US20040131585A1 - Identification and use og human bone marrow-derived endothelial progenitor cells to improve myocardial function after ischemic injury - Google Patents
Identification and use og human bone marrow-derived endothelial progenitor cells to improve myocardial function after ischemic injury Download PDFInfo
- Publication number
- US20040131585A1 US20040131585A1 US10/220,554 US22055403A US2004131585A1 US 20040131585 A1 US20040131585 A1 US 20040131585A1 US 22055403 A US22055403 A US 22055403A US 2004131585 A1 US2004131585 A1 US 2004131585A1
- Authority
- US
- United States
- Prior art keywords
- subject
- cells
- endothelial progenitor
- progenitor cells
- tissue
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/195—Chemokines, e.g. RANTES
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/44—Vessels; Vascular smooth muscle cells; Endothelial cells; Endothelial progenitor cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/193—Colony stimulating factors [CSF]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/08—Vasodilators for multiple indications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2866—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/069—Vascular Endothelial cells
- C12N5/0692—Stem cells; Progenitor cells; Precursor cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/21—Chemokines, e.g. MIP-1, MIP-2, RANTES, MCP, PF-4
Definitions
- cytokine-mobilized autologous human bone marrow-derived angioblasts for revascularization of myocardial infarct tissue, alone or in conjunction with currently used therapies, offers the potential to significantly reduce morbidity and mortality associated with left ventricular remodeling post-myocardial infarction.
- hypoxia directly stimulates collagen secretion by cardiac fibroblasts, while inhibiting DNA synthesis and cellular proliferation (6).
- late reperfusion following experimental myocardial infarction at a point beyond myocardial salvage significantly benefits remodeling (7).
- the presence of a patent infarct related artery is consistently associated with survival benefits in the post-infarction period in humans (8). This appears to be due to adequate reperfusion of the infarct vascular bed which modifies the ventricular remodeling process and prevents abnormal changes in wall motion (9).
- vasculogenesis 14-16
- precursor cells derived from the ventral endothelium of the aorta in human and lower species have been shown to give rise to cellular elements involved in both the processes of vasculogenesis and hematopoiesis (17,18).
- embryonic hemangioblasts are characterized by expression of CD34, CD117 (stem cell factor receptor), Flk-1 (vascular endothelial cell growth factor receptor-2, VEGFR-2), and Tie-2 (angiopoietin receptor), and have been shown to have high proliferative potential with blast colony formation in response to VEGF (19-22).
- CD34 stem cell factor receptor
- Flk-1 vascular endothelial cell growth factor receptor-2, VEGFR-2
- Tie-2 angiopoietin receptor
- VEGF receptors as well as GATA-2 and alpha4-integrins (24).
- the first series of experiments of the present invention shows that GATA-2 positive stem cell precursors are also present in adult human bone marrow, demonstrate properties of hemangioblasts, and can be used to induce vasculogenesis, thus preventing remodeling and heart failure in experimental myocardial infarction.
- vasculogenesis Growth of new vessels from pre-existing mature endothelium has been termed angiogenesis, and can be regulated by many factors including certain CXC chemokines (47-50).
- vasculogenesis is mediated by bone marrow-derived endothelial precursors (51-53) with phenotypic characteristics of embryonic angioblasts and growth/differentiation properties regulated by receptor tyrosine kinases such as vascular endothelial growth factor (VEGF) (54-57).
- VEGF vascular endothelial growth factor
- Therapeutic vasculogenesis 58-61) has the potential to improve perfusion of ischemic tissues, however the receptor/ligand interactions involved in selective trafficking of endothelial precursors to sites of tissue ischemia are not known.
- vasculogenesis can develop in infarcted myocardium as a result of interactions between CXC receptors on human bone marrow-derived angioblasts and ELR-positive CXC chemokines induced by ischemia, including IL-8 and Gro-alpha.
- redirected trafficking of angioblasts from the bone marrow to ischemic myocardium can be achieved by blocking CXCR4/SDF-1 interactions, resulting in increased vasculogenesis, decreased myocardial death and fibrous replacement, and improved cardiac function.
- CXC chemokines including IL-8, Gro-alpha, and stromal-derived factor-1 (SDF-1), play a central role in regulating vasculogenesis in the adult human, and suggest that manipulating interactions between CXC chemokines and their receptors on bone marrow-derived angioblasts can lead to optimal therapeutic vasculogenesis and salvage of ischemic tissues.
- SDF-1 stromal-derived factor-1
- the angiogenic response during wound repair or inflammation is thought to result from changes in adhesive interactions between endothelial cells in pre-existing vasculature and extracellular matrix which are regulated by locally-produced factors and which lead to endothelial cell migration, proliferation, reorganization and microvessel formation (70).
- the human CXC chemokine family consists of small ( ⁇ 10 kD) heparin-binding polypeptides that bind to and have potent chemotactic activity for endothelial cells.
- CXC chemokines such as IL-8 and Gro-alpha to CXC receptors 1 and 2 on endothelial cells (49,71), thus promoting endothelial chemotaxis and angiogenesis (47-48).
- CXC chemokines lacking the ELR motif bind to different CXC receptors and inhibit growth-factor mediated angiogenesis (49-72).
- SDF-1 an ELR-negative CXC chemokine
- CXCR4 CXCR4
- Vasculogenesis first occurs during the pre-natal period, with haemangioblasts derived from the human ventral aorta giving rise to both endothelial and haematopoietic cellular elements (74,75). Similar endothelial progenitor cells have recently been identified in adult human bone marrow (51-53), and shown to have the potential to induce vasculogenesis in ischemic tissues (59-61). However, the signals from ischemic sites required for chemoattraction of such bone marrow-derived precursors, and the receptors used by these cells for selective trafficking to these sites, are unknown.
- This invention provides a method of stimulating vasculogenesis in ischemia-damaged tissue of a subject comprising:
- step (b) recovering endothelial progenitor cells from the stem cells removed in step (a);
- step (c) introducing the endothelial progenitor cells from step (b) into a different location within the subject such that the endothelial progenitor cells stimulate vasculogenesis in the subject's ischemia-damaged tissue.
- This invention also provides the instant method, wherein subsequent to step (b), but before step (c), the endothelial progenitor cells are expanded by contacting them with a growth factor.
- This invention also provides the instant method, wherein the growth factor is a cytokine.
- This invention also provides the instant method, wherein the cytokine is VEGF, FGF, G-CSF, IGF, M-CSF, or GM-CSF.
- This invention also provides the instant method, wherein the growth factor is a chemokine.
- This invention also provides the instant method, wherein the chemokine is Interleukin-8.
- This invention also provides the instant method, wherein the endothelial progenitor cells are separated from other stem cells before expansion.
- This invention also provides the instant method, wherein the ischemia-damaged tissue is myocardium.
- This invention also provides the instant method, wherein the ischemia-damaged tissue is nervous system tissue.
- This invention also provides the instant method, wherein the stem cells are removed from the subject's bone marrow.
- This invention also provides the instant method, wherein the removal of the stem cells from the bone marrow is effected by aspiration from the subject's bone marrow.
- This invention also provides the instant method, wherein the removal of the stem cells from the subject is effected by a method comprising:
- This invention also provides the instant method, wherein the growth factor is introduced into the subject subcutaneously, orally, intravenously or intramuscularly.
- This invention also provides the instant method, wherein the growth factor is a chemokine that induces mobilization.
- This invention also provides the instant method, wherein the chemokine is Interleukin-8.
- This invention also provides the instant method, wherein the growth factor is a cytokine.
- This invention also provides the instant method, wherein the cytokine is G-CSF, M-CSF, or GM-CSF.
- This invention also provides the instant method, wherein the endothelial progenitor cells are recovered based upon their expression of CD117.
- This invention also provides the instant method, wherein the endothelial progenitor cells are recovered based upon their expression of a GATA-2 activated gene product.
- This invention also provides the instant method, wherein the endothelial progenitor cells are recovered based upon their expression of one or more of CD34, VEGF-R, Tie-2, GATA-3 or AC133.
- This invention also provides the instant method, wherein the subject has suffered or is suffering from one or more of the following: myocardial infarction, chronic heart failure, ischemic heart disease, coronary artery disease, diabetic heart disease, hemorrhagic stroke, thrombotic stroke, embolic stroke, limb ischemia, or another disease in which tissue is rendered ischemic.
- This invention also provides the instant method, wherein step (a) occurs prior to the subject suffering ischemia-damaged tissue and wherein step (c) occurs after the subject has suffered ischemia-damaged tissue.
- This invention also provides the instant method, wherein the endothelial progenitor cells are frozen for a period of time between steps (b) and (c).
- This invention also provides the instant method, wherein the endothelial progenitor cells are frozen for a period of time after being expanded but before step (c) is performed.
- This invention also provides the instant method, wherein the endothelial progenitor cells are introduced into the subject by injection directly into the peripheral circulation, heart muscle, left ventricle, right ventricle, coronary artery, cerebro-spinal fluid, neural tissue, ischemic tissue, or post-ischemic tissue.
- This invention also provides the instant method, further comprising administering to the subject one or more of the following: an inhibitor of Plasminogen Activator Inhibitor, Angiotensin Converting Enzyme Inhibitor or a beta blocker, wherein such administration occurs prior to, concomitant with, or following step (c).
- This invention also provides a method of stimulating angiogenesis in peri-infarct tissue in a subject comprising:
- step (b) recovering endothelial progenitor cells from the stem cells removed in step (a);
- step (c) expanding the endothelial progenitor cells recovered in step (b) by contacting the progenitor cells with a growth factor;
- step (d) introducing the expanded endothelial progenitor cells from step (c) into a different location in the subject such that the endothelial progenitor cells stimulate angiogenesis in peri-infarct tissue in the subject.
- This invention also provides a method of selectively increasing the trafficking of endothelial progenitor cells to ischemia-damaged tissue in a subject comprising:
- This invention also provides the instant method, wherein the chemokine is administered to the subject prior to administering the endothelial progenitor cells.
- This invention also provides the instant method, wherein the chemokine is administered to the subject concurrently with the endothelial progenitor cells.
- This invention also provides the instant method, wherein the chemokine is administered to the subject after administering the endothelial progenitor cells.
- This invention also provides the instant method, wherein the chemokine is a CXC chemokine.
- This invention also provides the instant method, wherein the CXC chemokine is selected from the group consisting of Interleukin-8, Gro-Alpha, or Stromal-Derived Factor-1.
- This invention also provides the instant method, wherein the chemokine is a CC chemokine.
- CC chemokine is selected from the group consisting of RANTES, EOTAXIN, MCP-1, MCP-2, MCP-3, or MCP-4.
- This invention also provides the instant method, wherein the chemokine is administered to the subject by injection into the subject's peripheral circulation, heart muscle, left ventricle, right ventricle, coronary arteries, cerebro-spinal fluid, neural tissue, ischemic tissue, or post-ischemic tissue.
- This invention also provides a method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue in a subject comprising inhibiting any interaction between Stromal-Derived Factor-1 and CXCR4.
- This invention also provides the instant method, wherein interaction between Stromal-Derived Factor-1 (SDF-1)and CXCR4 is inhibited by administration of an anti-SDF-1 or an anti-CXCR4 monoclonal antibody to the subject.
- SDF-1 Stromal-Derived Factor-1
- CXCR4 monoclonal antibody
- This invention also provides the instant method, further comprising administering to the subject an angiotensin converting enzyme inhibitor, an AT 1 -receptor blocker, or a beta blocker.
- This invention also provides a method of reducing trafficking of endothelial progenitor cells to bone marrow in a subject comprising inhibiting production of Stromal-Derived Factor-1 in the subject's bone marrow.
- This invention also provides the instant method, wherein SDF-1 production is inhibited by administration of an anti-SDF-1 or anti-CXCR4 monoclonal antibody to the subject.
- This invention also provides a method for treating a cancer in a subject comprising administering to the subject a monoclonal antibody directed against an epitope of a specific chemokine produced by proliferating cells associated with the cancer so as to reduce trafficking of endothelial progenitor cells to such proliferating cells and thereby treat the cancer in the subject.
- This invention also provides a method for treating a cancer in a subject comprising administering to the subject a monoclonal antibody directed against an epitope of a specific receptor located on an endothelial progenitor cell, for a chemokine produced by proliferating cells associated with the cancer, so as to reduce trafficking of the endothelial progenitor cell to such proliferating cells and thereby treat the cancer in the subject.
- This invention also provides a method for treating a tumor in a subject comprising administering to the subject an antagonist to a specific receptor on an endothelial progenitor cell so as to reduce the progenitor cell's ability to induce vasculogenesis in the subject's tumor and thereby treat the tumor.
- This invention also provides a method for treating a tumor in a subject comprising administering to the subject an antagonist to a specific receptor on an endothelial progenitor cell so as to reduce the progenitor cell's ability to induce angiogenesis in the subject's tumor and thereby treat the tumor.
- This invention also provides the instant method, wherein the receptor is a CD117 receptor.
- This invention also provides a method for expressing a gene of interest in an endothelial progenitor cell or a mast progenitor cell which comprises inserting into the cell a vector comprising a promoter containing a GATA-2 motif and the gene of interest.
- This invention also provides the instant method, wherein the vector is inserted into the cell by transfection.
- This invention also provides the instant method, wherein the promoter is a preproendothelin-1 promoter.
- This invention also provides the instant method, wherein the promoter is of mammalian origin.
- This invention also provides the instant method, wherein the promoter is of human origin.
- This invention provides a composition comprising an amount of a monoclonal antibody directed against an epitope of a specific chemokine produced by a cancer effective to reduce trafficking of endothelial progenitor cells to the cancer, and a pharmaceutically acceptable carrier.
- This invention provides a method of treating an abnormality in a subject wherein the abnormality is treated by the expression of a GATA-2 activated gene product in the subject comprising:
- step (b) recovering endothelial progenitor cells from the stem cells removed in step (a);
- step (d) inducing the cells recovered in step (c) as expressing GATA-2 to express a GATA-2 activated gene product
- step (e) introducing the cells expressing a GATA-2 activated gene product from step (d) into a different location in the subject such as to treat the abnormality.
- This invention provides a method of treating an abnormality in a subject wherein the abnormality is treated by the expression of a GATA-2 activated gene product in the subject comprising:
- step (b) recovering mast progenitor cells from the stem cells removed in step (a);
- step (d) inducing the cells recovered in step (c) as expressing GATA-2 to express a GATA-2 activated gene product
- step (e) introducing the cells expressing a GATA-2 activated gene product from step (d) into a different location in the subject such as to treat the abnormality
- This invention provides the instant method, wherein the abnormality is ischemia-damaged tissue.
- This invention provides the instant method, wherein the gene product is proendothelin.
- This invention provides the instant method, wherein the gene product is endothelin.
- This invention provides the a method of improving myocardial function in a subject that has suffered a myocardial infarct comprising:
- This invention provides the instant methods, wherein the subject is of mammalian origin.
- This invention provides the instant method, wherein the mammal is of human origin.
- This invention also provides a method of stimulating vasculogenesis in ischemia-damaged tissue in a subject comprising:
- step (b) recovering endothelial progenitor cells from the stem cells removed in step (a);
- step (c) introducing the endothelial progenitor cells recovered in step (b) into the subject such that the endothelial progenitor cells stimulate vasculogenesis in the subject's ischemia-damaged tissue.
- This invention provides the instant method, wherein the allogeneic stem cells are obtained from embryonic, fetal or cord blood sources.
- This invention provides a method of stimulating angiogenesis in ischemia-damaged tissue in a subject comprising:
- step (c) introducing the endothelial progenitor cells recovered in step (b) into the subject such that the endothelial progenitor cells stimulate angiogenesis in the subject's ischemia-damaged tissue.
- This invention provides the instant method, wherein the allogeneic stem cells are obtained from embryonic, fetal or cord blood sources.
- This invention also provides a method of improving myocardial function in a subject that has suffered a myocardial infarct comprising injecting G-CSF into the subject in order to mobilize endothelial progenitor cells.
- This invention also provides a method of improving myocardial function in a subject that has suffered a myocardial infarct comprising injecting anti-CXCR4 antibody into the subject.
- This invention also provides the instant method further comprising introducing endothelial progenitor cells into the subject.
- This invention also provides the instant method further comprising introducing G-CSF into the subject in order to mobilize endothelial progenitor cells.
- FIG. 1 G-CSF Mobilizes Two Human Bone Marrow-Derived Populations Expressing VEGF Receptors: One With Characteristics Of Mature Endothelial Cells. And A Second With Characteristics Of Embryonic Angioblasts.
- A-D depicts four-parameter flow cytometric phenotype characterization of G-CSF mobilized bone marrow-derived cells removed by leukopharesis from a representative human donor adult (25). Only live cells were analyzed, as defined by 7-AAD staining. For each marker used, shaded areas represent background log fluorescence relative to isoytpe control antibody.
- the CD34+CD117 dim subset contains a population with phenotypic characteristics of mature, vascular endothelium.
- the CD34+CD117 bright subset contains a population expressing markers characteristic of primitive hemangioblasts arising during waves of murine and human embryogenesis.
- CD34+CD117 bright cells co-expressing GATA-2 and GATA-3 also express AC133, another marker which defines hematopoietic cells with angioblast potential.
- FIG. 2 Bone Marrow-Derived Angioblasts (BA) Have Greater Proliferative Activity In Response To Both VEGF And Ischemic Serum Than Bone Marrow-Derived Endothelial Cells (BMEC).
- BA Bone Marrow-Derived Angioblasts
- BMEC Bone Marrow-Derived Endothelial Cells
- FIG. 3 Highly Purified Human Bone Marrow-Derived CD34 Cells Differentiate Into Endothelial Cells After in Vitro Culture.
- FIG. 4 In vivo migratory and proliferative characteristics of bone marrow- and peripheral vasculature-derived human cells after induction of myocardial ischemia.
- A-C Intravenous injection of 2 ⁇ 10 6 DiI-labeled human CD34-enriched cells (>95% CD34 purity), CD34-negative cells ( ⁇ 5% CD34 purity), or saphenous vein endothelial cells (SVEC), into nude rats after coronary artery ligation and infarction. Each human cellular population caused a similar degree of infiltration in infarcted rat myocardium at 48 hours.
- GATA-2 mRNA in ischemic tissue is expressed as the fold increase above that present under the same experimental condition in the absence of ischemia.
- Bone marrow from ischemic rats receiving either CD34+ or CD34 ⁇ cells contained similar levels of human GATA-2 mRNA, and showed a similar fold induction in GATA-2 mRNA expression after ischemia.
- ischemic hearts of rats receiving CD34+ cells contained much higher levels of human GATA-2 mRNA than those receiving CD34 ⁇ cells.
- F Consecutive sections of a blood vessel within the infarct bed of a nude rat two weeks after injection of human CD34+ cells.
- the vessel incorporates human endothelial cells, as defined by co-expression of DiI, HLA class I as measured by immunofluorescence using a fluorescein-conjugated mAb, and factor VIII, as measured by immunoperoxidase using a biotin-conjugated mAb.
- FIG. 5 Injection of G-CSF Mobilized Human CD34+ Cells Into Rats With Acute Infarction Improves Myocardial Function.
- A-D compares the functional effects of injecting 2 ⁇ 10 6 G-CSF mobilized human CD34+ (>95% purity) cells, CD34 ⁇ ( ⁇ 5% purity) cells, peripheral saphenous vein cells, or saline, into infarcted rat myocardium.
- LVEF left ventricular ejection fraction
- LVA left ventricular end-systolic area
- FIG. 6 Injection Of G-CSF Mobilized Human CD34+ Cells Into Rats With Acute Infarction Induces Neo-Angiogenesis And. Modifies The Process Of Myocardian Remodeling.
- A-D depicts infarcted rat myocardium at two weeks post-LAD ligation from representative experimental and control animals stained with either hematoxylin and eosin (A,B) or immunoperoxidase following binding of anti-factor VIII mAb (C,D).
- E,F depicts Mason trichrome stain of infarcted rat myocardium from representative control and experimental animals at 15 weeks post-LAD ligation.
- G depicts between-group differences in % scar/normal left ventricular tissue at 15 weeks.
- Infarct zone of rat injected with human CD34+ cells demonstrates significant increase in microvascularity and cellularity of granulation tissue, numerous capillaries (arrowheads), feeding vessels (arrow), and decrease in matrix deposition and fibrosis (x200).
- the collagen rich myocardial scar in the anterior wall of the left ventricle (ant.) stains blue and viable myocardium stains red.
- Focal islands of collagen deposition (blue) are also present in the posterior wall of the left ventricle (post).
- trichrome stain of rat myocardium at 15 weeks post-infarction in rat receiving highly purified CD34+ cells demonstrates significantly reduced infarct zone size together with increased mass of viable myocardium within the anterior wall (ant.) and normal EKG. Numerous vessels are evident at the junction of the infarct zone and viable myocardium. There is no focal collagen deposition in the left ventricular posterior wall (post).
- Rats receiving CD34+ cells had a significant reduction in mean size of scar tissue relative to normal left ventricular myocardium compared with each of the other groups (p ⁇ 0.01).
- Infarct size involving both epicardial and endocardial regions, was measured with a planimeter digital image analyzer and expressed as a percentage of the total ventricular circumference at a given slice. For each animal, final infarct size was calculated as the average of 10-15 slices.
- FIG. 7 Human Adult Bone Marrow-Derived Endothelial Precursor Cells Infiltrate Ischemic Myocardium, Inducing Infarct Bed Neoangiogenesis And Preventing Collagen Deposition.
- the CD34+CD117 bright subset contains a population expressing markers characteristic of primitive haemangioblasts arising during waves of murine and human embryogenesis, but not markers of mature endothelium. These cells also express CXC chemokine receptors.
- B DiI-labeled human CD34-enriched cells (>98% CD34 purity) injected intravenously into nude rats infiltrate rat myocardium after coronary artery ligation and infarction but not after sham operation at 48 hours.
- C The myocardial infarct bed at two weeks post-LAD ligation from representative rats receiving 2.0 ⁇ 10 6 G-CSF mobilized human bone marrow-derived cells at 2%, 40%, or 98% CD34+ purity, and stained with either Masson's trichrome or immunoperoxidase.
- the infarct zones of rats receiving either 2% or 40% pure CD34+ cells show myocardial scars composed of paucicellular, dense fibrous tissue stained blue (x400).
- the infarct zone of the rat injected with 98% pure human CD34+ cells demonstrates significant increase in microvascularity and cellularity of granulation tissue, numerous capillaries, and minimal matrix deposition and fibrosis (x400).
- immunoperoxidase staining following binding of anti-factor VIII mAb shows that the infarct bed of the rat injected with 98% pure CD34+ cells demonstrates markedly increased numbers of factor VIII-positive capillaries, which are not seen in either of the other animals (x400).
- FIG. 8 Migration Of Human Bone Marrow-Derived Endothelial Precursor Cells To The Site Of Infarction Is Dependent On Interactions Between CXCR1/2 And IL-8/Gro-Alpha Induced By Myocardial Ischemia.
- A,B Time-dependent increase in rat myocardial IL-8 and Gro-alpha mRNA expression relative to GAPDH from rats undergoing LAD ligation.
- D Time-dependent measurement of rat IL-8/Gro-alpha protein in serum of rats undergoing LAD ligation. Migration of CD34+ human bone marrow-derived cells to ischemic rat myocardium is inhibited by mAbs against either rat IL-8 or the IL-8/Gro chemokine family receptors CXCR1 and CXCR2 (all p ⁇ 0.01), but not against VEGF or its receptor Flk-1 (results are expressed as mean ⁇ sem of three separate experiments).
- FIG. 9. CXC Chemokines Directly Induce Chemotaxis Of Bone Marrow-Derived Human CD34+ Cells To Rat Myocardium.
- a and B depict results of in vitro chemotaxis of 98% pure human CD34+ cells to various conditions using a 48-well chemotaxis chamber (Neuro Probe, Md.). Chemotaxis is defined as the number of migrating cells per high power field (hpf) after examination of 10 hpf per condition tested.
- IL-8 induces chemotaxis in a dose-dependent manner (results are expressed as mean ⁇ sem of three separate experiments).
- Chemotaxis is increased in response to IL-8 and SDF-1 alpha/beta, but not VEGF or SCF.
- FIG. 10 Blocking CXCR4/SDF-1 Interactions Redirects Intravenously Injected Human CD34+ Angioblasts From Bone Marrow To Ischemic Myocardium.
- CD117 bright GATA-2 pos cells were quantitated by both [ 3 H] thymidine uptake and by flow cytometry. Ischemic serum induced a greater proliferative response of CD117 bright GATA-2 pos cells compared with each of the other conditions (both p ⁇ 0.01).
- C,D Effects of mAbs against CXCR4, SDF-1 or anti-CD34 on trafficking of human CD34+ cells to rat bone marrow and myocardium following LAD ligation.
- Co-administration of anti-CXCR4 or anti-SDF-1 significantly reduced trafficking of 98% pure CD34+ cells to rat bone marrow at 48 hours and increased trafficking to ischemic myocardium (results are expressed as mean ⁇ sem of bone marrow and cardiac studies performed in three LAD-ligated animals at 48 hours after injection).
- FIG. 11 Redirected Trafficking Of Human CD34+ Angioblasts To The Site Of Infarction Prevents Remodeling And Improves Myocardial Function.
- A,B The effects of human CD34+ cells on reduction in LVAs (A) and improvement in LVEF (B) after myocardial infarction.
- injection of 2.0 ⁇ 10 6 human cells containing 98% CD34+ purity significantly improved LVEF and reduced LVAs (both p ⁇ 0.0l)
- injection of 2.0 ⁇ 10 6 human cells containing 2% and 40% CD34+ purity did not have any effect on these parameters in comparison to animals receiving saline.
- co-administration of anti-CXCR4 together with 40% pure CD34+ cells significantly improved LVEF and reduced LVAs (both p ⁇ 0.0l), to levels approaching use of cells with 98% purity.
- FIG. 12 Culture of CD34+CD117 bright angioblasts with serum from LAD-ligated rats increases surface expression of CCR1 and CCR2, while surface expression of CCR3 and CCR5 remains unchanged.
- FIG. 13 Infarcted myocardium demonstrate a time-dependent increase in mRNA expression of several CCR-binding chemokines.
- FIG. 14 Co-administration of blocking mabs against MCP-1, MCP-3, and RANTES, or against eotaxin, reduced myocardial trafficking of human angioblasts by 40-60% relative to control antibodies (p ⁇ 0.01).
- FIG. 15 Intracardiac injection of eotaxin into non-infarcted hearts induced 1.5-1.7 fold increase in CD34+ angioblast trafficking whereas injection of the growth factors VEGF and stem cell factor had no effect on chemotaxis despite increasing angioblast proliferation (not shown).
- BMEC bone marrow-derived endothelial cells
- vasculogenesis is defined as the creation of new blood vessels from cells that are “pre-blood” cells such as bone marrow-derived endothelial cell precursors.
- mobilization is defined as inducing bone marrow-derived endothelial cell precursors to leave the bone marrow and enter the peripheral circulation.
- mobilized stem cells may be removed from the body by leukopheresis.
- ischemia is defined as inadequate blood supply (circulation) to a local area due to blockage of the blood vessels to the area.
- cytokine is defined as a factor that causes cells to grow or activate.
- chemokine is defined as a factor that causes cells to move to a different area within the body.
- ischemic heart disease is defined as any condition in which blood supply to the heart is decreased.
- angiogenesis is defined as the creation of blood vessels from pre-existing blood vessel cells.
- ischemic heart disease is defined as any condition in which blood supply to the heart is decreased.
- VEGF vascular endothelial growth factor
- VEGF-R vascular endothelial growth factor receptor
- FGF fibroblast growth factor
- IGF Insulin-like growth factor
- SCF stem cell factor
- G-CSF granulocyte colony stimulating factor
- M-CSF macrophage colony stimulating factor
- GM-CSF granulocyte-macrophage colony stimulating factor
- MCP monocyte chemoattractant protein.
- CXC chemokine refers to the structure of the chemokine.
- Each “C” represents a cysteine and “X” represents any amino acid.
- CC chemokine refers to the structure of the chemokine.
- Each “C” represents a cysteine.
- recovered means detecting and obtaining a cell based on the recoverable cell being a cell that binds a detectably labeled antibody directed against a specific marker on a cell including, but not limited to, CD117, GATA-2, GATA-3, and CD34.
- the chemokine administered to the subject could be in the protein form or nucleic acid form.
- This invention provides a method of stimulating vasculogenesis in ischemia-damaged tissue of a subject comprising:
- step (c) introducing the endothelial progenitor cells from step (b) into a different location within the subject such that the endothelial progenitor cells stimulate vasculogenesis in the subject's ischemia-damaged tissue.
- the endothelial progenitors are frozen for a period of time in between steps (b) and (c)
- the ischemia-damaged tissue is myocardium.
- the ischemia-damaged tissue is nervous system tissue.
- the endothelial progenitors are expanded by contacting the endothelial progenitors with a growth factor subsequent to step (b), but before step (c).
- the growth factor is a cytokine.
- the cytokine is VEGF, FGF, G-CSF, IGF, M-CSF, or GM-CSF.
- the growth factor is a chemokine.
- the chemokine is Interleukin-8.
- the endothelial progenitors are separated from other stem cells before expansion.
- the endothelial progenitors are frozen for a period of time after expansion but before step (c).
- step (a) occurs prior to the subject suffering ischemia-damaged tissue and wherein step (c) occurs after the subject has suffered ischemia-damaged tissue.
- the stem cells are removed directly from the subject's bone marrow. In a further embodiment the stem cells are removed by aspiration from the subject's bone marrow. In one embodiment the stem cells are removed from the subject by a method comprising:
- the growth factor is introduced subcutaneously, orally, intravenously or intramuscularly.
- the growth factor is a chemokine that induces mobilization.
- the chemokine is Interleukin-8.
- the growth factor is a cytokine.
- the cytokine is G-CSF, M-CSF, or GM-CSF.
- This invention also provides the instant method, wherein the endothelial progenitor cells are recovered based upon their expression of CD117.
- This invention also provides the instant method, wherein the endothelial progenitor cells are recovered based upon their expression of a GATA-2 activated gene product.
- the gene product is selected from the following group: preproendothelin-1, big endothelin, endothelin-1.
- the endothelial progenitors express GATA-2, and the endothelial progenitors are recovered as such by detection of intracellular GATA-2 expression or GATA-2 activity in those cells.
- the subject has suffered or is suffering from one or more of the following: myocardial infarction, chronic heart failure, ischemic heart disease, coronary artery disease, diabetic heart disease, hemorrhagic stroke, thrombotic stroke, embolic stroke, limb ischemia or another, disease in which tissue is rendered ischemic.
- the endothelial progenitors are introduced into the subject by injection directly into the peripheral circulation, heart muscle, left ventricle, right ventricle, coronary artery, cerebro-spinal fluid, neural tissue, ischemic tissue or post-ischemic tissue.
- the method further comprises administering to the subject one or more of the following: an inhibitor of Plasminogen Activator Inhibitor, Angiotensin Converting Enzyme Inhibitor or a beta blocker, wherein such administration occurs prior to, concomitant with, or following step (c).
- This invention also provides a method of stimulating angiogenesis in peri-infarct tissue in a subject comprising:
- step (c) expanding the endothelial progenitor cells recovered in step (b) by contacting the progenitor cells with a growth factor
- step (d) introducing the expanded endothelial progenitor cells from step (c) into a different location in the subject such that the endothelial progenitor cells stimulate angiogenesis in peri-infarct tissue in the subject.
- This invention also provides a method of selectively increasing the trafficking of endothelial progenitor cells to ischemia-damaged tissue in a subject comprising:
- the chemokine is administered to the subject prior to administering the endothelial progenitors. In an alternative embodiment the chemokine is administered to the subject concurrently with the endothelial progenitors. In an alternative embodiment the chemokine is administered to the subject after administering the endothelial progenitors. In one embodiment the chemokine is a CXC chemokine. In a further embodiment the CXC chemokine is selected from the group consisting of Interleukin-8, Gro-Alpha, or Stromal-Derived Factor-1. In one embodiment the chemokine is a CC chemokine. In a further embodiment the CC chemokine is selected from the group consisting of RANTES, EOTAXIN, MCP-1, MCP-2, MCP-3, or MCP-4.
- the chemokine is administered to the subject by injection into peripheral circulation, heart muscle, left ventricle, right ventricle, coronary arteries, cerebro-spinal fluid, neural tissue, ischemic tissue or post-ischemic tissue.
- This invention also provides a method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue in a subject comprising inhibiting any interaction between Stromal-Derived Factor-1 and CXCR4.
- the interaction between Stromal-Derived Factor-1 (SDF-1)and CXCR4 is inhibited by administration of an anti-SDF-1 or an anti-CXCR4 monoclonal antibody to the subject.
- the instant method further comprises administering to the subject ACE inhibitor, AT-receptor blocker, or beta blocker. ng enzyme inhibitor, an AT 1 -receptor blocker, or a beta blocker.
- This invention also provides a method of reducing trafficking of endothelial progenitor cells to bone marrow in a subject comprising inhibiting production of Stromal-Derived Factor-1 in the subject's bone marrow.
- the SDF-1 production is inhibited by administration of an anti-SDF-1 or anti-CXCR4 monoclonal antibody to the subject.
- This invention also provides a method for treating a cancer in a subject comprising administering to the subject a monoclonal antibody directed against an epitope of a specific chemokine produced by proliferating cells associated with the cancer so as to reduce trafficking of endothelial progenitor cells to such proliferating cells and thereby treat the cancer in the subject.
- This invention also provides a method for treating a cancer in a subject comprising administering to the subject a monoclonal antibody directed against an epitope of a specific receptor located on an endothelial progenitor cell, for a chemokine produced by proliferating cells associated with the cancer, so as to reduce trafficking of the endothelial progenitor cell to such proliferating cells and thereby treat the cancer in the subject.
- This invention also provides a method for treating a tumor in a subject comprising administering to the subject an antagonist to a specific receptor on an endothelial progenitor cell so as to reduce the progenitor cell's ability to induce vasculogenesis in the subject's tumor and thereby treat the tumor.
- This invention also provides a method for treating a tumor in a subject comprising administering to the subject an antagonist to a specific receptor on an endothelial progenitor cell so as to reduce the progenitor cell's ability to induce angiogenesis in the subject's tumor and thereby treat the tumor.
- This invention also provides a method for expressing a gene of interest in an endothelial progenitor cell or a mast progenitor cell which comprises inserting into the cell a vector comprising a promoter containing a GATA-2 motif and the gene of interest.
- This invention also provides the instant method, wherein the vector is inserted into the cell by transfection.
- This invention also provides the instant method, wherein the promoter is a preproendothelin-1 promoter.
- This invention also provides the instant method, wherein the promoter is of mammalian origin.
- This invention also provides the instant method, wherein the promoter is of human origin.
- This invention provides a composition comprising an amount of a monoclonal antibody directed against an epitope of a specific chemokine produced by a cancer effective to reduce trafficking of endothelial progenitor cells to the cancer, and a pharmaceutically acceptable carrier.
- This invention provides a method of treating an abnormality in a subject wherein the abnormality is treated by the expression of a GATA-2 activated gene product in the subject comprising:
- step (b) recovering endothelial progenitor cells from the stem cells removed in step (a);
- step (d) inducing the cells recovered in step (c) as expressing GATA-2 to express a GATA-2 activated gene product
- step (e) introducing the cells expressing a GATA-2 activated gene product from step (d) into a different location in the subject such as to treat the abnormality.
- the abnormality is ischemia-damaged tissue.
- the gene product is proendothelin.
- the gene product is endothelin.
- the subject is a mammal. In a further embodiment the mammal is a human
- This invention provides a method of treating an abnormality in a subject wherein the abnormality is treated by the expression of a GATA-2 activated gene product in the subject comprising:
- step (d) inducing the cells recovered in step (c) as expressing GATA-2 to express a GATA-2 activated gene product
- step (e) introducing the cells expressing a GATA-2 activated gene product from step (d) into a different location in the subject such as to treat the abnormality
- the abnormality is ischemia-damaged tissue.
- the gene product is proendothelin.
- the gene product is endothelin.
- the subject is a mammal. In a further embodiment the mammal is a human
- This invention provides the a method of improving myocardial function in a subject that has suffered a myocardial infarct comprising:
- the subject is a mammal. In a further embodiment the mammal is a human.
- This invention also provides a method of stimulating vasculogenesis in ischemia-damaged tissue in a subject comprising:
- step (c) introducing the endothelial progenitor cells recovered in step (b) into the subject such that the endothelial progenitor cells stimulate vasculogenesis in the subject's ischemia-damaged tissue.
- the allogeneic stem cells are removed from embryonic, fetal or cord blood sources.
- This invention provides a method of stimulating angiogenesis in ischemia-damaged tissue in a subject comprising:
- step (c) introducing the endothelial progenitor cells recovered in step (b) into the subject such that the endothelial progenitor cells stimulate angiogenesis in the subject's ischemia-damaged tissue.
- the allogeneic stem cells are removed from embryonic, fetal or cord blood sources.
- This invention also provides a method of improving myocardial function in a subject that has suffered a myocardial infarct comprising injecting G-CSF into the subject in order to mobilize endothelial progenitor cells.
- This invention also provides a method of improving myocardial function in a subject that has suffered a myocardial infarct comprising injecting anti-CXCR4 antibody into the subject.
- the method further comprises introducing endothelial progenitors into the subject.
- the method further comprises introducing G-CSF into the subject in order to mobilize endothelial progenitors.
- FIG. 1 a Following G-CSF mobilization, 60-80% of highly purified human CD34 cells (>90% positive) co-expressed the stem cell factor receptor CD117, FIG. 1 a , of which 15-25% expressed CD117 brightly and 75-85% expressed CD117 dimly.
- VEGFR-2 Flk-1
- FIG. 1 b Two populations of CD34 cells were recovered which expressed VEGFR-2 (Flk-1), one accounting for 20-30% of CD117 dim cells and expressing high levels of VEGFR-2, and a second accounting for 10-15% of CD117 bright cells and expressing lower levels of VEGFR-2, FIG. 1 b .
- CD117 bright cells which co-expressed GATA-2 and GATA-3 were also strongly AC133 positive, another marker which has recently been suggested to define a hematopoietic population with angioblast potential (2), figure id.
- AC133 expression was also detected on a subset of CD117 dim cells which was negative for GATA-2 and GATA-3, we conclude that identification of an embryonic bone-marrow derived angioblast (BA) phenotype requires concomitant expression of GATA-2, GATA-3, and CD117 bright in addition to AC133.
- BA embryonic bone-marrow derived angioblast
- G-CSF treatment mobilizes into the peripheral circulation a prominent population of mature, bone marrow-derived endothelial cells (BMEC), and a smaller bone marrow-derived population with phenotypic characteristics of embryonic angioblasts (BA).
- BMEC bone marrow-derived endothelial cells
- BA embryonic angioblasts
- VEGF vascular endothelial growth factor
- BA showed 2.9-fold increase in proliferation above baseline compared with 1.2-fold increase for BMEC, p ⁇ 0.0l
- BA showed 4.3-fold increase in proliferation above normal serum compared with 1.7-fold increase for BMEC, p ⁇ 0.01.
- FIG. 2 b which continued to express immature markers, including GATA-2, GATA-3, and CD117 bright , but not markers of mature endothelial cells, FIG. 2 c , indicating blast proliferation without differentiation.
- FIG. 3 a Following culture of CD34-positive monolayers on fibronectin in endothelial growth medium for 7 days (29), an exuberant cobblestone pattern of proliferation was seen, FIG. 3 a , with the majority of the adherent monolayers (>95%) having features characteristic of endothelial cells, FIG. 3 b - e , including uniform uptake of acetylated LDL, and co-expression of CD34, factor VIII, and eNOS. Since the BMEC population had low proliferative responses to VEGF or cytokines in ischemic serum, the origin of the exuberant endothelial cell outgrowth in culture is most likely the BA population defined by surface expression for GATA-2, GATA-3, and CD117 bright .
- CD34-negative cells ⁇ 5% CD34 purity
- SVEC saphenous vein endothelial cells
- FIG. 6 a and b Histologic examination at two weeks post-infarction (33) revealed that injection of CD34+ cells was accompanied by significant increase in microvascularity and cellularity of granulation tissue, and decrease in matrix deposition and fibrosis within the infarct zone in comparison to controls, FIG. 6 a and b . Moreover, ischemic myocardium of rats injected with human CD34+ cells contained significantly greater numbers of factor VIII-positive interstitial angioblasts and capillaries in comparison to ischemic myocardium of control rats, FIG. 6 c and d .
- neoangiogenesis within the infarcted tissue appears to be an integral component of the remodeling process (36,37), under normal circumstances the capillary network cannot keep pace with tissue growth and is unable to support the greater demands of the hypertrophied, but viable, myocardium which subsequently undergoes apoptosis due to inadequate oxygenation and nutrient supply.
- the development of neoangiogenesis within the myocardial infarct scar appears to require activation of latent collagenase and other proteinases following plasminogen activation by urokinase-type plasminogen activator (u-PA) expressed on infiltrating leukocytes (38).
- u-PA urokinase-type plasminogen activator
- GATA-2 Cell surface and RNA expression of the transcription factor GATA-2 appears to selectively identify human adult bone marrow-derived angioblasts capable of responding to signals from ischemic sites by proliferating and migrating to the infarct zone, and subsequently participating in the process of neo-angiogenesis.
- GATA-2 is a co-factor for endothelial cell transcription of preproendothelin-1 (ppET-1) (42), the precursor molecule of the potent vasoconstrictor and hypertrophic autocrine peptide ET-1.
- ppET-1 transcription is also increased by angiotensin II (43), produced as a result of activation of the renin-angiotensin neurohormonal axis following myocardial infarction
- the angioblasts infiltrating the infarct bed may be secreting high levels of ET-1 due to the synergistinc actions of angiotensin II surface receptor .signalling and GATA-2 transactivation.
- CD34 cells were stained with fluorescein-conjugated mAbs against CD34, CD117, VEGFR-2, Tie-2, GATA-2, GATA-3, AC133, vWF, eNOS, CD54, CD62E, CXCR1, CXCR2, CXCR4, and analyzed by four-parameter fluorescence using FACScan (Becton Dickinson, Calif.).
- CD34+ cells were plated in 48-well chemotaxis chambers fitted with membranes (8 mm pores) (Neuro Probe, Md.). After incubation for 2 hours at 37°, chambers were inverted and cells were cultured for 3 hours in medium containing IL-8 at 0.2, 1.0 and 5.0 mg/ml, SDF-1 alpha/beta 1.0 mg/ml, VEGF and SCF. The membranes were fixed with methanol and stained with Leukostat (Fischer Scientific, Illinois). Chemotaxis was calculated by counting migrating cells in 10 high-power fields.
- Quantitation of myocardial infiltration after injection of human cells was performed by assessment of DiI fluorescence in hearts from rats sacrificed 2 days after injection (expressed as number of DiI-positive cells per high power field, minimum 5 fields examined per sample). Quantitation of rat bone marrow infiltration by human cells was performed in 12 rats at baseline, days 2, 7, and 14 by flow cytometric and RT-PCR analysis of the proportion of HLA class I-positive cells relative to the total rat bone marrow population.
- Echocardiographic studies were performed at baseline, 48 hours after LAD ligation, and at 2, 6 and 15 weeks after injection of cells or saline, using a high frequency liner array transducer (SONOS 5500, Hewlett Packard, Andover, Mass.). 2D images were removed at mid-papillary and apical levels. End-diastolic (EDV) and end-systolic (ESV) left ventricular volumes were removed by bi-plane area-length method, and % left ventricular ejection fraction (LVEF) was calculated as [(EDV-ESV)/EDV] x100.
- SONOS 5500 Hewlett Packard, Andover, Mass.
- LVAs Left ventricular area at the end of systole
- Poly(A)+ mRNA was extracted by standard methods from the hearts of 3 normal and 12 LAD-ligated rats. RT-PCR was used to quantify myocardial expression of rat IL-8 and Gro-alpha mRNA at baseline and at 6, 12, 24 and 48 hours after LAD ligation after normalizing for total rat RNA as measured by GAPDH expression.
- cDNA was amplified in the polymerase chain reaction (PCR) using Taq polymerase (Invitrogen, Carlsbad, Calif., USA), radiolabeled dideoxy-nucleotide ([ ⁇ 32 p]-ddATP: 3,000 Ci/mmol, Amersham, Arlington Heights, Ill.), and primers for rat IL-8, Gro-alpha and GAPDH (Fisher Genosys, Calif.).
- Primer pairs (sense/antisense) for rat IL-8, Gro-alpha AND GAPDH were, gaagatagattgcaccgatg (SEQ ID NO:1)/catagcctctcacatttc (SEQ ID NO:2), gcgcccgtccgccaatgagctgcgc (SEQ ID NO:3)/cttggggacacccttcagcatcttttgg (SEQ ID NO:4), and ctctacccacggcaagttcaa (SEQ ID NO:5)/gggatgaccttgcccacagc (SEQ ID NO:6), respectively.
- the labeled samples were loaded into 2% agarose gels, separated by electrophoresis, and exposed for radiography for 6 h at ⁇ 70°.
- Serum levels of rat IL-8/Gro-alpha were measured at baseline and at 6, 12, 24 and 48 hours after LAD ligation in four rats by a commercial ELISA using polyclonal antibodies against the rat IL-8/Gro homologue CINC (ImmunoLaboratories, Japan).
- the amount of protein in each serum sample was calculated according to a standard curve of optical density (OD) values constructed for known levels of rat IL-8/Gro-alpha protein.
- FIG. 7 a 10-15% of CD117 bright cells were found to express a phenotype characteristic of embryonic angioblasts, with low level surface expression of VEGFR-2 and Tie-2, as well as the transcription factors GATA-2 and GATA-3, and AC133, recently shown to identify endothelial precursors (79). These cells did not express markers of mature endothelial cells such as vWF, eNOS and E-selectin, but were positive for the CXC chemokine receptors 1, 2, and 4.
- ischemic serum from LAD-ligated rats caused rapid expansion of the circulating CD34+CD117 bright angioblast population and concomitantly increased trafficking of these cells to the bone marrow.
- culture for 2 days with either VEGF or ischemic serum increased proliferation of CD34+CD117 bright angioblasts by 2.8 and 4.3 fold, respectively (p ⁇ 0.01).
- FIG. 10 a culture for 2 days with either VEGF or ischemic serum increased proliferation of CD34+CD117 bright angioblasts by 2.8 and 4.3 fold, respectively (p ⁇ 0.01).
- bone marrow front ischemic rats after LAD ligation contained 5-8 fold higher levels of human CD34+CD117 bright angioblasts compared with bone marrow from normal rats 2-14 days after intravenous injection of 2 ⁇ 10 6 human CD34-positive cells (>95% purity), (p ⁇ 0.001). Since SDF-1 is constitutively expressed by bone marrow stromal cells and preferentially promotes bone marrow migration of circulating CD34+ cells which are actively cycling (80), we investigated whether the increased homing of human CD34+CD117 bright angioblasts to ischemic rat bone marrow was due to heightened SDF-1/CXCR4 interactions. As shown in FIG.
- FIG. 11 a and b Although left ventricular function was severely depressed after LAD ligation, injection of >98% pure CD34+ cells was associated with significant recovery in left ventricular size and function within two weeks, and these effects persisted for the entire 15 week period of follow-up, FIG. 11 a and b .
- left ventricular end-systolic area decreased by a mean of 37 ⁇ 6% by 15 weeks compared to immediately post-infarction, FIG. 11 a
- LVEF left ventricular ejection fraction
- FIGS. 11 a and b Improvement in these parameters depended on the number of CD34+ cells injected, since intravenous injection of 2 ⁇ 10 6 G-CSF mobilized human cells containing 2% or 40% CD34+ purity did not significantly improve myocardial function despite similar degrees of trafficking to ischemic myocardium, FIGS. 11 a and b .
- co-administration of anti-CXCR4 mAb together with G-CSF mobilized human bone marrow-derived cells containing 40% CD34+ purity significantly improved LVEF recovery and reduced LVAs, to levels seen with >98% CD34+ purity.
- trichrome stain significant differences in left ventricular mass and collagen deposition were observed between the groups, FIG. 11 c .
- the mean proportion of fibrous scar/normal left ventricular myocardium was 13% and 21%, respectively, in rats receiving >98% pure CD34+ cells or 40% pure CD34+ cells together with anti-CXCR4 mAb, compared with 36-45% for rats receiving 2% and 40% pure CD34+ cells (p ⁇ 0.01), FIG. 11 d .
- augmentation of infarct bed vasculogenesis by increasing selective trafficking of a critical number of endothelial precursors leads to further prevention of the remodeling process, salvage of viable myocardium, and improvement in cardiac function.
- ELR+ CXC chemokine IL-8 and the ELR- CXC chemokine SDF-1 demonstrate similar effects on chemotaxis of CD34+ endothelial precursors, as well as on mature endothelium (73), when expressed at different extravascular sites they impart opposing biological effects on directional egress of endothelial progenitors, and consequently on tissue neovascularization.
- MMP-9 metalloproteinase-9
- Gelatinase B proteolytic enzymes
- intracardiac metalloproteinase activity may be a critical determinant of angioblast extravasation from the circulation and transendothelial migration into the infarct zone.
- IL-8 induces rapid release (within 20 minutes) of the latent form of MMP-9 from intracellular storage granules in neutrophils (82-83), and increases serum MMP-9 levels by up to 1,000-fold following intravenous administration in vivo in non-human primates (84).
- u-PA urokinase-type plasminogen activator
- IL-8-induced chemotaxis and progenitor mobilization require the presence of additional signals delivered through functional G-CSF receptors (89), it is possible that increased u-PA activity is required for IL-8 mediated trafficking of angioblasts to sites of ischemia. This would explain the limited extent of infarct bed neoangiogenesis observed normally after myocardial infarction (62,63) despite high levels of IL-8 production, and provides a rationale for in vivo or ex vivo administration of colony stimulating factors to mobilize and differentiate human bone marrow-derived angioblasts for use in therapeutic revascularization of ischemic tissues.
- infarcted myocardium demonstrated a time-dependent increase in mRNA expression of several CCR-binding chemokines.
- Infarcted myocardium was found to express over 8-fold higher levels of the CCR2-binding CC chemokine MCP-1, and 3-3.5-fold higher mRNA levels of MCP-3 and RANTES, as well as the CCR3-binding chemokine eotaxin, after normalizing for total mRNA content (all p ⁇ 0.001).
- This pattern of gene expression appeared to be relatively specific since every infarcted tissue studied demonstrated increased expression of these CC chemokines and none demonstrated induced expression of the CCRS-binding CC chemokines MIP-1 alpha or MIP-lbeta.
- Myocyte size was measured in normal rat hearts and in the infarct zone, peri-infarct rim and distal areas of infarct tissue sections stained by trichrome. The transverse and longitudinal diameters (mm) of 100-200 myocytes in each of 10-15 high-powered fields were measured at 400 ⁇ using Image-Pro Plus software.
- TUNEL dexynucleotidyl transferase
- Neoangiogenesis Protects Hypertrophied Myocardium Against Apoptosis.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Cell Biology (AREA)
- Epidemiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Vascular Medicine (AREA)
- Cardiology (AREA)
- Diabetes (AREA)
- Gastroenterology & Hepatology (AREA)
- Developmental Biology & Embryology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Heart & Thoracic Surgery (AREA)
- Hematology (AREA)
- Virology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Hospice & Palliative Care (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/220,554 US20040131585A1 (en) | 2000-06-05 | 2001-06-05 | Identification and use og human bone marrow-derived endothelial progenitor cells to improve myocardial function after ischemic injury |
| US11/234,879 US7662392B2 (en) | 2000-06-05 | 2005-09-22 | Use of SDF-1 or G-CSF to improve myocardial function after ischemic injury |
| US11/894,555 US20080057069A1 (en) | 2000-06-05 | 2007-08-20 | Method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue |
| US11/894,581 US8153113B2 (en) | 2000-06-05 | 2007-08-20 | Method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue |
| US12/657,264 US8486416B2 (en) | 2000-06-05 | 2010-01-15 | Use of SDF-1 to improve ischemic myocardial function |
| US13/938,608 US9387234B2 (en) | 2000-06-05 | 2013-07-10 | Use of SDF-1 to improve ischemic myocardial function |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US58744100A | 2000-06-05 | 2000-06-05 | |
| US10/220,554 US20040131585A1 (en) | 2000-06-05 | 2001-06-05 | Identification and use og human bone marrow-derived endothelial progenitor cells to improve myocardial function after ischemic injury |
| PCT/US2001/018399 WO2001094420A1 (en) | 2000-06-05 | 2001-06-05 | Identification and use of human bone marrow-derived endothelial progenitor cells to improve myocardial function after ischemic injury |
Related Parent Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US58744100A Continuation-In-Part | 2000-06-05 | 2000-06-05 | |
| PCT/US2001/018399 A-371-Of-International WO2001094420A1 (en) | 2000-06-05 | 2001-06-05 | Identification and use of human bone marrow-derived endothelial progenitor cells to improve myocardial function after ischemic injury |
| PCT/US2001/018399 Continuation WO2001094420A1 (en) | 2000-06-05 | 2001-06-05 | Identification and use of human bone marrow-derived endothelial progenitor cells to improve myocardial function after ischemic injury |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/234,879 Continuation US7662392B2 (en) | 2000-06-05 | 2005-09-22 | Use of SDF-1 or G-CSF to improve myocardial function after ischemic injury |
| US11/234,879 Continuation-In-Part US7662392B2 (en) | 2000-06-05 | 2005-09-22 | Use of SDF-1 or G-CSF to improve myocardial function after ischemic injury |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20040131585A1 true US20040131585A1 (en) | 2004-07-08 |
Family
ID=24349821
Family Applications (6)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10/220,554 Abandoned US20040131585A1 (en) | 2000-06-05 | 2001-06-05 | Identification and use og human bone marrow-derived endothelial progenitor cells to improve myocardial function after ischemic injury |
| US11/234,879 Expired - Fee Related US7662392B2 (en) | 2000-06-05 | 2005-09-22 | Use of SDF-1 or G-CSF to improve myocardial function after ischemic injury |
| US11/894,555 Abandoned US20080057069A1 (en) | 2000-06-05 | 2007-08-20 | Method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue |
| US11/894,581 Expired - Fee Related US8153113B2 (en) | 2000-06-05 | 2007-08-20 | Method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue |
| US12/657,264 Expired - Fee Related US8486416B2 (en) | 2000-06-05 | 2010-01-15 | Use of SDF-1 to improve ischemic myocardial function |
| US13/938,608 Expired - Fee Related US9387234B2 (en) | 2000-06-05 | 2013-07-10 | Use of SDF-1 to improve ischemic myocardial function |
Family Applications After (5)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/234,879 Expired - Fee Related US7662392B2 (en) | 2000-06-05 | 2005-09-22 | Use of SDF-1 or G-CSF to improve myocardial function after ischemic injury |
| US11/894,555 Abandoned US20080057069A1 (en) | 2000-06-05 | 2007-08-20 | Method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue |
| US11/894,581 Expired - Fee Related US8153113B2 (en) | 2000-06-05 | 2007-08-20 | Method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue |
| US12/657,264 Expired - Fee Related US8486416B2 (en) | 2000-06-05 | 2010-01-15 | Use of SDF-1 to improve ischemic myocardial function |
| US13/938,608 Expired - Fee Related US9387234B2 (en) | 2000-06-05 | 2013-07-10 | Use of SDF-1 to improve ischemic myocardial function |
Country Status (7)
| Country | Link |
|---|---|
| US (6) | US20040131585A1 (https=) |
| EP (2) | EP2324839B1 (https=) |
| JP (3) | JP5414958B2 (https=) |
| AU (1) | AU2001275339A1 (https=) |
| CA (2) | CA2810249A1 (https=) |
| MX (1) | MXPA02012067A (https=) |
| WO (1) | WO2001094420A1 (https=) |
Cited By (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040019184A1 (en) * | 2000-09-13 | 2004-01-29 | Keiichi Fukuda | Remedies for ischemic disease |
| US20040258670A1 (en) * | 2002-12-05 | 2004-12-23 | Case Western Reserve University | Cell-based therapies for ischemia |
| US20050069527A1 (en) * | 2002-12-05 | 2005-03-31 | Case Western Reserve University | Cell-based therapies for ischemia |
| US20050158858A1 (en) * | 2000-04-06 | 2005-07-21 | Franco Wayne P. | Growth factor therapy mobilization of stem cells into the periperal blood |
| US20050233992A1 (en) * | 2002-04-23 | 2005-10-20 | Silviu Itescu | Regeneration of endogeneous myocardial tissue by induction of neovascularization |
| US20050265980A1 (en) * | 2004-05-14 | 2005-12-01 | Becton, Dickinson And Company | Cell culture environments for the serum-free expansion of mesenchymal stem cells |
| US20050277576A1 (en) * | 2000-04-06 | 2005-12-15 | Franco Wayne P | Combination growth factor therapy and cell therapy for treatment of acute and chronic diseases of the organs |
| US20060035290A1 (en) * | 2004-08-13 | 2006-02-16 | Medtronic, Inc. | Isolation of endothelial progenitor cell subsets and methods for their use |
| US20060111290A1 (en) * | 2000-06-05 | 2006-05-25 | The Trustees Of Columbia University In The City Of New York | Use of SDF-1 or G-CSF to improve myocardial function after ischemic injury |
| US20070105217A1 (en) * | 2005-11-07 | 2007-05-10 | Pecora Andrew L | Compositions and methods of vascular injury repair |
| US20070111935A1 (en) * | 2000-04-06 | 2007-05-17 | Franco Wayne P | Combination growth factor therapy and cell therapy for treatment of acute and chronic diseases of the organs |
| US20070258943A1 (en) * | 2002-08-22 | 2007-11-08 | Cleveland Clinic Foundation | Genetically engineered cells for therapeutic applications |
| US20080241246A1 (en) * | 2006-11-15 | 2008-10-02 | Arteriocyte Inc. | Cell-based therapies for treating liver disease |
| US20090148415A1 (en) * | 2007-04-16 | 2009-06-11 | Biocardia, Inc. | Treatment for Chronic Myocardial Infarct |
| US20100034794A1 (en) * | 2006-10-03 | 2010-02-11 | Van Der Strate Barry W A | Endothelial progenitor cell compositions and neovascularization |
| US20100143317A1 (en) * | 2006-10-24 | 2010-06-10 | Andrew Pecora | Infarct area perfusion-improving compositions and methods of vascular injury repair |
| US20100166717A1 (en) * | 2002-08-22 | 2010-07-01 | Penn Marc S | Method of treating ischemic disorders |
| US20100272679A1 (en) * | 2007-12-14 | 2010-10-28 | Penn Marc S | Compositions and methods of promoting wound healing |
| EP2185719A4 (en) * | 2007-08-02 | 2012-01-04 | Novimmune Sa | RANTES ANTIBODIES AND METHOD FOR THEIR USE |
| US8343485B2 (en) | 2005-11-07 | 2013-01-01 | Amorcyte, Inc. | Compositions and methods of vascular injury repair |
| US8425899B2 (en) | 2005-11-07 | 2013-04-23 | Andrew L. Pecora | Compositions and methods for treating progressive myocardial injury due to a vascular insufficiency |
| US8883756B2 (en) | 2009-08-28 | 2014-11-11 | Juventas Therapeutics, Inc. | SDF-1 delivery for treating ischemic tissue |
| RU2612388C2 (ru) * | 2007-08-06 | 2017-03-09 | Ноксон Фарма Аг | Связывающие sdf-1 нуклеиновые кислоты и их применение |
| US9694038B2 (en) | 2000-04-06 | 2017-07-04 | Wayne P. Franco | Combination growth factor therapy and cell therapy for treatment of acute and chronic diseases of the organs |
| US10281478B2 (en) | 2000-04-06 | 2019-05-07 | Wayne P. Franco | Combination growth factor therapy and cell therapy for treatment of acute and chronic diseases of the organs |
| CN112118851A (zh) * | 2018-03-16 | 2020-12-22 | 美迪因诺医疗创新科技有限公司 | 使用神经干细胞诱导血管生成的方法 |
Families Citing this family (51)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7368425B2 (en) * | 2006-03-24 | 2008-05-06 | Chemokine Therapeutics Corp. | Cyclic peptides for modulating growth of neo-vessels and their use in therapeutic angiogenesis |
| US20020061587A1 (en) | 2000-07-31 | 2002-05-23 | Piero Anversa | Methods and compositions for the repair and/or regeneration of damaged myocardium |
| US7547674B2 (en) * | 2001-06-06 | 2009-06-16 | New York Medical College | Methods and compositions for the repair and/or regeneration of damaged myocardium |
| US7862810B2 (en) | 2000-07-31 | 2011-01-04 | New York Medical College | Methods and compositions for the repair and/or regeneration of damaged myocardium |
| DK1411918T3 (da) * | 2001-07-31 | 2012-04-23 | Genzyme Global S A R L | Fremgangsmåder til at mobilisere progenitor/stamceller |
| US7169750B2 (en) * | 2001-07-31 | 2007-01-30 | Anormed, Inc. | Methods to mobilize progenitor/stem cells |
| MXPA04006154A (es) | 2001-12-21 | 2004-11-01 | Immunex Corp | Celulas madre endoteliales, poblaciones y metodos para el aislamiento y uso de las mismas. |
| EP1490107A4 (en) * | 2002-03-21 | 2005-11-09 | Univ Florida | MODULATION OF ANGIOGENESIS |
| WO2004082703A1 (ja) * | 2003-03-20 | 2004-09-30 | Keiichi Fukuda | G-csfと血管新生作用を有する因子の併用 |
| KR20060018851A (ko) * | 2003-05-16 | 2006-03-02 | 교와 핫꼬 고교 가부시끼가이샤 | 조직 파괴를 수반하는 질환의 예방 및/또는 치료제 |
| DE10333901A1 (de) * | 2003-07-21 | 2005-03-10 | Transtissue Technologies Gmbh | Verwendung von Chemokinen zur Rekrutierung von humanen mesenchymalen Vorläuferzellen zur Regeneration von Gelenkdefekten |
| EP1527785A1 (en) * | 2003-10-27 | 2005-05-04 | Ludwig-Maximilians-Universität München | Use of G-CSF for treating ischemia |
| GB0329449D0 (en) * | 2003-12-19 | 2004-01-28 | Omnicyte Ltd | Stem cells |
| TW200605910A (en) | 2004-04-30 | 2006-02-16 | Orbus Medical Technologies Inc | Medical device with coating for capturing genetically-altered cells and methods for using same |
| WO2006055743A2 (en) * | 2004-11-18 | 2006-05-26 | Franco, Wayne | Compbination growth therapy and cell therapy for treatment of acute and chronic diseases of the organs |
| EP1991664B1 (en) | 2006-02-16 | 2018-03-28 | Ospedale San Raffaele S.r.l. | Skeletal muscle periangioblasts and cardiac mesangioblasts, method for isolation and uses thereof |
| TW200734462A (en) | 2006-03-08 | 2007-09-16 | In Motion Invest Ltd | Regulating stem cells |
| RU2388425C2 (ru) * | 2006-08-09 | 2010-05-10 | Федеральное государственное учреждение Новосибирский научно-исследовательский институт патологии кровообращения имени акад. Е.Н. Мешалкина Федерального агентства по высокотехнологичной медицинской помощи | Способ лазерного энграфтинга клеток |
| US7696309B2 (en) | 2006-10-23 | 2010-04-13 | The Brigham And Women's Hospital, Inc. | Protease resistant mutants of stromal cell derived factor-1 in the repair of tissue damage |
| EP2114422A1 (en) * | 2007-03-02 | 2009-11-11 | National University of Ireland, Galway | Osteopontin for the prediction and treatment of cardiovascular diseases |
| MX2010003371A (es) | 2007-09-28 | 2010-05-05 | Intrexon Corp | Constructos interruptores genicos terapeuticos y biorreactores para la expresion de moleculas bioterapeuticas y usos de los mismos. |
| WO2009062143A2 (en) | 2007-11-09 | 2009-05-14 | New York Medical College | Methods and compositions for the repair and/or regeneration of damaged myocardium using cytokines and variants thereof |
| EP2227238A2 (en) | 2007-11-30 | 2010-09-15 | New York Medical College | Compositions comprising vascular and myocyte progenitor cells and methods of their use |
| AU2008334036B2 (en) | 2007-11-30 | 2014-05-29 | New York Medical College | Methods of reducing transplant rejection and cardiac allograft vasculopathy by implanting autologous stem cells |
| US8512696B2 (en) | 2007-11-30 | 2013-08-20 | Autologous, Llc | Methods of isolating non-senescent cardiac stem cells and uses thereof |
| GB0818725D0 (en) | 2008-10-13 | 2008-11-19 | Habib Nagy A | Pharmaceutical composition |
| SI2509619T1 (sl) * | 2009-12-11 | 2021-04-30 | Medregen, Llc | Metode zdravljenja z uporabo mobilizatorjev matičnih celic in imunosupresivnih učinkovin |
| US10813917B2 (en) | 2009-12-11 | 2020-10-27 | Medregen, Llc | Treatment methods utilizing stem cell mobilizers and immunosuppressive agents |
| WO2011082339A2 (en) * | 2009-12-31 | 2011-07-07 | Cedars-Sinai Medical Center | Regeneration of, reestablishing function in and replacing microvasculature in organs and tissues |
| WO2011106234A1 (en) | 2010-02-25 | 2011-09-01 | Provasculon, Inc. | Protease-resistant mutants of stromal cell derived factor-1 in the repair of tissue damage |
| KR20140045411A (ko) | 2011-05-16 | 2014-04-16 | 젠자임 코포레이션 | Cxcr4 길항제의 용도 |
| JP6145089B2 (ja) | 2011-06-07 | 2017-06-07 | メソブラスト インターナショナル エスエイアールエル | ストロマ細胞由来因子−1のプロテアーゼ耐性変異体を用いた、組織損傷を修復するための方法 |
| AR087363A1 (es) | 2011-07-29 | 2014-03-19 | Pf Medicament | Uso del anticuerpo i-3859 para la deteccion y diagnostico de los canceres |
| AR087364A1 (es) | 2011-07-29 | 2014-03-19 | Pf Medicament | Anticuerpo anti-cxcr4 y su uso para la deteccion y dianostico de canceres |
| US20130231647A1 (en) * | 2012-03-05 | 2013-09-05 | BFM Group International GMBH | Laser therapy for endogenously enhancing ventricular function |
| US10072247B2 (en) * | 2012-10-05 | 2018-09-11 | Samsung Life Public Welfare Foundation | Composition comprising ischemic serum for promoting activation of stem cell and method for promoting activation of stem cell |
| US10420818B2 (en) | 2014-05-08 | 2019-09-24 | Wake Forest University Health Sciences | Methods of treating incontinence and other sphincter deficiency disorders |
| WO2017106630A1 (en) | 2015-12-18 | 2017-06-22 | The General Hospital Corporation | Polyacetal polymers, conjugates, particles and uses thereof |
| WO2018106738A1 (en) | 2016-12-05 | 2018-06-14 | Massachusetts Institute Of Technology | Brush-arm star polymers, conjugates and particles, and uses thereof |
| WO2018183625A1 (en) | 2017-03-30 | 2018-10-04 | Wake Forest University Health Sciences | Methods of treatment for kidney disease |
| TW201841916A (zh) | 2017-04-12 | 2018-12-01 | 美商麥珍塔治療學股份有限公司 | 芳香烴受體拮抗劑及其用途 |
| US11654181B2 (en) | 2017-08-11 | 2023-05-23 | Wake Forest University Health Sciences | Use of CXCL12 for therapy after prostate surgery |
| US20190314407A1 (en) | 2017-10-31 | 2019-10-17 | Magenta Therapeutics Inc. | Compositions and methods for the expansion of hematopoietic stem and progenitor cells |
| EP3703715A1 (en) | 2017-10-31 | 2020-09-09 | Magenta Therapeutics, Inc. | Compositions and methods for hematopoietic stem and progenitor cell transplant therapy |
| US11260079B2 (en) | 2017-12-06 | 2022-03-01 | Magenta Therapeutics, Inc. | Dosing regimens for the mobilization of hematopoietic stem and progenitor cells |
| CN111712262A (zh) | 2017-12-06 | 2020-09-25 | 美真达治疗公司 | 用于动员造血干细胞和祖细胞的给药方案 |
| US20200338132A1 (en) | 2018-01-03 | 2020-10-29 | Magenta Therapeutics Inc. | Compositions and methods for the expansion of hematopoietic stem and progenitor cells and treatment of inherited metabolic disorders |
| EP4051298A1 (en) | 2019-11-01 | 2022-09-07 | Magenta Therapeutics, Inc. | Dosing regimens for the mobilization of hematopoietic stem and progentor cells |
| CA3176979A1 (en) | 2020-04-27 | 2021-11-04 | Anthony Boitano | Methods and compositions for transducing hematopoietic stem and progenitor cells in vivo |
| WO2022197776A1 (en) | 2021-03-16 | 2022-09-22 | Magenta Therapeutics, Inc. | Dosing regimens for hematopoietic stem cell mobilization for stem cell transplants in multiple myeloma patients |
| WO2025224720A1 (en) | 2024-04-24 | 2025-10-30 | Biolinerx Ltd. | Methods of selecting treatment regimen against solid tumors |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US107195A (en) * | 1870-09-06 | Improvement in sawing-machine | ||
| US5061620A (en) * | 1990-03-30 | 1991-10-29 | Systemix, Inc. | Human hematopoietic stem cell |
| US5552381A (en) * | 1989-07-21 | 1996-09-03 | Washington University | Recombinantly produced human membrane cofactor protein (MCP) pharmaceutical composition, and method of inhibiting complement activity |
| US5599703A (en) * | 1993-10-28 | 1997-02-04 | The United States Of America As Represented By The Secretary Of The Navy | In vitro amplification/expansion of CD34+ stem and progenitor cells |
| US5880090A (en) * | 1997-09-19 | 1999-03-09 | The Hope Heart Institute | Treatment of vascular graft implants with G-CSF |
| US5980887A (en) * | 1996-11-08 | 1999-11-09 | St. Elizabeth's Medical Center Of Boston | Methods for enhancing angiogenesis with endothelial progenitor cells |
| US6288103B1 (en) * | 1997-08-07 | 2001-09-11 | Zeneca Limited | Indole derivatives as MCP-1 receptor antagonists |
| US20060051334A1 (en) * | 1999-03-30 | 2006-03-09 | Myocardial Therapeutics, Inc. | Injection of bone marrow-derived conditioned medium for angiogenesis |
| US20060057722A1 (en) * | 1999-03-30 | 2006-03-16 | Myocardial Therapeutics, Inc. | Conditioned medium of autologous or allogenic progenitor cells for angiogenesis treatment |
Family Cites Families (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5008284A (en) * | 1989-02-15 | 1991-04-16 | E. R. Squibb & Sons, Inc. | Method of reducing pre- and post-ischemic myocardial arrhythmias and fibrillation |
| EP0504257A4 (en) * | 1989-11-29 | 1993-03-03 | Brigham And Women's Hospital | (ala il-8) 77 as a leukocyte adhesion inhibitor |
| JP2697495B2 (ja) * | 1991-06-19 | 1998-01-14 | 富士レビオ株式会社 | アルデヒド誘導体 |
| JPH07166906A (ja) * | 1993-12-14 | 1995-06-27 | Nissan Motor Co Ltd | 燃料カットと点火時期変更による加速スリップ制御装置 |
| DE4442665A1 (de) * | 1994-11-30 | 1996-06-05 | Gruenenthal Gmbh | Chimäre Proteine mit fibrinolytischen und thrombinhemmenden Eigenschaften |
| US6110889A (en) * | 1996-06-14 | 2000-08-29 | Board Of Regents, The University Of Texas System | Peptide tumor cell growth inhibitors |
| JP3866800B2 (ja) * | 1996-08-29 | 2007-01-10 | 東菱薬品工業株式会社 | アポトーシス関連疾患の予防及び/又は治療薬 |
| EP0897980A3 (en) * | 1997-08-20 | 2002-04-17 | Smithkline Beecham Corporation | CXCR4B: A human splice variant of CXCR4 chemokine receptor |
| US7507705B2 (en) * | 1997-10-02 | 2009-03-24 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Methods for the modulation of neovascularization and/or the growth of collateral arteries and/or other arteries from preexisting arteriolar connections |
| EP1021737B1 (en) * | 1997-10-06 | 2008-06-11 | Acculase, Inc. | Apparatus for ablating tissue |
| WO1999037779A1 (en) * | 1998-01-22 | 1999-07-29 | Genentech, Inc. | Antibody fragment-polymer conjugates and humanized anti-il-8 monoclonal antibodies and uses of same |
| US6852533B1 (en) * | 1998-01-23 | 2005-02-08 | Cornell Research Foundation, Inc. | Purified populations of stem cells |
| ATE512231T1 (de) * | 1998-02-27 | 2011-06-15 | Univ Pennsylvania | Impfstoffe, immuntherapeutika und verfahren zur anwendung derselben |
| WO1999045775A1 (en) * | 1998-03-09 | 1999-09-16 | St. Elizabeth's Medical Center | Compositions and methods for modulating vascularization |
| WO1999065507A1 (en) * | 1998-06-19 | 1999-12-23 | The General Hospital Corporation | Modulating platelet function |
| US20020107195A1 (en) * | 1998-07-21 | 2002-08-08 | Smithkline Beecham Corporation | Method for inducing chemotaxis in endothelial cells by administering stromal cell derived factor-1alpha |
| CA2368677C (en) | 1999-03-30 | 2012-07-10 | Ran Kornowski | Intramyocardial injection of autologous bone marrow |
| JP5704780B2 (ja) * | 1999-08-13 | 2015-04-22 | ノバルティス バクシンズ アンド ダイアグノスティックス,インコーポレーテッド | 脈管形成因子の用量および心筋血流を改善するための投与方法 |
| MXPA02012067A (es) | 2000-06-05 | 2004-08-19 | Univ Columbia | Identificacion y uso de celulas endoteliales precursoras derivadas de medula osea par mejorar la funcion del miocardio despues de dano isquemico. |
| US7547674B2 (en) * | 2001-06-06 | 2009-06-16 | New York Medical College | Methods and compositions for the repair and/or regeneration of damaged myocardium |
| RU2002110275A (ru) | 2000-08-22 | 2004-03-27 | Дзе Брихэм Энд Уимен'З Хоспитал, Инк. (Us) | Диагностика и лечение сердечно-сосудистых состояний |
| WO2002020848A2 (en) * | 2000-09-08 | 2002-03-14 | The Regents Of The University Of California | Gene and sequence variation associated with cancer |
| WO2002022163A1 (en) * | 2000-09-13 | 2002-03-21 | Chugai Seiyaku Kabushiki Kaisha | Remedies for ischemic diseases |
| WO2002036078A2 (en) | 2000-11-05 | 2002-05-10 | University Of Florida | Targeting pluripotent stem cells to tissues |
| IL146970A0 (en) | 2001-12-06 | 2002-08-14 | Yeda Res & Dev | Migration of haematopoietic stem cells and progenitor cells to the liver |
| US20030199464A1 (en) | 2002-04-23 | 2003-10-23 | Silviu Itescu | Regeneration of endogenous myocardial tissue by induction of neovascularization |
| CA2494115A1 (en) | 2002-08-01 | 2004-02-12 | Northwestern University | Mutants of ige proteins and uses thereof |
| US7220407B2 (en) * | 2003-10-27 | 2007-05-22 | Amgen Inc. | G-CSF therapy as an adjunct to reperfusion therapy in the treatment of acute myocardial infarction |
| EP2069262A2 (en) * | 2006-08-29 | 2009-06-17 | Corning Incorporated | High strength substantially non-microcracked cordierite honeycomb body and manufacturing method |
| US7959387B2 (en) | 2007-10-03 | 2011-06-14 | Kennametal Inc. | Shrink fit sleeve for tool holder |
-
2001
- 2001-06-05 MX MXPA02012067A patent/MXPA02012067A/es active IP Right Grant
- 2001-06-05 JP JP2002501968A patent/JP5414958B2/ja not_active Expired - Lifetime
- 2001-06-05 WO PCT/US2001/018399 patent/WO2001094420A1/en not_active Ceased
- 2001-06-05 AU AU2001275339A patent/AU2001275339A1/en not_active Abandoned
- 2001-06-05 CA CA2810249A patent/CA2810249A1/en not_active Abandoned
- 2001-06-05 CA CA2412436A patent/CA2412436C/en not_active Expired - Lifetime
- 2001-06-05 US US10/220,554 patent/US20040131585A1/en not_active Abandoned
- 2001-06-05 EP EP10012752.1A patent/EP2324839B1/en not_active Expired - Lifetime
- 2001-06-05 EP EP01942041A patent/EP1290033B1/en not_active Expired - Lifetime
-
2005
- 2005-09-22 US US11/234,879 patent/US7662392B2/en not_active Expired - Fee Related
-
2007
- 2007-08-20 US US11/894,555 patent/US20080057069A1/en not_active Abandoned
- 2007-08-20 US US11/894,581 patent/US8153113B2/en not_active Expired - Fee Related
-
2010
- 2010-01-15 US US12/657,264 patent/US8486416B2/en not_active Expired - Fee Related
-
2012
- 2012-10-24 JP JP2012235072A patent/JP5710574B2/ja not_active Expired - Lifetime
-
2013
- 2013-07-10 US US13/938,608 patent/US9387234B2/en not_active Expired - Fee Related
- 2013-08-05 JP JP2013162803A patent/JP5710709B2/ja not_active Expired - Lifetime
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US107195A (en) * | 1870-09-06 | Improvement in sawing-machine | ||
| US5552381A (en) * | 1989-07-21 | 1996-09-03 | Washington University | Recombinantly produced human membrane cofactor protein (MCP) pharmaceutical composition, and method of inhibiting complement activity |
| US5061620A (en) * | 1990-03-30 | 1991-10-29 | Systemix, Inc. | Human hematopoietic stem cell |
| US5599703A (en) * | 1993-10-28 | 1997-02-04 | The United States Of America As Represented By The Secretary Of The Navy | In vitro amplification/expansion of CD34+ stem and progenitor cells |
| US5980887A (en) * | 1996-11-08 | 1999-11-09 | St. Elizabeth's Medical Center Of Boston | Methods for enhancing angiogenesis with endothelial progenitor cells |
| US6288103B1 (en) * | 1997-08-07 | 2001-09-11 | Zeneca Limited | Indole derivatives as MCP-1 receptor antagonists |
| US5880090A (en) * | 1997-09-19 | 1999-03-09 | The Hope Heart Institute | Treatment of vascular graft implants with G-CSF |
| US20060051334A1 (en) * | 1999-03-30 | 2006-03-09 | Myocardial Therapeutics, Inc. | Injection of bone marrow-derived conditioned medium for angiogenesis |
| US20060057722A1 (en) * | 1999-03-30 | 2006-03-16 | Myocardial Therapeutics, Inc. | Conditioned medium of autologous or allogenic progenitor cells for angiogenesis treatment |
Cited By (52)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070111935A1 (en) * | 2000-04-06 | 2007-05-17 | Franco Wayne P | Combination growth factor therapy and cell therapy for treatment of acute and chronic diseases of the organs |
| US10281478B2 (en) | 2000-04-06 | 2019-05-07 | Wayne P. Franco | Combination growth factor therapy and cell therapy for treatment of acute and chronic diseases of the organs |
| US7291597B2 (en) | 2000-04-06 | 2007-11-06 | Franco Wayne P | Growth factor therapy mobilization of stem cells into the peripheral blood |
| US9694038B2 (en) | 2000-04-06 | 2017-07-04 | Wayne P. Franco | Combination growth factor therapy and cell therapy for treatment of acute and chronic diseases of the organs |
| US20050158858A1 (en) * | 2000-04-06 | 2005-07-21 | Franco Wayne P. | Growth factor therapy mobilization of stem cells into the periperal blood |
| US20050277576A1 (en) * | 2000-04-06 | 2005-12-15 | Franco Wayne P | Combination growth factor therapy and cell therapy for treatment of acute and chronic diseases of the organs |
| US7662392B2 (en) | 2000-06-05 | 2010-02-16 | The Trustees Of Columbia University In The City Of New York | Use of SDF-1 or G-CSF to improve myocardial function after ischemic injury |
| US20060111290A1 (en) * | 2000-06-05 | 2006-05-25 | The Trustees Of Columbia University In The City Of New York | Use of SDF-1 or G-CSF to improve myocardial function after ischemic injury |
| US8153113B2 (en) | 2000-06-05 | 2012-04-10 | The Trustees Of Columbia University In The City Of New York | Method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue |
| US20090142296A1 (en) * | 2000-06-05 | 2009-06-04 | The Trustees Of Columbia University In The City Of New York | Method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue |
| US20050048026A1 (en) * | 2000-09-13 | 2005-03-03 | Tatsuya Miyai | Remedies for ischemic diseases |
| US7473425B2 (en) * | 2000-09-13 | 2009-01-06 | Keiichi Fukuda | Remedies for ischemic disease |
| US8329641B2 (en) * | 2000-09-13 | 2012-12-11 | Chugai Seiyaku Kabushiki Kaisha | Remedies for ischemic disease of the limbs comprising administration of G-CSF |
| US20040019184A1 (en) * | 2000-09-13 | 2004-01-29 | Keiichi Fukuda | Remedies for ischemic disease |
| US7544359B2 (en) | 2000-09-13 | 2009-06-09 | Keiichi Fukuda | Remedies for ischemic disease |
| US20060104942A1 (en) * | 2000-09-13 | 2006-05-18 | Keiichi Fukuda | Remedies for ischemic disease |
| US7887796B2 (en) | 2002-04-23 | 2011-02-15 | The Trustees Of Columbia University In The City Of New York | Method of inhibiting collagen formation by VDUP1 inhibition |
| US20070172467A1 (en) * | 2002-04-23 | 2007-07-26 | The Trustees Of Columbia University In The City Of New York | Regeneration of endogenous myocardial tissue by induction of neovascularization |
| US8663652B2 (en) | 2002-04-23 | 2014-03-04 | The Trustees Of Columbia University In The City Of New York | Regeneration of endogenous myocardial tissue |
| US20050233992A1 (en) * | 2002-04-23 | 2005-10-20 | Silviu Itescu | Regeneration of endogeneous myocardial tissue by induction of neovascularization |
| US8242091B2 (en) | 2002-04-23 | 2012-08-14 | The Trustees Of Columbia University In The City Of New York | Treatment of tumor with dnazyme directed to peroxiredoxin |
| US20070258943A1 (en) * | 2002-08-22 | 2007-11-08 | Cleveland Clinic Foundation | Genetically engineered cells for therapeutic applications |
| US9226978B2 (en) | 2002-08-22 | 2016-01-05 | The Cleveland Clinic Foundation | Method of treating ischemic disorders |
| US20100166717A1 (en) * | 2002-08-22 | 2010-07-01 | Penn Marc S | Method of treating ischemic disorders |
| US20040258670A1 (en) * | 2002-12-05 | 2004-12-23 | Case Western Reserve University | Cell-based therapies for ischemia |
| US7470538B2 (en) | 2002-12-05 | 2008-12-30 | Case Western Reserve University | Cell-based therapies for ischemia |
| US20050069527A1 (en) * | 2002-12-05 | 2005-03-31 | Case Western Reserve University | Cell-based therapies for ischemia |
| US7790458B2 (en) | 2004-05-14 | 2010-09-07 | Becton, Dickinson And Company | Material and methods for the growth of hematopoietic stem cells |
| US20050265980A1 (en) * | 2004-05-14 | 2005-12-01 | Becton, Dickinson And Company | Cell culture environments for the serum-free expansion of mesenchymal stem cells |
| US20060035290A1 (en) * | 2004-08-13 | 2006-02-16 | Medtronic, Inc. | Isolation of endothelial progenitor cell subsets and methods for their use |
| US20090226402A1 (en) * | 2005-11-07 | 2009-09-10 | Andrew Pecora | Compositions and Methods of Vascular Injury Repair |
| US8088370B2 (en) | 2005-11-07 | 2012-01-03 | Amorcyte, Inc. | Compositions and methods of vascular injury repair |
| US9534202B2 (en) | 2005-11-07 | 2017-01-03 | Amorcyte, Inc. | Compositions and methods for treating progressive myocardial injury due to a vascular insufficiency |
| US8343485B2 (en) | 2005-11-07 | 2013-01-01 | Amorcyte, Inc. | Compositions and methods of vascular injury repair |
| US8425899B2 (en) | 2005-11-07 | 2013-04-23 | Andrew L. Pecora | Compositions and methods for treating progressive myocardial injury due to a vascular insufficiency |
| US20070105217A1 (en) * | 2005-11-07 | 2007-05-10 | Pecora Andrew L | Compositions and methods of vascular injury repair |
| US8637005B2 (en) | 2005-11-07 | 2014-01-28 | Amorcyte, Inc. | Compositions and methods of vascular injury repair |
| US7794705B2 (en) | 2005-11-07 | 2010-09-14 | Amorcyte, Inc. | Compositions and methods of vascular injury repair |
| US20100034794A1 (en) * | 2006-10-03 | 2010-02-11 | Van Der Strate Barry W A | Endothelial progenitor cell compositions and neovascularization |
| US20100143317A1 (en) * | 2006-10-24 | 2010-06-10 | Andrew Pecora | Infarct area perfusion-improving compositions and methods of vascular injury repair |
| US9034316B2 (en) | 2006-10-24 | 2015-05-19 | Amorcyte, Llc | Infarct area perfusion-improving compositions and methods of vascular injury repair |
| US20080241246A1 (en) * | 2006-11-15 | 2008-10-02 | Arteriocyte Inc. | Cell-based therapies for treating liver disease |
| US8496926B2 (en) * | 2007-04-16 | 2013-07-30 | Biocardia, Inc. | Treatment for chronic myocardial infarction |
| US9504642B2 (en) | 2007-04-16 | 2016-11-29 | Biocardia, Inc. | Treatment for chronic myocardial infarct |
| US9517199B2 (en) | 2007-04-16 | 2016-12-13 | Biocardia, Inc. | Treatment for chronic myocardial infarct |
| US20090148415A1 (en) * | 2007-04-16 | 2009-06-11 | Biocardia, Inc. | Treatment for Chronic Myocardial Infarct |
| EP2185719A4 (en) * | 2007-08-02 | 2012-01-04 | Novimmune Sa | RANTES ANTIBODIES AND METHOD FOR THEIR USE |
| RU2612388C2 (ru) * | 2007-08-06 | 2017-03-09 | Ноксон Фарма Аг | Связывающие sdf-1 нуклеиновые кислоты и их применение |
| US8679477B2 (en) | 2007-12-14 | 2014-03-25 | The Cleveland Clinic Foundation | Use of SDF-1 to mitigate scar formation |
| US20100272679A1 (en) * | 2007-12-14 | 2010-10-28 | Penn Marc S | Compositions and methods of promoting wound healing |
| US8883756B2 (en) | 2009-08-28 | 2014-11-11 | Juventas Therapeutics, Inc. | SDF-1 delivery for treating ischemic tissue |
| CN112118851A (zh) * | 2018-03-16 | 2020-12-22 | 美迪因诺医疗创新科技有限公司 | 使用神经干细胞诱导血管生成的方法 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1290033A4 (en) | 2004-12-08 |
| JP5710574B2 (ja) | 2015-04-30 |
| US20150150943A1 (en) | 2015-06-04 |
| WO2001094420A1 (en) | 2001-12-13 |
| US20080057069A1 (en) | 2008-03-06 |
| US8153113B2 (en) | 2012-04-10 |
| CA2810249A1 (en) | 2001-12-13 |
| AU2001275339A1 (en) | 2001-12-17 |
| CA2412436A1 (en) | 2001-12-13 |
| JP2013063979A (ja) | 2013-04-11 |
| EP2324839A1 (en) | 2011-05-25 |
| US7662392B2 (en) | 2010-02-16 |
| US9387234B2 (en) | 2016-07-12 |
| CA2412436C (en) | 2013-05-21 |
| EP1290033A1 (en) | 2003-03-12 |
| JP2004509847A (ja) | 2004-04-02 |
| US20090142296A1 (en) | 2009-06-04 |
| WO2001094420B1 (en) | 2002-03-07 |
| JP5414958B2 (ja) | 2014-02-12 |
| JP5710709B2 (ja) | 2015-04-30 |
| JP2014001221A (ja) | 2014-01-09 |
| US8486416B2 (en) | 2013-07-16 |
| US20060111290A1 (en) | 2006-05-25 |
| US20100209401A1 (en) | 2010-08-19 |
| EP2324839B1 (en) | 2017-08-09 |
| MXPA02012067A (es) | 2004-08-19 |
| EP1290033B1 (en) | 2012-10-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8486416B2 (en) | Use of SDF-1 to improve ischemic myocardial function | |
| Kocher et al. | Neovascularization of ischemic myocardium by human bone-marrow–derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function | |
| Kocher et al. | Myocardial homing and neovascularization by human bone marrow angioblasts is regulated by IL-8/Gro CXC chemokines | |
| US8242091B2 (en) | Treatment of tumor with dnazyme directed to peroxiredoxin | |
| Rüster et al. | Mesenchymal stem cells display coordinated rolling and adhesion behavior on endothelial cells | |
| Itescu et al. | Myocardial neovascularization by adult bone marrow-derived angioblasts: strategies for improvement of cardiomyocyte function | |
| Itescu et al. | Myocardial neovascularization by adult bone marrow-derived angioblasts: strategies for improvement of cardiomyocyte function | |
| Bonaros et al. | CCR3-and CXCR4-mediated interactions regulate migration of CD34+ human bone marrow progenitors to ischemic myocardium and subsequent tissue repair | |
| Itescu et al. | Adult bone marrow-derived angioblasts for improvement of cardiomyocyte function after myocardial ischemia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ITESCU, SILVIU;REEL/FRAME:013948/0755 Effective date: 20030212 |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |