US20090269766A1 - Nucleic acid amplification in the presence of modified randomers - Google Patents

Nucleic acid amplification in the presence of modified randomers Download PDF

Info

Publication number
US20090269766A1
US20090269766A1 US12/406,450 US40645009A US2009269766A1 US 20090269766 A1 US20090269766 A1 US 20090269766A1 US 40645009 A US40645009 A US 40645009A US 2009269766 A1 US2009269766 A1 US 2009269766A1
Authority
US
United States
Prior art keywords
pcr
amplification
nucleic acid
dna
oligonucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/406,450
Other languages
English (en)
Inventor
Dieter Heindl
Waltraud Ankenbauer
Frank Laue
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Roche Diagnostics GmbH
Roche Molecular Systems Inc
Original Assignee
Roche Diagnostics GmbH
Roche Diagnostics Operations Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Roche Diagnostics GmbH, Roche Diagnostics Operations Inc filed Critical Roche Diagnostics GmbH
Assigned to ROCHE DIAGNOSTICS GMBH reassignment ROCHE DIAGNOSTICS GMBH ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ANKENBAUER, WALTRAUD, LAUE, FRANK, HEINDL, DIETER
Assigned to ROCHE DIAGNOSTICS OPERATIONS, INC. reassignment ROCHE DIAGNOSTICS OPERATIONS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ROCHE DIAGNOSTICS GMBH
Publication of US20090269766A1 publication Critical patent/US20090269766A1/en
Priority to US13/711,846 priority Critical patent/US8592184B2/en
Assigned to ROCHE MOLECULAR SYSTEMS, INC. reassignment ROCHE MOLECULAR SYSTEMS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ROCHE DIAGNOSTICS OPERATIONS, INC.
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Definitions

  • the present invention relates to the field of template dependent polymerase catalyzed primer extension reactions.
  • the invention provides a new method for nucleic acid amplification by means of performing a polymerase chain reaction (PCR). More precisely, the present invention provides a new method for performing a hot start PCR characterized in that unspecific primer dimer amplification is avoided.
  • PCR polymerase chain reaction
  • thermostable DNA polymerases are also moderately active at ambient temperature.
  • amplification products due to eventually by chance occurring primer dimerisation and subsequent extension are observed frequently.
  • it is well known in the art to perform a so called “hot start” PCR wherein one component essential for the amplification reaction is either separated from the reaction mixture or kept in an inactive state until the temperature of the reaction mixture is being raised for the first time. Since the polymerase cannot-function under these conditions, there is no primer elongation during the period when the primers can bind non-specifically. In order to achieve this effect, several methods have been applied:
  • the physical separation can be obtained for example by a barrier of solid wax, which separates the compartment containing the DNA polymerase from the compartment containing the bulk of the other reagents.
  • a barrier of solid wax which separates the compartment containing the DNA polymerase from the compartment containing the bulk of the other reagents.
  • the wax is then melting automatically and the fluid compartments are mixed (Chou, Q., et al., Nucleic Acids Res 20 (1992) 1717-23, U.S. Pat. No. 5,411,876).
  • the DNA polymerase is affinity immobilized on a solid support prior to the amplification reaction and only released into the reaction mixture by a heat mediated release (Nilsson, J., et al., Biotechniques 22 (1997) 744-51). Both methods, however are time consuming and inconvenient to perform.
  • the DNA polymerase is reversibly inactivated as a result of a chemical modification. More precisely, heat labile blocking groups are introduced into the Taq DNA polymerase which renders the enzyme inactive at room temperature (U.S. Pat. No. 5,773,258). These blocking groups are removed at high temperature during a pre-PCR step such that the enzyme is becoming activated.
  • a heat labile modification for example can be obtained by coupling Citraconic Anhydride or Aconitric Anhydride to the Lysine residues of the enzyme (U.S. Pat. No. 5,677,152).
  • Enzymes carrying such modifications are meanwhile commercially available as Amplitaq Gold (Moretti, T., et al., Biotechniques 25 (1998) 716-22) or FastStart DNA polymerase (Roche Molecular Biochemicals).
  • Amplitaq Gold Mossham
  • FastStart DNA polymerase Roche Molecular Biochemicals
  • the introduction of blocking groups is a chemical reaction which arbitrarily occurs on all sterically available Lysine residues of the enzyme. Therefore, the reproducibility and quality of chemically modified enzyme preparations may vary and can hardly be controlled.
  • Cold sensitive mutants of Taq Polymerase have been prepared by means of genetic engineering. These mutants differ from the wildtype enzyme in that they lack the N-terminus (U.S. Pat. No. 6,241,557). In contrast to native or wild type recombinant Taq Polymerase, these mutants are completely inactive below 35° C. und thus may be used in some cases for performing a hot start PCR.
  • the N-terminal truncated cold sensitive mutant form requires low salt buffer conditions, has a lower processivity as compared to the wild type enzyme and thus can only be used for the amplification of short target nucleic acids.
  • the truncated form lacks 5′-3′ exonuclease activity, it can not be used for real time PCR experiments based on the TaqMan detection format.
  • primer extension is inhibited at temperatures below the melting point of the short double stranded DNA fragment, but independent from the sequence of the competitor DNA itself. However, it is not known, to which extent the excess of competitor DNA influences the yield of the nucleic acid amplification reaction.
  • oligonucleotide Aptamers with a specific sequence resulting in a defined secondary structure may be used.
  • Aptamers have been selected using the SELEX Technology for a very high affinity to the DNA polymerase (U.S. Pat. No. 5,693,502, Lin, Y., and Jayasena, S. D., J Mol Biol 271 (1997) 100-11).
  • the presence of such Aptamers within the amplification mixture prior to the actual thermocycling process itself again results in a high affinity binding to the DNA polymerase and consequently a heat labile inhibition of its activity (U.S. Pat. No. 6,020,130). Due to the selection process, however, all so far available Aptamers can only be used in combination with one particular species of DNA polymerase.
  • U.S. Pat. No. 5,985,619 discloses a specific embodiment for performing PCR using a hot start antibody, wherein besides Taq polymerase, e. g. Exonuclease III from E. coli is added as a supplement to the amplification mixture in order to digest unspecific primer dimer intermediates.
  • Exonuclease III recognizes double-stranded DNA as a substrate, like, for example, target/primer- or target/primer extension product hybrids. Digestion is taking place by means of cleavage of the phosphodiester bond at the 5′ end of the 3′ terminal deoxynucleotide residue.
  • EP 0 799 888 and GB 2293238 disclose an addition of 3′ blocked oligonucleotides to PCR reactions. Due to the 3′ block, these oligonucleotides can not act as primers. The blocked oligonucleotides are designed to compete/interact with the PCR primers which results in reduction of non-specific products.
  • thermostable DNA-Polymerase a thermostable DNA-Polymerase
  • thermostable 3′-5′ Exonuclease a thermostable 3′-5′ Exonuclease
  • at least one primer for nucleic acid amplification with a modified 3′ terminal residue which is not elongated by said thermostable DNA-Polymerase as well as methods for performing a PCR reaction using this composition.
  • polyanionic polymerase inhibitors may control the activity of thermostable DNA polymerases dependent on the applied incubation temperature.
  • U.S. Pat. No. 6,667,165 discloses a hot start embodiment, characterized in that inactive polymerase-inhibitor complexes are formed at temperatures below 40° C. Between 40° C. and 55° C., the inhibitor competes with the template DNA for binding to the Taq Polymerase, whereas at temperatures above 55° C., the inhibitor is displaced from the polymerase active site. Yet, the inhibitor tends to reduce the obtainable product yield, when primers with lower annealing temperatures are used.
  • thermostable polymerases are known for a long time lo be active only in presence of Mg2+ cations, a sequestration of magnesium prior to the start of the thermocycling protocol has been attempted in order to avoid mispriming and unspecifying primer extension.
  • Mg2+ may be present in form of a precipitate and thus unavailable at the beginning of the amplification reaction.
  • the precipitate dissolves and Mg2+ becomes fully available within the first 3 cycles.
  • Such a solution has been shown to be fairly applicable and capable of providing good hot start results.
  • the present invention provides a composition comprising
  • Such a composition is particularly useful for the performance of a PCR amplification reaction, because formation of artificial amplification products such as primer dimers is avoided.
  • said modification is positioned at the 5′ end of said randomized oligonucleotide.
  • said organic hydrophobic moiety of said modification is either a Pyrene or a Stilbene.
  • the DNA Polymerase is a thermostable DNA Polymerase such as Taq Polymerase. If this is the case, the composition may comprise not only one primer but at least a pair of amplification primers.
  • compositions as defined above further comprises a target nucleic acid sample.
  • the present invention is directed to a kit comprising a DNA Polymerase, and a randomized 5-8 mer oligonucleotide, characterized in that said oligonucleotide comprises a modification with an organic hydrophobic moiety.
  • said modification is positioned at the 5′ end of said randomized oligonucleotide (capped randomer).
  • said organic hydrophobic moiety of said modification is either Pyrene or Stilbene.
  • said kit is characterized in that said DNA polymerase is a thermostable DNA polymerase such as Taq DNA Polymerase. If this is the case, the kit may comprise not only one primer but at least a pair of amplification primers.
  • the present invention provides a method for primer extension on a specific target nucleic acid comprising the steps of
  • the present invention provides a method for amplification of a specific target nucleic acid comprising the steps of
  • said nucleic acid amplification reaction is a Polymerase Chain Reaction which is monitored in real time.
  • the amplification product generated by said amplification is subsequently subjected to a melting curve analysis.
  • the present invention provides a new and improved solution for performing a primer extension reaction with increased specificity.
  • the present invention provides a new and improved solution for performing a nucleic acid amplification reaction with improved specificity.
  • the so called hot start effect results in effective inhibition of undesired primer elongations.
  • Undesired primer elongations result from accidential hybridization events wherein primers are at least partially hybridized to any sequence in a nucleic acid sample which is different from the actual primer binding side of the nucleic acid target.
  • compositions comprising
  • the DNA Polymerase in general may be any enzyme which is capable of performing a template dependent primer extension reaction.
  • a template dependent primer extension reaction can occur on all partially double stranded nucleic acid hybrids characterized in that a primer nucleic acid with a free 3′ hydroxyl group is hybridized to a template nucleic acid with a single stranded 5′ overhang.
  • the template dependent polymerase then catalyzes extension of the 3′ end of the primer by means of incorporating nucleotide residues which are always complementary to the nucleotide at the opposite position within the template strand.
  • the reaction uses dNTPs as substrates and results in a release of pyrophosphate.
  • said DNA Polymerase is an RNA template dependent Polymerase or any modification thereof.
  • Such enzymes are usually called Reverse Transcriptase. Examples are AMV reverse transcriptase or MMLV reverse transcriptase.
  • Transcriptor Reverse Transcriptase (Roche Applied Science cat. No: 03 531 317 001) is an applicable enzyme in the context of the present invention.
  • Inventive compositions comprising such RNA dependent DNA Polymerase are especially useful for all kinds and applications of preparative and analytical cDNA syntheses, and in particular 2-step RT-PCR.
  • the DNA Polymerase is a DNA template dependent DNA polymerase or any mutant or modification thereof.
  • Klenow polymerase Roche Applied Science Cat. No. 11 008 404 001
  • the DNA polymerase is a thermostable DNA polymerase or any mutant or modification thereof.
  • a typical example is Taq DNA Polymerase from Thermus aquaticus (Roche Applied Science Cat. No: 11 647 679 001).
  • the DNA dependent DNA polymerase enzymes may or may not have a 3′-5′ proofreading activity such as Pwo Polymerase (Roche Applied Science Cat. No: 11 644 947 001).
  • DNA polymerase component of the present invention may be a mix of enzymes with and without proofreading activity such as the Expand High Fidelity system (Roche Applied Science Cat. No: 11 732 641 001).
  • Inventive compositions comprising any kind of thermostable Polymerase are specifically useful for performing various preparative or analytical embodiments of the Polymerase Chain Reaction (PCR).
  • the DNA polymerase component of the present invention is a thermostable DNA dependent DNA polymerase with additional RNA template dependent Reverse Transcriptase activity like the Polymerase from Thermus thermophilus (Roche Applied Science Cat. No: 11 480 014 001) or a mix of a an RNA dependent DNA Polymerase (i.e. a reverse Reverse Transcriptase) and a thermostable DNA dependent DNA polymerase.
  • Inventive compositions comprising such components are particularly useful for analytical performance of one-step RT-PCR.
  • the Deocxynucleotide-Triphosphates are usually a mixture of dATP, dCTP, dGTP and dTTP, however, in some specific instances, only 3 or less different kinds of dNTP may be used. Morever, such a dNTP may be chemically modified in any way, as long as said building block is still capable of being incorporated into the nascent polynucleotide chain by the Polymerase. For example, said modified nucleotide compounds may carry a Biotin or a fluorescent compound modification at the respective base moiety.
  • the at least one primer oligonucleotide is usually a desoxy-oligonucleotide which is completely or almost completely complementary to a specific region of the target nucleic acid. Furthermore, said primer moiety must have a free 3′ hydroxyl group so that it is extendible by a DNA polymerase. For specific purposes, such a primer may be chemically modified for example at its 3′ end. Examples for frequently used modifications are Biotin labels, Digoxygenin labels and fluorescent labels.
  • thermostable DNA dependent DNA polymerase is designed for a PCR reaction
  • a composition according to the present invention comprises usually two primer oligonucleotides hybridizing in opposite orientations to the opposite strands of the target nucleic acid adjacent to the target sequence that shall become amplified. It is also possible that a composition of the present invention comprises multiple pairs of oligonucleotide PCR primers for multiplex PCR amplification.
  • a randomized 5-8 mer oligonucleotide characterized in that said oligonucleotide comprises a modification with an organic hydrophobic moiety.
  • randomized oligonucleotide refers to a pool of oligonucleotides, the sequences of which represent more or less equally all possible combinations of the 4 different nucleotide residues.
  • Said randomized oligonucleotides may be added to the primer extension reaction or the PCR reaction in a concentration range between 10 ⁇ M and 1 mM, preferably between 25 ⁇ M and 400 ⁇ M and most preferably in a concentration of about 100 ⁇ M. It has also been proven to be particular advantageous, if the randomized oligonucleotides have a non extendible 3′ terminus, which for example may be blocked by a phosphate moiety. This avoids an undesired elongation by the Polymerase in case of an accidential hybridization of any of the oligonucleotides at any region of the sample nucleic acid.
  • the randomized oligonucleotides are chemically modified with an organic hydrophobic moiety.
  • Said moieties usually do not interfere with any type of primer extension reaction.
  • an organic hydrophobic moiety may be selected from a group of moieties consisting of polycondensend aromatic and heteroaromatic rings like naphthalin, anthracen, phenantren, pyrene, anthraquinones, carbazol phenantrolines, quonolines, etc. or from stilbens, or from steroids like cholesterol.
  • Such hydrophobic moieties may be substituted by non bulky substituents like cyano, methoxy, methyl, nitro and halogens, and are partially known to act as a so called “cap” for stabilizing terminal base pairs. Narayanan, S., et al., Nucleic Acids Research 32(9) (2004) 2901-2911; Dogan, Z., et al., Journal of the American Chemical Society 126(15) (2004) 4762-4763.
  • such an organic hydrophobic moiety is either a an optionally substituted Pyrene or a an optionally substituted Stilben, which have the following chemical structures:
  • a pyrene or stilbene is attached to the 5′ end of a randomized oligonucleotide whereas the 5′ end of such an oligonucleotide has the following structure
  • the organic hydrophobic moiety can be positioned at any part of the randomized oligonucleotide.
  • said modification is introduced at the 5′ end of the randomized oligonucleotide.
  • Phosphoramidite chemistry with an appropriate terminal Phosphoramidite according to standard methods that are well known in the art and that pyrene and stilbene phosphoramidites are commercially available.
  • the randomized oligonucleotide could comprise nucleobase analogs with modified bases like 7 deaza analogs like 7 deaza dG, 7 deaza 8 aza analogs like 7 bromo 7 deaza 8 aza 2 amino dA, or substituted bases like propinyl U, propinyl C, or analogs with modified sugars like 2′ methoxy ribose or locked sugars like in LNA, or with ribose analogs like hexitol and altritol.
  • randomization universal bases like nitroindol or N8 ribosylated-7 deaza 8 aza dA are used whereas preferably only at one position of the randomer is used a universal base instead of randomers.
  • the internucleosidic phosphate could be substituted by an phosphate mimetikum like phosphorthioate or methyl phosphonate or phosphoramidates.
  • the randomized oligonucleotide has preferably one hydrophobic moiety but can be additionally substituted by other hydrophobic moieties, whereas the hydrophobic moieties are independently selected from each other.
  • compositions which comprise randomized oligonucleotides that are chemically modified with an organic hydrophobic moiety in conjunction with a DNA dependent thermostable DNA polymerase and at least one pair of amplification primers are particularly useful for the performance of a PCR amplification reaction.
  • the reason is that the presence of said randomized and modified oligonucleotides efficiently inhibits formation of artificial amplification products such as primer dimers at temperatures below the annealing temperatures of the respective amplification primers, thereby creating a hot start effect.
  • compositions as defined above further comprises a target nucleic acid sample.
  • the sample usually may for example contain genomic DNA or fragmented genomic DNA in conjunction with DNA dependent DNA polymerases or total cellular or poly-A+ RNA in conjunction with RNA dependent DNA polymerases.
  • the present invention also. provides kits for preparing compositions as disclosed in detail above.
  • the present invention is also directed to a kit comprising at least a DNA Polymerase and a randomized 5-8 mer oligonucleotide, characterized in that said oligonucleotide comprises a modification with an organic hydrophobic moiety.
  • said modification is any of the examples as disclosed above and is positioned at the 5′ end of said randomized oligonucleotide.
  • the kits may comprise further components such as Desoxynucleotide Triphosphates (dNTPs) and appropriate buffers as well as other reagent additives, which are useful for performing respective primer extension reactions.
  • parameter specific kits may comprise at least one target specific primer oligonucleotide.
  • the kit is designed for cDNA synthesis and comprises a Reverse Transcriptase as disclosed above.
  • the kit may comprise either a parameter specific primer for amplification of specific cDNAs.
  • the kit is designed for performing PCR and comprises a DNA dependent thermostable Polymerase or a mix of DNA dependent thermostable Polymerases.
  • the kit may then additionally comprise for example dNTPs and/or a buffer solution and/or at least one or multiple pairs of amplification primers.
  • the enzyme component may be a DNA dependent thermostable DNA polymerase which in addition comprises Reverse Transcriptase activity.
  • the kit is designed for 2-step RT-PCR and may comprise various combinations of components selected from the components of the first and second embodiment as disclosed above.
  • kits according to the second and third specific embodiments may comprise components which are useful for the detection of PCR amplification products.
  • a kit may additionally comprise a double stranded DNA binding dye component such as SybrGreen (Roche Applied Science Cat. No: 04 707 516 001) or the LC480 ResoLight dye (Roche Applied Science Cat. No: 04 909 640 001).
  • a kit may additionally comprise fluorescently labeled hybridization probes such as TaqMan probes (U.S. Pat. No. 5,804,375), Molecular Beacons (U.S. Pat. No. 5,118,801), FRET hybridization probes (U.S. Pat. No. 6,174,670), or Simple Probes (WO 02/14555).
  • the present invention is not only directed to compositions and kits but also to methods of performing primer extension reactions in general and PCR or reverse transcription reactions in particular.
  • a method according to the present invention comprises the steps of
  • a method according to the present invention comprises the steps of
  • the sample is either total or poly-A+ RNA
  • the DNA Polymerase is a Reverse Transcriptase
  • the primer oligonucleotide is a specific primer that is complementary to a specific type of cDNA.
  • the sample is derived from genomic DNA
  • the DNA Polymerase is a thermostable DNA Polymerase or a mixture of thermostable DNA polymerases and at least one pair or multiple pairs of amplification primers are added prior to a PCR amplification reaction.
  • said nucleic acid amplification reaction is a Polymerase Chain Reaction which is monitored in real time according to standard methods known in the art (see, for example U.S. Pat. No. 5,210,015, U.S. Pat. No. 5,338,848, U.S. Pat. No. 5,487,972, WO 97/46707, WO 97/46712, WO 97/46714).
  • the amplification product generated is subjected to a melting curve analysis (U.S. Pat. No. 6,174,670, U.S. Pat. No. 6,569,627) by means of subjecting the amplification product to a thermal gradient over time.
  • fluorescence intensity is monitored, which is due either to the binding of a respectively labeled hybridization probe, or due to the fluorescence originating from a DNA binding dye.
  • the first derivative of the decrease in fluorescence intensity due to the melting of the hybridization probe or the two strands of amplicon, respectively, is plotted against the temperature gradient.
  • oligonucleotide characterized in that said oligonucleotide comprises a modification with an organic hydrophobic moiety during the amplification process subsequently provides superior quality melting curve results.
  • inventive method comprises several advantages over methods already disclosed in the art.
  • the presence of a randomized 5-8 mer oligonucleotide, characterized in that said oligonucleotide comprises a modification with an organic hydrophobic moiety during a primer extension reaction such as a reverse transcription or a PCR or an RT-PCR clearly results in an increase in the specificity of the respective reaction.
  • oligonucleotide molecules may interact with the primer to an extend that the primer is not capable of being elongated even if it is already annealed to a longer, substantially complementary nucleic acid molecule.
  • One major advantage of the present invention is the ease of use and the short activation time to eliminate the inhibition of the polymerase at low temperatures.
  • a randomized 5-8 mer oligonucleotide characterized in that said oligonucleotide comprises a modification with an organic hydrophobic moiety needs to be added to a PCR reaction set up.
  • the denaturation time prior to the first cycle which is usually required to separate double stranded DNA templates into single strands is sufficient to eliminate the interaction between the conjugated randomers and the PCR primers.
  • inventive methods, compositions and kits can be generically used for any kind of primer extension, reverse transcription or PCR amplification, irrespective of what specific target nucleic acid sequence shall be prepared, amplified, detected, or analyzed.
  • FIG. 1 Amplification of genomic DNA in the presence of Pyrene-capped hexamers according to example 1
  • FIG. 2 Amplification of genomic DNA in the presence of Pyrene-capped hexamers according to example 2
  • FIG. 3 Amplification in the of pyrene or stilbene-capped octamers according to example 4
  • FIG. 4 Real time PCR melting curve analysis according to example 7
  • FIG. 5 Real time RT PCR according to example 9
  • Randomized oligonucleotides are synthesized by standard methods on a ABI 394 synthesizer on a 10 ⁇ mol scale in the trityl off mode using commercially available phosphate CPG(2-[2-(4,4′-Dimethoxytrityoxy)ethylsulfonyl]ethyl-2-succinoyl)-long chain alkylamino-CPG) as solid support and a aequimolare ( ⁇ 0.1 mol) mixture of a standard dA(bz) dT, dG (iBu) dC(Bz) phosphoramidites, deprotection was performed under standard conditions with ammonia or NaOH and the product was desalted via dialysis
  • 5′ Pyrene-capped hexamers were analyzed in DNA amplification. PCR reactions in the presence or absence of 100 ⁇ M Pyrene-capped hexamers were performed in 50 ⁇ l reactions containing 50 ng, 25 ng, 10 ng, 5 ng, 1 ng and 0 ng of human genomic DNA, 30 mM Tris-HCl, pH 8.6, 1.5 mM MgCl 2 , 50 mM KCl, 0.2 mM dNTP's each, 0.4 ⁇ M primers (SEQ ID NO: 1 ATT AGA GAA CCA TGT TAA CAC TAC CG and SEQ ID NO: 2 GAG GTG AAT GAC CAC TGT TTA TTT TC) and 2.5 units Taq DNA polymerase.
  • FIG. 1 shows a clear improvement in amplification specificity in the presence of pyrene-capped hexamers.
  • 5′ Pyrene-capped hexamers were analyzed in realtime PCR. PCR reactions in the presence or absence of Pyrene-capped hexamers were performed in 20 ⁇ l rections containing 30 ng, 3 ng or 0.3 ng of human genomic DNA, 50 mM Tris-HCl, pH 8.6, 0.2 mM CHAPS, 1 mM BigChap, 20 mM KCl, 3 mM MgCl 2 , 0.4 ⁇ M primers (SEQ ID NO: 3 GGA AGT ACA GCT CAG AGT TCT GC and SEQ ID NO: 4 GAA TCT CCA TTC ATT CTC AAA AGG ACT), 0.2 mM deoxynucleotides, and 2.5 units Taq DNA polymerase.
  • PCR was performed in a LIGHTCYCLER 480 Instrument (Roche Diagnostics GmbH) with the following cycle conditions: Initial denaturation for 2 min at 95° C. and 45 cycles with 1 second denaturation at 95° C., 10 seconds annealing at 65° C. and 10 seconds elongation at 72° C. The amplification products were separated on agarose gel and visualized by ethidium bromide staining ( FIG. 2 ). The result shows a clear improvement in amplification specificity by pyrene-capped hexamers.
  • 5′ Pyrene-capped octamers and stilbene-capped octamers were tested in 100 ⁇ M final concentration in the amplification or a human collagen gene fragment with 50 ng, 25 ng, 10 ng, 5 ng, 1 ng and 0 ng of human DNA using the same PCR buffer as described in example 1.
  • PCR primers SEQ ID NO: 5 TAA AGG GTC ACC GTG GCT TC and SEQ ID NO: 6 CGA ACC ACA TTG GCA TCA
  • the total reaction volume was 50 ⁇ l.
  • PCR cycling was performed in a block cycler with an initial denaturation for 4 min at 94° C., 35 cycles with 20 seconds at 94° C., 30 seconds at 62° C., 4 min at 72° C. and a final elongation step at 72° C. for 7 minutes.
  • 5′ Pyrene-capped monomers were analyzed in realtime PCR. PCR reactions in the presence or absence of pyrene-capped monomers (up to 400 ⁇ M) or pyrene-capped hexamers (up to 400 ⁇ M) were performed in 20 ⁇ l reactions containing 30 ng, 3 ng, 0.3 ng, 0.03 ng, 0.01 ng and 0 ng of human genomic DNA, 50 mM Tris-HCl, pH 8.6, 0.2 mM CHAPS, 1 mM BigChap, 20 mM KCl, 3 mM MgCl 2 , 0.4 ⁇ M primers (SEQ ID NO: 7 CAC CCC GTG CTG CTG ACC GA and SEQ ID NO: 8 AGG GAG GCG GCC ACC AGA AG), 0.2 mM deoxynucleotides, and 2.5 units Taq DNA polymerase.
  • PCR was performed in a LIGHTCYCLER 480 Instrument with the following cycle conditions: Initial denaturation for 2 minutes at 95° C. and 45 cycles with 1 second denaturation at 95° C., 15 seconds annealing at 65° C. and 5 seconds elongation at 72° C. The amplification products were separated on agarose gel and visualized by ethidium bromide staining The results show a clear improvement in amplification specificity by pyrene-capped hexamers, but no increase in specificity with pyrene-capped monomer in comparison to the control reaction (not shown).
  • 3′ phosphorylated hexamers without organic molecule at the 5′end were tested in up to 200 ⁇ M final concentration in the amplification of a human collagen gene fragment with 50 ng, 25 ng, 10 ng, 5 ng, 1 ng and 0 ng of human genomic DNA using the same PCR buffer as described in example 1.
  • PCR primers SEQ ID NO: 5 TAA AGG GTC ACC GTG GCT TC and SEQ ID NO: 6 CGA ACC ACA TTG GCA TCA TC
  • the total reaction volume was 50 ⁇ l.
  • PCR cycling was performed in a block cycler with an initial denaturation for 4 minutes at 94° C., 35 cycles with 20 seconds at 94° C., 30 seconds at 58° C., 4 min at 72° C. and a final elongation step at 72° C. for 7 minutes.
  • the amplification products were separated on an agarose gel and visualized by ethidium bromide staining. The results show no difference in PCR product compositions no matter whether hexamers were present or not (not shown).
  • 5′ Pyrene-capped hexamers were analyzed in real time PCR. PCR reactions in the presence or absence of Pyrene-capped hexamers were performed in 20 ⁇ l reactions containing 30 ng, 3 ng or 0.3 ng, 0.03 ng, 0.01 ng and 0 ng of human genomic DNA, 50 mM Tris-HCl, pH 8.6, 0.2 mM CHAPS, 1 mM BigChap, 20 mM KCl, 3 mM MgCl 2 , 0.4 ⁇ M primer (SEQ ID NO: 3 GGA AGT ACA GCT CAG AGT TCT GC and SEQ ID NO: 4 GAA TCT CCA TTC ATT CTC AAA AGG ACT), 0.2 mM deoxynucleotides, and 2.5 units Taq DNA polymerase and SYBR Green (1:40 000).
  • PCR was performed in a LIGHTCYCLER 480 Instrument with the following cycle conditions: Initial denaturation for 2 min at 95° C. and 45 Cycles with 1 second denaturation at 95° C., 10 sec annealing at 65° C. and 10 seconds elongation at 72° C. For relative quantification of specific and unspecific products melting curves were performed according to the protocol recommended for LightCycler 480. The result is shown in FIG. 4 . In the absence of additive ( FIG. 4A ) a high amount of unspecific product is formed; in the presence of additive ( FIG. 4B ) unspecific product is strongly reduced.
  • the reaction mixtures of 20 ⁇ l contained total RNA from human liver cells 100 pg, 10 pg, 1 pg, 0.1 pg and 0 pg, respectively, 7.4 ⁇ l RNA Master, 3.25 mM Manganese acetate, 0.5 ⁇ M of each primer (SEQ ID NO: 9 TGCAGCCTCCATAACCATGAG and SEQ ID NO: 10 GATGCCTGCCATTGGACCTA) and 0.25 ⁇ M hydrolysis probe (SEQ ID NO: 11 FAM-GATGCCTGCCATTGGACCTA-TAMRA).
  • the reactions were performed in the absence of pyrene-capped hexamers or with 50 ⁇ M, 100 ⁇ M or 200 ⁇ M pyrene-capped hexamers.
  • RT-PCR was performed in a LIGHTCYCLER 480 instrument according to the protocol recommended by the manufacturer.
  • the cp-values are shown in Table 1. Pyrene-capped hexamers had no influence on crossing points. There is no delay in amplification signals or loss of sensitivity
  • a primer pair was chosen which causes the formation of unspecific products when low amounts of RNA are present in the RT-PCR reaction: G6PDH forw (SEQ ID NO: 12 GCA AAC AGA GTG AGC CCT TC) and G6PDH rev (SEQ ID NO: 13 GGG CAA AGA AGT CCT CCA G) primers.
  • cDNA was synthesized in 20 ⁇ l reactions containing 0.5 ⁇ M primers, 0.6 units of Transcriptor (Roche Applied Sciences, Cat No.: 03531317001), 30 mM Tris.HCl, pH 8.6; 3 mM MgCl 2 , 200 ⁇ M dATP, 200 ⁇ M dGTP, 200 ⁇ M dCTP, 600 ⁇ M dUTP, 20 mM KCl, 0.2 mM CHAPSO, 1 mM BigChap, 125 ng/ml T4gene 32 protein, SYBR Green in a final dilution of 1:20 000 and 10 pg of total.
  • RNA from HeLa cells RNA from HeLa cells.
  • Two samples for cDNA synthesis were prepared, one with 100 ⁇ M pyrene-capped hexamer, the other without pyrene-capped hexamer.
  • the reactions were incubated for 10 min at 50° C., 2 min at 95° C. and chilled on ice.
  • PCR was performed in 20 ⁇ l reaction volumes using 2 ⁇ l of the cDNA reaction mixtures, 0.5 ⁇ M of the primers, 1.2 units of Taq polymerase in the same buffer as described for the cDNA reaction mixture in the presence or absence of additional pyrene-capped hexamer in 100 ⁇ M final concentration.
  • the reactions were incubated in a LightCycler 480 instrument at 95° C.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US12/406,450 2008-03-19 2009-03-18 Nucleic acid amplification in the presence of modified randomers Abandoned US20090269766A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/711,846 US8592184B2 (en) 2008-03-19 2012-12-12 Nucleic acid amplification in the presence of modified randomers

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP08005100.6 2008-03-19
EP08005100 2008-03-19

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/711,846 Continuation US8592184B2 (en) 2008-03-19 2012-12-12 Nucleic acid amplification in the presence of modified randomers

Publications (1)

Publication Number Publication Date
US20090269766A1 true US20090269766A1 (en) 2009-10-29

Family

ID=39683448

Family Applications (2)

Application Number Title Priority Date Filing Date
US12/406,450 Abandoned US20090269766A1 (en) 2008-03-19 2009-03-18 Nucleic acid amplification in the presence of modified randomers
US13/711,846 Expired - Fee Related US8592184B2 (en) 2008-03-19 2012-12-12 Nucleic acid amplification in the presence of modified randomers

Family Applications After (1)

Application Number Title Priority Date Filing Date
US13/711,846 Expired - Fee Related US8592184B2 (en) 2008-03-19 2012-12-12 Nucleic acid amplification in the presence of modified randomers

Country Status (7)

Country Link
US (2) US20090269766A1 (fr)
EP (1) EP2103693B1 (fr)
JP (1) JP5457055B2 (fr)
CN (1) CN101691593B (fr)
CA (1) CA2658520C (fr)
ES (1) ES2450073T3 (fr)
HK (1) HK1142928A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011163120A1 (fr) 2010-06-21 2011-12-29 Life Technologies Corporation Compositions, méthodes et kits de synthèse et d'amplification d'acides nucléiques
WO2017079636A1 (fr) * 2015-11-05 2017-05-11 University Of Utah Research Foundation Pcr par transcription inverse extrême
US9932634B2 (en) 2012-05-24 2018-04-03 University Of Utah Research Foundation Methods for fast nucleic acid amplification
US11091801B2 (en) 2010-06-21 2021-08-17 Life Technologies Corporation Compositions, kits and methods for synthesis and/or detection of nucleic acids
US11338296B2 (en) 2018-07-26 2022-05-24 Lex diagnostics Ltd. Variable temperature reactor, heater and control circuit for the same

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL230602B1 (pl) 2013-04-04 2018-11-30 Centrum Badan Molekularnych I Makromolekularnych Polskiej Akademii Nauk Kwas (E)-3-arylo-3-oksoprop-1-enylo-2-fosfonowy i jego pochodne, sposob ich wytwarzania oraz ich zastosowanie
PL223918B1 (pl) 2013-05-28 2016-11-30 Centrum Badań Molekularnych i Makromolekularnych Polskiej Akademii Nauk 3-Arylo-2-fosforylo podstawione 1-indanony i sposób ich wytwarzania
WO2018025899A1 (fr) * 2016-08-03 2018-02-08 和光純薬工業株式会社 Solution pour remplir un dispositif microfluidique en plastique
JP2019198259A (ja) * 2018-05-15 2019-11-21 株式会社島津製作所 １ステップｒｔ−ｐｃｒ法

Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5118801A (en) * 1988-09-30 1992-06-02 The Public Health Research Institute Nucleic acid process containing improved molecular switch
US5210015A (en) * 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5338848A (en) * 1991-04-04 1994-08-16 Basf Aktiengesellschaft Indolizinetrimethine dyes
US5338671A (en) * 1992-10-07 1994-08-16 Eastman Kodak Company DNA amplification with thermostable DNA polymerase and polymerase inhibiting antibody
US5411876A (en) * 1990-02-16 1995-05-02 Hoffmann-La Roche Inc. Use of grease or wax in the polymerase chain reaction
US5449603A (en) * 1989-10-24 1995-09-12 Stratagene Method for hybridizing nucleic acids using single-stranded nucleic acid binding protein
US5677152A (en) * 1995-08-25 1997-10-14 Roche Molecular Systems, Inc. Nucleic acid amplification using a reersibly inactivated thermostable enzyme
US5693502A (en) * 1990-06-11 1997-12-02 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand inhibitors to DNA polymerases
US5792607A (en) * 1990-01-26 1998-08-11 Abbott Laboratories Method and kits for amplifying target nucleic acids applicable to both polymerase and ligase chain reactions
US5985619A (en) * 1995-02-07 1999-11-16 Clinical Diagnostic Systems, Inc. Use of exonuclease and/or glycosylase as supplements to anti-polymerase antibody to increase specificity in polymerase chain reaction
US6020130A (en) * 1995-06-07 2000-02-01 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands that bind to and inhibit DNA polymerases
US6174670B1 (en) * 1996-06-04 2001-01-16 University Of Utah Research Foundation Monitoring amplification of DNA during PCR
US6403341B1 (en) * 2001-08-02 2002-06-11 Wayne M. Barnes Magnesium precipitate hot start method for PCR
US6421557B1 (en) * 1999-06-29 2002-07-16 Biotronik Mess-und Therapiegeräte GmbH & Co. Ingenieurbüro Berlin Method for determining the baroreflex latent period and baroreflex sensitivity
US20030118998A1 (en) * 2001-10-15 2003-06-26 Dean Frank B. Nucleic acid amplification
US6667165B2 (en) * 2001-11-13 2003-12-23 Eppendorf Ag Method and compositions for reversible inhibition of thermostable polymerases
US20050221304A1 (en) * 2001-04-11 2005-10-06 Charlie Xiang Modified random primers for probe labeling
US20070238117A1 (en) * 2006-03-22 2007-10-11 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Method for retaining methylation pattern in globally amplified dna

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2293238A (en) 1994-09-13 1996-03-20 Inceltec Ltd Primers for replication and/or amplification reactions
US6033851A (en) 1994-12-09 2000-03-07 Wakunaga Seiyaku Kabushiki Kaisha Method for suppressing nonspecific hybridization in primer extension method
CA2176193A1 (fr) 1995-05-22 1996-11-23 John Wesley Backus Methodes de preamplification de la reaction en chaine de la polymerase a l'aide d'exonucleases, en presence d'amorces a base de phosphorothioate
AU736742B2 (en) 1996-06-03 2001-08-02 Governors Of The University Of Alberta, The Methods for detection of rearranged DNA
JP4281877B2 (ja) 1996-06-04 2009-06-17 ユニバーシティ オブ ユタ リサーチ ファウンデーション 生物学的プロセスを実行し且つモニタリングするためのシステムと方法
US6787305B1 (en) 1998-03-13 2004-09-07 Invitrogen Corporation Compositions and methods for enhanced synthesis of nucleic acid molecules
US20030118992A1 (en) 1998-09-29 2003-06-26 Warren Richard Lloyd ABC transporter
DE19913923A1 (de) 1999-03-26 2000-09-28 Amphenol Tuchel Elect Kontaktiereinrichtung für eine SIM-Karte
WO2000068411A1 (fr) 1999-05-12 2000-11-16 Invitrogen Corporation Compositions et methodes d'amelioration de la sensibilite et de la specificite d'une synthese d'acide nucleique
CA2417986C (fr) 2000-08-11 2013-11-26 University Of Utah Research Foundation Sondes oligonucleotidiques simples, marquees
EP1275735A1 (fr) 2001-07-11 2003-01-15 Roche Diagnostics GmbH Composition et méthode pour l'amplification des acides nucléiques à la facon 'hot start'

Patent Citations (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5118801A (en) * 1988-09-30 1992-06-02 The Public Health Research Institute Nucleic acid process containing improved molecular switch
US5449603A (en) * 1989-10-24 1995-09-12 Stratagene Method for hybridizing nucleic acids using single-stranded nucleic acid binding protein
US5792607A (en) * 1990-01-26 1998-08-11 Abbott Laboratories Method and kits for amplifying target nucleic acids applicable to both polymerase and ligase chain reactions
US5411876A (en) * 1990-02-16 1995-05-02 Hoffmann-La Roche Inc. Use of grease or wax in the polymerase chain reaction
US5693502A (en) * 1990-06-11 1997-12-02 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand inhibitors to DNA polymerases
US5487972A (en) * 1990-08-06 1996-01-30 Hoffmann-La Roche Inc. Nucleic acid detection by the 5'-3'exonuclease activity of polymerases acting on adjacently hybridized oligonucleotides
US5210015A (en) * 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5804375A (en) * 1990-08-06 1998-09-08 Roche Molecular Systems, Inc. Reaction mixtures for detection of target nucleic acids
US5338848A (en) * 1991-04-04 1994-08-16 Basf Aktiengesellschaft Indolizinetrimethine dyes
US5338671A (en) * 1992-10-07 1994-08-16 Eastman Kodak Company DNA amplification with thermostable DNA polymerase and polymerase inhibiting antibody
US5985619A (en) * 1995-02-07 1999-11-16 Clinical Diagnostic Systems, Inc. Use of exonuclease and/or glycosylase as supplements to anti-polymerase antibody to increase specificity in polymerase chain reaction
US6020130A (en) * 1995-06-07 2000-02-01 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands that bind to and inhibit DNA polymerases
US5677152A (en) * 1995-08-25 1997-10-14 Roche Molecular Systems, Inc. Nucleic acid amplification using a reersibly inactivated thermostable enzyme
US5773258A (en) * 1995-08-25 1998-06-30 Roche Molecular Systems, Inc. Nucleic acid amplification using a reversibly inactivated thermostable enzyme
US6174670B1 (en) * 1996-06-04 2001-01-16 University Of Utah Research Foundation Monitoring amplification of DNA during PCR
US6569627B2 (en) * 1996-06-04 2003-05-27 University Of Utah Research Foundation Monitoring hybridization during PCR using SYBR™ Green I
US6421557B1 (en) * 1999-06-29 2002-07-16 Biotronik Mess-und Therapiegeräte GmbH & Co. Ingenieurbüro Berlin Method for determining the baroreflex latent period and baroreflex sensitivity
US20050221304A1 (en) * 2001-04-11 2005-10-06 Charlie Xiang Modified random primers for probe labeling
US6403341B1 (en) * 2001-08-02 2002-06-11 Wayne M. Barnes Magnesium precipitate hot start method for PCR
US20030118998A1 (en) * 2001-10-15 2003-06-26 Dean Frank B. Nucleic acid amplification
US6667165B2 (en) * 2001-11-13 2003-12-23 Eppendorf Ag Method and compositions for reversible inhibition of thermostable polymerases
US20070238117A1 (en) * 2006-03-22 2007-10-11 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Method for retaining methylation pattern in globally amplified dna

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011163120A1 (fr) 2010-06-21 2011-12-29 Life Technologies Corporation Compositions, méthodes et kits de synthèse et d'amplification d'acides nucléiques
US9005895B2 (en) 2010-06-21 2015-04-14 Life Technologies Corporation Compositions, methods and kits for nucleic acid synthesis and amplification
EP3109326A1 (fr) 2010-06-21 2016-12-28 Life Technologies Corporation Compositions, méthodes et kits de synthèse et d'amplification d'acides nucléiques avec rt
US11091801B2 (en) 2010-06-21 2021-08-17 Life Technologies Corporation Compositions, kits and methods for synthesis and/or detection of nucleic acids
US9932634B2 (en) 2012-05-24 2018-04-03 University Of Utah Research Foundation Methods for fast nucleic acid amplification
US10144960B2 (en) 2012-05-24 2018-12-04 University Of Utah Research Foundation Methods for fast nucleic acid amplification
US11021744B2 (en) 2012-05-24 2021-06-01 University Of Utah Research Foundation Methods for fast nucleic acid amplification
US11834708B2 (en) 2012-05-24 2023-12-05 University Of Utah Research Foundation Methods for fast nucleic acid amplification
WO2017079636A1 (fr) * 2015-11-05 2017-05-11 University Of Utah Research Foundation Pcr par transcription inverse extrême
US10900074B2 (en) 2015-11-05 2021-01-26 University Of Utah Research Foundation Extreme reverse transcription PCR
US11338296B2 (en) 2018-07-26 2022-05-24 Lex diagnostics Ltd. Variable temperature reactor, heater and control circuit for the same

Also Published As

Publication number Publication date
CA2658520C (fr) 2016-11-08
CA2658520A1 (fr) 2009-09-19
HK1142928A1 (zh) 2010-12-17
ES2450073T3 (es) 2014-03-21
US8592184B2 (en) 2013-11-26
JP2009225796A (ja) 2009-10-08
CN101691593B (zh) 2015-11-25
US20130109060A1 (en) 2013-05-02
EP2103693B1 (fr) 2013-12-11
JP5457055B2 (ja) 2014-04-02
EP2103693A1 (fr) 2009-09-23
CN101691593A (zh) 2010-04-07

Similar Documents

Publication Publication Date Title
US8592184B2 (en) Nucleic acid amplification in the presence of modified randomers
EP1989324B1 (fr) Pcr hot start par séquestration de magnésium
JP4718493B2 (ja) 核酸増幅中のプライマー凝集体形成を減少させるためのｄＵＴＰに基づく組成物
US8440406B2 (en) Amplification primers with non-standard bases for increased reaction specificity
JP2000505312A (ja) 標的核酸配列増幅
US7910720B2 (en) Polyanion for improved nucleic acid amplification
JP2005052143A (ja) ホットスタートリアルタイムポリメラーゼ連鎖反応のための新しい検出形式
US20210071243A1 (en) Method for primer extension reaction with improved specificity
US20210071244A1 (en) Method for the amplification of a nucleic acid with improved specificity
JP4104285B2 (ja) Ｄｎａ増幅方法及びそのキット
JP2003259882A (ja) 改良されたｐｃｒ用の試薬
EP1321532A1 (fr) Réactif pour PCR amélioré

Legal Events

Date Code Title Description
AS Assignment

Owner name: ROCHE DIAGNOSTICS GMBH, GERMANY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HEINDL, DIETER;ANKENBAUER, WALTRAUD;LAUE, FRANK;REEL/FRAME:022920/0001;SIGNING DATES FROM 20090622 TO 20090626

Owner name: ROCHE DIAGNOSTICS OPERATIONS, INC., INDIANA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ROCHE DIAGNOSTICS GMBH;REEL/FRAME:022920/0014

Effective date: 20090624

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

AS Assignment

Owner name: ROCHE MOLECULAR SYSTEMS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ROCHE DIAGNOSTICS OPERATIONS, INC.;REEL/FRAME:032038/0716

Effective date: 20140115