexin-A-3 (Maestrini et al. 1996 supra), plexin-A-4, plexin-B-1 (Maestrini et al.
  • the invention provides a method for diagnosing a disease involving abe ⁇ ant immune regulation or a disease involving aberrant cell growth, compnsmg compa ⁇ ng the ammo acid sequence of one of the four plexin polypeptides from an individual suspected of having the disease with the amino acid sequence of one of the four plexin polypeptides from an unaffected individual, wherein the presence of a difference between the two amino acid sequences identifies the individual suspected of having the disease as having the disease.
  • “Disease or disorder involving aberrant immune regulation” and “disease or disorder involving aberrant cell growth” are as defined above.
  • “difference” in the amino acid sequence of one of the four plexin polypeptides from an individual suspected of having the disease or disorder as compared with the amino acid sequence of one of the four plexin polypeptides from an unaffected individual is meant any mutation that changes the ammo acid sequence including substitution, deletion, of addition of one or more ammo acid residues.
  • one of the four plexin polypeptides is extracted from cells of an individual suspected of having a disease involving aberrant immune regulation (e.g., using an antibody according to the seventh aspect of the invention)
  • the ammo acid sequence of the plexin polypeptide is determined by N- terminal sequencing and compared to the ammo acid sequence of one of the four plexin polypeptides from an unaffected individual (i e., a normal individual of the same species that does not have a disease involving aberrant immune regulation or a disease involving aberrant cell growth). If there is a difference in the two amino acid sequences, the individual suspected of having a disease involving abe ⁇ ant immune regulation is identified as having a disease involving aberrant immune regulation, and may be treated accordingly
  • amino acid sequence of the plexin polypeptide from the unaffected individual comp ⁇ ses the sequence of SEQ ID NO 2, 4, 6, 8 or 10
  • Plexin-B2 cDNA was amplified by RT-PCR starting from the partial cDNA sequences of clones MM1 (Shinoura, N., Shamraj, O.I., Hugenholz, H., Zhu, J.G., McBlack, P., Warnick, R., Tew, J.J., Wani, M.A., and Menon, A.G. (1995). Identification and partial sequence of a cDNA that is differentially expressed in human brain tumors. Cancer Lett 89, 215-221) and
  • KIAA0315 Genbank database
  • the genomic locus of SEP-B was identified due to its 100% sequence identity with clone C22_311 from human chromosome 22.
  • Plexin-B3 coding sequence was identified in the genomic sequence of ALD locus on human chromosome Xq28, using the algorithms HEXON and GENIE.
  • Plexin-Dl was similarly found in the genomic sequence of chromosome 3 (pac pDJ70il 1).
  • the common donor site is CCATCAG/gtgattgt (position 2028 from ATG); the alternative splice acceptor sites are: (i) cccccttcag/AGCCC, leading to the canonical plexin-Bl sequence, and (ii) ctcctctcag/GTGAT, leading to "plexin-Bl truncated" variant.
  • Cell transfections were carried out by Calcium phosphate and DEAE-dextran methods, using 5-10 ⁇ g of each cDNA (1-2 ⁇ g each in case of cotransfections).
  • the cDNA was cloned in pCDNA3 or derived expression plasmids (Invitrogen).
  • MDCK stable transfectants for plexin-A3 were obtained using pCEP4 expression plasmid (Invitrogen); the selection was done in the presence of Hygromicin-B (100-200 ⁇ g/ml).
  • Plexin-A3 positive clones of MDCK cells were isolated from two independent transfections, and showed identical biological properties.
  • Plexin and neuropilin expression constructs included a VSV- and myc-tag at the N' and C protein termini, respectively, detected by monoclonal antibodies anti- VSV-G (cat. V-5507, Sigma) and anti-cMyc-tag (cat. OP10-100UG, Calbiochem).
  • "Plexin-B 1 truncated" splice variant was expressed from a cDNA fragment isolated by RT-PCR and VSV-tagged at the N' terminus: the encoded amino acid sequence spans up to aa 676 (including the sema domain and two MRS motifs).
  • Protein-Bl -sema derives from a further deletion of the plexin-Bl extracellular domain, and exclusively includes the sema domain.
  • "Plexin-B 1- ⁇ sema” protein mutant includes only the C terminal half of plexin-Bl extracellular domain, starting from amino acid 606, i.e. excluding sema domain and first MRS but including second and third MRS, transmembrane and intracellular domains.
  • cells were lysed with EB buffer (20 mM Tris-HCl pH 7.4, 5 mM EDTA, 150 mM NaCl, 10% glycerol, 1% Triton X-100), in the presence of a cocktail of protease inhibitors and lmM Na-ortovanadate. Immunoprecipitations were performed at 4DC for 4h with the appropriate antibodies; high stringency washes were performed, in the presence of 1 M LiCl.
  • kinase buffer 50 mM Hepes, 100 ⁇ M DTT, 5 mM MnCl 2 , 5 mM MgCl 2
  • redivue 5 ⁇ Ci [ ⁇ - 32 P] ATP Amersham
  • Samples were then submitted to SDS-PAGE and autoradiography, or analysed using a Phosphor- Imager system (Molecular Dynamics). Alkali treatment of the polyacrilamide gels was performed with 1M KOH for two hours at 55°C.
  • Soluble forms of Semaphorin extracellular domains were expressed as chimeric molecules with placental Secreted Alkaline Phosphatase (SEAP) and harvested from the conditioned media of transiently transfected COS or BOSC-23 cells. Serum-free media were concentrated over 100 times using Centricon Plus-20 filters (Millipore) with a molecular weight cutoff of 100 kDa. The AP activity of these media was assessed as described (Flanagan, J.G. and Leder, P. (1990). The kit ligand: a cell surface molecule altered in steel mutant fibroblasts. Cell 63, 185-194); the specific activity of chimeric molecules was approx. 1000 U/mg.
  • Semaphorin-SEAP Concentrated Semaphorin-SEAP were diluted as appropriate in a Hepes buffered saline, additioned with 0.2% BSA, 0.1% NaN 3 , 5 mM CaCl 2 and 1 mM MgCl 2 (HBSBA).
  • BSA 0.2% BSA
  • NaN 3 0.1% NaN 3
  • 5 mM CaCl 2 0.1% MgCl 2
  • HBSBA 1 mM MgCl 2
  • plexin-B 1 was purified from cell extracts by immunoprecipitation with anti-VSV antibody. Extracts of mock-transfected cells were used as control samples. After washing, the immunocomplexes were incubated with serial dilutions of CD100-SEAP (prepared as above) for 2 hours at 4°C, in continuous agitation. Samples were then washed 3 times with HBSBA and the bound alkaline phosphatase activity was measured by colorimetric assay using p-nitro-phenyl- phosphate, as described (Flanagan and Leder, 1990). Scatchard analysis was done using Equilibrate (by GertJan C. Veenstra).
  • Example 4 In situ hybridization analysis RNA in situ hybridization was performed essentially as described (He, Z. and Tessier-Lavigne, M. (1997). Neuropilin is a receptor for the axonal chemorepellent Semaphorin m. Cell 90, 739-751). Briefly cDNA fragments of plexin-Al, -A2, and - A3 were used to generate S-labeled antisense and sense RNA probes, which were used for in situ hybridization histochemistry of cryostat sections of rat embryos.
  • Example 5 Xenopus turning assay
  • Mock- transfected and plexin-A3 overexpressing MDCK cells were seeded with mesenchymal cells (NIH 3T3, KJ29, D17, among others), in multiwell culture plates by 1:4 or 1:1 ratio.
  • NLH and KJ-29 cells were sometimes labeled by addition of Dil (1,1'- dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate, Fluka) in the culture medium, 4 hours before harvesting for the assay; clusters of cells marked with this dye are marked in blue (in light microscopy) and emit red epifluorecence (TRITC filter).
  • the repelling effect was observed 16-30 hours after confluency, by contrast phase microscopy using Leica DM IL.
  • the progress of the assays was also monitored by time- lapse video-microscopy (320 minutes recording were converted into 1 minute play).
  • time-lapse video-microscopy 320 minutes recording were converted into 1 minute play.
  • randomly chosen fibroblasts were followed during several hours and the duration of each contact between their lamellipodia and MDCK cells was measured. The doubling time of cells and their viability during the assay could also be analyzed, and no differences were observed in presence of control or plexin-A3 expressing cells.
  • Substrate adhesion of plexin-A3 overexpressing MDCKs was analyzed by counting attached cells after 30 minutes from seeding on micro-wells coated with fibronectin, collagen or polylysin, in the absence of calf serum: no differences versus control cells were observed.
  • Example 7 Apoptosis detection TUNEL reaction (Boehringer detection kit) was performed on mixed cultures of
  • Plexins are specific receptors for cell surface semaphorins in vertebrates
  • Plexin-Cl has been shown to bind the soluble viral semaphorins Sema VA and VB (Comeau et al., 1998 supra), and we recently found that Drosophila Plexin A (D Plex A) interacts with transmembrane Sema la (Winberg et al., 1998 supra).
  • D Plex A Drosophila Plexin A
  • Sema3A Sema 3C or Sema3F; see below
  • plexins-Al -A2, -A3, -Bl, B2, or -Cl
  • plexin-Cl (Vespr) specifically bound Sema7A(Sema- Kl) (Fig. 2a), a GPI-membrane linked semaphorin (class 7).
  • Sema7A may represent the cellular counte ⁇ art of viral semaphorin SemaVB, previously shown to interact with this plexin (Comeau et al., 1998 supra).
  • neuropihns As outlined above, secreted semaphorins of subclass 3 are known to bind neuropihns (He and Tessier-Lavigne, 1997 supra; Kolodkin et al., 1997 supra; Chen, H., Chedotal, A., He, Z., Goodman, C.S., and Tessier-Lavigne, M. (1997) "Neuropilin- 2, a novel member of the neuropilin family, is a high affinity receptor for the semaphorins Sema E and Sema IV but not Sema HI.” Neuron 19, 547-559).
  • plexin-A3 (e.g.) is expressed in a large number of neuronal classes, including sensory, sympathetic, motor, and olfactory bulb neurons ( Figure 4 and data not shown), which are known to respond to class 3 semaphorins, and which express either neuropilin-1 or neuropilin-2 or both (Chen et al., 1997 supra; Feiner, L., Koppel, A.M., Kobayashi, H., and Raper, J.A. (1997).
  • plexin-A3 is a candidate for a physiological coreceptor involved in mediating class 3 semaphorin effects on these axons.
  • Other plexins may also have a role as neuropilin coreceptors in specific cell populations, such as plexin-A2, which is expressed in a subset of sensory neurons and in dorsal horn cells, and plexin-Al, which is expressed at low levels and broadly in the spinal cord ( Figure 4).
  • plexin-A3 and plexin-Bl proteins are phosphorylated on tyrosine residues when overexpressed in human kidney cells (BOSC-23), as demonstrated using anti-phosphotyrosine antibodies (Fig. 6a). Furthermore, after immunoprecipitation and in vitro kinase assays, plexin- A3 and plexin-Bl became phosphorylated (Fig. 6b). Resistance to an alkali treatment (see Experimental procedures) confirmed the specific phosphorylation of tyrosine residues.
  • the cytoplasmic domains of several receptors become tyrosine phosphorylated owing to an intrinsic kinase activity (Ullrich, A. and
  • Stable transfectants expressing recombinant human plexin-A3 were successfully obtained in four different cell lines: LMR32 and AF8 (human neuroblasts), and BOSC- 23 and MDCK (human and canine kidney cells, respectively). We observed modest phenotypic changes in the transfected cells, which generally become flatter and larger in size. The growth rate of plexin-A3 overexpressing cells was comparable to parental lines and we did not observe differences in the ability to adhere on different substrates (data not shown).
  • Plexin a novel neuronal cell surface molecule that mediates cell adhesion via a homophilic binding mechanism in the presence of calcium ions.
  • Neuron 14, 1189-1199 we observed a modest increase in calcium-dependent homotypic cell aggregation of plexin-A3 transfectants (not shown).
  • epithelial MDCK cells overexpressing plexin-A3 mediate strong repelling cues for adjacent cells. This was observed by co-culturing mock-transfected and plexin- A3 overexpressing MDCK cells together with several non-epithelial cell lines (such as NIH3T3, Kj29, and D17; Fig. 7A). Mock MDCKs grew alongside mesenchymal cells until confluency, when both cell types stopped proliferating. In contrast, when plexin- A3-overexpressing epithelial cells were grown in the same conditions, the adjacent mesenchymal cells withdrew from them, and ultimately detached from the plate.
  • non-epithelial cell lines such as NIH3T3, Kj29, and D17; Fig. 7A
  • transmembrane semaphorins such as Sema4D
  • tyrosine residues which may themselves become phosphorylated and associate with cytoplasmic signal transducer molecules, a property shown for ligands of the ephrin family (Holland, S.J., Gale, N.W., Mbamalu, G., Yancopoulos, G.D., Henkemeyer, M., and Pawson, T. (1996) "Bidirectional signalling through the EPH- family receptor Nuk and its transmembrane ligands.” Nature 383, 722-725).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides methods and compositions related to novel plexins. The polypeptides may be produced recombinantly from transformed host cells and from the disclosed plexin encoding nucleic acids or purified from human cells. The invention provides isolated plexin hybridization probes and primers capable of specifically hybridizing with the disclosed plexin genes, plexin-specific binding agents such as specific antibodies, and methods of making and using the subject compositions in diagnosis, therapy and in biopharmaceutical industry. The invention also provides novel plexin neuropilin multimeric receptor complexes for semaphorins and methods of use thereof, including but not limited to, the treatment and diagnosis of neurological disease and neuroregeneration, immune modulation, and viral and oncological diseases.

Description

NOVEL PLEXINS AND USES THEREOF
BACKGROUND OF THE INVENTION
Field of the Invention The invention relates to the identification and characteπzation of four novel proteins that are members of the plexin family. Summary of the Related Art
Plexin family members encode large transmembrane proteins, whose cysteme- πch extracellular domains share regions of homology with the Scatter Factor receptors (encoded by the Met gene family). The extracellular domains of plexins also contain -500 amino acid Semaphoπn domains (see below). The highly conserved cytoplasmic moieties of plexins (approx. 600 ammo acids), however, have no homology with the Met tyrosine kinase domain, nor with any other known protein. Met- ke receptors and their ligands, the Scatter Factors, mediate a complex biological program including dissociation of cell-cell contacts, motility and invasion (for a review see Tamagnone, L. and Comoglio, P.M. (1997) "Control of invasive growth by hepatocyte growth factor (HGF) and related scatter factors." Cytok e Growth Factor Rev 8, 129-142). Duπng embryogenesis Scatter Factor- 1 and Met promote the dissociation of cell layers in the somites and dnve the migration of myogemc cells to their appropπate location (Bladt, F., Riethmacher, D., Isenmann, S., Aguzzi, A., and Birchmeier, C. (1995) "Essential role for the c-met receptor in the migration of myogemc precursor cells into the limb bud." Nature 376, 768-771 ; Maina, F., Casagranda, F., Audero, E., Simeone, A., Comoglio, P.M., Klem, R.a., and Ponzetto, C. (1996) "Uncoupling of grb2 from the met receptor in vivo reveals complex roles in muscle development." Cell 87, 531-542). Met and Scatter Factor- 1 are also involved in controlling neuπte outgrowth and axonal guidance (Ebens, A., Brose, K., Leonardo, E.D., Hanson, M.G.J., Bladt, F., Birchmeier, C, Barres, B.A., and Tessier-Lavigne, M. (1996) "Hepatocyte growth factor/scatter factor is an axonal chemoattractant and a neurotrophic factor for spinal motor neurons." Neuron 17, 1157-1172, Maina, F., Hilton, M.C , Ponzetto, C, Davies, A.M., and Klem, R. (1997) "Met receptor signaling is required for sensory nerve development and HGF promotes axonal growth and survival of sensory neurons " Genes Dev 11, 3341- 3350; Maina, F , Hilton, M.C, Andres, R , Wyatt, S , Klein, R., and Davies, A.M (1998) "Multiple roles for hepatocyte growth factor in sympathetic neuron development." Neuron 20, 835-846).
The first clue regarding a possible function for plexins came from the finding that a novel plexin, Vespr, interacts with the viral semaphorin A39R (Comeau, M.R., Johnson, R., DuBose, R.F., Petersen, M., Gearing, P., VandenBos, T., Park, L., Faπah, T., Buller, R.M., Cohen, J.I., Strockbine, L.D., Rauch, C, and Spriggs, M.K. (1998) "A poxvirus-encoded semaphorin induces cytokine production from monocytes and binds to a novel cellular semaphorin receptor, VESPR." Immunity. 8, 473-482). Semaphorins are a large family of secreted and membrane-bound molecules that are characterized by an extracellular domain containing a -500 amino acid Semaphorin domain (Kolodkin et al. (1993) "The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules." Cell 75, 1389-1399). As noted above, plexins contain a more divergent but nevertheless conserved Semaphorin domain.
Semaphorins were originally characterized in the nervous system, where they have been implicated in repulsive axon guidance (Kolodkin et al. (1993) supra; Luo, Y., Raible, D., and Raper, J.A. (1993) "Collapsin: a protein in brain that induces the collapse and paralysis of neuronal growth cones." Cell 75, 217-227; Tessier-Lavigne, M. and Goodman, C.S. (1996) "The molecular biology of axon guidance." Science 274, 1123-1133). More recently, semaphorins have been furthermore implicated in cardiac and skeletal development (Behar, O., Golden, J.A., Mashimo, H., Schoen, F.J., and Fishman, M.C. (1996) "Semaphorin UI is needed for normal patterning and growth of nerves, bones and heart." Nature 383, 525-528), in the immune response (Hall, K.T., Boumsell, L., Schultze, J.L., Boussiotis, V.A., Dorfman, D.M., Cardoso, A.A., Bensussan, A., Nadler, L.M., and Freeman, G.J. (1996) "Human CD100, a novel leukocyte semaphorin that promotes B-cell aggregation and differentiation."
Proc.Natl.Acad.Sci.U.S.A. 93, 11780-11785), in the regulation of angiogenesis (Miao, H.Q., Soker, S., Feiner, L., Alonso, J.L., Raper, J.A., and Klagsbrun, M. (1999) "Neuropilin-1 mediates collapsin- 1/Semaphorin UI inhibition of endothelial cell motility. Functional competition of collapsin-1 and vascular endothelial growth factor- 165" [In Process Citation]. J Cell Biol 146, 233-242), and in tumor growth and metastasis (Christensen, C.R., Klingelhofer, J., Tarabykina, S., Hulgaard, E.F., Kramerov, D., and Lukanidin, E. (1998) "Transcription of a novel mouse semaphorin gene, M-semaH, coπelates with the metastatic ability of mouse tumor cell lines." Cancer Res. 58, 1238-1244).
Previously identified plexins have been shown to be expressed in the developing nervous system, (i.e. Plexin-A is a receptor for class 1 semaphorins (Sema-la and Sema-lb). Moreover, Plexin-A has been shown via genetic analysis to control motor and CNS axon guidance induced by semaphorins (Winberg, M.L., Noordermeer, J.N., Tamagnone, L., Comoglio, P.M., Spriggs, M.K., Tessier-Lavigne, M., and Goodman, C.S. (1998). Plexin A is a neuronal semaphorin receptor that controls axon guidance. Cell 95, 903-916). Thus a need exists for discovery of other members of the plexin family of proteins.
SUMMARY OF THE INVENTION The present invention provides four novel plexin family members. In one aspect, the invention provides an isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence that encodes an amino acid sequence selected from the group consisting of the amino acid sequence shown in (SEQ ID NO: 2), (SEQ ID NO: 4), (SEQ ID NO: 6) and (SEQ ID NO: 8).
In other aspects, the invention provides isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence selected from the group consisting of the nucleotide sequence shown in (SEQ ID NO: 1), (SEQ ID NO: 3), (SEQ ID NO: 5) and (SEQ ID NO: 7).
In another aspect, the invention provides a vector comprising the nucleic acid of the above-aspects.
The invention also provides an isolated polypeptide the amino acid sequence of which comprises residues 1-18, 19-518, 451-530, 601-680, 751-830, 800-1010, or 1196-1215 of SEQ ID NO: 2; 1-23, 24-507 or 1100-1119 of SEQ ID NO: 4; or 1-42, 43-600, 541-620, 691-770, 831-910, 900-1110 or 1270-1293 of SEQ ID NO: 6; or 8-49, 154-199 or 1-199 of SEQ ID NO: 8.
In another aspect, the invention provides an isolated polypeptide having at least 80% amino acid sequence identity to an amino acid sequence selected from the group consisting of the amino acid sequence shown in (SEQ ID NO: 2), (SEQ ID NO: 4), (SEQ ID NO: 6) and (SEQ LD NO: 8) The invention also provides a chimeric molecule comprising a polypeptide of the above aspects fused to a heterologous amino acid sequence. In one embodiment the heterologous amino acid sequence is a Fc region of an immunoglobulin. In other aspects, the invention provides an antibody that specifically binds to the polypeptides of the above aspects.
The invention also provides a method of treating, suppressing or altering a disorder involving abeπant immune regulation involving a signaling pathway between a plexin and a neuropilin in a mammal comprising the step of administering an effective amount of an agent to said mammal capable of interfering with the association between the plexin and neuropilin. Contemplated agents include a chimeric molecule or an antibody of the above aspects.
DESCRIPTION OF THE DRAWINGS Figure 1.
(A) Phylogenetic tree of human plexins. Known family members cluster in two major groups: plexin A and plexin-B subfamilies. (B) Structural features of plexins, Met-like receptors and semaphorins. In the extracellular moieties, yellow boxes indicate the "sema" domains and blue boxes mark the cysteine-rich MRS motifs, some of which are stippled to indicate their atypical sequence; atypical MRS are also found in the sema domain of semaphorins. Sequence identity among sema domains ranges from 15-50%, as previously described (see Winberg et al., 1998 supra). Potential furin-like proteolytic sites are marked by red ribbons. plexin-B 1 "truncated" is the product of a splicing variant (see text). plexin-Dl and plexin-Cl (VESPR) are more distant family members, since they include atypical features in their extracellular domains. The intracellular domain of plexins (SP domain) is highly conserved through all family members, and it includes two separate regions of high homology (Maestrini, E.,
Tamagnone, T., Longati, P., Cremona, O., Gulisano, M., Bione, S., Tamanini, F., Neel, B.G., Toniolo, D., and Comoglio, P.M. (1996) "A family of transmembrane proteins with homology to the MET-hepatocyte growth factor receptor." Proc. Natl. Acad. Sci. USA 93, 674-678) (green oval and box). Met-like receptors are disulfi de-bound heterodimers and include a cytoplasmic tyrosine kinase domain (red box). Mammalian semaphorins can be either secreted or cell surface proteins. Molecular weights of representative proteins are Plexin-A 1 220 kDa, Plexin-B 1 250 kDa, Plexin-Cl 200 kDa, HGF-R/Met 145+45 kDa (heterodimer), Sem 4D 150 kDa (transmembrane), Sema7A approx 100 kDa (membrane GPI-hnked). Figure 2. (a) Cell surface semaphonns specifically bind human plexins. Micropraphs of the binding assays done testing I) the extracellular domain of semaphoπn CD 100 fused to alkaline phosphatase (CD100-AP) on COS cells transfected with plexin-Bl cDNA; n) control AP on plexin-B l ; in) CD100-AP on plexιn-B2; iv) CD100-AP on the entire extracellular domain of plexin-B l ; v) CD100-AP on isolated "plexin-B l truncated" (including sema domain, 1° and 2° MRS); vi) CD100-AP on a "plex -B l-Δsema" (including 2° and 3° MRS; vn) extracellular domain of semaphoπn A39R fused to AP, on plexin-Cl (Vespr); vin) SemaKl-AP on plexin-Cl . The final detection of the binding was done either using alkaline phosphatase substrates (i-vi) or by immunofluorescence (vn and vin). (B) Scatchard analysis and binding curve of CD100-AP to plexin-Bl (KD = 0.9 nM ± 0.15). Figure 3.
Plexins associate with neuropihns via specific extracellular domains. Western blots of lmmunoprecipitated samples from cells co-expressing neuropihns and plexins. Specific MoAbs were used, directed against the VSV-tag included in plexms or the myc-tag included in neuropιlm-2 (Np2, 130 kDa). Np2 co-immunoprecipitates with plexins, such as plexιn-A3 (220 kDa), the extracellular domain of plexmAl
(approx.160 kDa), and plexin-Bl (250 kDa) but not with the unrelated cell surface receptor DCC (170 kDa). Np2 can also associate a truncated form of the extracellular moiety of plex -Bl ("plex-B l trunc ", approx. 110 kDa), containing the sema domain Figure 4. Expression of mRNAs for plexins Al (panel A, B), -A2 (panel C, D) and A3
(panel E, F) in the spinal cord (sc), dorsal root ganglia (d) and sympathetic ganglia (sg) of E13.5 mouse embryos. Expression of the mRNAs was detected by RNA in situ hybπdization. Scale baπ l μm Figure 5. Effect of a truncated plex -Al construct (lacking the cytoplasmic domain) on repulsive and attractive responses of Xenopus spinal neurons to Sema3A and netπn-1 (A-F) A control spinal neuron exposed to a gradient of Sema3A emanating from a pipette (A) is repelled away over a peπod of 1 hr (B) In contrast, a GFP-expressmg spinal neuron from an embryo injected with mRNA for the truncated plexin-Al construct (C) is not affected by Sema3A (D). A similar neuron (E) shows a normal attractive response to netrin-1 (F).
(G) Cumulative distribution plot of turning angles for all the neurons studied. Curves show the percent of neurons with turning angles less than the angle indicated on the abscissa, under different conditions (open circles, control neurons; black and blue circles, control neurons responding to Sema3A or netrin-1, respectively; red and green circles, responses of neurons expressing the truncated plexin-Al construct to Sema3A and netrin-1, respectively. (H) Mean turning angle under all the conditions just mentioned.
Figure 6.
Tyrosine phosphorylation of plexin-A3 and plexin-Bl. (a) Anti- phosphotyrosine western blotting of immunoprecipitated p220p ex" and p250p ex~ proteins. plexin-Bl is larger since it contains an extra sequence between the second and the third MRS motif, in the extracellular domain (see Fig. 1). (b) The same immunoprecipitated samples underwent in vitro kinase assay in the presence of [γ32P]ATP , Mg++ and Mn++ ions. The SDS-PAGE was treated with alkali in conditions known to eliminate the phosphate labeling of Ser/Thr residues and specifically preserving phosphotyrosines. Figure 7
Plexin-A3 overexpression mediates cell repelling cues, (a) Epithelial kidney MDCK cells transfected to overexpress plexin-A3 (or mock transfected) were cocultured with mesenchymal KJ-29 or NIH-3T3 cells. After 16-30 hours, mixed cultures of control cells (upper panels) reached confluency and stopped growing: typically the epithelial cells formed islets (circled) surrounded by a fibroblasts lawn. In contrast, MDCKs overexpressing plexin- A3 (lower panels) overwhelmed the adjacent mesenchymal cells. The latter withdrew and selectively detached from the culture dish (dying cell clusters are indicated by arrowheads), and eventually epithelial cells only survived. To allow an easier detection of the mesenchymal cells, these were labeled with Dil before being plated in mixed cultures, (b) Plexin-A3 expressing cells do not induce apoptotic signal on repelled fibroblasts. Mixed cultures of NLH 3T3 and control or plexin-A3 overexpressing MDCKs were tested for the presence of TUNEL-AP positive cells. Apoptotic cells were not present in clusters of repelled cells (indicated by arrows) The right panel shows a positive control where apoptosis was induced on the same cells by UV treatment (c) Plexιn-A3 over-expressing cells form very transient contacts with fibroblasts Time-lapse video-microscopy of control and plexιn-A3 overexpressing MDCK cells grown in presence of fibroblasts On top, snap-shot images from the movie, taken every 50 minutes (real time) In the upper row is shown the persistent contact of a fibroblast (marked by an arrow) with an islet of control MDCK cells (marked by a star) In the lower row another fibroblast, instead, forms a transient contact with an islet of plexιn-A3 transfected cells, which also, in turn, reshapes At the bottom, the diagrams show the relative frequency of persistent, transient or very transient contacts between fibroblasts and MDCK cells DETAILED DESCRIPTION OF THE INVENTION The reference works, patents, patent applications, and scientific literature, including accession numbers to GenBank database sequences, that are referred to herein establish the knowledge of those with skill in the art and are hereby incorporated by reference in their entirety to the same extent as if each was specifically and individually indicated to be incorporated by reference Any conflict between any reference cited herein and the specific teachings of this specification shall be resolved in favor of the later Likewise, any conflict between an art-understood definition of a word or phrase and a definition of the word or phrase as specifically taught in this specification shall be resolved in favor of the latter
Four novel human plexins have been identified plexιn-B2, plexιn-B3, plexin-Dl and Plexm A-4 Plexιn-A4 is located on human chromosome 7 and is a family member of the plexin-A subfamily which also includes plexm-Al (alternatively named plexm- 1/NOV), plexιn-A2 (alternatively named plexm-2/OCT) and plexιn-A3 (alternatively named plexm-2/SEX) Plexιn-B2 and plexιn-B3 are located on human chromosome 22 and chromosome X, respectively, and are family members of the plexm-B subfamily which also includes plexin-Bl (alternatively named SEP) Plexιn-B3 maps very close to the plexιn-A3 genomic locus on Xq28 Plexm-Dl is the first identified member of the plexin-D subfamily and is atypical of any of the other subfamilies A fourth subfamily of plexins, the plexin-C subfamily, is defined by VESPR (now plexin-Cl) The four novel plexins as descπbed herein have in their extracellular domains regions of homology with two other protein families (a) Scatter Factors Receptors, encoded by the MET oncogene family (Tamagnone and Comoglio, 1997 supra), and (b) Semaphorins (Kolodkin et al. (1993) supra (Figure lb). In particular, plexins and Met- like receptors contain short cysteine-rich motifs, termed "Met Related Sequences" (MRS), whose minimal consensus is: C-X(5-6)-C-X(2)-C-X(6-8)-C-X(2)-C-X(3-5)-C (Maestrini et al., 1996 supra); Tamagnone and Comoglio, 1997 supra); blue boxes in Fig. IB). The proteins of the Met family contain a single MRS (in their receptor β chains), whereas in plexin family members there are two/three repeated MRS motifs. Furthermore, all plexin family members contain in their extracellular moiety a 500 amino acid region similar to the sema domain of semaphorins (Kolodkin et al. (1993) supra; Winberg et al., 1998 supra); yellow boxes in Fig. IB. The MRS motif is proposed to function as protein-protein interaction domain.
The cytoplasmic domain of plexins contains a -600 amino acid domain which we term the SP domain ("Sex and Plexins", marked in green in Fig. IB) that is highly conserved within the family (57-97% similarity) and in evolution (over 50% similarity between invertebrates and humans). The SP domain does not share homology with any known protein. It includes a number of potential tyrosine phosphorylation sites, but lacks the typical motifs of catalytic tyrosine kinases. Interestingly, the predicted secondary structure of the SP domain includes long conserved alpha helices, typically found in protein-protein interaction modules. Furthermore, there are several dihydrophobic amino acid motifs (such as LL or LI), known to mediate the intemalization and downregulation of transmembrane receptors (Sandoval, IN. and Bakke O. (1994). Targeting of membrane proteins to endosomes and lysosomes. Trends in Cell Biology 4, 292-297).
The present invention also demonstrates that plexins can form complexes with neuropihns, which in turn demonstrates that a receptor for semaphorins can be hetero- oligomers of plexins and neuropihns. As demonstrated by in situ mRΝA expression analysis, plexins and neuropihns are in fact simultaneously expressed in several neuronal populations during embryonic development. The plexin-neuropilin complex predates ligand binding, since the association is not influenced by the presence of class 3 semaphorins. That the observed plexin-neuropilin complexes are formed in cis is furthermore supported by the experimental conditions used (cotransfection of isolated cells with the two constructs). An interaction in trans might also be envisioned (considering that plexins and semaphorins share similar sema domains), however by analyzing mixed cultures of cells separately transfected with plexins and neuropihns we did not isolate associated complexes (data not shown).
We observed that the main semaphorin binding domain of neuropihns (CUB domain (Giger, R.J., Urquhart, E.R., Gillespie, S.K., Levengood, D.V., Ginty, D.D., and Kolodkin, A.L. (1998) "Neuropilin-2 is a receptor for semaphorin IV: insight into the structural basis of receptor function and specificity." Neuron 21, 1079-1092; Nakamura, F., Tanaka, M., Takahashi, T., Kalb, R.G., and Strittmatter, S.M. (1998) "Neuropilin- 1 extracellular domains mediate semaphorin D/LU-induced growth cone collapse" [In Process Citation]. Neuron 21, 1093-1100; Chen et al. 1998 supra) is not required for the interaction with plexins, as indicated by the association of the relevant Neuropilin-2 deletion construct with plexin-Bl (not shown). A ternary complex, where neuropihns use two distinct protein modules to form a bridge between the sema domain of semaphorins and the sema domain of plexins is thus contemplated. It is further contemplated that plexins are the functional partners of neuropihns, required for transducing signals mediated by semaphorins, preferably class 3 semaphorins. For example, in flies, which lack both neuropihns and class 3 semaphorins, D Plex A appears sufficient as a functional receptor for Sema la, a transmembrane class 1 semaphorin (Winberg et al., 1998 supra). Further support that plexins are functional co- receptors for secreted semaphorins is demonstrated in an experiment that shows that a truncated plexin-Al construct expressed in Xenopus spinal neurons abolishes repulsive responses to Sema3A without markedly affecting attractive responses to netrin-1. These results are consistent with the involvement of plexins.
The intracellular signals transduced by plexins are still largely obscure. The cytoplasmic domain of plexins is large and highly conserved within and across species and contains stretches of alpha helices, which are putative protein-protein interaction domains, and could thus mediate the association with cytosolic partners. We demonstrate herein that the cytoplasmic domain of plexins can be tyrosine phosphorylated, suggesting that, like other receptors devoid of intrinsic catalytic activity, plexins may signal by associating a tyrosine kinase (Stahl, N. and Yancopoulos, G.D. (1993). The alphas, betas, and kinases of cytokine receptor complexes. Cell 74, 587-590; Glass, D.J., Bowen, D.C., Stitt, T.N., Radziejewski, C, Bruno, J., Ryan, T.E., Gies, D.R., Shah, S., Mattsson, K., Burden, S.J., DiStefano, P.S., Valenzuela, D.M., DeChiara, T.M., and Yancopoulos, G.D. (1996). Agπn acts via a MuSK receptor complex. Cell 85, 513-523) .
In addition, we show herein that expression of plexins, particularly plexιn-A3, mediates cell-repelhng cues. By time-lapse video-microscopy we observed a true repelling effect on fibroblasts. Intπgumgly, we observed that -upon interaction with fibroblasts- also the islets of plexιn-A3 MDCKs at times reshaped. This may be explained by the existence of intra-epithelial repelling cues, balanced by the attractive forces exerted by epithelial cell junctions.
Moreover we have demonstrated that in the nervous system (i.e. Drosophila), that defasciculatmg motor axons co-express both Plexin A and one of its interacting partners, the transmembrane semaphoπn Sema-la (Winberg et al., 1998 supra). This demonstrates that plexins act in vivo either as receptors or ligands for cell surface semaphonns, which in turn can transduce intracellular signals, as reported for ephπns (Holland et al., 1996 supra). Semaphonns, therefore, besides being pivotal in axon guidance, have a general role in moφhogenesis and tissue remodeling by mediating cell-repelhng cues via their interactions with plexins.
Accordingly, in a first aspect, the invention provides an isolated nucleic acid molecule encoding a novel human plexin polypeptide. By "plexin polypeptide" is meant a member of the plexin family compnsmg an amino acid sequence that shares at least 60% ammo acid sequence homology with SEQ ID NOS: 2 (plexin B-2), 4 (plexin B-3), 6 (plexm D-l) or 8 (plexm A-4), preferably, at least 65% sequence homology, more preferably, at least 70% sequence homology, more preferably, at least at least 75% sequence homology, more preferably, at least 80% sequence homology, still more preferably at least 85% sequence homology, even more preferably, at least 90% sequence homology, and most preferably at least 95% sequence homology with SEQ ID NOS: 2, 4, 6 or 8. Plexin polypeptides of the invention are useful for modulating cell growth (i.e nerve) and immune regulation.
As used herein, by "modulating" is meant increasing or decreasing cell growth By "cell growth" is meant any change in cell number or size, including, without limitation, increase or decrease in cell number, increase or decrease in rate of cell division, increase or decrease in rate of cell death, and/or increase or decrease in cell size. Standard methods for measuπng cell growth include standard apoptosis assays (e.g., TUNEL assays, DNA fragmentation, trypan blue exclusion) and cell proliferation assays (e.g., H-thymidine incorporation). It will be appreciated that the degree of modulation of cell growth provided by a plexin polypeptide in a given assay will vary, but one of skill in the art can readily determine the statistically significant change in cell growth of a cell exposed to a plexin polypeptide. By "immune regulation" is meant increasing or decreasing the biological functions of immune cells (i.e., cells involved in an immune response). Immune cells include, without limitation, lymphocytes (T and B), NK cells, dendritic cells, myeloid cells (e.g., macrophages and neutrophils), and other hematopoietic cells involved in an immune response. By "nucleic acid molecule" or "nucleic acid" as used herein, is meant any deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), including, without limitation, complementary DNA (cDNA), genomic DNA, RNA, heteronuclear RNA (hnRNA), messenger RNA (mRNA), DNA/RNA hybrids, or synthetic nucleic acids (e.g., an oligonucleotide) comprising ribonucleic and/or deoxyribonucleic acids or synthetic variants thereof. The nucleic acid of the invention includes, without limitation, an oligonucleotide or a polynucleotide. The nucleic acid can be single stranded, or partially or completely double stranded (duplex). Duplex nucleic acids can be homoduplex or heteroduplex.
By "polypeptide" is meant any molecule comprising two or more amino acids joined together with a peptide bone, regardless of length or post-translational modifications (e.g., without limitation, glycosylation, lipidation, acetylation, or phosphorylation). Useful plexin polypeptides of the invention include, without limitation, the full length plexin polypeptides having the amino acid sequence of SEQ ID NOS: 2, 4 , 6, 8 or 10,; an extracellular domain of the polypeptide having the amino acid sequence 1 to 1199 of SEQ ID NO: 2; 1 to 1099 of SEQ ID NO: 4; 1 to 1270 of SEQ ID NO: 6 or 1 to 199 of SEQ ID NO: 8, with its associated signal peptide; or an extracellular domain of the polypeptide having the amino acid sequence 19 to 1199 of SEQ ID NO: 2; 24 to 1099 of SEQ ID NO: 4; or 43 to 1270 of SEQ ID NO: 6, lacking its associated signal peptide; an intracellular domain of the polypeptide having the amino acid sequence of SEQ ID NOS: 2, 4, 6 or 8; and polypeptides, the amino acid sequence of which comprises about residues 1-18 (putative signal sequence), 19- 518 (sema domain), 451-530 (1° MRS), 601-680 (2° MRS), 751-830 (3° MRS), 800- 1010 (G-P repeats) or 1196-1215 (putative transmembrane domain) of SEQ ID NO 2; about residues 1-23 (putative signal sequence), 24-507 518 (sema domain) or 1100-1119 (putative transmembrane domain) of SEQ ID NO- 4, or about residues 1-42 (putative signal sequence), 43-600 (sema domain), 541-620 (1° MRS), 691-770 (2° MRS), 831-910 (3° MRS), 900-1110 (G-P repeats) or 1270- 1293 (putative transmembrane domain) of SEQ ID NO 6; or about residue 8-49 (1° MRS) or 154-199 (2° MRS) of SEQ ID NO: 8
By "isolated" is meant a compound (e g , a nucleic acid molecule or a protein) that has been separated from components (e g , nucleic acid molecules, proteins, hpids, and/or carbohydrates) which naturally accompany it Water, buffers, and other small molecules (e g , molecules having a molecular weight of less than about 1000 daltons) may accompany an isolated compound of the invention Preferably, an isolated compound is at least 70%, by weight, free from components which naturally accompany it More preferably, an isolated is at least 75%, by weight, free from components which naturally accompany it, still more preferably, at least 80%, by weight, free, even more preferably, at least 85%, by weight, free, and even more preferably, at least 90%, by weight, free from components which naturally accompany it Most preferably, a substantially puπfied compound is at least 95%, by weight, free from components which naturally accompany it
Where the isolated compound is a nucleic acid molecule, the isolated nucleic acid molecule is separated from other nucleic acids (e g , genes or transcπpts) or proteins which, in the naturally-occurπng genome of the organism from which the nucleic acid molecule was deπved, flanked the nucleic acid molecule Isolated nucleic acid molecules therefore include, without limitation, a recombinant nucleic acid molecule mcoφorated into a plasmid or other vector (e g , a replication-defective virus), a recombinant nucleic acid molecule incoφorated into the genome of a prokaryotic or eukaryotic organism, or a nucleic acid molecule which exists as a separate molecule independent of other nucleic acids (e g , a PCR product, a chemically synthesized nucleic acid molecule, or a nucleic acid molecule produced by restπction endonuclease digestion) Puπfication of a nucleic acid molecule can be accomplished and measured by any standard method including, without limitation, sequence analysis, chemical synthesis, PCR, CsCl gradient, phenol chloroform extraction, ethanol precipitation, Southern or Northern blotting analysis followed by band extraction and puπfication, and high performance liquid chromatography (HPLC; see, e.g., Fisher (1980) Laboratory Techniques in Biochemistry and Molecular Biology, Work and Burdon (eds.), Elsevier).
Thus, in one non-limiting example, to obtain an isolated nucleic acid molecule encoding a plexin polypeptide, a nucleic acid molecule is chemically synthesized on a standard oligonucleotide synthesis machine. The resulting single stranded molecule is then subjected to second strand synthesis to form a duplex DNA molecule, which is then ligated into a plasmid capable of replication in a prokaryotic or eukaryotic cell. The nucleic acid molecule is then replicated in the cell, purified (e.g., by CsCl gradient), and subjected to sequence analysis. In certain embodiments of the first aspect of the invention, the nucleic acid molecule has a nucleic acid sequence comprising SEQ ID NOS: 1, 3, 5, 7 or 9. Preferably, the nucleic acid molecule of the invention has not more than 500 nucleotides flanking each of the 5' and 3' ends of SEQ ID NOS: 1, 3, 5, 7 or 7. In certain embodiments, the plexin polypeptide has an amino acid sequence that comprises SEQ ID NOS: 2, 4, 6, 8 or 10. Preferably, the plexin polypeptide of the invention has not more than 50 amino acid residues flanking each of the N-terminal and C-terminal ends of SEQ ID NOS: 2, 4, 6, 8 or 10.
In certain embodiments of the first aspect of the invention, the nucleic acid molecule hybridizes under stringent conditions (as defined herein) to SEQ ID NOS: 1, 3, 5, 7 or 9.
The invention also includes nucleic acid molecules that hybridize under stringent hybridization conditions (as defined herein) to all or a portion of the nucleotide sequence represented by SEQ ID NOS: 1, 3, 5, 7 or 9 or its complement. The hybridizing portion of the hybridizing nucleic is at least 80%, e.g., at least 95%, or at least 98%, homologous to the sequence of a portion or all of a nucleic acid encoding a polypeptide having the amino acid sequence of SEQ ID NOS: 2, 4, 6, 8 or 10, or its complement. Hybridizing nucleic acids of the type described herein can be used, for example , as a cloning probe, a primer (e.g., a PCR primer) or a diagnostic probe.
Hybridization of the oligonucleotide probe to a nucleic acid sample typically is performed under stringent conditions. Nucleic acid duplex or hybrid stability is expressed as the melting temperature or Tm, which is the temperature at which a probe dissociates from a target DNA. This melting temperature is used to define the required stringency conditions. If sequences are to be identified that are related and substantially identical, rather than identical, then it is useful to first establish the lowest temperature at which only homologous hybridization occurs with a particular concentration of salt (e.g., SSC or SSPE). Then, assuming that 1% mismatch results in a 1°C decrease in the Tm, the temperature of the final wash in the hybridization reaction is reduced accordingly (for example, if the sequences have > 95% identity with the probe are sought, the final wash temperature is decreased 5°C). In practice, the change in the Tm can be between 0.5 C and 1.5 C per 1% mismatch. "Stringent conditions" involve hybridization at 68°C in 5x SSC/5x Denhardt's solution/1.0% SDS, and washing in 0.2xSSC/0.1% SDS at room temperature. "Moderately stringent conditions" include washing in 3xSSC at 42°C. The parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid. Additional guidance regarding such conditions is readily available in the art, for example, by Sambrook et al, supra; and Ausubel et al, supra.
Nucleic acid sequence homology (as well as amino acid sequence homology) can be measured according to standard methods. Unless otherwise specified, as used herein used herein, "percent homology" of two amino acid sequences or of two nucleic acids is determined using the algorithm of Karlin and Altshul (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990), modified as in Karlin and Altschul (Proc. Natl. Acad. Sci. USA 90: 5873-5877, 1993). Such an algorithm is incoφorated into the NBLAST and XBLAST programs of Altschul et al. (J. Mol. Biol. 215: 403-410, 1990). BLAST nucleotide searches are performed with the NBLAST program, e (score) = 100, word length = 12, to obtain nucleotide sequences homologous to a nucleic acid molecule of the invention. BLAST protein searches are performed with the XBLAST program, e (score) = 50, word length = 3, to obtain amino acid sequences homologous to a reference polypeptide (e.g., SEQ ID NO: 2). To obtain gapped alignments for comparison puφoses, Gapped BLAST is utilized as described in Altschul et al. (Nucleic Acids Res. 25: 3389-3402, 1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) are used, namely e=10; w=l 1 for nucleic acid; w=3 for amino acid (the Blosum 62 scoring matrix); low complexity sequence filtering. The default settings of BLAST emphasize regions of local alignment to detect relationships among sequences which share only isolated regions of similarity (Altschul et al., J. Mol. Biol. 215: 403-410 (1990). See http://www.ncbi.nlm.nih.gov. Thus, in a non-limiting example to obtain an isolated nucleic acid molecule encoding a plexin polypeptide, a nucleic acid molecule having the sequence of SEQ ID NOS: 1, 3, 5 or 7 is used to probe a cDNA library under stringent conditions according to standard techniques (see., e.g., Ausubel et al, supra). Upon identification of a positive clone (i.e., a clone that hybridizes to SEQ ID NOS: 1, 3, 5 or 7 under stringent conditions), that clone is expanded and subjected to sequence analysis. A nucleic acid molecule having a nucleic acid sequence that is at least 70% identical, preferably at least 75% identical, more preferably, at least 80% identical, still more preferably at least 85% identical, even more preferably, at least 90% identical, and most preferably at least 95% identical (as measured by the basic BLAST program of NCBI on default settings) to SEQ ID NOS: 1, 3, 5 or 7 is a nucleic acid molecule of the invention.
In a second aspect, the invention provides four novel isolated plexin polypeptides. "Isolated" is as defined for the first aspect of the invention. Where the isolated compound is a polypeptide, the isolated polypeptide is separated from organic molecules, such as nucleic acid molecules, polypeptides, and/or carbohydrates, which, in the naturally-occurring organism from which the polypeptide was derived, accompany the polypeptide. Isolated polypeptides therefore also include a recombinant polypeptide (e.g., a human polypeptide expressed in an insect cell), or a chemically synthesized polypeptide. Purification of a polypeptide can be accomplished and measured by any standard method including, without limitation, chemical synthesis, recombinant polypeptide expression in prokaryotic or eukaryotic cells, affinity chromatography, Western blotting analysis, SDS-PAGE analysis, and/or HPLC.
In accordance with this aspect, the invention provides all derivatives, mutants, truncations, and/or splice variants of the four novel plexin polypeptides, so long as these derivatives, mutants, truncations, and/or splice variants share at least 60% amino acid sequence homology with SEQ ID NOS: 2 ,4 ,6 or 8, preferably, at least 65% sequence homology, more preferably, at least 70% sequence homology, more preferably, at least at least 75% sequence homology, more preferably, at least 80% sequence homology, still more preferably at least 85% sequence homology, even more preferably, at least 90% sequence homology, and most preferably at least 95% sequence homology with SEQ ID NOS: 2 ,4 ,6 or 8 as determined using the basic BLAST program of the National Center for Biotechnology (NCBI; National Library of Medicine, Bethesda, MD), using the default settings defined therein using the sequence of the four novel plexin derivative, mutant, truncation and/or splice variance as the probe.
Preferred plexin polypeptide derivatives include polypeptides whose sequences differ from the sequence given in SEQ ID NOS: 2 ,4 ,6 or 8, by one or more conservative amino acid substitutions, or by one or more non-conservative amino acid substitutions, deletions or insertions which do not abolish the biological activity of the plexins. Conservative amino acid substitutions typically include the substitution of one amino acid for another with similar biochemical characteristics, such as polarity, size, and/or charge. Non-limiting examples of conservative substitutions are substitutions within the following groups: valine, glycine, glycine, alanine, valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine, phenylalanine, and tyrosine.
Useful methods for mutagenesis to generate plexin mutants are known in the art (see, e.g., Sambrook et al, supra; Ausubel et al., supra). Preferred methods for mutagenesis are described in PCT Publication WO99/12965 and include PCR mutagenesis and saturation mutagenesis. A library of random amino acid sequence variants can also be generated by the synthesis of a set of degenerate oligonucleotide sequences.
In certain embodiments of the second aspect of the invention, the plexin polypeptide has a sequence comprising the sequence of SEQ ID NOS: 2 ,4 ,6 or 8. In one non-limiting example, in accordance with the invention, an isolated plexin polypeptide comprising the sequence of SEQ ID NOS: 2 ,4 ,6 or 8 can chemically synthesized according to standard techniques (e.g., at a commercial peptide generating facility). For example, a putative plexin polypeptide is purified and subjected to N- terminal sequencing to determine its amino acid sequence. The amino acid sequence of the polypeptide is then compared to SEQ ID NOS: 2 ,4 ,6, 8 or 10 (as measured by the basic BLAST program of NCBI on default settings). A polypeptide that shares at least 60% homology with SEQ ID NOS: 2 ,4 ,6, 8 or 10 is a plexin polypeptide of the invention.
In another example, purification of a plexin polypeptide is facilitated by the addition of a tag to the polypeptide that enables purification of the tagged polypeptide. Non-limiting examples of a tag include a hemagglutinin (HA) tag, a his tag, a GST tag, a FLAG-tag, and a myc tag. Thus, a nucleic acid molecule of the first aspect is engineered using standard molecular biology techniques to incoφorate the nucleic acid sequence encoding the tag. The engineered nucleic acid molecule is then introduced and positioned for expression in an appropriate cell to produce the recombinant tagged polypeptide, which can then be readily purified by binding of the tag to its substrate. For example, the his tag binds to Ni-NTA agarose. Likewise, a GST (glutathione S- transferase) tag binds to glutathione agarose beads. Both his tag and GST tag expression and purification kits are commercially available from PharMingen (San Diego, CA). Likewise, myc-tagged plexin polypeptide are produced by cells introduced with a nucleic acid molecule encoding the tagged protein and positioned for expression in the cell. It will be appreciated that particularly useful polypeptides of this aspect of the invention are secreted by the cell in which they are produced, thus facilitating purification of the polypeptide from the culture media in which the cells have been maintained, without requiring lysis of the cell. In a third aspect, the invention provides a cell engineered to comprise a nucleic acid molecule encoding one of the four plexin polypeptides. By "engineered" is meant that the cell of the invention has been modified by standard molecular biology techniques. Where the cell is "engineered to comprise a nucleic acid molecule," standard molecular biology techniques have been employed to introduce the indicated nucleic acid molecule into the cell, either by transformation or transfection of the cell with a plasmid, or by infection or transduction of the cell with a recombinant virus.
The nucleic acid molecule of the first aspect of the invention is preferably subcloned into a plasmid or vector (for example, but not limited to, a vector used to generate a recombinant virus), wherein the nucleic acid molecule is positioned for expression in the plasmid or vector. The plasmid or vector is then introduced into a cell by standard techniques to produce an engineered cell in accordance with the third aspect of the invention.
In certain embodiments of the third aspect, the cell is a prokaryotic cell (e.g., a bacterium). For example, E. coli cells (e.g., DH5α) are transformed (using, e.g., electroporation) with a bacterial plasmid (i.e., a plasmid containing an E. coli origin of replication) containing a nucleic acid molecule of the first aspect of the invention. The transformed bacteria are selected using, for example, an antibiotic-resistance encoding nucleic acid molecule (e.g., ampicillin resistance) on the plasmid such that the antibiotic resistance protein is expressed by the transformed bacteria. The transformed bacteria are then propagated, and can be cryopreserved and stored frozen in glycerol.
Those of skill in the art will appreciate that in accordance with the third aspect of the invention, a nucleic acid molecule encoding one of the four plexin polypeptides may be introduced into a large variety of cells. For example, a nucleic acid molecule encoding one of the four plexin polypeptides can be introduced into prokayotic cells (e.g., bacteria), and any eukaryotic cell into which an exogenous nucleic acid molecule may be introduced. Thus, in certain embodiments of the third aspect of the invention, the cell is a eukaryotic cell. Eukaryotic cells according to this aspect of the invention that comprise a nucleic acid molecule encoding one of the four plexin polypeptides include, without limitation, yeast cells, plant cells, insect cells, and mammalian cells. Within the category of mammalian cells are cells from any mammalian species (including, without limitation, mouse, hamster, monkey, human), of any lineage (including, without limitation, lymphocyte, fibroblast, stem cell), and may be an immortalized cell, or a non- immortalized cell. Cells, as well as plasmids and/or vectors (e.g., vectors that can be packaged to form infectious virus particles), are commercially available, for example, from the American Type Culture Collection ("ATCC"; Manassas, VA).
In certain embodiments of the third aspect of the invention, the nucleic acid molecule is positioned for expression in the cell. By "positioned for expression" is meant that the nucleic acid molecule is operably linked to at least one regulatory sequence which directs the transcription and translation of the nucleic acid molecule in a cell, such that the cell engineered to comprise the nucleic acid molecule produces (i.e., expresses) the protein encoded by the nucleic acid molecule. By "operably linked" is meant that the nucleic acid molecule and the regulatory sequence are connected in a such a way as to permit expression of the nucleic acid molecule when the nucleic acid molecule is present in a cell. Regulatory sequences include, without limitation, promoters, enhancers, IRES sequences, and polyadenylation signals. Since plexin polypeptides are involved in immune regulation and the modulation of cell growth, it may be desirable to operably link a nucleic acid molecule encoding one of the four plexin polypeptides to an inducible promoter.
The four plexin polypeptides that are encoded by the nucleic acid molecules do not necessarily include the transmembrane domain of the four plexin polypeptides, and so may be produced by the cell as an intracellular polypeptide or a soluble secreted polypeptide. For example, if the polypeptide fragment is secreted by the cell, it can be puπfied from the conditioned growth media of the transfected cells, without having to lyse the cells. Likewise, although a soluble intracellular polypeptide fragment is puπfied from only lysed cells, the fragment, being soluble, does not have to be extracted from the cell membrane; thus, different lysis conditions may be used to obtain puπfied soluble intracellular polypeptide fragment as compared to the lysis conditions required to obtain puπfied full length plexin polypeptides (which has a transmembrane domain).
Protein expression systems have been established for a vaπety of cells and are known to those of skill in the art. Cells are also commercially available from the ATCC, and a vaπety of protein expression system kits are commercially available from, for example, Invitrogen Coφ. (Carlsbad, CA), Clontech Laboratoπes (Palo Alto, CA), PharMmgen (San Diego, CA), Promega Coφ. (Madison, WI), and Stratagene (La Jolla, CA).
For example, a nucleic acid molecule encoding one of the four plexin polypeptides is operably linked to bacteπal regulatory sequences (e.g., T7 late promoter or bacteπophage regulatory sequences), and the resulting nucleic acid molecule is used to transform bacteπal cells, where the transformed bacteπal cells produce one of the four plexm polypeptides. In another example, a nucleic acid molecule encoding one of the four plexin polypeptides is operably linked to baculovirus regulatory sequences in a baculovirus vector. Recombinant baculovirus are then generated and used to transduce insect cells (using, for example, the expression kit commercially available from Clontech Laboratoπes. The transduced insect cells compπse a nucleic acid molecule encoding one of the four plexin polypeptides positioned for expression in the insect cell, and thus produce one of the four plexin polypeptides. Mammalian cells are widely used as protein expression systems. For example, a mammalian cell may be transduced with a recombinant retrovirus or adenovirus compnsmg a nucleic acid molecule encoding one of the four plexin polypeptides operably linked to regulatory sequences that are either endogenous to the particular virus or exogenous to the virus (e.g., a CMV promoter in a retroviral vector). The transduced mammalian cell is then propagated in vitro in tissue culture, in vivo (e.g., in an immunocompromised animal), and/or cryopreserved and stored frozen in DMSO.
In another example, mammalian cells are transfected with an expression plasmid compnsmg a nucleic acid molecule encoding one of the four plexin polypeptides operably linked to one or more regulatory sequences on the plasmid. By "expression plasmid" is meant a plasmid in which an inserted nucleic acid molecule of interest (e.g., encoding one of the four plexin polypeptides, a plexin chimeric molecule, or tagged plexin polypeptide) is operably linked to at least one regulatory sequence such that when the expression plasmid containing the inserted nucleic acid molecule of interest is introduced (e.g., by transfection) into a cell, the inserted nucleic acid molecule is positioned for expression in that cell. The nucleic acid molecule in the expression plasmid, upon being introduced into the cell, is thus positioned for expression in that cell, and enables the cell to produce one of the four plexin polypeptides encoded by the nucleic acid molecule.
In one non-limiting example, a nucleic acid molecule according to the first aspect of the invention is inserted into a standard mammalian expression plasmid (e.g., pcDNA3.1 commercially available from Invitrogen Coφ., Carlsbad, California), such that the inserted nucleic acid molecule encoding one of the four plexin polypeptides is operably linked to the regulatory sequences in the mammalian expression plasmid.
Mammalian cells are then transfected with this expression plasmid (using, e.g., CaPO or DEAE-dextran). Where the expression plasmid contains an antibiotic-resistance encoding nucleic acid molecule (e.g., neomycin resistance on the pCDNA3.1 plasmid) such that the antibiotic resistance protein is expressed by the transfected cells, transfected cells may be selected for the ability to grow in the presence of the antibiotic. The transfected cells may then be propagated and cryopreserved and stored in frozen in DMSO.
In a fourth aspect, the invention provides an isolated nucleic acid molecule encoding a chimeric molecule comprising at least two segments, wherein one of the segments comprises one of the four plexin polypeptides. By "chimeric molecule" is meant a protein that comprises at least two segments of polypeptide joined together by any means, including, without limitation, a covalent bond (e.g., peptide bond), a non- covalent bond (e.g., ionic bond or hydrogen bond) or by a chemical crosslinker. It should be noted that one of the four plexin polypeptides that has been tagged is within the definition of a chimeric molecule.
In certain embodiments of the fourth aspect of the invention, the nucleic acid molecule encoding the segment of a chimeric molecule comprising one of the four plexin polypeptides hybridizes under stringent conditions to SEQ ID NO: 1, 3, 5 or 7. "Stringent conditions" are as described above for the first aspect of the invention.
Standard molecular biology techniques may be employed to generate nucleic acid molecules encoding chimeric molecules according to the fourth aspect of the invention. For example, a nucleic acid molecule encoding the extracellular domain of one of the four plexin polypeptides may be joined, in frame, to a nucleic acid molecule encoding the constant region of an immunoglobulin molecule (see, e.g., Chamow S.M., Antibody Fusion Proteins, John Wiley & Sons, New York, 1999). By "in frame" is meant that a first nucleic acid molecule is ligated to a second nucleic acid molecule such that the each of the amino acid sequences of the polypeptides encoded by each of the first and the second nucleic acid molecules is not frame-shifted.
In one non-limiting example, a chimeric molecule comprising the extracellular domain of one of the four plexin polypeptides including the amino acid sequence of SEQ ID NOS: 2, 4, 6 or 8 is generated. In this example, a nucleic acid molecule encodes amino acid residue number 1(19) through about amino acid residue number 1199 of SEQ ID NO: 2; amino acid residue number 1(24) through about amino acid residue number 1099 of SEQ ID NO: 4; amino acid residue number 1(43) through about amino acid residue number 1270 of SEQ ID NO: 6 and amino acid residue number 1 through about amino acid residue number 199 of SEQ ID NO: 8 with its associated signal peptide (parenthesis depicts about the beginning of the amino acid sequence of the extracellular domain lacking its signal peptide). This nucleic acid molecule is fused in frame with a nucleic acid molecule encoding the constant region of an immunoglobulin, such that the chimeric molecule encoded by the resulting nucleic acid molecule generally has the following structure:
Figure imgf000022_0001
peptide
The heavy chain class (e.g., IgG, IgA, IgM, IgD, or IgE) can be varied in this chimeric molecule depending upon which constant region is used. Nucleic acid molecules encoding the constant region of various immunoglobulin (Ig) heavy chains are known (see, e.g., Zettlmeissl et al., DNA Cell Biol. 9(5):347-53, 1990) Indeed, expression plasmids are available, into which the nucleic acid molecule of interest (i.e., a nucleic acid molecule encoding an extracellular domain of the polypeptide of SEQ ID NO: 2; SEQ LO NO: 4; SEQ ID NO: 6; or SEQ ID NO: 8) can be inserted, and the resulting plasmid introduced into a cell to produce one of the four extracellular plexin-Ig chimeric molecule s (see, e.g., Zettlmeissl et al., supra; Miller et al., J. Exp. Med. 178 (1): 211- 222, 1993).
Any variety of chimeric molecule carrying the extracellular domains of one of the four plexin polypeptide may be generated. For example, the extracellular domain of one of the four plexin polypeptides can be myc-tagged, his-tagged, or FLAG tagged according to standard molecular biology techniques.
Such extracellular proteins are particularly useful for identifying ligands to which the extracellular domain of one of the four plexin polypeptides bind. For example, extracellular plexin-Dl-Ig chimera can be immobilized on a protein A-sepharose column. Molecules suspected of binding the extracellular domain of plexin-Dl are added to the column, to which the molecule that binds to the extracellular domain of plexin-Dl adhere, and the non-binding molecules flow through the column. The extracellular plexin-Dl -binding molecules are readily eluted, for example, by changing the pH or ion concentration of the elution buffer.
Extracellular plexin proteins are also used to identify cells expressing the ligand of plexin extracellular domain on their cell surface (and thereby also identify the ligand itself). For example, cells are incubated with a FLAG-tagged plexin extracellular domain chimeric molecule. A FLAG-tagged plexin extracellular domain chimeric molecule is generated. An anti-FLAG antibody that is detectably labeled is then added to the cells. By "detectably labeled" is meant any means for marking and identifying the presence of a molecule. Detectable labels include, without limitation, radioactive labels (e.g., 32P or 35S) and fluorophore labels (e.g., FITC, phycoerythrin, or rhodamine). For example, FTTC-labeled anti-FLAG antibodies are commercially available from Babco, Richmond, CA The "stained" cells (i.e., cells incubated first with the FLAG-tagged plexin extracellular domain chimeπc molecule and then with the FITC-labeled anti-FLAG antibody), are then subjected to flow cytometry analysis to select those cells that are labeled with FITC, and so express a molecule that binds to the extracellular domain of one of the four plexin polypeptides The FITC labeled cells are then further manipulated (e g., characterized to determine which cells express the plexin polypeptide ligand)
The ligand of the plexin extracellular domain is itself identified, for example, by lysmg the cells, adding the lysate to one of the four plexin extracellular domam-Ig chimeπc molecule columns descπbed above, and puπfying the ligand The ligand is then sequenced by N-terminal sequencing.
In another non-limiting example, the intracellular domain of one of the four plexin polypeptides is used as "bait" in a yeast two-hybπd system to identify ligands that interact with the intracellular domain of one of the four plexins descπbed herein. For general descπption of the two-hybπd system, see U.S. Patent Nos. 5,283,173; 5,468,614; and 5,695,941 In this example, a nucleic acid molecule encoding from about amino acid residue number 143 through at least amino acid residue number 214 of SEQ ID NO 2 is inserted into a standard DNA binding domain expression plasmid (e.g., the GAL4 DNA binding domain plasmid in the Interactor kit commercially available from PharMingen (San Diego, CA). (It will be understood that the nucleic molecule may encode amino acid residue number 138-148 through at least amino acid residue number 214 of SEQ ID NO: 2.) A vaπety of cDNA hbraπes in transcπptional activation domain vectors are available (e.g., from Clontech, Palo Alto CA). The cDNA hbraπes are screened employing standard methods (see, e.g., the methods employed in U.S. Patent No. 5,780,262) to identify cDNA clones encoding a ligand that binds to the intracellular domain of one of the four plexin polypeptides. One preferable cDNA library screened in this example is a cDNA library generated from an immune cell (e.g., a lymphocyte or NK cell).
In a fifth aspect, the invention provides a puπfied chimeπc molecule compnsmg one of the four plexm polypeptides. Methods for puπfying proteins are as descπbed for the second aspect of the invention
In a sixth aspect, the invention provides a cell engineered to compπse a nucleic acid molecule encoding a chimeπc molecule compnsmg at least two segments, wherein one of the segments compπses one of the four plexin polypeptides. As descπbed for the third aspect of the invention, a nucleic acid encoding a chimeric molecule comprising one of the four plexin polypeptides may be introduced into any variety of cells. In certain embodiments, the cell is a prokaryotic cell or a eukaryotic cell. In certain embodiments, the eukaryotic cell is a yeast cell or a mammalian cell (e.g., a human cell). In a seventh aspect, the invention provides an isolated binding agent that specifically binds one of the four plexin polypeptides, or specifically binds a chimeric molecule comprising a segment comprising one of the four plexin polypeptides. In certain embodiments, the plexin protein has an amino acid sequence comprising SEQ ID NOS:2, 4, 6 or 8. By "specifically binds" is meant a binding agent (e.g., an antibody) that binds to its specific target (e.g., one of the four plexin polypeptides) with greater affinity than it binds to other molecules. Preferably, where the binding agent is an antibody, the antibody preferably specifically binds to its specific target with a dissociation constant (KD) of at least 10"5 M, more preferably, 10"6 M, even more preferably 10"7 M, and most preferably, the binding agent specifically binds to its specific target with a KD of at least 10"8 M.
Preferably, the binding agent of this aspect of the invention is an antibody, such as a monoclonal antibody or a polyclonal antibody, or a fragment of an antibody that specifically binds one of the four plexin polypeptides. Standard methods may be employed to generated both monoclonal and polyclonal antibodies that specifically bind to one of the four plexin polypeptides of the invention. See, e.g., Ausubel et al., supra; Coligan, J.E. et al., Current Protocols in Immunology, John Wiley & Sons, New York (1991); and Delves, P.J., Antibody Production: Essential Techniques, John Wiley & Sons, New York (1997). Briefly, the plexin polypeptides of the present invention, purified according to the methods described for the second aspect of the invention, are used to immunize rabbits (e.g., for polyclonal antibodies) or mice (e.g., for monoclonal antibodies) to generate antibody-mediated immunity to the four plexin polypeptides used to immunize the animal. For monoclonal antibodies, antibodies can be screened by, e.g., ELISA, to identify those antibodies that show the highest affinity for the immunizing plexin protein of polypeptide fragment. The cloned cell producing the high affinity monoclonal antibody can then propagated in vitro (where the antibody is purified from the culture supernatant) or in vivo (where the antibody is purified from ascites fluid), and can also be cryopreserved and stored frozen at, e.g., -70°C in DMSO, to provide a potentially limitless supply of monoclonal antibody.
In addition to intact monoclonal and polyclonal antibodies, the invention also provides various antibody fragments, such as Fab, F(ab')2, Fv, and sFv fragments. Recombinant, chimeric, and humanized antibodies are also provided.
Recombinant "humanized antibodies" which specifically bind to one of the four plexin polypeptides can be synthesized according to methods known in the art (see, e.g., Green L.L. et al., Nature Genetics 7: 13-21, 1994 for fully humanized antibodies expressed in transgenic animals; see also U.S. Patent Nos: 5,693,761 ; 5,777,085; and 5,585,089). Humanized antibodies are chimeras comprising mostly human IgG sequences into which at least portions of the regions responsible for specific antigen- binding (e.g., CDR's) have been inserted. Animals are immunized with the desired antigen, the coπesponding antibodies are isolated, and the portion of the variable region sequences responsible for specific antigen binding are removed. The animal-derived antigen binding regions are then cloned into the appropriate position of human antibody genes in which the antigen binding regions have been deleted. Humanized antibodies minimize the use of heterologous (i.e., inter-species) sequences in human antibodies, and thus are less likely to elicit immune responses in the treated subject (see also, e.g., U.S. Patent No. 5,807,715). Construction of different classes of recombinant antibodies can also be accomplished by making chimeric or humanized antibodies comprising nonhuman variable domains and human constant domains (CHI, CH2, CH3) isolated from different classes of immunoglobulins. For example, antibodies with increased antigen binding site valencies can be recombinantly produced by cloning the antigen binding site into vectors caπying the human chain constant regions (see, e.g., Arulanandam et al., J. Exp. Med. 177: 1439-1450, 1993).
In addition, standard recombinant DNA techniques can be used to alter the binding affinities of recombinant antibodies with their antigens by altering amino acid residues in the vicinity of the antigen binding sites. The antigen binding affinity of a humanized antibody can be increased by mutagenesis based on molecular modeling (see, e.g., Queen et al., Proc. Natl. Acad. Sci. 86: 10029-10033, 1989).
Also provided in the invention are plexin polypeptide-specific single polypeptide chain antibodies (see general methods in U.S. Patent Nos. 4,946,788 and 4,704,692); single domain antibodies (Ward, E.S. et al., Nature 341: 544-546, 1989); and chimeric antibodies (U.S. Patent No. 4,816,567).
Binding agents that specifically bind the plexin polypeptides of the present invention are useful, for example, in determining expression levels of the plexin polypeptides in various tissues of the body, Western blotting analysis, and immunochromatography. Particularly, binding agents that specifically bind the plexin polypeptides are useful for binding the plexin polypeptide on a cell expressing the plexin polypeptide, thereby activating the cell.
A binding agent that specifically binds one of the four plexin polypeptides, for example, is effective as an immune modulator. Additional applications include, without limitation, an injectable formulation comprising a binding agent that specifically binds one of the four plexin polypeptides that is useful to antagonize activity in a disease involving aberrant immune regulation or a disease involving aberrant cell growth.
In an eighth aspect, the invention provides an isolated antisense oligonucleotide complementary to a portion of a nucleic acid molecule encoding one of the four plexin polypeptides. In certain embodiments, hybridization of the antisense oligonucleotide to the nucleic acid molecule inhibits transcription or translation of the nucleic acid molecule.
By two nucleic acid molecules being "complementary" to one another is meant that the first nucleic acid molecule (e.g., an oligonucleotide) is able to form Watson- Crick base pair hydrogen bonds (i.e., hybridize) with the second nucleic acid molecule to form a duplex. The first nucleic acid molecule is thus a "complement" of the second nucleic acid molecule.
The antisense oligonucleotides according to the invention are complementary to a region of a nucleic acid molecule (or a region at the intron/exon boundary of DNA or RNA) that encodes one of the four plexin polypeptides. Preparation of antisense oligonucleotides is well known (see, e.g., Agrawal et al, Trends Biotechnol. 10:152-158, 1992; U.S. Patent No. 5,149,798; Agrawal et al, Proc. Natl Acad. Sci. USA 85:7079- 7083, 1988; Froehler, Tetrahedron Lett. 27:5575-5578, 1986; and Bergot et al., J. Chromatog. 559:35-42, 1992.
In a ninth aspect, the invention provides a method for identifying a nucleic acid molecule encoding one of the four plexin polypeptides, comprising contacting a pool of candidate nucleic acid molecules with a nucleic acid molecule encoding one of the four plexin polypeptides, wherein hybridization of the nucleic acid molecule encoding one of the four plexin polypeptides under stringent conditions to a candidate nucleic acid molecule identifies the candidate nucleic acid molecule as a nucleic acid molecule that encodes one of the four plexin polypeptides. According to this aspect of the invention, "hybridization" and "stringent conditions" are as defined above for the first aspect of the invention. In certain embodiments, the nucleic acid molecule encoding one of the four plexin polypeptides has a nucleic acid sequence comprising SEQ ID NOS: 1, 3, 5 or 7.
It will be understood that the isolated plexin polypeptides according to the second aspect of the invention, the plexin chimeric molecules according to the fifth aspect of the invention, and binding agents that specifically bind the plexin polypeptides according to the seventh aspect of the invention, are useful as therapeutics to treat an individual suffering from, or suspected of having, a disease or disorder involving aberrant immune regulation or an individual suffering from, or suspected of having, a disease or disorder involving aberrant cell growth, particularly nerve cell growth. By "disease or disorder involving aberrant immune regulation" is meant any disease or disorder in which an abnormal immune response is generated in response to either self or foreign antigens. Thus, this definition includes, without limitation, autoimmune diseases (e.g., lupus, inflammatory bowel disease, or Diabetes Type 1) and immunosuppressive diseases (e.g., multiple sclerosis or rheumatoid arthritis). By "disease or disorder involving abeπant cell growth" is meant any disease or disorder in which an abnormal amount of cell growth is observed. "Cell growth" is defined above. Thus, diseases and disorders involving aberrant cell growth include hypeφlasia, neoplasia, and cancer, as well as degenerative diseases, such as neurodegenerative diseases. Preferable therapeutically useful plexin polypeptides are soluble polypeptides
(e.g., lacking the hydrophobic transmembrane domain of the plexin polypeptides), particularly soluble polypeptide fragments that are secreted by the cell in which the fragment was produced. In a prefeπed embodiment the soluble plexin polypeptides are selected from the group consisting of plexin-A-1 (Maestrini et al. 1996 supra), plexin-A- 2 (Maestrini et al. 1996 supra), plexin-A-3 (Maestrini et al. 1996 supra), plexin-A-4, plexin-B-1 (Maestrini et al. 1996, supra), plexin-B-2, plexin-B-3, plexin-Cl (Comeau et al. 1998 supra), plexin-D-1. In a tenth aspect, the invention provides a method for diagnosing a disease involving abeπant immune regulation or a disease involving aberrant cell growth, compnsmg compaπng the ammo acid sequence of one of the four plexin polypeptides from an individual suspected of having the disease with the amino acid sequence of one of the four plexin polypeptides from an unaffected individual, wherein the presence of a difference between the two amino acid sequences identifies the individual suspected of having the disease as having the disease. "Disease or disorder involving aberrant immune regulation" and "disease or disorder involving aberrant cell growth" are as defined above. By "difference" in the amino acid sequence of one of the four plexin polypeptides from an individual suspected of having the disease or disorder as compared with the amino acid sequence of one of the four plexin polypeptides from an unaffected individual, is meant any mutation that changes the ammo acid sequence including substitution, deletion, of addition of one or more ammo acid residues. Thus, in one nonhmiting example, one of the four plexin polypeptides is extracted from cells of an individual suspected of having a disease involving aberrant immune regulation (e.g., using an antibody according to the seventh aspect of the invention) The ammo acid sequence of the plexin polypeptide is determined by N- terminal sequencing and compared to the ammo acid sequence of one of the four plexin polypeptides from an unaffected individual (i e., a normal individual of the same species that does not have a disease involving aberrant immune regulation or a disease involving aberrant cell growth). If there is a difference in the two amino acid sequences, the individual suspected of having a disease involving abeπant immune regulation is identified as having a disease involving aberrant immune regulation, and may be treated accordingly
In certain embodiments of the tenth aspect, the amino acid sequence of the plexin polypeptide from the unaffected individual compπses the sequence of SEQ ID NO 2, 4, 6, 8 or 10
The following examples are intended to further illustrate certain preferred embodiments of the invention and are not limiting in nature Those skilled in the art will recognize, or be able to ascertain, using no more than routine expeπmentation, numerous equivalents to the specific substances and procedures descπbed herein Such equivalents are considered to be within the scope of this invention, and are covered by the following claims.
Practice of the present invention will employ, unless indicated otherwise, conventional techniques of cell biology, cell culture, molecular biology, microbiology, recombinant DNA, protein chemistry, and immunology, which are within the skill of the art. Such techniques are described in the literature. See, for example, Molecular Cloning: A Laboratory Manual, 2nd edition. (Sambrook, Fritsch and Maniatis, eds.), Cold Spring Harbor Laboratory Press, 1989; DNA Cloning, Volumes I and II (D.N. Glover, ed), 1985; Oligonucleotide Synthesis, (M.J. Gait, ed.), 1984; U.S. Patent No. 4,683,195 (Mullis et al.,); Nucleic Acid Hybridization (B.D. Hames and S.J. Higgins, eds.), 1984; Transcription and Translation (B.D. Hames and S.J. Higgins, eds.), 1984; Culture of Animal Cells (R.I. Freshney, ed). Alan R. Liss, Inc., 1987; Immobilized Cells and Enzymes, IRL Press, 1986; A Practical Guide to Molecular Cloning (B. Perbal), 1984; Methods in Enzymology, Volumes 154 and 155 (Wu et al., eds), Academic Press, New York; Gene Transfer Vectors for Mammalian Cells (J.H.
Miller and M.P. Calos, eds.), 1987, Cold Spring Harbor Laboratory; Immunochemical Methods in Cell and Molecular Biology (Mayer and Walker, eds.), Academic Press, London, 1987; Handbook of Experiment Immunology, Volumes I-IV (D.M. Weir and C.C. Blackwell, eds.), 1986; Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, 1986.
The following Examples are provided to illustrate the present invention, and should not be construed as limiting thereof.
EXAMPLES
Example 1
Identification and cDNA cloning of plexins and sequence analysis
Since the coding sequences of human plexin-Bl (SEP), plexin- A2(OCT) and plexin-Al (NOV) were incomplete, we obtained the missing cDNA by RT-PCR; primers were designed by homology to orthologous murine sequences and corresponding ESTs. Updated database entries are X87904, X87831 and X87832, respectively. Partial cDNA of plexin-A4 was obtained by assembling five overlapping human ESTs (HGI THC Report: THC203425), deriving from chromosome 7 specific cDNA pools. Another EST from chr. 7 (clone 7B19F10) encodes the cytoplasmic domain of a plexin and presumably derives from the same gene as plexin-A4. Plexin-B2 cDNA was amplified by RT-PCR starting from the partial cDNA sequences of clones MM1 (Shinoura, N., Shamraj, O.I., Hugenholz, H., Zhu, J.G., McBlack, P., Warnick, R., Tew, J.J., Wani, M.A., and Menon, A.G. (1995). Identification and partial sequence of a cDNA that is differentially expressed in human brain tumors. Cancer Lett 89, 215-221) and
KIAA0315 (Genbank database); the genomic locus of SEP-B was identified due to its 100% sequence identity with clone C22_311 from human chromosome 22. Plexin-B3 coding sequence was identified in the genomic sequence of ALD locus on human chromosome Xq28, using the algorithms HEXON and GENIE. Plexin-Dl was similarly found in the genomic sequence of chromosome 3 (pac pDJ70il 1). The genomic sequence of plexin-Bl(SEP), in the region of the alternative splicing of the extracellular domain, was obtained using the following primers: sense 5'GCAGCACCTGTGCACCCACAAGGC3' and antisense: 5 GCAGGCTGGACGGGAGGATGAGG3'. The common donor site is CCATCAG/gtgattgt (position 2028 from ATG); the alternative splice acceptor sites are: (i) cccccttcag/AGCCC, leading to the canonical plexin-Bl sequence, and (ii) ctcctctcag/GTGAT, leading to "plexin-Bl truncated" variant. All these new sequences were analyzed using the algoritms BLAST2, NETPHOS (phosphorylation prediction sites, by Nicolaj Blom), PH-PREDICT and Consensus Protein Secondary Structure prediction at IBCP. The phylogenetic tree was generated using AllAll algorithm of the Darwin sequence analysis system (at CBRG).
Example 2 Plexin cDNA expression constructs and protein analysis
Cell transfections were carried out by Calcium phosphate and DEAE-dextran methods, using 5-10 μg of each cDNA (1-2 μg each in case of cotransfections). For transient transfections in COS and BOSC-23 cells the cDNA was cloned in pCDNA3 or derived expression plasmids (Invitrogen). MDCK stable transfectants for plexin-A3 were obtained using pCEP4 expression plasmid (Invitrogen); the selection was done in the presence of Hygromicin-B (100-200 μg/ml). Plexin-A3 positive clones of MDCK cells were isolated from two independent transfections, and showed identical biological properties. Plexin and neuropilin expression constructs included a VSV- and myc-tag at the N' and C protein termini, respectively, detected by monoclonal antibodies anti- VSV-G (cat. V-5507, Sigma) and anti-cMyc-tag (cat. OP10-100UG, Calbiochem). "Plexin-B 1 truncated" splice variant was expressed from a cDNA fragment isolated by RT-PCR and VSV-tagged at the N' terminus: the encoded amino acid sequence spans up to aa 676 (including the sema domain and two MRS motifs). "Plexin-Bl -sema" derives from a further deletion of the plexin-Bl extracellular domain, and exclusively includes the sema domain. "Plexin-B 1-Δsema" protein mutant includes only the C terminal half of plexin-Bl extracellular domain, starting from amino acid 606, i.e. excluding sema domain and first MRS but including second and third MRS, transmembrane and intracellular domains. For immunoprecipitations, cells were lysed with EB buffer (20 mM Tris-HCl pH 7.4, 5 mM EDTA, 150 mM NaCl, 10% glycerol, 1% Triton X-100), in the presence of a cocktail of protease inhibitors and lmM Na-ortovanadate. Immunoprecipitations were performed at 4DC for 4h with the appropriate antibodies; high stringency washes were performed, in the presence of 1 M LiCl. For in vitro kinase assays, immunopurified proteins were incubated with kinase buffer (50 mM Hepes, 100 μM DTT, 5 mM MnCl2, 5 mM MgCl2) in the presence of redivue 5 μCi [γ-32P] ATP (Amersham) for 10 minutes at 4°C in agitation. Samples were then submitted to SDS-PAGE and autoradiography, or analysed using a Phosphor- Imager system (Molecular Dynamics). Alkali treatment of the polyacrilamide gels was performed with 1M KOH for two hours at 55°C.
Western blots were performed according to standard methods. Specific detection of phospho-tyrosines was done with PY20 MoAb (Trasduction laboratories). Final detection was done with ECL system (Amersham). Example 3
Semaphorin-SEAP binding assays
Soluble forms of Semaphorin extracellular domains were expressed as chimeric molecules with placental Secreted Alkaline Phosphatase (SEAP) and harvested from the conditioned media of transiently transfected COS or BOSC-23 cells. Serum-free media were concentrated over 100 times using Centricon Plus-20 filters (Millipore) with a molecular weight cutoff of 100 kDa. The AP activity of these media was assessed as described (Flanagan, J.G. and Leder, P. (1990). The kit ligand: a cell surface molecule altered in steel mutant fibroblasts. Cell 63, 185-194); the specific activity of chimeric molecules was approx. 1000 U/mg. Concentrated Semaphorin-SEAP were diluted as appropriate in a Hepes buffered saline, additioned with 0.2% BSA, 0.1% NaN3, 5 mM CaCl2 and 1 mM MgCl2 (HBSBA). For binding assays, COS cells transiently transfected with plexins were seeded on 48 well plates to reach confluence, and then incubated with Semaphorin-SEAP preparations (approx 1-5 nM) for 90 minutes at room temperature. The binding was detected as described (Flanagan and
Leder, 1990). Binding experiments with plexin-Cl/VESPR were as described (Comeau, M.R., Johnson, R., DuBose, R.F., Petersen, M., Gearing, P., VandenBos, T., Park, L., Faπah, T., Buller, R.M., Cohen, J.I., Strockbine, L.D., Rauch, C, and Spriggs, M.K. (1998). A poxvirus-encoded semaphorin induces cytokine production from monocytes and binds to a novel cellular semaphorin receptor, VESPR. Immunity. 8, 473-482; He, Z. and Tessier-Lavigne, M. (1997). Neuropilin is a receptor for the axonal chemorepellent Semaphorin UI. Cell 90, 739-751).
For in vitro binding assays, plexin-B 1 was purified from cell extracts by immunoprecipitation with anti-VSV antibody. Extracts of mock-transfected cells were used as control samples. After washing, the immunocomplexes were incubated with serial dilutions of CD100-SEAP (prepared as above) for 2 hours at 4°C, in continuous agitation. Samples were then washed 3 times with HBSBA and the bound alkaline phosphatase activity was measured by colorimetric assay using p-nitro-phenyl- phosphate, as described (Flanagan and Leder, 1990). Scatchard analysis was done using Equilibrate (by GertJan C. Veenstra). Example 4 In situ hybridization analysis RNA in situ hybridization was performed essentially as described (He, Z. and Tessier-Lavigne, M. (1997). Neuropilin is a receptor for the axonal chemorepellent Semaphorin m. Cell 90, 739-751). Briefly cDNA fragments of plexin-Al, -A2, and - A3 were used to generate S-labeled antisense and sense RNA probes, which were used for in situ hybridization histochemistry of cryostat sections of rat embryos. Example 5 Xenopus turning assay
The methods for injecting mRNA encoding various constructs, and for studying the turning responses of the neurons, are exactly as described previously (Hong, K., Hinck, L., Nishiyama, M., Poo, M.M., Tessier-Lavigne, M., and Stein, E. (1999). A ligand-gated association between cytoplasmic domains of UNC5 and DCC family receptors converts netrin-induced growth cone attraction to repulsion. Cell 97, 927- 941); Song, H., Ming, G., He, Z., Lehmann, M., Tessier-Lavigne, M., and Poo, M. (1998). Conversion of neuronal growth cone responses from repulsion to attraction by cyclic nucleotides [see comments]. Science 281, 1515-1518). Example 6 Mixed-culture assays and time-lapse videomicroscopy
Mock- transfected and plexin-A3 overexpressing MDCK cells were seeded with mesenchymal cells (NIH 3T3, KJ29, D17, among others), in multiwell culture plates by 1:4 or 1:1 ratio. NLH and KJ-29 cells were sometimes labeled by addition of Dil (1,1'- dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate, Fluka) in the culture medium, 4 hours before harvesting for the assay; clusters of cells marked with this dye are marked in blue (in light microscopy) and emit red epifluorecence (TRITC filter). The repelling effect was observed 16-30 hours after confluency, by contrast phase microscopy using Leica DM IL. The progress of the assays was also monitored by time- lapse video-microscopy (320 minutes recording were converted into 1 minute play). To determine the time-length of cell contacts, for each assay, randomly chosen fibroblasts were followed during several hours and the duration of each contact between their lamellipodia and MDCK cells was measured. The doubling time of cells and their viability during the assay could also be analyzed, and no differences were observed in presence of control or plexin-A3 expressing cells. Substrate adhesion of plexin-A3 overexpressing MDCKs was analyzed by counting attached cells after 30 minutes from seeding on micro-wells coated with fibronectin, collagen or polylysin, in the absence of calf serum: no differences versus control cells were observed. Example 7 Apoptosis detection TUNEL reaction (Boehringer detection kit) was performed on mixed cultures of
MDCK and NIH3T3 cells, 24 hours after seeding in a 24-well culture plate. The labeling was converted into a colorimetric signal for analysis by light microscopy using the TUNEL-AP detection kit (Boehringer). As a positive control for the induction of apoptosis, the same cells were treated with UV-C (50 μJ/cm ) or lμM staurosporin. Although the foregoing invention has been described in some detail by way of illustration and example for puφoses of clarity of understanding, it will be apparent to those skilled in the art that certain changes and modifications will be practiced. Therefore, the description and examples should not be construed as limiting the scope of the invention, which is delineated by the appended claims. Example 8
Plexins are specific receptors for cell surface semaphorins in vertebrates
Plexin-Cl (VESPR) has been shown to bind the soluble viral semaphorins Sema VA and VB (Comeau et al., 1998 supra), and we recently found that Drosophila Plexin A (D Plex A) interacts with transmembrane Sema la (Winberg et al., 1998 supra). We therefore examined in vertebrates whether the extracellular domain of several different cellular semaphorins -fused to alkaline phosphatase- could bind members of the human plexin-A, -B and -C subfamilies. Multiple secreted semaphorins of class 3 (Sema3A, Sema 3C or Sema3F; see below) did not interact with plexins-Al, -A2, -A3, -Bl, B2, or -Cl (data not shown). In contrast, plexin-Cl (Vespr) specifically bound Sema7A(Sema- Kl) (Fig. 2a), a GPI-membrane linked semaphorin (class 7). This result is not entirely unexpected, since Sema7A may represent the cellular counteφart of viral semaphorin SemaVB, previously shown to interact with this plexin (Comeau et al., 1998 supra). More interestingly, the class 4 transmembrane semaphorin Sema4D (CD 100) did interact strongly and specifically with plexin-Bl (Fig. 2a). Thus the prototypes of two distinct plexin families are the receptors for members of two distinct semaphorin subclasses. We also found that Sema7A and Sema4D do not bind to neuropilin- 1 or -2 alone, nor did co-transfection of either neuropilin with plexin-B 1 significantly modify its binding efficiency (not shown). Neuropihns thus seem so far to function as receptors only for vertebrate semaphorins of class 3.
The affinity constant of Sema4D for plexin-B 1 was estimated by Scatchard plot to be in the subnanomolar range (KD = 0.9 nM, Fig. 2b; the estimated KD of Sema7A for plexin-Cl is 2.1 nM, not shown). These values are consistent with those observed for semaphorins-neuropilins, and fly semaphorin 1 -Plexin A interactions (He and Tessier-Lavigne, 1997 suprάWmberg et al., 1998).
We used two deletion constructs of plexin-Bl to explore the semaphorin binding sites of plexins. Neither the N-terminal half of plexin-Bl extracellular domain ("plexin-Bl truncated", see previous paragraph), nor its C-terminal half ("plexin-B 1- Δsema", see Experimental Procedures) was sufficient alone to bind CD100 (see Fig. 2a), suggesting that the binding of Sema4D depends on multiple structural determinants of the extracellular domain of plexin-B 1. Example 9 Plexins associate with class 3 Semaphorin receptors, Neuropihns
As outlined above, secreted semaphorins of subclass 3 are known to bind neuropihns (He and Tessier-Lavigne, 1997 supra; Kolodkin et al., 1997 supra; Chen, H., Chedotal, A., He, Z., Goodman, C.S., and Tessier-Lavigne, M. (1997) "Neuropilin- 2, a novel member of the neuropilin family, is a high affinity receptor for the semaphorins Sema E and Sema IV but not Sema HI." Neuron 19, 547-559). However, the short cytoplasmic tail of neuropihns seems to be dispensable for their biological activity (Nakamura, et al (1998) supra), indicating the requirement of an associated co- receptor for signal transduction. Interestingly, in Drosophila (where neuropihns have not been identified to date) Plexin A is sufficient to mediate the biological response to semaphorin- 1 in axon guidance (Winberg et al., I998supra).
In an initial set of experiments, we could not observe binding of the class 3 semaphorins Sema3A(Sema HI), Sema3C(Sema E) or Sema3F(Sema IV) to plexins-Al, A2, A3, Bl, B2 or Cl (not shown). To test whether plexins might be coreceptors with neuropihns for class 3 semaphorins, we set up co-precipitation experiments in COS cells to test whether neuropihns may interact with plexins. Three tested plexins (plexin- Al, -A3 and -Bl) associated both with neuropilin-2 (Np2, shown in Fig. 3) and neuropilin- 1 (not shown). The binding was specific, inasmuch as neither neuropilin nor any plexins coimmunoprecipitated with the netrin receptor DCC, under conditions where DCC coimmunoprecipitated with the other netrin receptor UNC5H2 (Fig. 3 and data not shown). We observed finally that the plexin-neuropilin association is mediated by the sema domain of plexins, as demonstrated using either the "plexin-B 1 truncated" splice variant (Figure 3) or an even shorter form of the extracellular domain ("plexin- Bl-sema", see Experimental procedures, not shown).
To further support the idea of a plexin-neuropilin multimeric receptor complex for semaphorins, we show here that plexin-A3 (e.g.) is expressed in a large number of neuronal classes, including sensory, sympathetic, motor, and olfactory bulb neurons (Figure 4 and data not shown), which are known to respond to class 3 semaphorins, and which express either neuropilin-1 or neuropilin-2 or both (Chen et al., 1997 supra; Feiner, L., Koppel, A.M., Kobayashi, H., and Raper, J.A. (1997). Secreted chick semaphorins bind recombinant neuropilin with similar affinities but bind different subsets of neurons in situ. Neuron 19, 539-545; He and Tessier-Lavigne, 1997 supra; Kolodkin et al., 1997 supra). Thus, plexin-A3 is a candidate for a physiological coreceptor involved in mediating class 3 semaphorin effects on these axons. Other plexins may also have a role as neuropilin coreceptors in specific cell populations, such as plexin-A2, which is expressed in a subset of sensory neurons and in dorsal horn cells, and plexin-Al, which is expressed at low levels and broadly in the spinal cord (Figure 4). To directly test the possible involvement of plexins in class 3 semaphorin signal transduction, we studied the repulsive responses of Xenopus spinal neurons to Sema3A, which is mediated by a receptor mechanism involving neuropilin-1 (Song et al., 1998 supra). We asked whether these responses could be altered by expression of a presumed dominant-negative plexin-Al construct lacking the cytoplasmic domain of the protein. Transmembrane proteins can be reliably expressed in these neurons by injecting the encoding mRNA at the developmental two cell stage, allowing the embryos to grow to tadpole stage, and then removing the spinal cord and culturing the neurons (Hong et al., 1999 supra). We therefore injected the mRNA encoding the truncated plexin-Al construct, together with mRNA encoding GFP (as a reporter) and then studied the responses of spinal neurons expressing GFP that were derived from these embryos. Whereas control spinal neurons are repelled by Sema3A (Figure 5A, B and Song et al. 1998 supra), neurons from embryos injected with mRNA for truncated plexin-Al did not respond with either repulsion or attraction to Sema3A (Figure 5C, D). This blocking effect appeared to be specific, since expression of a different heterologous receptor, UNC5H2, did not impair repulsion by Sema3A (Hong et al., 1997 supra), and since expression of the truncated plexin construct did not block attractive responses to netrin-1 (Figure 5E, F). Figure 5G, H quantifies these effects. As can be seen, the effect of Sema3A is completely abolished by the truncated plexin; although there is a slight apparent decrease in the attractive effect of netrin-1 the effect is not statistically significant.
Although we have used a truncated plexin-Al construct, this construct may be expected to interfere with the function of various plexins, since all the plexins tested (Al, A3 and Bl) associated with neuropilin-1. These results support a role for one or more plexins in mediating the repulsive Sema3A signal in the Xenopus spinal neurons. Example 10 Plexins signal via a novel type of tyrosine phosphorylated cytoplasmic domain
The sequences of plexin cytoplasmic domains are highly conserved among plexins but do not match any known sequences. We found that the plexin-A3 and plexin-Bl proteins are phosphorylated on tyrosine residues when overexpressed in human kidney cells (BOSC-23), as demonstrated using anti-phosphotyrosine antibodies (Fig. 6a). Furthermore, after immunoprecipitation and in vitro kinase assays, plexin- A3 and plexin-Bl became phosphorylated (Fig. 6b). Resistance to an alkali treatment (see Experimental procedures) confirmed the specific phosphorylation of tyrosine residues.
The cytoplasmic domains of several receptors, including Met proteins, become tyrosine phosphorylated owing to an intrinsic kinase activity (Ullrich, A. and
Schlessinger, J. (1990) "Signal transduction by receptors with tyrosine kinase activity."
Cell 61, 203-212). Since the cytoplasmic domain of plexins is not similar to any bona fide or atypical tyrosine kinase, this suggests that a distinct tyrosine kinase co- immunoprecipitates in association with plexins, and is responsible for their tyrosine phosphorylation. Although some additional phosphorylated proteins can be found specifically with plexin-A3 and -Bl, we have not as yet identified this associated kinase. A number of endogenously expressed tyrosine kinases, namely Met, Ron, Abl and Src, were not found associated with plexin-A3 by immunoprecipitation and
Western blotting (not shown). Since tyrosine phosphorylated residues often function as docking sites for intracellular signal transducers (Cantley, L.C., Auger, K.R., Caφenter, C, Duckworth, B., Graziani, A., Kapeller, R., and Soltoff, S. (1991) "Oncogenes and signal transduction." Cell 64, 281-302), the fact that the cytoplasmic domains of plexins are tyrosine phosphorylated further suggests that they are part of signaling complexes. Example 11 Plexin-A3 expressing cells induce repulsion of co-cultured cells
Stable transfectants expressing recombinant human plexin-A3 were successfully obtained in four different cell lines: LMR32 and AF8 (human neuroblasts), and BOSC- 23 and MDCK (human and canine kidney cells, respectively). We observed modest phenotypic changes in the transfected cells, which generally become flatter and larger in size. The growth rate of plexin-A3 overexpressing cells was comparable to parental lines and we did not observe differences in the ability to adhere on different substrates (data not shown).
In keeping with previous report on the related Plexin of Xenopus laevis (Ohta, K., Mizutani, A., Kawakami, A., Murakami, Y., Kasuya, Y., Takagi, S., Tanaka, H., and Fujisawa, H. (1995). "Plexin: a novel neuronal cell surface molecule that mediates cell adhesion via a homophilic binding mechanism in the presence of calcium ions." Neuron 14, 1189-1199), we observed a modest increase in calcium-dependent homotypic cell aggregation of plexin-A3 transfectants (not shown). Suφrisingly, we found that epithelial MDCK cells overexpressing plexin-A3 mediate strong repelling cues for adjacent cells. This was observed by co-culturing mock-transfected and plexin- A3 overexpressing MDCK cells together with several non-epithelial cell lines (such as NIH3T3, Kj29, and D17; Fig. 7A). Mock MDCKs grew alongside mesenchymal cells until confluency, when both cell types stopped proliferating. In contrast, when plexin- A3-overexpressing epithelial cells were grown in the same conditions, the adjacent mesenchymal cells withdrew from them, and ultimately detached from the plate.
To analyze the dynamics of this repulsion process, we monitored for 36 hours, by time-lapse video-microscopy, mixed cultures of transfected MDCK cells and fibroblasts, in a number of independent experiments. At low cell density, fibroblasts showed intrinsic motility, exploring the surface of the plate with long lamellipodia and filopodia, and thus coming in contacts with a high number of stationary MDCK islets. The time-length of the contacts between fibroblasts and control MDCK cells varied from 30 minutes to several hours, lasting mostly over 100 minutes. However, when fibroblasts were cultured with MDCK cells overexpressing plexin- A3, transient contacts were observed, often lasting less than 30 minutes (see Fig. 7C). At higher cell density, fibroblasts stopped and clustered alongside the islands of control MDCKs, whereas they kept moving in a hectic fashion between the islands of plexin-A3 transfected cells (data not shown). This cell-repelling effect is not due to the release of soluble factors, since exchanging conditioned media between mixed cultures was without effect (not shown). Moreover, the two different cell populations grew normally until they came into contact, indicating that the repelling effect requires cell-cell interaction. To rule out the possibility that plexin-A3 expressing cells generate an apoptotic signal for fibroblasts, we monitored cell viability and apoptosis by TUNEL staining. As shown in Figure 7B, the clusters of repelled fibroblasts did not include apoptotic cells; furthermore, the detaching cells still excluded Trypan blue stain and were able to spread again on a new culture plate (not shown).
Taken together, these results demonstrate that in our experimental system, plexin- A3 mediates cell repelling cues, presumably by interacting with surface bound ligands on opposing cells. We could not identify -so far- the specific ligand for plexin-A3, however we propose that this may be a transmembrane semaphorin. It should be noted that the intracellular domains of transmembrane semaphorins, such as Sema4D, also include tyrosine residues, which may themselves become phosphorylated and associate with cytoplasmic signal transducer molecules, a property shown for ligands of the ephrin family (Holland, S.J., Gale, N.W., Mbamalu, G., Yancopoulos, G.D., Henkemeyer, M., and Pawson, T. (1996) "Bidirectional signalling through the EPH- family receptor Nuk and its transmembrane ligands." Nature 383, 722-725).

Claims

What is claimed is:
1. Isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence that encodes an amino acid sequence selected from the group consisting of the amino acid sequence shown in (SEQ ID NO: 2 (plexin B-2)), (SEQ ID NO: 4 (plexin B-3)), (SEQ ID NO: 6 (plexin D-l)) and (SEQ ID NO: 8 (plexin A-4))
2. Isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence selected from the group consisting of the nucleotide sequence shown (SEQ ID NO: 1 (plexin B-2)), (SEQ ID NO: 3 (plexin B- 3)), (SEQ ID NO: 5 (plexin D-l)) and (SEQ ID NO: 7 (plexin A-4)).
3. A vector comprising the nucleic acid of any one of claims 1 or 2.
4. An isolated polypeptide having at least 80% amino acid sequence identity to an amino acid sequence selected from the group consisting of the amino acid sequence shown in (SEQ ID NO: 2 (plexin B-2)), (SEQ LO NO: 4 (plexin B- 3)), (SEQ ID NO: 6 (plexin D-l)) and (SEQ ID NO: 8 (plexin A-4)).
5. An isolated polypeptide having at least 80% amino acid sequence identity to: (a) the polypeptide shown in (SEQ ID NO: 2 (plexin B-2)), (SEQ ID
NO: 4 (plexin B-3)), (SEQ ID NO: 6 (plexin D-l)) and (SEQ ID NO: 8 (plexin A-4)), lacking its associated signal peptide;
(b) an extracellular domain of the polypeptide shown in (SEQ ID NO: 2 (plexin B-2)), (SEQ ID NO: 4 (plexin B-3)), (SEQ ID NO: 6 (plexin D- 1)) and (SEQ ID NO: 8 (plexin A-4)), with its associated signal peptide; or
(c) an extracellular domain of the polypeptide shown in (SEQ ID NO: 2 (plexin B-2)), (SEQ ID NO: 4 (plexin B-3)), (SEQ ID NO: 6 (plexin D- 1)) and (SEQ ID NO: 8 (plexin A-4)), lacking its associated signal peptide.
6. A chimeric molecule comprising a polypeptide according to claim 4 or 5 fused to a heterologous amino acid sequence.
7. The chimeric molecule of claim 6, wherein the heterologous amino acid sequence is a Fc region of an immunoglobulin.
8. An antibody that specifically binds to a polypeptide according to claim 4 or
5.
9. The antibody according to claim 8, wherein the antibody is a monoclonal, a humanized antibody or a single-chain antibody.
10. A method of suppressing or altering aberrant cell growth involving a signaling pathway between a plexin and a neuropilin in a mammal comprising the step of administering an effective amount of an agent to said mammal capable of interfering with the association between the plexin and neuropilin
11. A method of treating, suppressing or altering a disorder involving aberrant immune regulation involving a signaling pathway between a plexin and a neuropilin in a mammal comprising the step of administering an effective amount of an agent to said mammal capable of interfering with the association between the plexin and neuropilin.
12. The method according to claim 10 or 11 wherein said agent is a chimeric molecule according to claim 6 or 7.
13. The method according to claim 10 or 11, wherein said agent is an antibody according to claim 8 or 9.
14. A method of diagnosing or screening for tumors in a subject characterized by the expression profiles of the polypeptides according to claim 4 or 5 wherein the expression profile of the polypeptides is different in a non- tumor sample as compared to the expression profile of the polypeptides in a tumor sample.
PCT/US2000/023365 1999-08-25 2000-08-25 Novel members of the plexin family and uses thereof WO2001014420A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU70738/00A AU7073800A (en) 1999-08-25 2000-08-25 Novel plexins and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US15057699P 1999-08-25 1999-08-25
US60/150,576 1999-08-25

Publications (2)

Publication Number Publication Date
WO2001014420A2 true WO2001014420A2 (en) 2001-03-01
WO2001014420A3 WO2001014420A3 (en) 2002-05-10

Family

ID=22535146

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/023365 WO2001014420A2 (en) 1999-08-25 2000-08-25 Novel members of the plexin family and uses thereof

Country Status (2)

Country Link
AU (1) AU7073800A (en)
WO (1) WO2001014420A2 (en)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003035100A1 (en) * 2001-09-26 2003-05-01 Institut National De La Sante Et De La Recherche Medicale (Inserm) Neuropilin as a novel therapeutic target for modulation of immune reponses
WO2004006898A2 (en) * 2002-07-11 2004-01-22 Sema Aps Use of compounds capable of inhibiting the proteolytic processing of semaphorins for prevention, treatment, diagnosis and prognosis of an invasive disease
WO2005003776A2 (en) * 2003-06-30 2005-01-13 Progenika Biopharma, S.A. In vitro methods for detecting renal cancer
WO2005056791A1 (en) * 2003-10-30 2005-06-23 Kazusa Dna Research Institute Foundation Novel plexin polypeptide, dna encoding the same and use thereof
EP1712619A1 (en) * 2003-12-24 2006-10-18 Takeda Pharmaceutical Company Limited Preventive/remedy for cancer
WO2007009816A3 (en) * 2005-07-21 2007-03-29 Stichting Katholieke Univ Plexin d1 as a target for tumor diagnosis and therapy
US7402660B2 (en) 2000-08-02 2008-07-22 The Johns Hopkins University Endothelial cell expression patterns
EP2385121A1 (en) 2010-05-06 2011-11-09 Netris Pharma Antagonists of Sema3E/PlexinD1 interaction as anti-cancer agents
WO2012107531A1 (en) * 2011-02-09 2012-08-16 Ruprecht-Karls-Univeristät Heidelberg B-type plexin antagonists and uses thereof
WO2012114339A1 (en) 2011-02-23 2012-08-30 Rappaport Family Institute For Research In The Medical Sciences High affinity molecules capable of binding a type a plexin receptor and uses of same
WO2012049228A3 (en) * 2010-10-12 2012-08-30 Protagen Ag Marker sequences for multiple sclerosis and the use thereof
US20120251539A1 (en) * 2009-11-25 2012-10-04 Ting Jenny P-Y Methods and Compositions for the Treatment of Immune Disorders
EP2691420A1 (en) * 2011-03-28 2014-02-05 President and Fellows of Harvard College Modulators of plexin b2 activity
WO2015037009A1 (en) 2013-09-16 2015-03-19 Plexicure Ltd. Isolated proteins capable of binding plexin-a4 and methods of producing and using same
WO2020239945A1 (en) 2019-05-28 2020-12-03 Vib Vzw Cancer treatment by targeting plexins in the immune compartment
WO2020239934A1 (en) 2019-05-28 2020-12-03 Vib Vzw Cd8+ t-cells lacking plexins and their application in cancer treatment
US11142561B2 (en) 2015-06-29 2021-10-12 The University Of British Columbia B1SP fusion protein therapeutics, methods, and uses
WO2022063957A1 (en) 2020-09-24 2022-03-31 Vib Vzw Biomarker for anti-tumor therapy

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999004263A1 (en) * 1997-07-17 1999-01-28 The John Hopkins University School Of Medicine Semaphorin receptor

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999004263A1 (en) * 1997-07-17 1999-01-28 The John Hopkins University School Of Medicine Semaphorin receptor

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
COMEAU, M. ET AL.: "A poxvirus-encoded semaphorin induces cytokine production from monocytes and binds to a novel cellular semaphorin receptor, VESPR" IMMUNITY, vol. 8, April 1998 (1998-04), pages 473-482, XP000945259 cited in the application *
EMBL DATABASE EM_HUM:AB014520; ACCESSION-NO.:AB014520, 15 July 1998 (1998-07-15), XP002173834 & ISHIKAWA, K.-I. ET AL.: "Prediction of the coding sequences of unidentified human genes. X. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro" DNA RESEARCH, vol. 5, 30 June 1998 (1998-06-30), pages 169-176, XP002121149 *
EMBL DATABASE EM_OV:XLPLEX; ACCESSION-NO:D38175, 25 August 1995 (1995-08-25), XP002173837 & OHTA, K. ET AL.: "Plexin: a novel neuronal cell surface molecule taht mediates cell adhesion via a homophilic binding mechanism in the presence of calcium ions" NEURON, vol. 14, 1995, pages 1189-1199, XP001013227 *
EMBL DATABASE EMHUM4:HS5211110; ACCESSION-NO: U52111, 9 May 1996 (1996-05-09), XP002173835 *
EMBL DATABASE EMHUM4:HSAB2313; ACCESSION-NO: AB002313, 1 July 1997 (1997-07-01), XP002157964 & DATABASE SWALL:O15031; ACCESSION-NO: O15031, 1 January 1998 (1998-01-01), & NAGASE, T. ET AL.: "Prediction of the coding sequences of unidentified human genes. VII. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro" DNA RESEARCH, vol. 4, 1997, pages 141-150, XP002102085 *
EMBL DATABASE EMHUM6:HSOCTPROT; ACCESSION-NO: X87831, 6 February 1996 (1996-02-06), XP002173836 *
KAMEYAMA, T. ET AL.: "Identification of a cell surface protein plexin (the B2) in mouse, and its expression in developing nervous systems" NEUROSCIENCE RESEARCH SUPPLEMENT, vol. 18, 1993, page S115 XP000945106 *
MAESTRINI, E. ET AL.: "A family of transmembrane proteins with homology to the MET-hepatocyte growth factor receptor" PROC.NATL.ACAD.SCI.USA, vol. 93, no. 2, 1996, pages 674-678, XP000941746 *
NAKAMURA, F. ET AL.: "Neuropilin-1 extracellular domains mediate semaphorin D/III-induced growth cone collapse" NEURON, vol. 21, November 1998 (1998-11), pages 1093-1100, XP002174004 cited in the application *
TAKAHASHI, T. ET AL.: "Plexin-Neuropilin-1 complexes form functional semaphorin-3A receptors" CELL, vol. 99, 1 October 1999 (1999-10-01), pages 59-69, XP000941701 *
TAMAGNONE, L. ET AL.: "Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vetebrates" CELL, vol. 99, 1 October 1999 (1999-10-01), pages 71-80, XP000941702 *

Cited By (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7402660B2 (en) 2000-08-02 2008-07-22 The Johns Hopkins University Endothelial cell expression patterns
WO2003035100A1 (en) * 2001-09-26 2003-05-01 Institut National De La Sante Et De La Recherche Medicale (Inserm) Neuropilin as a novel therapeutic target for modulation of immune reponses
WO2004006898A2 (en) * 2002-07-11 2004-01-22 Sema Aps Use of compounds capable of inhibiting the proteolytic processing of semaphorins for prevention, treatment, diagnosis and prognosis of an invasive disease
WO2004006898A3 (en) * 2002-07-11 2004-02-17 Sema Aps Use of compounds capable of inhibiting the proteolytic processing of semaphorins for prevention, treatment, diagnosis and prognosis of an invasive disease
ES2297953A1 (en) * 2003-06-30 2008-05-01 Progenika Biopharma, S.A. In vitro methods for detecting renal cancer
WO2005003776A2 (en) * 2003-06-30 2005-01-13 Progenika Biopharma, S.A. In vitro methods for detecting renal cancer
WO2005003776A3 (en) * 2003-06-30 2005-04-21 Progenika Biopharma Sa In vitro methods for detecting renal cancer
WO2005056791A1 (en) * 2003-10-30 2005-06-23 Kazusa Dna Research Institute Foundation Novel plexin polypeptide, dna encoding the same and use thereof
US7816132B2 (en) 2003-10-30 2010-10-19 Kazusa Dna Research Institute Foundation DNA encoding plexin polypeptides and kits thereof
US7482322B2 (en) 2003-10-30 2009-01-27 Kazusa Dna Research Institute Foundation Plexin family-like polypeptide, and uses thereof
EP1712619A4 (en) * 2003-12-24 2008-01-02 Takeda Pharmaceutical Preventive/remedy for cancer
EP1712619A1 (en) * 2003-12-24 2006-10-18 Takeda Pharmaceutical Company Limited Preventive/remedy for cancer
US9422358B2 (en) 2005-07-21 2016-08-23 Modiquest B.V. Plexin D1 as a target for tumor diagnosis and therapy
JP2009506985A (en) * 2005-07-21 2009-02-19 ステイヒテイング・カソリーケ・ユニベルシタイト Plexin D1 as a target for tumor diagnosis and treatment
US9988449B2 (en) 2005-07-21 2018-06-05 Modiquest B.V. Plexin D1 as a target for tumor diagnosis and therapy
WO2007009816A3 (en) * 2005-07-21 2007-03-29 Stichting Katholieke Univ Plexin d1 as a target for tumor diagnosis and therapy
US8871205B2 (en) * 2009-11-25 2014-10-28 The University Of North Carolina At Chapel Hill Methods and compositions for the treatment of immune disorders
US20120251539A1 (en) * 2009-11-25 2012-10-04 Ting Jenny P-Y Methods and Compositions for the Treatment of Immune Disorders
EP2385121A1 (en) 2010-05-06 2011-11-09 Netris Pharma Antagonists of Sema3E/PlexinD1 interaction as anti-cancer agents
WO2011138449A2 (en) 2010-05-06 2011-11-10 Netris Pharma Antagonists of sema3e/plexind1 interaction as anti-cancer agents
WO2011138449A3 (en) * 2010-05-06 2015-07-30 Netris Pharma Antagonists of sema3e/plexind1 interaction as anti-cancer agents
WO2012049228A3 (en) * 2010-10-12 2012-08-30 Protagen Ag Marker sequences for multiple sclerosis and the use thereof
US9198966B2 (en) 2011-02-09 2015-12-01 Ruprecht-Karls-Universität Heidelberg B-type plexin antagonists and uses thereof
WO2012107531A1 (en) * 2011-02-09 2012-08-16 Ruprecht-Karls-Univeristät Heidelberg B-type plexin antagonists and uses thereof
JP2014511377A (en) * 2011-02-09 2014-05-15 ルプレヒト−カールス−ウニベルジテート ハイデルベルク B-type plexin antagonists and uses thereof
AU2012215438B2 (en) * 2011-02-09 2016-10-27 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. B-type plexin antagonists and uses thereof
WO2012114339A1 (en) 2011-02-23 2012-08-30 Rappaport Family Institute For Research In The Medical Sciences High affinity molecules capable of binding a type a plexin receptor and uses of same
CN107337733A (en) * 2011-03-28 2017-11-10 哈佛大学校长及研究员协会 The conditioning agent of the activity of neuropile protein B 2
EP2691420A1 (en) * 2011-03-28 2014-02-05 President and Fellows of Harvard College Modulators of plexin b2 activity
CN103748113B (en) * 2011-03-28 2017-05-17 哈佛大学校长及研究员协会 Modulators of plexin b2 activity
EP2691420A4 (en) * 2011-03-28 2015-01-07 Harvard College Modulators of plexin b2 activity
CN103748113A (en) * 2011-03-28 2014-04-23 哈佛大学校长及研究员协会 Modulators of plexin b2 activity
WO2015037009A1 (en) 2013-09-16 2015-03-19 Plexicure Ltd. Isolated proteins capable of binding plexin-a4 and methods of producing and using same
US11142561B2 (en) 2015-06-29 2021-10-12 The University Of British Columbia B1SP fusion protein therapeutics, methods, and uses
WO2020239945A1 (en) 2019-05-28 2020-12-03 Vib Vzw Cancer treatment by targeting plexins in the immune compartment
WO2020239934A1 (en) 2019-05-28 2020-12-03 Vib Vzw Cd8+ t-cells lacking plexins and their application in cancer treatment
WO2022063957A1 (en) 2020-09-24 2022-03-31 Vib Vzw Biomarker for anti-tumor therapy

Also Published As

Publication number Publication date
AU7073800A (en) 2001-03-19
WO2001014420A3 (en) 2002-05-10

Similar Documents

Publication Publication Date Title
WO2001014420A2 (en) Novel members of the plexin family and uses thereof
Tamagnone et al. Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates
US20080241857A1 (en) Netrin receptors
US20080118951A1 (en) Nogo receptor homologues and their use
WO1996026958A2 (en) Eph RECEPTOR LIGAND ELF-2
JP3998417B2 (en) Semaphorin receptor
US6280955B1 (en) Interleukin-1 receptor accessory proteins, nucleic acids and methods
JP2005519584A (en) NOGO receptor homologues and their use
AU4139296A (en) Cdna encoding a bmp type ii receptor
US20030220488A1 (en) Isolated human secreted proteins, nucleic acid molecules encoding human secreted proteins, and uses thereof
KR20040028601A (en) Osteoclast-associated receptor
AU710551B2 (en) Nucleic acid encoding a nervous tissue sodium channel
WO2008109596A2 (en) Canine transient receptor potential v2 (ctrpv2) and methods of screening for trpv2 channel modulators
AU2002363091B2 (en) EE3-protein family and corresponding DNA sequences
WO2000056764A1 (en) Dna molecules encoding human clax proteins and their soluble fusion proteins
US7070946B2 (en) Bone metabolism related protein and gene thereof
WO2004035627A1 (en) Modulation of tgfbeta-like signalling pathways
WO2000002910A2 (en) Human fast-1 gene
US7309783B2 (en) Mammalian early developmental regulator gene
US6670150B1 (en) Isolated human receptor proteins, nucleic acid molecules encoding human receptor proteins, and uses thereof
US6489456B1 (en) Isolated human secreted proteins, nucleic acid molecules encoding human secreted proteins, and uses thereof
JP2007006701A (en) Bmp-4 neutralizing factor protein
WO2001036634A1 (en) Novel g protein-coupled receptors, genes thereof and production and use of the same
US20030049789A1 (en) Isolated human secreted proteins, nucleic acid molecules encoding human secreted proteins, and uses thereof
JP2003204792A (en) New cell adhesive molecule and its gene

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP