US20040101928A1 - Lipolytic enzyme genes - Google Patents

Lipolytic enzyme genes Download PDF

Info

Publication number
US20040101928A1
US20040101928A1 US10/250,824 US25082403A US2004101928A1 US 20040101928 A1 US20040101928 A1 US 20040101928A1 US 25082403 A US25082403 A US 25082403A US 2004101928 A1 US2004101928 A1 US 2004101928A1
Authority
US
United States
Prior art keywords
seq
ala
ser
mature peptide
gly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/250,824
Other languages
English (en)
Inventor
Noriko Tsutsumi
Jesper Vind
Shamkant Patkar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novozymes AS
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Assigned to NOVOZYMES A/S reassignment NOVOZYMES A/S ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: PATKAR, SHAMKANT ANANT, VIND, JESPER, TSUTSUMI, NORIKO
Publication of US20040101928A1 publication Critical patent/US20040101928A1/en
Priority to US11/474,151 priority Critical patent/US7271139B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16—Organic compounds
    • C11D3/38—Products with no well-defined composition, e.g. natural products
    • C11D3/386—Preparations containing enzymes, e.g. protease or amylase
    • A—HUMAN NECESSITIES
    • A21—BAKING; EDIBLE DOUGHS
    • A21D—TREATMENT, e.g. PRESERVATION, OF FLOUR OR DOUGH, e.g. BY ADDITION OF MATERIALS; BAKING; BAKERY PRODUCTS; PRESERVATION THEREOF
    • A21D8/00—Methods for preparing or baking dough
    • A21D8/02—Methods for preparing dough; Treating dough prior to baking
    • A21D8/04—Methods for preparing dough; Treating dough prior to baking treating dough with microorganisms or enzymes
    • A21D8/042—Methods for preparing dough; Treating dough prior to baking treating dough with microorganisms or enzymes with enzymes
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16—Organic compounds
    • C11D3/38—Products with no well-defined composition, e.g. natural products
    • C11D3/386—Preparations containing enzymes, e.g. protease or amylase
    • C11D3/38627—Preparations containing enzymes, e.g. protease or amylase containing lipase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C12N15/1027—Mutagenizing nucleic acids by DNA shuffling, e.g. RSR, STEP, RPR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C12N9/20—Triglyceride splitting, e.g. by means of lipase

Definitions

  • the present invention relates to a method of generating diversity into lipolytic enzymes by the use of the so-called family shuffling of homologous genes.
  • the invention also relates to polynucleotides for use in the method, and to lipolytic enzymes encoded by the polynucleotides.
  • the lipase of Thermomyces lanuginosus (also known as Humicola lanuginosa ) is known to be useful for various industrial purposes such as detergents and baking (EP 258068, WO 9404035). Its amino acid and DNA sequences are shown in U.S. Pat. No. 5,869,438.
  • novel lipolytic enzyme genes with a high homology to the T. lanuginosus lipase gene and are thus well suited for use in gene shuffling.
  • novel genes are shown as SEQ ID NO: 3, 5, 7, 9 and 11.
  • Identity tables for some protein and DNA sequences are shown below. The novel sequences are identified as follows:
  • Talthe1M SEQ ID NO: 3 and 4 from Talaromyces thermophilus.
  • Theiba1M SEQ ID NO: 5 and 6 from Thermomyces ibadanensis.
  • Taleme1M SEQ ID NO: 7 and 8 from Talaromyces emersonii.
  • Talbys1M SEQ ID NO: 9 and 10 from Talaromyces byssochiamydoides.
  • Thelan1M Lipase from Thermomyces lanuginosus , SEQ ID NO: 1 and 2.
  • Asptub2M EMBL A84589 Lipase from Aspergillus tubingensis.
  • Aspory3M EMBL E16314 Phospholipase A1 from Aspergillus oryzae.
  • Aspnig2M EMBL A90761 Lysophospholipase from Aspergillus niger.
  • the invention provides a method of generating genetic diversity into lipolytic enzymes by family shuffling of two or more homologous genes which encode lipolytic enzymes.
  • One gene encodes a lipolytic enzyme with at least 90% identity to the T. Ianuginosus lipase, and another gene encodes a lipolytic enzyme with 55-90% identity to the T. lanuginosus lipase.
  • the DNA shuffling technique Is used to create a library of chimeric shuffled genes, and this is expressed in a suitable expression system and the expressed proteins are screened for lipolytic enzyme activity.
  • the expressed proteins may further be screened to identify lipolytic enzymes with improved properties.
  • the invention also provides a polynucleotide comprising a nucleotide sequence encoding a lipolytic enzyme and a lipolytic enzyme (a polypeptide with lipolytic enzyme activity).
  • the polynucleotide may be a DNA sequence cloned into a plasmid present in E. coli deposit number DSM 14047, 14048, 14049, or 14051, the DNA sequence encoding a mature peptide shown in SEQ ID NO: 3, 5, 7 or 9 or one that can be derived therefrom by substitution, deletion, and/or insertion of one or more nucleotides.
  • the polynucleotide may have at least 90% identity with the DNA sequence encoding a mature peptide shown in SEQ ID NO: 3, at least 80% identity with the DNA sequence encoding a mature peptide shown in SEQ ID NO: 5, at least 65% identity with the DNA sequence encoding a mature peptide shown in SEQ ID NO: 7, or at least 60% identity with the DNA sequence encoding a mature peptide shown in SEQ ID NO: 9.
  • It may also be an allelic variant of the DNA sequence encoding a mature peptide shown in SEQ ID NO: 3, 5, 7 or 9; or it may hybridize under high stringency conditions with a complementary strand of the nucleic acid sequence encoding a mature peptide shown in SEQ ID NO: 3, 5, 7 or 9, or a subsequence thereof having at least 100 nucleotides.
  • the lipolytic enzyme may be encoded by a DNA sequence cloned into a plasmid present in E. coli deposit number DSM 14047 or 14049, or may have an amino acid sequence which is the mature peptide of SEQ ID NO: 6 or 10, or one that can be derived therefrom by substitution, deletion, and/or insertion of one or more amino acids.
  • the lipolytic enzyme may have an amino acid sequence which has at least 80% identity with the mature peptide of SEQ ID NO: 6 or at least 60% identity with the mature peptide of SEQ ID NO: 10.
  • the lipolytic enzyme may further be immunologically reactive with an antibody raised against the mature peptide of SEQ ID NO: 6 or 10 in purified form, be an allelic variant of the mature peptide of SEQ ID NO: 6 or 10; or be encoded by a nucleic acid sequence which hybridizes under high stringency conditions with a complementary strand of the nucleic acid sequence encoding a mature peptide shown in SEQ ID NO: 5 or 9, or a subsequence thereof having at least 100 nucleotides.
  • FIG. 1 shows a PCR scheme used in Example 7.
  • Lipolytic enzyme genes of the invention may be derived from strains of Talaromyces or Thermomyces, particularly Talaromyces thermophilus, Thermomyces ibadanensis, Talaromyces emersonii or Talaromyces byssochlamydoides , using probes designed on the basis of the DNA sequences in this specification.
  • genes and polypeptides shown in the sequence listing were isolated from the organisms indicated below.
  • Strains of Escherichia coli containing the genes were deposited by the inventors under the terms of the Budapest Treaty with the DSMZ—Deutsche Sammlung von Microorganismen und Zellkulturen GmbH, Mascheroder Weg 1b, D-38124 Braunschweig DE as follows: Gene and polypep- Clone de- Clone deposit
  • Source organism tide sequences posit No. date Talaromyces thermophilus ATCC SEQ ID NO: 3 and DSM 14051 8 Feb. 10518 4 2001
  • Thermomyces ibadanensis CBS SEQ ID NO: 5 and DSM 14049 8 Feb.
  • ATCC American Type Culture Collection
  • CBS Cartraalbureau voor Schimmelcultures
  • Uppsalalaan 8 3584 CT Utrecht, The Netherlands.
  • IMI International Mycological Institute, Bakeham Lane, Englefield Green, EGHAM, Surrey TW20 9TY, United Kingdom.
  • the polynucleotides to be used for recombination are two or more genes encoding lipolytic enzymes, including one with at least 90% identity and one with 55-90% identity to the T. lanuginosus lipase (SEQ ID NO: 2).
  • the poloynucleotides differ in at least one nucleotide.
  • the starting material may include the mature part of two or more (e.g. three, four or five) of SEQ ID NO: 1, 3, 5, 7 and/or 9. It may also include genes encoding two or more (e.g. three, four or five) of variants of SEQ ID NO: 2, 4, 6, 8 or 10 obtained by deleting, substituting and/or inserting one or more amino acids and/or by attaching a peptide extension at the N- and/or C-terminal. Examples of variants of the T. lanuginosus lipase are described, e.g., in U.S. Pat. No. 5,869,438, WO 9522615, WO 9704079 and WO 0032758, and similar variants can be made by altering corresponding amino acids in the other sequences.
  • any introns present in the genes may optionally be removed before the shuffling.
  • Shuffling between two or more homologous input polynucleotides may involve fragmenting the polynucleotides and recombining the fragments, to obtain output polynucleotides (i.e. polynucleotides that have been subjected to a shuffling cycle) wherein a number of nucleotide fragments are exchanged in comparison to the input polynucleotides.
  • DNA recombination or shuffling may be a (partially) random process in which a library of chimeric genes is generated from two or more starting genes.
  • a number of known formats can be used to carry out this shuffling or recombination process.
  • the process may involve random fragmentation of parental DNA followed by reassembly by PCR to new full length genes, e.g. as presented in U.S. Pat. No. 5,605,793, U.S. Pat. No. 5,811,238, U.S. Pat. No. 5,830,721, U.S. Pat. No. 6,117,679 .
  • In-vitro recombination of genes may be carried out, e.g. as described in U.S. Pat. No. 6,159,687, WO98/41623, U.S. Pat. No. 6,159,688, U.S. Pat. No. 5,965,408, U.S. Pat. No. 6,153,510.
  • the recombination process may take place in vivo in a living cell, e.g. as described in WO 97/07205 and WO 98/28416.
  • the parental DNA may be fragmented by DNA'se I treatment or by restriction endonuclease digests as descriobed by Kikuchi et al (2000a, Gene 236:159-167).
  • Shuffling of two parents may be done by shuffling single stranded parental DNA of the two parents as described in Kikuchi et al (2000b, Gene 243:133-137).
  • the lipolytic enzyme obtained by the invention is able to hydrolyze carboxylic ester bonds and is classified as EC 3.1.1 according to Enzyme Nomenclature 1992, Academic Press, Inc. It may particularly have activity as a lipase (triacylglycerol lipase) (EC 3.1.1.3), phospholipase A1 (EC 3.1.1.32), phospholipase A2 (EC 3.1.1.4), cholesterol esterase (EC 3.1.1.13) and/or galactolipase (EC 3.1.1.26).
  • a lipase triacylglycerol lipase
  • phospholipase A1 EC 3.1.1.32
  • phospholipase A2 EC 3.1.1.4
  • cholesterol esterase EC 3.1.1.13
  • galactolipase EC 3.1.1.26
  • thermostability was evaluated by means of Differential Scanning Calorimetry (DSC).
  • DSC Differential Scanning Calorimetry
  • the denaturation peak (T d ) when heated at 90 deg/hr at pH 5 is slightly above 75° C. for the lipolytic enzyme from T. ibadanensis , compared to slightly above 70° C. for the prior-art T. lanuginosus lipase.
  • the lipolytic enzyme from T. ibadanensis has optimum activity at alkaline pH (similar to the T. lanuginosus lipase) and has an isoelectric point of about 4.3 (slightly lower than the T. lanuginosus lipase).
  • the degree of homology may be determined by means of computer programs known in the art, such as GAP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wis., USA 53711) (Needleman, S. B. and Wunsch, C. D., (1970), Journal of Molecular Biology, 48, 443-45), using GAP with the following settings for polypeptide sequence comparison: GAP creation penalty of 3.0 and GAP extension penalty of 0.1.
  • the determination of homology may also be made using Align from the fasta package version v20u6.
  • Align is a Needleman-Wunsch alignment (i.e. global alignment), useful for both protein and DNA alignments.
  • the default scoring matrices BLOSUM50 and the identity matrix are used for protein and DNA alignments respectively.
  • the penalty for the first residue in a gap is ⁇ 12 for proteins and ⁇ 16 for DNA. While the penalty for additional residues in a gap is ⁇ 2 for proteins and ⁇ 4 for DNA.
  • the homologies discussed in this specification may correspond to at least 60% identity, in particular to at least 70% or at least 80% identity, e.g. at least 90% or at least 95% identity.
  • the enzyme of the invention can be used, e.g., in filtration improvement, vegetable oil treatment, baking, detergents, or preparation of lysophospholipid.
  • it may be used in known applications of lipolytic enzymes by analogy with the prior art, e.g.:
  • An enzyme with lipase activity may be used for fat hydrolysis and for modification of triglycerides and for production of mono- and diglycerides.
  • An enzyme with lipase activity may be used for interesterification of bulk fats, production of frying fats, shortenings and margarine components.
  • An enzyme with phospholipase activity (A1, A2) may be used for degumming of vegetable oils and for lysophospholipid production.
  • An enzyme with lysophospholipase activity can be used to improve the filterability of an aqueous solution or slurry of carbohydrate origin by treating it with the variant. This is particularly applicable to a solution or slurry containing a starch hydrolysate, especially a wheat starch hydrolysate since this tends to be difficult to filter and to give cloudy filtrates.
  • the treatment can be done in analogy with EP 219,269 (CPC International).
  • the lipolytic enzyme produced by the invention may be used as a detergent additive, e.g. at a concentration (expressed as pure enzyme protein) of 0.001-10 (e.g. 0.01-1) mg per gram of detergent or 0.001-100 (e.g. 0.01-10) mg per liter of wash liquor.
  • the detergent composition of the invention may for example be formulated as a hand or machine laundry detergent composition including a laundry additive composition suitable for pre-treatment of stained fabrics and a rinse added fabric softener composition, or be formulated as a detergent composition for use in general household hard surface cleaning operations.
  • a laundry detergent the variant may be effective for the removal of fatty stains, for whiteness maintenance and for dingy cleanup.
  • a laundry detergent composition may be formulated as described in WO 97/04079, WO 97/07202, WO 97/41212, PCT/DK WO 98/08939 and WO 97/43375.
  • the detergent composition of the invention may particularly be formulated for hand or machine dishwashing operations. e.g. as described in GB 2,247,025 (Unilever) or WO 99/01531 (Procter & Gamble).
  • the variant may be effective for removal of greasy/oily stains, for prevention of the staining/discoloration of the dishware and plastic components of the dishwasher by highly colored components and the avoidance of lime soap deposits on the dishware.
  • the detergent composition of the invention may be in any convenient form, e.g., a bar, a tablet, a powder, a granule, a paste or a liquid.
  • a liquid detergent may be aqueous, typically containing up to 70% water and 0-30% organic solvent, or non-aqueous.
  • the detergent composition comprises one or more surfactants, which may be non-ionic including semi-polar and/or anionic and/or cationic and/or zwitterionic.
  • the surfactants are typically present at a level of from 0.1% to 60% by weight, e.g. 0.5-40%, such as 1-30%, typically 1.5-20%.
  • the lipolytic enzyme can be used in the preparation of dough and baked products made from dough, such as bread and cakes, e.g. to increase dough stability and dough handling properties, or to improve the elasticity of the bread or cake.
  • it can be used in a process for making bread, comprising adding it to the ingredients of a dough, kneading the dough and baking the dough to make the bread. This can be done in analogy with U.S. Pat. No. 4,567,046 (Kyowa Hakko), JP-A 60-78529 (QP Corp.), JP-A 62-111629 (QP Corp.), JP-A 63-258528 (QP Corp.) or EP 426211 (Unilever).
  • the lipolytic enzyme may be used together with an anti-staling amylase, particularly an endo-amylase such as a maltogenic amylase in analogy with WO 99/53769 (Novo Nordisk).
  • an anti-staling amylase particularly an endo-amylase such as a maltogenic amylase in analogy with WO 99/53769 (Novo Nordisk).
  • the lipolytic enzyme may be incorporated in a flour composition such as a dough or a premix for dough.
  • the Aspergillus oryzae expression plasmid pCaHj 483 (WO 98/00529) consists of an expression cassette based on the Aspergillus niger neutral amylase II promoter fused to the Aspergillus nidulans triose phosphate isomerase non translated leader sequence (Pna2/tpi) and the A. niger amyloglycosidase terminator (Tamg). Also present on the plasmid is the Aspergillus selective marker amdS from A. nidulans enabling growth on acetamide as sole nitrogen source. These elements are cloned into the E. coli vector pUC19 (New England Biolabs). The ampicillin resistance marker enabling selection in E. coli of this plasmid was replaced with the URA3 marker of Saccharomyces cerevisiae that can complement a pyrF mutation in E. coli , the replacement was done in the following way:
  • the pUC19 origin of replication was PCR amplified from pCaHj483 with the primers 142779 (SEQ ID NO: 35) and 142780 (SEQ ID NO: 36).
  • Primer 142780 introduces a Bbul site in the PCR fragment.
  • the Expand PCR system (Roche Molecular Biochemicals, Basel, Switserland) was used for the amplification following the manufacturers instructions for this and the subsequent PCR amplifications.
  • the URA3 gene was amplified from the general S. cerevisiae cloning vector pYES2 (Invitrogen corporation, Carlsbad, Calif., USA) using the primers 140288 (SEQ ID NO: 37) and 142778 (SEQ ID NO: 38).
  • Primer 140288 introduces an EcoRI site in the PCR fragment.
  • the two PCR fragments were fused by mixing them and amplifying using the primers 142780 and 140288 in the splicing by overlap method (Horton et al (1989) Gene, 77, 61-68).
  • the resulting fragment was digested with EcoRI and BbuI and ligated to the largest fragment of pCaHj 483 digested with the same enzymes.
  • the ligation mixture was used to transform the pyrF E. coli strain DB6507 (ATCC 35673) made competent by the method of Mandel and Higa (Mandel, M. and A. Higa (1970) J. Mol. Biol. 45, 154). Transformants were selected on solid M9 medium (Sambrook et. al (1989) Molecular cloning, a laboratory manual, 2. edition, Cold Spring Harbor Laboratory Press) supplemented with 1 g/l casaminoacids, 500 ⁇ g/l thiamine and 10 mg/l kanamycin.
  • a plasmid from a selected transformant was termed pCaHj 527.
  • the Pna2/tpi promoter present on pCaHj527 was subjected to site directed mutagenises by a simple PCR approach.
  • Nucleotide 134-144 was altered from SEQ ID NO: 39 to SEQ ID NO: 40 using the mutagenic primer 141223 (SEQ ID NO: 41).
  • Nucleotide 423-436 was altered from SEQ ID NO: 42 to SEQ ID NO: 43 using the mutagenic primer 141222 (SEQ ID 44).
  • pMT2188 The resulting plasmid was termed pMT2188.
  • Plasmid pENI1861 was made in order to have the state of the art Aspergillus promoter in the expression plasmid, as well as a number of unique restriction sites for cloning.
  • a PCR fragment (app. 620 bp) was made using pMT2188 (see above) as template and the primers 051199J1 (SEQ ID 45) and 1298TAKA (SEQ ID 46).
  • Plasmid pENI1902 was made in order to have a promoter that works in both E. coli and Aspergillus. This was done by unique site elimination using the “Chameleon double stranded site-directed mutagenesis kit” as recommended by Stratagene®.
  • Plasmid pENI1861 was used as template and the following primers with 5′ phosphorylation were used as selection primers: 177996 (SEQ ID 47), 135640 (SEQ ID 48) and 135638 (SEQ ID 49).
  • the 080399J19 primer (SEQ ID NO: 50) with 5′ phosphorylation was used as mutagenic primer to introduce a ⁇ 35 and ⁇ 10 promoter consensus sequence (from E. coli ) in the Aspergillus expression promoter. Introduction of the mutations was verified by sequencing.
  • Plasmid pENI1960 was made using the Gateway VectorTM conversion system (Lifetechnology® cat no. 11828-019) by cutting pENI1902 with BamHI, filling the DNA ends using Klenow fragment polymerase and nucleotides (thus making blunt ends) followed by ligation to reading frame A GatewayTM PCR fragment. The cloning in the correct orientation was confirmed by sequencing.
  • YPG 4 g/L Yeast extract, 1 g/L KH2PO4, 0.5 g/L MgSO4-7aq, 5 g/L Glucose, pH 6.0.
  • strains of Thermomyces ibadanensis, Talaromyces emersonii, Talaromyces byssochlamydoides , and Talaromyces thermophilus were used as a genomic DNA supplier. Each strain was cultivated in 100 ml of YPG at appropriate temperature for several days. Mycelia was harvested and ground in liquid N 2 . It was suspended with 2 ml of 50 mM Tris-HCl (pH8.0) buffer including 100 mM NaCl, 25 mM EDTA, and 1% SDS and then 12 ⁇ l of proteinase K (25 mg/ml) was added. The suspension was incubated at 65° C. for 30-60min.
  • Tris-HCl pH8.0
  • Phenol extraction was done to remove proteins and DNA was precipitated by 0.7 volume of isopropanol. The precipitate was dissolved with sterilized water and RNase was added. After Phenol/isoamylalcohol extraction, DNA was precipitated by EtOH.
  • PCR reactions on each genomic DNA was done with HL 2 and HL12 (SEQ ID NO: 51 and 52) or HL2 and HL6 (SEQ ID NO: 51 and 53) designed based upon alignment lipases.
  • Step Temperature Time 1 94° C. 1 min 3 50° C. 1 min 4 72° C. 2 min 5 72° C. 10 min 6 4° C. forever
  • Steps 1 to 3 were repeated 30 times.
  • 540 bp of fragment and 380 bp of fragment were amplified from primer sets of HL2/HL12 and HL2/HL6, respectively. They were gel-purified with GFXTM PCR DNA and Gel Band Purification kit (amersham pharmacia biotech) Each DNA was sequenced and compared to the lipase, showing that a clone encodes the internal part of the lipase.
  • Amplified DNA fragment was gel-purified with GFXTM PCR DNA and Gel Band Purification kit (Amersham Pharmacia Biotech) and ligated into a pT7Blue vector or pST BLue-1 AccepTor vector (Novagen) with ligation high (TOYOBO, Japan).
  • the ligation mixtures were transformed into E. coli JM109 or DH5 ⁇ .
  • the sequence of four plasmids of each gene was determined and their sequence were compared. The sequence of majority is defined as the right nucleotide sequence.
  • A Plasmid with gene from Talaromyces thermophilus and oligo 051200j1/051200j8 (SEQ ID NO: 11 and 18).
  • B Plasmid with gene from Talaromyces emersonii and oligo 051200j9/051200j16 (SEQ ID NO: 19 and 26).
  • C Plasmid with gene from Thermomyces Ibadanensis and oligo 051200j17/051200j24 (SEQ ID NO: 27 and 34).
  • PCR fragments were run and purified from a 1% agarose gel and cloned into pENI1960 (see above) using Gateway cloning as recommended by the supplier (Life Technologies) and transformed into E. coli DH10b (Life Technologies, Gaithersburg, Md.) and sequenced, thus creating pENI 2146 ( Talaromyces emersonii lipase gene), pENI2147 ( Thermomyces Ibadanensis lipase gene) and pENI2148 ( Talaromyces thermophilus lipase gene).
  • PCR-fragment was cloned into pENI1960 cut with Scal (in order to cleave in the ccdB gene) using Gateway cloning as recommended by the supplier (Life Technologies) and transformed into E. coli DH10b and sequenced, thus creating intron-less Talaromyces thermophilus lipase gene.
  • [0101] 2 051200j10 and 051200j13 (SEQ ID NO: 20 and 23).
  • [0102] 3 051200j12 and 051200j15 (SEQ ID NO: 22 and 25).
  • PCR-fragment was cloned into and cloned into pENI1960 cut Scal using Gateway cloning as recommended by the supplier (Life Technologies) and transformed into E. coli DH10b and sequenced, thus creating an intron-less Talaromyces emersonii lipase gene.
  • PCR-fragment was cloned into and cloned into pENI1960 cut Scal using Gateway cloning as recommended by supplier (life technologies) and transformed into E. coli DH10b and sequenced, thus creating intron-less Thermomyces lbadanensis lipase gene.
  • Plasmids containing DNA sequences encoding lipolytic enzymes are mixed in equimolar amounts.
  • the following components where mixed in a microtube:
  • the tube is set in a Perkin Elmer 2400 thermocycler.
  • the following PCR-program is run:(94° C., 5 minutes) 1 cycle:
  • the PCR-reaction is run on a 1.5% agarose gel.
  • a DNA-band of the specific expected size is cut out of the agarose gel and purified using JETsorb (from GENOMED Inc.).
  • the purified PCR-product is cloned into a TA-vector (from Invitrogen (the original TA cloning kit).
  • the ligated product is transformed into a standard Escherichia coli strain (DH5a).
  • the shuffled sequences can then be subcloned from the E. coli TA vector into the yeast vector pJSOO26 (WO 9928448) as a BamHI-Xbal fragment (see WO 97/07205), and e.g. screened for new shuffled sequences with improved properties, e.g. improved performance in detergents (see WO 97/07205).
  • PCR products of lipolytic enzyme genes are generated as in the previous example and pooled in equimolar amounts. The following mixture is generated in a suitable tube:
  • the mixture is set in a PE2400 thermocycler where the following program is run: 96° C., 5 minutes, 25° C. 5 minutes, 0.5 ml Klenow enzyme is added, 25° C. 60 minutes, 35° C. 90 minutes.
  • 10 ⁇ l PCR mixture (0.25 mM dNTP, 1 ⁇ l 10* Taq buffer (Perkin Elmer), 2.5 mM MgCl2, 0.5 ⁇ l Taq enzyme) is added to the 10 ⁇ l in the tube in the thermocycler. Then the following standard PCR-program is run: (94° C., 5 minutes) 1 cycle, (94° C 30 seconds, 45° C., 30 seconds, 72° C. 30 seconds) 25 cycles, 72° C. 7 minutes, 4° C. indefinite.
  • PCR products are run on a 1.5% agarose gel. A clear unbiased smear is seen. DNA between 400 and 800 bp is isolated from the gel.
  • Half of the purified PCR product is mixed in a tube with two specific primers (40 pmol) flanking the gene of interest, 0.25 mM dNTP, 2 ⁇ l 10* Taq buffer, 2.5 mM MgCl2. Then the following standard PCR-program is run: (94° C., 5 minutes) 1 cycle, (94° C. 30 seconds, 50° C., 30 seconds, 72° C. 30 seconds) 25 cycles, 72° 0 C. 7 minutes, 4° C. indefinite.
  • the PCR product is run on a 1.5% agarose gel. A band of the expected size is isolated. Additional PCR is run using specific primers (as mentioned above) in order to amplify the PCR-product before cloning.
  • PCR-product and the desired vector are cut with the appropriate restriction enzymes (BamHI/XhoI).
  • the vector and the PCR product are run on a 1.5% agarose gel, and purified from the gel.
  • the cut PCR-product and the cut vector are mixed in a ligase buffer with T4 DNA ligase (Promega). After overnight ligation at 16° C. the mixture is transformed into E. coli strain DH5a.
  • lipase genes with homology to the Thermomyces lanuginosus lipase gene were cloned. These genes were cloned as genomic DNA and were thus known to contain introns.
  • oligoes were used in standard PCR (as known to a person skilled in the art), thus creating PCR fragments covering each and every exon (coding sequence) in the gene. These PCR fragments were purified from a 1% agarose gel. The PCR fragments were assembled into a full length gene, in a second PCR using the DNA oligoes flanking the whole gene, as primers.
  • Talaromyces thermophilus 051200j1, 051200J2, 051200J3, 051200J4, 051200J5, 051200J6, 051200J7 and 051200J8 (SEQ ID NO: 11-18), thus creating pENI2178, when cloned into pENI1960.
  • Talaromyces emersonii 051200J9, 051200J10, 051200J11, 051200J12, 051200J13, 051200J14, 051200J15 and 051200J16 (SEQ ID NO: 19-26), thus creating pENI2159, when cloned into pENI1960.
  • Thermomyces ibadanensis 051200J17, 051200J18, 051200J19, 051200J20, 051200J21, 051200J22, 051200J23 and 051200J24 (SEQ ID NO: 27-34), thus creating pENI2160, when cloned into pENI1960.
  • Talaromyces byssochlamydoides 080201P1, 080201P2, 080201P3, 080201P4, 080201 P5, 080201P6, 080201P7 and 080201P8 (SEQ ID NO: 54-61), thus creating pENI2230 when cloned into pENI1960.
  • oligonucleotides are shown in FIG. 1: 1298-taka, 19670, 19672, 115120 and 050401P6 (SEQ ID NO: 62-65 and 68).
  • 050401P1 (SEQ ID NO: 66) hybridises to 5 ′ T. lanuginose lipase gene.
  • 030501 P1 (SEQ ID NO: 67) hybridises to 5′ of the other 4 lipase genes.
  • pENI2376 is a derivative of pENI1861(pat. PCT/DK02/00050).
  • the vector and PCR-fragment was purified from a 1% gel and ligated O/N.
  • the ligated DNA pool was transformed into electro-competent E. coli DH10B, thus creating a library of app. 700.000 independent clones.
  • This library can be screened for activity towards various substrates such as Lecithin, DGDG, triglycerides such as tributyrine, olive oil, PNP-valerate or PNP-palmitate at different conditions such as high pH, low pH, high temperature, in presences of detergent, in the presence of ions or in the absence of ions.
  • substrates such as Lecithin, DGDG, triglycerides such as tributyrine, olive oil, PNP-valerate or PNP-palmitate at different conditions such as high pH, low pH, high temperature, in presences of detergent, in the presence of ions or in the absence of ions.
  • DNA-oligoes 1298-taka: gcaagcgcgcgcaatacatggtgttttgatcat 19670: ccccatcctttaactatagcg 19672: ccacacttctcttccttcctc 115120: gctttgtgcagggtaaatc 050401P1: cggccgggccgcggaggccagggatccaccatgaggagctcccttgtgctg 030501P1: cggccgggccgcggaggccacaagtttgtacaaaaagcagg (hybridises to 5′
  • Lipolytic enzymes from Thermomyces ibadanensis and Talaromyces thermophilus were prepared as described above, purified and used for characterization
  • the specific lipase activity was determined by the LU method described in WO 0032758, and the amount of enzyme protein was determined from the optical density at 280 nm. The specific activity was found to be 3181 LU/mg for the Th. ibadanensis lipase and 1000 LU/mg for the Tal. thermophilus lipase.
  • the pH-activity relation was found by determining the lipase by the LU method at pH 5, 6, 7, 8, 9 and 10. Both enzymes were found to have the highest lipase activity at pH 10.
  • the Th. ibadanensis lipase showed a broad optimum with more than 50% of maximum activity in the pH range 6-10 whereas the Tal. thermophilus lipase showed a stronger activity drop at lower pH with less than 30% of maximum activity at pH 5-8.
  • thermostability was determined by differential scanning calorimetry (DSC) at pH 5 (50 mM acetate buffer), pH 7 (50 mM HEPES buffer) and pH 10 (50 mM glycine buffer) with a scan rate of 90° C./hr.
  • the temperature at the top of the denaturation peak (T d ) was found to be as follows: T d (° C.) pH T. ibadanesis T. thermophilus 5 74* 72* 7 72 75 10 64 69

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Bakery Products And Manufacturing Methods Therefor (AREA)
  • Detergent Compositions (AREA)
  • Cereal-Derived Products (AREA)
US10/250,824 2001-02-23 2002-02-25 Lipolytic enzyme genes Abandoned US20040101928A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/474,151 US7271139B2 (en) 2001-02-23 2006-06-23 Lipolytic enzyme genes

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DKPA200100304 2001-02-23
DKPA200100304 2001-02-23
PCT/DK2002/000124 WO2002066622A2 (fr) 2001-02-23 2002-02-25 Genes d'enzyme lipolytique

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/474,151 Continuation US7271139B2 (en) 2001-02-23 2006-06-23 Lipolytic enzyme genes

Publications (1)

Publication Number Publication Date
US20040101928A1 true US20040101928A1 (en) 2004-05-27

Family

ID=8160293

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/250,824 Abandoned US20040101928A1 (en) 2001-02-23 2002-02-25 Lipolytic enzyme genes
US11/474,151 Expired - Fee Related US7271139B2 (en) 2001-02-23 2006-06-23 Lipolytic enzyme genes

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11/474,151 Expired - Fee Related US7271139B2 (en) 2001-02-23 2006-06-23 Lipolytic enzyme genes

Country Status (7)

Country Link
US (2) US20040101928A1 (fr)
EP (1) EP1404827A2 (fr)
JP (2) JP2004522448A (fr)
CN (1) CN1526013A (fr)
AU (1) AU2002234513B2 (fr)
CA (1) CA2432375C (fr)
WO (1) WO2002066622A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080182322A1 (en) * 2007-01-30 2008-07-31 Dayton Christopher L G Enzymatic Degumming Utilizing a Mixture of PLA and PLC Phospholipases
US20090069587A1 (en) * 2007-09-11 2009-03-12 Dayton Christopher L G Enzymatic Degumming Utilizing a Mixture of PLA and PLC Phospholipases with Reduced Reaction Time
US8241876B2 (en) 2008-01-07 2012-08-14 Bunge Oils, Inc. Generation of triacylglycerols from gums

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0112226D0 (en) 2001-05-18 2001-07-11 Danisco Method of improving dough and bread quality
US6936289B2 (en) 1995-06-07 2005-08-30 Danisco A/S Method of improving the properties of a flour dough, a flour dough improving composition and improved food products
BRPI9609230B1 (pt) 1995-06-07 2016-03-08 Bioteknologisk Inst molécula de dna recombinante, célula hospedeira microbiana, preparação compreendendo um polipeptídio apresentando atividade da hexose oxidase, polipeptídio de espécie algácea marinha tendo atividade da hexose oxidase e método de fabricar um produto cosmético
US7745599B1 (en) 1995-06-07 2010-06-29 Danisco A/S Hexose oxidase-encoding DNAs and methods of use thereof
US8178090B2 (en) 1995-06-07 2012-05-15 Danisco A/S Recombinant hexose oxidase
AU699331C (en) 1995-06-07 2005-08-25 Dupont Nutrition Biosciences Aps A method of improving the properties of a flour dough, a flour dough improving composition and improved food products
AU2002339115B2 (en) * 2001-05-18 2007-03-15 Dupont Nutrition Biosciences Aps Method of preparing a dough with an enzyme
EP1803353A3 (fr) * 2001-05-18 2007-07-18 Danisco A/S Procédé pour la préparation de pâte avec une enzyme
ATE494368T1 (de) 2002-10-01 2011-01-15 Novozymes As Polypeptide der gh-61-familie
AU2004252572B2 (en) 2003-06-25 2011-09-08 Novozymes A/S Polypeptides having alpha-amylase activity and polypeptides encoding same
CN101818177A (zh) 2004-07-16 2010-09-01 丹尼斯科公司 脂肪分解酶及其在食品工业中的应用
CA2592083C (fr) 2004-12-22 2017-02-21 Novozymes A/S Enzymes hybrides faits d'une premiere sequence d'acides amines codant une endo-amylase et d'une deuxieme sequence d'acides amines contenant un module liant des glucides
US20080138856A1 (en) * 2005-02-10 2008-06-12 Novozymes A/S Enzymatic Enantioselective Ester or Amide Hydrolysis or Synthesis
WO2008006781A2 (fr) * 2006-07-14 2008-01-17 Novozymes A/S Polypeptides présentant une activité lipase et polynucléotides codant pour ces polypeptides
US8586330B2 (en) 2006-07-14 2013-11-19 Novozymes A/S Methods for producing secreted polypeptides having biological activity
DE102006046857A1 (de) 2006-10-02 2008-04-03 Ab Enzymes Gmbh Klonierung, Expression und Verwendung saurer Lysophospholipasen
DE102006046719A1 (de) 2006-10-02 2008-04-03 Ab Enzymes Gmbh Klonierung, Expression und Verwendung saurer Phospholipasen
WO2008122640A2 (fr) 2007-04-09 2008-10-16 Novozymes A/S Traitement enzymatique pour le dégraissage des cuirs et peaux
CN102666824A (zh) 2009-12-21 2012-09-12 丹尼斯科美国公司 能够改进经脂肪酶处理的脂质基污渍的清洁的表面活性剂
US8765425B2 (en) 2011-03-23 2014-07-01 Butamax Advanced Biofuels Llc In situ expression of lipase for enzymatic production of alcohol esters during fermentation
US8759044B2 (en) 2011-03-23 2014-06-24 Butamax Advanced Biofuels Llc In situ expression of lipase for enzymatic production of alcohol esters during fermentation
JP6216495B2 (ja) * 2011-04-19 2017-10-18 三菱ケミカルフーズ株式会社 小麦粉膨化食品の製造方法
US9949409B2 (en) * 2016-05-11 2018-04-17 Facebook, Inc. Modular network switches, associated structures, and associated methods of manufacture and use
BR112019012155A2 (pt) * 2016-12-14 2019-11-12 Stichting Technische Wetenschappen uso de pelo menos uma molécula-guia de rna e uma proteína cas, método de ligação, clivagem, marcação ou modificação de um polinucleotídeo alvo de fita dupla, célula transformada, e, complexo de nucleoproteína
CN106676084B (zh) * 2017-02-09 2019-11-29 浙江工业大学 一种来源于嗜热踝节菌的脂肪酶突变体、编码基因及其应用
CN112175967B (zh) * 2020-10-10 2021-10-29 安徽农业大学 一种增强植物抵抗鳞翅目害虫的pen1基因及其应用
CN112175976B (zh) * 2020-11-12 2021-12-28 武汉轻工大学 一种耐高温脂肪酶基因tllgold及其应用
CN117916366A (zh) * 2021-08-30 2024-04-19 天野酶制品株式会社 含有脂肪酶作为有效成分的酯交换用酶剂
WO2023203080A1 (fr) 2022-04-20 2023-10-26 Novozymes A/S Procede de production d'acides gras libres
WO2023225459A2 (fr) 2022-05-14 2023-11-23 Novozymes A/S Compositions et procédés de prévention, de traitement, de suppression et/ou d'élimination d'infestations et d'infections phytopathogènes

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4275011A (en) * 1978-12-20 1981-06-23 Ajinomoto Company, Incorporated Method of producing improved glyceride by lipase
US5869438A (en) * 1990-09-13 1999-02-09 Novo Nordisk A/S Lipase variants
US5976855A (en) * 1994-02-22 1999-11-02 Novo Nordisk A/S Method of preparing a variant of a lipolytic enzyme
US6140094A (en) * 1997-01-16 2000-10-31 Rohm Gmbh Protein with phospholipase activity
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
US20040053360A1 (en) * 2001-02-07 2004-03-18 Signe Munk Lipase variants

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4810414A (en) 1986-08-29 1989-03-07 Novo Industri A/S Enzymatic detergent additive
WO1992019726A1 (fr) * 1991-05-01 1992-11-12 Novo Nordisk A/S Enzymes stabilisees
ATE222599T1 (de) 1992-06-16 2002-09-15 Sankyo Co Phospholipase a1, verfahren zu seiner herstellung und anwendung
CN1193346A (zh) 1995-07-14 1998-09-16 诺沃挪第克公司 一种具有脂解活性的修饰酶
WO1997007206A1 (fr) * 1995-08-11 1997-02-27 Okkels, Jens, Sigurd Procede pour preparer des variants polypeptidiques
ATE418608T1 (de) * 1997-03-18 2009-01-15 Novozymes As Methode zur herstellung einer bibliothek mittels dna-shuffling
ATE272107T1 (de) 1997-04-09 2004-08-15 Danisco Lipase und verwendung davon zur verbesserung von teigen und backwaren
EP1131416B1 (fr) * 1998-11-27 2009-09-02 Novozymes A/S Variants d'enzyme lipolytique

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4275011A (en) * 1978-12-20 1981-06-23 Ajinomoto Company, Incorporated Method of producing improved glyceride by lipase
US5869438A (en) * 1990-09-13 1999-02-09 Novo Nordisk A/S Lipase variants
US5976855A (en) * 1994-02-22 1999-11-02 Novo Nordisk A/S Method of preparing a variant of a lipolytic enzyme
US6140094A (en) * 1997-01-16 2000-10-31 Rohm Gmbh Protein with phospholipase activity
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
US20040053360A1 (en) * 2001-02-07 2004-03-18 Signe Munk Lipase variants

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080182322A1 (en) * 2007-01-30 2008-07-31 Dayton Christopher L G Enzymatic Degumming Utilizing a Mixture of PLA and PLC Phospholipases
US8956853B2 (en) 2007-01-30 2015-02-17 Bunge Oils, Inc. Enzymatic degumming utilizing a mixture of PLA and PLC phospholipases
US20090069587A1 (en) * 2007-09-11 2009-03-12 Dayton Christopher L G Enzymatic Degumming Utilizing a Mixture of PLA and PLC Phospholipases with Reduced Reaction Time
US8460905B2 (en) 2007-09-11 2013-06-11 Bunge Oils, Inc. Enzymatic degumming utilizing a mixture of PLA and PLC phospholipases with reduced reaction time
US8241876B2 (en) 2008-01-07 2012-08-14 Bunge Oils, Inc. Generation of triacylglycerols from gums
US8541211B2 (en) 2008-01-07 2013-09-24 Bunge Oils, Inc. Generation of triacylglycerols

Also Published As

Publication number Publication date
AU2002234513B2 (en) 2006-12-07
JP2004522448A (ja) 2004-07-29
CA2432375C (fr) 2015-09-08
WO2002066622A3 (fr) 2004-01-08
CA2432375A1 (fr) 2002-08-29
CN1526013A (zh) 2004-09-01
JP4130693B2 (ja) 2008-08-06
WO2002066622A2 (fr) 2002-08-29
US20070010418A1 (en) 2007-01-11
US7271139B2 (en) 2007-09-18
EP1404827A2 (fr) 2004-04-07
JP2008035867A (ja) 2008-02-21

Similar Documents

Publication Publication Date Title
US7271139B2 (en) Lipolytic enzyme genes
AU2002234513A1 (en) Method of generating diversity into lipolytic enzymes and lipolytic enzyme genes
EP2119773A1 (fr) Enzyme lipolytique des souches fusarium ou acremonium
EP1360278B1 (fr) Variantes de lipase
US7226770B2 (en) Lipolytic enzyme variant
US6645749B2 (en) Lipolytic enzyme
US7781200B2 (en) Polypeptides having lipase activity and polynucleotides encoding same
US6506588B2 (en) Lipolytic enzymes
US6511837B2 (en) Lipolytic enzymes
US6509182B2 (en) Lipolytic enzymes
HUT71315A (en) Modified cutinases, dna, vector and host
HUT74267A (en) Detergent compositions containing enzime
CA2150837A1 (fr) Cutinases modifiees, adn, vecteur et hote
WO2002024881A1 (fr) Phospholipase provenant de zygoascus hellenicus
CA2334041A1 (fr) Enzyme ayant une activite xylanase

Legal Events

Date Code Title Description
AS Assignment

Owner name: NOVOZYMES A/S, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TSUTSUMI, NORIKO;VIND, JESPER;PATKAR, SHAMKANT ANANT;REEL/FRAME:014938/0149;SIGNING DATES FROM 20030613 TO 20030616

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO PAY ISSUE FEE