US20020114781A1 - Modulation of IL-2- and IL-15-mediated T cell responses - Google Patents

Modulation of IL-2- and IL-15-mediated T cell responses Download PDF

Info

Publication number
US20020114781A1
US20020114781A1 US09/953,323 US95332301A US2002114781A1 US 20020114781 A1 US20020114781 A1 US 20020114781A1 US 95332301 A US95332301 A US 95332301A US 2002114781 A1 US2002114781 A1 US 2002114781A1
Authority
US
United States
Prior art keywords
cell
cells
agent
receptor
agents
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09/953,323
Other languages
English (en)
Inventor
Terry Strom
Xian Li
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beth Israel Deaconess Medical Center Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US09/953,323 priority Critical patent/US20020114781A1/en
Publication of US20020114781A1 publication Critical patent/US20020114781A1/en
Priority to US10/749,699 priority patent/US7579439B2/en
Assigned to BETH ISRAEL DEACONESS MEDICAL CENTER, INC. reassignment BETH ISRAEL DEACONESS MEDICAL CENTER, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ZHENG, XIN XIAO, STROM, TERRY B., LI, XIAN CHANG
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/55IL-2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/20Interleukins [IL]
    • A61K38/2013IL-2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/20Interleukins [IL]
    • A61K38/2086IL-13 to IL-16
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/04Drugs for skeletal disorders for non-specific disorders of the connective tissue
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/14Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/24Drugs for disorders of the endocrine system of the sex hormones
    • A61P5/30Oestrogens
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/5443IL-15
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto

Definitions

  • This invention relates to immunology, transplant rejection, and diseases associated with the immune system.
  • IL-2 and IL-15 are functionally redundant in stimulating T cell proliferation in vitro. However, their role in primary immune activation and immune homeostasis in vivo is much less clear. In vivo, IL-2 and IL-15 may have distinct functions and regulate distinct aspects of T cell activation. For example, IL-2 may prime activated T cells for apoptosis (Lenardo, Nature 353:858-861, 1991), while IL-15 may support cell survival (Dooms et al., J. Immunol. 161:2141-2150, 1998; Bulfone et al. Nature Medicine 3:1124-1128, 1997).
  • IL-15 also appears to drive the proliferation of memory type CD8 + T cells in vivo while IL-2 limits their continued expansion (Ku et al., Science 288:675-678, 2000).
  • the phenotype of IL-2 deficient mice is lymphoproliferative and autoimmune (Horak et al., Immunol. Rev. 148:35-44, 1995), whereas IL-15 deficient mice are somewhat lymphopenic and unable to mount a primary response to viral challenge (Kennedy et al., J. Exp. Med. 191:771-780, 2000; Lodolce et al., Immunity 2:669-676, 1998).
  • the molecular basis for this striking dichotomy remains enigmatic.
  • the functional receptors for IL-2 and IL-15 consist of a private ⁇ chain, which defines the binding specificity for IL-2 or IL-15, and shared IL-2 receptor ⁇ and ⁇ chains.
  • the ⁇ chain is also a critical signaling component of the IL-4, IL-7, and IL-9 receptors (Sugamura et al., Ann. Rev. Immunol. 14:179-205, 1996).
  • these receptor subunits can be expressed individually or in various combinations resulting in the formation of receptors with different affinities and/or with distinct signaling capabilities (Sugamura et al., supra).
  • the ⁇ chain can associate with either the a chain or the y chain to form dimeric structures, or with both the ⁇ and ⁇ chains to form trimeric structures.
  • the ⁇ chain can interact with the ⁇ chain and, through the ⁇ chain, with the ⁇ chain of either the IL-2 receptor or the IL-15 receptor.
  • the IL- 15 receptor ⁇ chain alone in contrast to the IL- 2 receptor ⁇ chain, can bind to IL-15 with a remarkably high affinity (Giri et al., EMBO J. 14:3654-3663, 1995).
  • this interaction is not believed to trigger signaling events.
  • trimerization of ⁇ , ⁇ , and ⁇ chain subunits is essential for the functional integrity of high affinity receptors for both IL-2 and IL-15.
  • activated T cells can express both IL-2 receptor ⁇ chain and IL-15 receptor ⁇ chain (Chae et al., J. Immunol. 157:2813-2819, 1996) and the ⁇ and ⁇ chains are constitutively expressed by activated T cells (Ishii et al., Int. Immunol. 6:1273-1277, 1994). Furthermore, both IL-2 and IL-15 are readily detected during immune activation in vivo (Li et al., J. Immunol. 161:890-896, 1998). Thus, it is unclear how activated T cells distinguish between IL-2, IL-15, and other ⁇ chain dependent cytokines in vivo.
  • the present invention is based, in part, on expression studies of IL-2 and IL-15 receptor subunits by cycling T cells in vivo. Surprisingly, these subunits direct activated T cell responses to IL-2 or IL-15 in a selective manner and, thereby, regulate the T cell response in vivo. In other words (and contrary to the conventional wisdom that IL-2 and IL-15 are redundant), IL-2 and IL-15 perform different roles in controlling T cell proliferation in vivo. In particular, IL-15 is critical for initiating T cell division, whereas IL-2 controls T cell expansion via down-regulation of ⁇ c expression.
  • the invention generally features novel combinations of IL-2 and IL-15 antagonists and methods of suppressing the immune response by administering these antagonists.
  • suppression is achieved by administration of a first agent that antagonizes an IL-15 molecule or an IL-15 receptor (IL-15R) and a second agent that antagonizes an IL-2 molecule or an IL-2 receptor (IL-2R).
  • IL-15R IL-15 receptor
  • IL-2R IL-2 receptor
  • compositions of the invention can include (in place of, or in addition to, the agents described above), agents that inhibit the expression of the nucleic acids (e.g., DNA or RNA) that encode an interleukin (e.g., IL-2 or IL-15) or an interleukin receptor (e.g., an IL-2 or an IL-15 receptor).
  • agents that inhibit the expression of the nucleic acids e.g., DNA or RNA
  • an interleukin e.g., IL-2 or IL-15
  • an interleukin receptor e.g., an IL-2 or an IL-15 receptor
  • the invention features novel combinations of agents that, when administered to a patient, reduce the number of antigen-reactive T cells.
  • the invention features compositions (e.g., pharamaceutically acceptable compositions) that include two or more agents, each of which promote T cell death.
  • the composition can contain at least one agent that promotes T cell death and at least one agent that inhibits T cell proliferation.
  • the agent that promotes T cell death can promote AICD (activation induced cell death), passive cell death, ADCC (antibody dependent cell-mediated cytotoxicity) or CDC (complement directed cytotoxicity).
  • Agents that promote AICD include IL-2 and related molecules (e.g., IL-2/Fc or other molecules that function as agonists of IL-2 or the IL-2 receptor (e.g., an antibody that specifically binds to the IL-2 receptor and mimics the binding of the receptor's natural ligand)).
  • Another agent that promotes AICD is the Fas Ligand (FasL).
  • Agents that promote passive cell death include agents that antagonize IL-15(by targeting, e.g., binding to, and thereby inhibiting the activity of, IL-15, an IL-15 receptor, or a component of the intracellular signaling pathway that is activated once a receptor is bound) or any other factor required for T cell survival (e.g., IL-4, IL-7, OX-4 ligand, IFN- ⁇ , 4-1 BB, or IGF-I).
  • agents that antagonize IL-15 by targeting, e.g., binding to, and thereby inhibiting the activity of, IL-15, an IL-15 receptor, or a component of the intracellular signaling pathway that is activated once a receptor is bound
  • any other factor required for T cell survival e.g., IL-4, IL-7, OX-4 ligand, IFN- ⁇ , 4-1 BB, or IGF-I.
  • compositions of the invention can include (in place of, or in addition to, one or more of the agents described above), agents that inhibit the expression of the nucleic acids (e.g., DNA or RNA) that encode an interleukin (e.g., IL-2 or IL-15) or an interleukin receptor (e.g., an IL-2 or an IL-15 receptor).
  • agents that inhibit the expression of the nucleic acids e.g., DNA or RNA
  • an interleukin e.g., IL-2 or IL-15
  • an interleukin receptor e.g., an IL-2 or an IL-15 receptor
  • agents that promote ADCC or CDC include fusion proteins that contain an interleukin (e.g., IL-2 or a mutant IL-15) and an Fc region (e.g., IL-2/Fc) as well as antibodies or other Fc-containing proteins that bind to an interleukin receptor (e.g., an IL-2 or an IL-15 receptor).
  • an interleukin e.g., IL-2 or a mutant IL-15
  • Fc region e.g., IL-2/Fc
  • antibodies or other Fc-containing proteins that bind to an interleukin receptor e.g., an IL-2 or an IL-15 receptor
  • compositions of the invention can include not only an agent that promotes T cell death, but also an agent that inhibits T cell proliferation.
  • Agents that inhibit T cell proliferation include rapamycin, mycophenolate mofetil (MMF), azathioprine, and any of the other agents known and used in the art to prevent cellular proliferation (including chemotherapeutic agents).
  • MMF mycophenolate mofetil
  • azathioprine any of the other agents known and used in the art to prevent cellular proliferation (including chemotherapeutic agents).
  • the use of an agent that inhibits T cell proliferation is particularly useful in combination with agents that promote AICD and also stimulate T cell proliferation (such as IL-2/Fc).
  • the invention features a pharmaceutically acceptable composition that includes IL-2/Fc (which, for example, promotes AICD and cellular lysis via ADCC or CDC), an IL-15 antagonist (which, for example, promotes passive cell death by antagonizing IL-15, a factor required for T cell survival), and rapamycin (which inhibits T cell proliferation).
  • IL-2/Fc which, for example, promotes AICD and cellular lysis via ADCC or CDC
  • an IL-15 antagonist which, for example, promotes passive cell death by antagonizing IL-15, a factor required for T cell survival
  • rapamycin which inhibits T cell proliferation.
  • an agent when two or more agents are employed, they need not be physically separate from one another. While an agent can be a single entity that has primarily one functional activity (e.g., an antibody that targets IL-2 or IL-15 by specifically binding IL-2 or IL-15), it can also be a single entity that has at least two functional activities (e.g., IL-2/Fc, mIL-15/Fc, or an anti-IL-2 or anti-IL-15 antibody; in these molecules, the interleukin mediates AICD and the Fc portion of the molecule mediates CDC and ADCC).
  • IL-2/Fc e.g., an antibody that targets IL-2 or IL-15 by specifically binding IL-2 or IL-15
  • mIL-15/Fc mIL-15/Fc
  • an anti-IL-2 or anti-IL-15 antibody e.g., anti-IL-2 or anti-IL-15 antibody
  • composition that includes (1) an agent that induces AICD, (2) an agent that induces CDC, and (3) an agent that inhibits cellular proliferation may include only two active ingredients (e.g., (1) an IL-2/Fc molecule, which induces AICD and CDC, and (2) rapamycin, which inhibits cellular proliferation).
  • compositions described herein are useful in treating patients who would benefit from immune suppression (e.g., a patient who has received, or is scheduled to receive, a transplant; a patient who has an immune disease, particularly an autoimmune disease; a patient who has cancer (e.g., a cancer of the immune system), or a patient suffering from graft versus host disease (GVHD)).
  • GVHD is characterized by a response of donor leukocytes against antigens in the recipient. This response is particularly problematic in bone marrow transplants, but also occurs in whole organ transplants; donor leukocytes resident in transplanted organs are always co-transplanted.
  • compositions of the invention can contain more than one agent, the methods of the invention are not limited to those in which the agents are administered simultaneously.
  • a patient could receive a composition containing an IL-15 antagonist or an IL-1 SR antagonist before receiving a composition containing an IL-2 antagonist or an IL-2R antagonist.
  • a patient could receive a composition containing rapamycin before receiving a composition containing an IL-2 agonist.
  • the compositions of the invention (applied simultaneously or sequentially) can be used to treat an organ or cellular graft before it is implanted in a patient.
  • the agents of the invention, and methods for their use, are described further below.
  • agents that target an IL-15R can be fusion proteins that include a mutant IL-15(mIL-15) polypeptide. These agents are unlikely to be immunogenic because the mutant IL-15 portion of the fusion protein can differ from wild type IL-15 by only a few substituted residues.
  • miL-15 polypeptides can bind the IL-15R ⁇ with high affinity, they can compete effectively with wild type IL-15 for the receptor.
  • agents of the invention can activate components of the host immune system, such as complement and phagocytes, which ultimately mediate elimination of (or depletion of) cells bearing the receptor (e.g., an IL-2 receptor) to which the agent binds.
  • agents of the invention can mediate lysis or phagocytosis of targeted cells.
  • IL-15R ⁇ alpha subunit of the IL-15 receptor
  • agents of the invention can be used to specifically target those cells that have been activated (e.g., antigen-activated T cells) or that have become malignant.
  • T cells represent a preferred target for the agents of the invention
  • the compositions of the invention can also be used to target other cells involved in the pathogenesis of immunological disorders, such as other cells of the immune system or hyperproliferating cells of tissues.
  • FIG. 1 is a representation of a wild-type IL-15 nucleic acid sequence (SEQ ID NO: 1) and the predicted amino acid sequence (SEQ ID NO: 2).
  • FIG. 2 is a representation of a mutant IL-15 nucleic acid sequence (SEQ ID NO: 3) and the predicted amino acid sequence (SEQ ID NO: 4).
  • the wild-type codon encoding glutamine at position 149, CAG, and the wild-type codon encoding glutamine at position 156, CAA, have both been changed to GAC, which encodes aspartate. (These positions (149 and 156) correspond to positions 101 and 108, respectively, in the mature IL-15 polypeptide, which lacks a 48-amino acid signal sequence).
  • FIG. 3A is a series of plots depicting expression of IL-2 receptor ⁇ , ⁇ and ⁇ c chains by dividing T cells in a host spleen 3 days after intravenous (i.v.) injection of CFSE-labeled cells. Representative data of six experiments are shown.
  • FIG. 3B is a series of plots depicting expression of IL-2 receptor ⁇ , ⁇ and ⁇ chains by dividing T cells in vitro.
  • CFSE-labeled cells lymphocytes were stimulated with anti-CD3(2 ⁇ g/ml) in vitro for three days.
  • Cell division and the expression of IL-2 receptor subunits were analyzed by fluorescence-activated cell sorting (FACS).
  • FIG. 3C is a plot depicting expression of L-selectin by dividing T cells in vivo.
  • Cells were harvested from lymph nodes of host mice three days after intravenous injection of CFSE-labeled cells and stained with PE-anti-CD62mAb. The quadrant was set based on cells stained with isotype control mAb.
  • FIG. 3D is a series of plots depicting differential expression of IL-2 receptor ⁇ chain between in vivo dividing T cells.
  • CFSE-labeled cells were stimulated in vivo for three days and cells in the second cell division were sorted. The sorted cells were re-stimulated in vitro with anti-CD3 and anti-CD28 for three days. Cells division and expression of the IL-2 receptor ⁇ chain were analyzed by FACS.
  • FIG. 4A is a series of plots depicting expression of IL-15 receptor a chain by dividing T cells in vivo three days after intravenous injection of CFSE-labeled cells.
  • Cells were stained with an IL-15-FLAG fusion protein, followed by staining with biotinylated anti-FLAG mAb and PE-streptavidin. Cell staining in the absence of IL-15-FLAG was included as a control.
  • FIG. 4B is a bar graph depicting the different response of in vivo dividing T cells to IL-2 and IL-15 in vitro.
  • CFSE-labeled lymphocytes were stimulated in vivo for three days and cell division was analyzed by examining the CFSE profile.
  • T cells in the second cell division were sorted and cells (1 ⁇ 10 4 ) were cultured in vitro with IL-2 or IL-15 for two days.
  • Cellular proliferation was determined by 3 H-TdR uptake. The results are presented as the mean CPM ⁇ SD of triplicate assays.
  • FIG. 4C is a pair of graphs depicting the effect of anti-CD25 treatment on T cell division in vivo.
  • Host mice were given anti-CD25 mAb intraperiotoneally (i.p.) at 1 mg/day for three days immediately before intravenous injection of CFSE-labeled cells.
  • Mice treated with isotype control mAb (rat IgG1) were included as a control.
  • FIG. 5A is a series of plots depicting intracellular IL-2 staining of in vivo dividing T cells.
  • CFSE-labeled cells were stimulated in vivo for three days.
  • Cells harvested from the host spleen were stimulated in vitro with PMA and ionomycin for four hours in the presence of GolgiStopTM.
  • Cells were then fixed, permeablized, and stained for IL-2 production.
  • Cells stained with isotype control mAb were included as a control.
  • FIG. 5B is a pair of graphs depicting expression of ⁇ c by CD4 + T cells from IL-2 deficient mice. Spleen cells from IL-2 deficient mice and wild type control mice were stained with PE-anti-mouse CD4 mAb and FITC-anti-mouse IL-2 receptor ⁇ c mAb. The expression of ⁇ c by CD4 + T cells was analyzed by FACS.
  • FIG. 5C is a series of plots depicting the effect of anti-CD25 treatment on ⁇ c expression by dividing T cells in vivo.
  • Host mice were given anti-CD25 mAb at 1 mg/day (i.p.) for three days immediately before intravenous injection of CFSE-labeled cells.
  • Expression of IL-2 receptor ⁇ and ⁇ chains on dividing T cells in vivo was determined on day three (i.e., three days after injection of CFSE-labeled cells).
  • Mice treated with an isotype control mAb (rat IgG1) were included as a control.
  • FIG. 5D is a series of plots depicting apoptotic cell death of in vivo dividing T cells.
  • CFSE-labeled cells were stimulated in vivo for three days.
  • Cells were harvested from the host spleen and stained with PE-annexin V.
  • Cell division and apoptic cell death were analyzed by FACS.
  • FIG. 5E is a series of plots depicting intracellular Bcl-2 expression by dividing T cells in vivo. CFSE-labeled cells were stimulated in vivo for three days. Cells harvested from the host spleen were stained with PE-anti-mouse Bcl-2 mAb or an isotype control mAb. Cell division and expression of Bcl-2 were analyzed by FACS.
  • FIG. 6 is a bar graph depicting the results of an experiment in which cell death (assessed by release of the isotope 51 Cr from CTLL-2 cells; see the x axis) was assessed following treatment with various agents.
  • NP40 is a detergent
  • IL-2/Fc is a fusion protein that contains IL-2 and the Fc region of an IgG molecule (this molecule is lytic);
  • C′ is rat complement
  • IL-2/FC-/- is a non-lytic IL-2-containing fusion protein
  • mIg is a murine immunoglobulin.
  • FIG. 7 is a series of histographs.
  • the fluorescence intensity of FcRI on CHO (Chinese hamster ovary) cells was measured after the cells were exposed to phosphate buffered saline (PBS; upper left), a murine immunoglobulin (mIgG2 a ; upper right), a non-lytic IL-2/Fc molecule (IL-2/Fc-/-; lower left), and a lytic IL-2 containing fusion protein (IL-2 /Fc; lower right).
  • PBS phosphate buffered saline
  • mIgG2 a murine immunoglobulin
  • IL-2/Fc-/- a non-lytic IL-2/Fc molecule
  • IL-2 /Fc lytic IL-2 containing fusion protein
  • FIG. 8 is a series of eight plots depicting the proliferative response of CD4 + (left-hand side) and CD8 + (right-hand side) T cells in vivo.
  • the cells were labeled with CFSE and stimulated in vivo for three days with a lytic molecule (IL-2/Fc), a cell proliferation agent (rapamycin (Rap)), or the two agents combined.
  • IL-2/Fc lytic molecule
  • rapamycin rapamycin
  • IL-2/FC was analyzed by their CFSE profile. This study supports the conclusion that rapamycin inhibits IL-2 proliferative signaling.
  • FIG. 9 is a series of four plots obtained from an experiment in which CFSE-labeled lymphocytes were stimulated in vivo for three days.
  • the expression of an IL-2R ⁇ chain on dividing T cells was assessed by FACS in animals that received no treatment (upper left), rapamycin alone (Rap; upper right), IL-2/Fc alone (lower left), or a combination of rapamycin and IL-2/Fc (Rap+IL-2/Fc; lower right).
  • This study supports the conclusion that treatment with rapamycin and IL-2/Fc promotes expression of the ⁇ subunit of the IL-2R during early T cell proliferation in vivo.
  • FIG. 10 is a pair of plots obtained when CFSE-labeled lymphocytes were stimulated in vivo for three days and analyzed by FACS.
  • the expression of Annexin V on dividing T cells (CD4 + ) was assessed in animals that received no treatment (left hand panel) or rapamycin and IL-2/Fc (Rap+IL-2/Fc; right hand panel). This study supports the conclusion that rapamycin and IL-2/Fc treatment promotes apoptosis of CD4+ cells during early T cell proliferation in vivo.
  • FIG. 11 is a Table showing the results of experiments that examined islet allograft survival in autoimmune non-obese diabetic (NOD) mice.
  • the grafts were assessed in terms of primary allograft function (the percentages shown in this column represent the percentage of mice in which the allograft functioned (function was assessed by monitoring blood glucose levels)) and the mean survival time (MST) of the functioning grafts.
  • MST mean survival time
  • n the number of animals tested.
  • the treatments are indicated under the heading “Treatment” (see also the legend that accompanies the Table and the description below).
  • the results presented here support the conclusion that treatment with a combination of rapamycin, IL-2/Fc and mIL-15/Fc results in long-term survival of islet allografts.
  • FIG. 12 is a Table showing the results of experiments that examined the survival of skin allografts in NOD mice.
  • the treatments are indicated under the heading “Treatment” (see also the legend that accompanies the Table and the description below).
  • the results presented here support the conclusion that treatment with a combination of rapamycin, IL-2/Fc and mIL-15/Fc results in long-term survival of skin allografts.
  • FIG. 13 is a line graph that plots the % of animals that remained diabetes free over time following treatment with a lytic IL-2/Fc molecule, a murine immunoglobulin (mIg), and a non-lytic IL-2/Fc molecule. Cytolytic IL-2/Fc blocked autoimmunity, but lytic IL-2/Fc did not.
  • An effective immune response begins when an antigen or mitogen triggers the activation of T cells.
  • T cell activation numerous cellular changes occur, which include the expression of cytokines and cytokine receptors.
  • cytokines include interleukin-15(IL-15), which is a T cell growth factor that stimulates the proliferation and differentiation of B cells, T cells, natural killer (NK) cells, and lymphocyte-activated killer (LAK) cells in vitro. In vivo, the proliferation of these cell types enhances the immune response.
  • IL-15 interleukin-15
  • Another cytokine involved in the immune response, and described herein, is IL-2.
  • compositions of the present invention include agents that target IL-15, or its receptor, and IL-2, or its receptor, and methods in which those compositions are used to suppress an immune response (e.g., a humoral or cellular immune response).
  • an immune response e.g., a humoral or cellular immune response.
  • Patients benefit from suppression of the immune response in a number of circumstances, for example, in the event of organ transplantation or immune disease, particularly autoimmune disease, or Graft Versus Host Disease. In other circumstances, for example when select immune cells have become malignant or autoaggressive, it is beneficial to actively destroy them.
  • the present invention is based on the discovery of novel ways to inhibit the immune response. Inhibition can be achieved by administering of a combination of agents, one of which targets IL-15 or an IL-15R and one of which targets IL-2 or an IL-2R (modes of administration, including ex vivo treatment of grafts, are known in the art and described further below). More generally, one can reduce the number of antigen-reactive T cells by activating signaling pathways that lead to the death of activated T cells (by, e.g., AICD);
  • compositions of the invention include agents that achieve one or more of these ends (i.e., that promote T cell death via a recognized cell death pathway (e.g., AICD, passive cell death, ADCC, or CDC)).
  • a recognized cell death pathway e.g., AICD, passive cell death, ADCC, or CDC
  • the compositions of the invention can include one or more agents that inhibit T cell proliferation (as occurs, e.g., in response to an antigen).
  • the invention features a composition (e.g., a pharmaceutically acceptable composition or one formulated for application to an organ or cell culture) that includes IL-2/Fc (which, for example, promotes AICD and cellular lysis via ADCC or CDC), mIL-15/Fc (which antagonizes IL-15(and thereby promotes passive cell death) and promotes cellular lysis via ACDD or CDC), and rapamycin (which inhibits T cell proliferation).
  • IL-2/Fc which, for example, promotes AICD and cellular lysis via ADCC or CDC
  • mIL-15/Fc which antagonizes IL-15(and thereby promotes passive cell death) and promotes cellular lysis via ACDD or CDC
  • rapamycin which inhibits T cell proliferation
  • agent is meant to encompass essentially any type of molecule that can be used as a therapeutic agent.
  • Proteins such as antibodies, fusion proteins, and soluble ligands, any of which may either be identical to a wild-type protein or contain a mutation (i.e., a deletion, addition, or substitution of one or more amino acid residues), and the nucleic acid molecules that encode them (or that are “antisense” to them; e.g., an oligonucleotide that is antisense to the nucleic acids that encode IL-2, IL-15, or a component (e.g., a subunit) of their receptors), are all “agents.”
  • the agents of the invention can either be administered systemically, locally, or by way of cell-based therapies (i.e., an agent of the invention can be administered to a patient by administering a cell that expresses that agent to the patient).
  • the cell can be a cell administered to the patient solely for the purpose of expressing the therapeutic agent.
  • the cell can also be a cell of a cellular, tissue, or organ transplant.
  • transplanted cells e.g., islet cells
  • cells within tissues or organs e.g., cells within a patch of skin or a liver, kidney, or heart
  • an agent or transduced with a nucleic acid molecule that encodes an agent ex vivo e.g., prior to transplantation.
  • the transplanted cell produces its own immunosuppressive agents.
  • a cell with a desirable phenotype e.g., an insulin producing cell
  • a cell with a desirable phenotype can be modified to include a gene producing one or more of the immunosuppresive factors of the invention.
  • the transplanted cell, tissue, or organ can be treated either prior to or subsequent to transplantation. Methods of administering agents to patients (or to cells or organs in culture) are known and routinely used by those of ordinary skill in the art and are discussed further below.
  • compositions of the invention can include one or more agents that target IL-15 or an IL-15 receptor.
  • agents that target IL-15 or an IL-15R include agents that bind to (or otherwise interact with) IL-15, an IL-15R, or the nucleic acids that encode them as well as agents that bind to and subsequently destroy IL-15R-bearing cells, such as activated T cells.
  • agents useful in achieving immune suppression can contain two functional moieties: a targeting moiety that targets the agent to an IL-15R-bearing cell and a target-cell depleting (e.g., lytic) moiety that leads to the elimination of the IL-15R-bearing cell.
  • the targeting moiety binds an IL-15R without effectively transducing a signal through that receptor.
  • the targeting moiety can include a mutant IL-15 polypeptide
  • the target-cell depleting moiety can include the Fc region of an immunoglobulin molecule.
  • the Fc region can be derived from an IgG, such as human IgG1, IgG2, IgG3, IgG4, or analogous mammalian IgGs or from an IgM, such as human IgM or analogous mammalian IgMs.
  • the Fc region includes the hinge, CH2 and CH3 domains of human IgG1 or murine IgG2 a .
  • mutant IL-15 polypeptides that bind the IL-15 receptor complex with an affinity similar to wild-type IL-15, but fail to fully activate signal transduction, have been produced. These mutant polypeptides compete effectively with wild-type IL-15 polypeptides and can inhibit one or more of the events that normally occur in response to IL-15 signaling, such as cellular proliferation.
  • the “wild-type IL-15 polypeptide” referred to herein is a polypeptide that is identical to a naturally occurring IL-15 (e.g., a wild-type IL-15 polypeptide is shown in FIG. 1).
  • a “mutant IL-15 polypeptide” is a polypeptide that has at least one mutation relative to wild-type IL-15 and that inhibits at least one of the in vivo or in vitro activities that are usually promoted by wild-type IL-15.
  • a mutant IL-15 polypeptide that can be used according to the present invention will generally block at least 40%, more preferably at least 70%, and most preferably at least 90% of one or more of the activities of the wild-type IL-15 molecule.
  • the ability of a mutant IL-15 polypeptide to block wild-type IL-15 activity can be assessed by numerous assays, including the BAF-BO3 cell proliferation assay described herein (in which the cells were transfected with a construct encoding IL-2R ⁇ ). Further, mutant polypeptides of the invention can be defined according the particular percent identity they exhibit with wild-type IL-15.
  • the length of the sequences compared will generally be at least 16 amino acids, preferably at least 20 amino acids, more preferably at least 25 amino acids, and most preferably at least 35 amino acids.
  • identity refers to the identity between subunits (amino acid residues of proteins or nucleotides of DNA molecules) within the two polypeptide or DNA sequences being compared. When a subunit position in both of the molecules is occupied by the same monomeric subunit (i.e., the same amino acid residue or nucleotide), then the molecules are identical at that position.
  • polypeptide that is 50% identical to a reference polypeptide that is 100 amino acids long can be a 50 amino acid polypeptide that is completely identical to a 50 amino acid long portion of the reference polypeptide. It might also be a 100 amino acid long polypeptide that is 50% identical to the reference polypeptide over its entire length. Of course, many other polypeptides will meet the same criteria. Identity is typically and most conveniently measured using sequence analysis software, such as the Sequence Analysis Software Package of the Genetics Computer Group at the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wis. 53705), with the default parameters thereof.
  • a mutant IL-15 polypeptide of the invention can be at least 65%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% (e.g., 96%, 97%, 98% or 99%) identical to wild-type IL-15.
  • the mutation can consist of a change in the number or content of amino acid residues.
  • the mutant IL-15 can have a greater or a lesser number of amino acid residues than wild-type IL-15.
  • the mutant polypeptide can contain a substitution of one or more amino acid residues that are present in the wild-type IL-15.
  • the mutant IL-15 polypeptide can differ from wild-type IL15 by the addition, deletion, or substitution of a single amino acid residue, for example, an addition, deletion or substitution of the residue at position 156.
  • the mutant polypeptide can differ from wild-type by an addition, deletion, or substitution of two amino acid residues, for example, the residues at positions 156 and 149.
  • the mutant IL-15 polypeptide can differ from wild-type IL-15 by the substitution of aspartate for glutamine at residues 156 and 149 (as shown in FIG. 2).
  • Mutant polypeptides useful as targeting agents like wild-type IL-15, recognize and bind a component of the IL-15R.
  • mutant IL-15 polypeptides can include one or more mutations within IL-2R ⁇ (the IL-2 receptor ⁇ subunit) binding domain.
  • a mutant IL-15 polypeptide contains a substitution of one amino acid residue for another
  • the substitution can be, but is not necessarily, a conservative substitution, which includes a substitution within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
  • the therapeutic agent can be an antibody.
  • IL-15 can be targeted (i.e., specifically bound) with an antibody.
  • the IL-15R can be targeted with antibodies that bind a component of the IL-15R (e.g., the IL-15R ⁇ subunit).
  • the methods by which antibodies, including humanized antibodies, can be generated against a component of the IL-15R are well known in the art.
  • the antibodies preferably should be able to activate complement and phagocytosis, for example, human IgG3 and IgG1 (preferably the latter) subclasses, or murine IgG2 a subclass.
  • compositions that contain: (a) two or more agents, each of which promote T cell death or (b) at least one agent that promotes T cell death and at least one agent that inhibits T cell proliferation.
  • the agent that promotes T cell death can do so by promoting passive cell death, which occurs when a T cell is deprived of a factor required for its survival.
  • IL-15 is one such agent (others are described below).
  • agents that interfere with the ability of IL-15 to serve as a survival factor can be included in the compositions of the invention (e.g., a composition can include an agent that promotes AICD, an agent that promotes passive cell death (e.g., an anti-IL-15 antibody), and, optionally, an agent that inhibits T cell proliferation.
  • a composition can include an agent that promotes AICD, an agent that promotes passive cell death (e.g., an anti-IL-15 antibody), and, optionally, an agent that inhibits T cell proliferation.
  • agents useful in achieving immune suppression can contain two functional moieties: a targeting moiety that targets the agent to an IL-15R-bearing cell (such as the mutant IL-15 molecule just described) and a target-cell depleting moiety that, for example, lyses or otherwise leads to the elimination of, the IL-15R-bearing cell.
  • the agent can be a chimeric polypeptide that includes a mutant IL-15 polypeptide and a heterologous polypeptide such as the Fc region of the IgG and IgM subclasses of antibodies.
  • the Fc region may include a mutation that inhibits complement fixation and Fc receptor binding, or it may be target-cell depleting (i.e., able to destroy cells by binding complement or by another mechanism, such as antibody-dependent complement lysis).
  • the Fc region can be isolated from a naturally occurring source, recombinantly produced, or synthesized (just as any polypeptide featured in the present invention can be).
  • an Fc region that is homologous to the IgG C-terminal domain can be produced by digestion of IgG with papain.
  • IgG Fc has a molecular weight of approximately 50 kDa.
  • the polypeptides of the invention can include the entire Fc region, or a smaller portion that retains the ability to lyse cells.
  • full-length or fragmented Fc regions can be variants of the wild-type molecule. That is, they can contain mutations that may or may not affect the function of the polypeptide.
  • Targeting occurs when an agent directly or indirectly binds to, or otherwise interacts with, an interleukin or an interleukin receptor in a way that affects the activity of the interleukin or the interleukin receptor.
  • Activity can be assessed by those of ordinary skill in the art and with routine laboratory methods. For example, one can assess the strength of signal transduction or another downstream biological event that occurs, or would normally occur, following receptor binding.
  • the activity generated by an agent that targets an interleukin or an interleukin receptor can be, but is not necessarily, different from the activity generated when a naturally occurring interleukin binds a naturally occurring interleukin receptor.
  • an agent that targets an IL-2 receptor falls within the scope of the invention even if that agent generates substantially the same activity that would occur had the receptor been bound by naturally occurring IL-2.
  • the agent can be described as a receptor agonist (the agent and the natural ligand being examined under the same conditions).
  • the agent when an agent generates activity that is less than the activity generated by a naturally occurring ligand, the agent can be described as an antagonist of the receptor (if the agent's primary interaction is with the receptor; e.g., mIL-15) or of the interleukin (if the agent's primary interaction is with the interleukin; e.g., an anti-IL-15 antibody).
  • the agent can be described as an antagonist of the receptor (if the agent's primary interaction is with the receptor; e.g., mIL-15) or of the interleukin (if the agent's primary interaction is with the interleukin; e.g., an anti-IL-15 antibody).
  • levels of activity are assessed by testing the agent and the naturally occurring receptor (or ligand) under the same conditions.
  • the Fc region that can be part of the agents of the invention can be “target-cell depleting” or “non-target-cell depleting.”
  • a non-target-cell depleting Fc region typically lacks a high affinity Fc receptor binding site and a C′1q binding site.
  • the high affinity Fc receptor binding site of murine IgG Fc includes the Leu residue at position 235 of IgG Fc.
  • the murine Fc receptor binding site can be destroyed by mutating or deleting Leu 235. For example, substitution of Glu for Leu 235 inhibits the ability of the Fc region to bind the high affinity Fc receptor.
  • the murine C′1q binding site can be functionally destroyed by mutating or deleting the Glu 318, Lys 320, and Lys 322 residues of IgG. For example, substitution of Ala residues for Glu 318, Lys 320, and Lys 322 renders IgG1 Fc unable to direct antibody-dependent complement lysis.
  • a target-cell depleting IgG Fc region has a high affinity Fc receptor binding site and a C′1q binding site.
  • the high affinity Fc receptor binding site includes the Leu residue at position 235 of IgG Fc
  • the C′1q binding site includes the Glu 318, Lys 320, and Lys 322 residues of IgG1.
  • Target-cell depleting IgG Fc has wild-type residues or conservative amino acid substitutions at these sites.
  • Target-cell depleting IgG Fc can target cells for antibody dependent cellular cytotoxicity or complement directed cytolysis (CDC).
  • CDC complement directed cytolysis
  • Appropriate mutations for human IgG are also known (see, e.g., Morrison et al., The Immunologist 2:119-124, 1994; and Brekke et al., The Immunologist 2:125, 1994).
  • Agents that target the IL-15R can mutant IL-15 polypeptides, optionally fused to an antigenic tag (e.g., a FLAG sequence).
  • FLAG sequences are recognized by biotinylated, highly specific, anti-FLAG antibodies, as described herein (see also Blanar et al., Science 256:1014, 1992; LeClair et al., Proc. Natl. Acad. Sci. USA 89:8145, 1992).
  • soluble IL-15R ⁇ chain can be used as antagonist. While the IL-15 receptor complex consists of ⁇ ⁇ ⁇ subunits, the ⁇ chain alone displays a high affinity for IL-15. Thus, soluble IL-15R ⁇ chain will bind IL-15 and prevent IL-15 from binding to a cell surface-bound IL-15R complex. Thus, a soluble IL-15R ⁇ chain can act as a receptor-specific antagonist.
  • soluble IL-15R ⁇ chain involves cloning the extracellular fragment of the IL-15R ⁇ chain from receptor-positive cells, such as activated T cells or receptor expressing cell lines, and, optionally, fusing it to a molecular tag sequence.
  • the tag sequence can be, for example, FLAG, GST, or Histidine.
  • This genetic construct in an expression vector can be transfected into expressing cell lines.
  • the tagged soluble IL-15R ⁇ chain produced by expressing cell lines will be purified using mAbs specific for the Tag sequence.
  • an IL-15R extracellular domain can be linked (e.g., fused by way of a peptide bond) to an immunoglobulin Fc domain (e.g. hinge, CH2 and CH3 domains of Immunoglogulin G), preferably of an IgG or IgM subtype.
  • an immunoglobulin Fc domain e.g. hinge, CH2 and CH3 domains of Immunoglogulin G
  • the agents that target IL-15R-bearing cells can be administered with an agent that targets IL-2 or an IL-2R.
  • An agent that is administered “with” another may be, but is not necessarily, administered at the same time or in the same manner (while this comment is stated in the context of a discussion of IL-2-related agents, it is applicable for any of the agents or molecules combined in the compositions of the invention).
  • an agent that targets an IL-15R may be administered before or after an agent that targets an IL-2R.
  • an agent that targets IL-15 or an IL15R can be administered ex vivo (to treat, for example, a cell, tissue, or organ that is slated for transplantation) while an agent that targets IL-2 or an IL-2R can be administered systemically (e.g., intravenously) to a patient (e.g. a patient who has received a transplant that was treated ex vivo with an agent that targets IL-15).
  • a patient e.g. a patient who has received a transplant that was treated ex vivo with an agent that targets IL-15.
  • an agent that promotes AICD at a different time or in a different manner than an agent that inhibits cellular proliferation.
  • any of the agents or types of molecules that are combined in the compositions of the invention can be administered separately.
  • agents that target IL-2 or an IL-2R include agents that bind to IL-2 or an IL-2R as well as agents that bind to and subsequently destroy IL-2R-bearing cells, such as activated T cells.
  • agents useful in achieving immune suppression can contain a moiety that targets the agent to an IL-2R-bearing cell and a target-cell depleting (e.g., lytic) moiety that leads to the elimination of the IL-2R-bearing cell.
  • the targeting moiety can bind an IL-2R without effectively transducing a signal through that receptor.
  • that region can be derived from the same immunoglobulin molecules described above.
  • Targeting agents such as an IL-2/Fc agent (e.g., see Zheng et al., J. Immunol. 163:4041-4048, 1999) can be administered with an agent that prevents IL-2-mediated IL-2R signaling, such as rapamycin.
  • agent that prevents IL-2-mediated IL-2R signaling such as rapamycin.
  • Agents that inhibit cellular proliferation are well known to those of ordinary skill in the art (and are discussed further below).
  • the therapeutic agent used in combination with an IL-15 antagonist can be an anti-IL-2 or an anti-IL-2R antibody (e.g., a humanized antibody) that antagonizes IL-2 or the IL-2R, respectively.
  • an anti-IL-2R antibody e.g., a humanized antibody
  • compositions e.g., pharmaceutically acceptable compositions
  • agents that contain: (a) two or more agents, each of which promote T cell death or (b) at least one agent that promotes T cell death and at least one agent that inhibits T cell proliferation.
  • the agent that promotes T cell death can do so by promoting AICD (activation induced cell death), and such agents include IL-2 and molecules that function as IL-2 agonists.
  • IL-2/Fc mutants of IL-2 that retain the ability to bind and transduce a signal through the IL-2 receptor, and antibodies that specifically bind and agonize the IL-2 receptor (e.g., an antibody that specifically binds the ⁇ subunit of the IL-2 receptor) can be included in the compositions of the invention.
  • agents that promote AICD include Fas Ligand (FasL), which stimulates T cell death by activating the Fas signal transduction cascade on activated T cells, and biologically active mutants thereof.
  • Fas Ligand Fas Ligand
  • Passive T cell death occurs when a T cell is deprived of an agent that is required for its survival.
  • factors including IL-4, IL-7, OX-40 ligand, IFN ⁇ , 4-1BB and IGF-I are essential (i.e., T cells die in the absence of each of these factors; see, e.g., Tu et al., J. Immunol. 165:1331-1336, 2000; Tsuda et al., J. Immunol. Meth. 236:37-51, 2000; Bertolino et al., Int. Immunol. 11: 1225-1238, 1999; Takahashi et al., J. Immunol.
  • T cells of one or more of these factors IL-15, IL-4, IL-7, etc.
  • IL-15, IL-4, IL-7, etc. IL-15, IL-4, IL-7, etc.
  • ADCC and CDC can be provoked by agents that bind to the T cell surface and that contain an Fc portion of an immunoglobulin molecule that activates ADCC or CDC.
  • agents include antibodies that bind to cell surface structures that are expressed on activated immune cells (e.g., cell surface receptors such as CD154, the IL-2 receptor, and the IL-15 receptor).
  • activated immune cells e.g., cell surface receptors such as CD154, the IL-2 receptor, and the IL-15 receptor.
  • a ligand/Fc chimeric fusion protein which binds to receptor proteins on the surface of activated cells (e.g., an IL-2/Fc or a mIL-15/Fc). Given these examples, other suitable agents will be apparent to those of ordinary skill in the art.
  • Agents that inhibit cellular proliferation include rapamycin (Sirolimus), mycophenolate mofetil (MMF), azathioprine, and any other of the agents that are known to be useful for the treatment of hyperproliferative disorders (such as cancer).
  • Well-characterized chemotherapeutics include agents that inhibit nucleic acid metabolism (such as purine and pyrimidine biosynthesis inhibitors, RNA synthesis inhibitors, and DNA binding, DNA modifying, or intercalating agents). These agents are especially useful when the composition used to, for example, inhibit an immune response, also contains an agent such as IL-2/Fc, which not only promotes AICD but also stimulates T cell proliferation.
  • Agents that inhibit cellular proliferation also include folic acid antimetabolites such as methotrexate (MTX) and pyrimethamine; purine antimetabolites (such as 6-mercaptopurine (6-MP) and azathioprine) and pyrimidine antagonists such as cytarabine (ara-C), 5-azacytidine, and 5-fluorouracil (these categories were mentioned above); alkylating and other DNA-linking agents (e.g., cyclophosphamide (CPA); mitomycin C, and Doxorubicin (Adriamycin)); vinca alkaloids (e.g., vincristine); and calcineurin inhibitors (e.g., Cyclosporin A, FK506, and Brequinar).
  • folic acid antimetabolites such as methotrexate (MTX) and pyrimethamine
  • purine antimetabolites such as 6-mercaptopurine (6-MP) and azathioprine
  • agents that can be used to inhibit cellular proliferation include agents that interfere directly with proteins involved in cell cycle regulation (such as anti-CDKs (Cell Division Kinase) or anti-cyclins) or proteins that affect cell proliferation check points (all proliferating cells have check points at different stages of the cell cycle that prevent them from entering the next stage of the cell division cycle (CDC) before they have concluded the previous step).
  • Pathways that feed into check point controls include DNA-, RNA- and protein-synthesis inhibitors (e.g., S6 kinase and PI-3-kinase inhibitors). Cytokinesis inhibitors can also be used.
  • a candidate agent e.g., a mutant IL-15 or IL-2 polypeptide
  • These in vivo assays represent only some of the routine ways in which one of ordinary skill in the art could further test the efficacy of agents of the invention.
  • the assays are relevant to organ transplantation, immune disease, particularly autoimmune disease, graft versus host disease and cancers of the immune system (e.g. cancers that arise when T cells become malignant).
  • the combination can be administered (either directly, by gene-based therapy, or by cell-based therapy) in the context of well-established transplantation paradigms.
  • Agents of the invention can be systemically or locally administered by standard means to any conventional laboratory animal, such as a rat, mouse, rabbit, guinea pig, or dog, before an allogeneic or xenogeneic skin graft, organ transplant, or cell implantation is performed on the animal.
  • Strains of mice such as C57 B1-10, B10.BR, and B10.AKM (Jackson Laboratory, Bar Harbor, Me.), which have the same genetic background but are mismatched for the H-2 locus, are well suited for assessing various organ grafts.
  • Function of the transplanted heart can be assessed frequently by palpation of ventricular contractions through the abdominal wall. Rejection is defined as the cessation of myocardial contractions.
  • Agents of the invention e.g., a combination of mutant IL-15/Fc and an antibody that binds to and inhibits IL-2 or IL-2R, or a combination of a mutant IL-15/FC, IL-2/Fc, and rapamycin
  • the effectiveness of various combinations of the agents of the invention can also be assessed following a skin graft.
  • a donor animal is anesthetized and the full thickness skin is removed from a part of the tail.
  • the recipient animal is also anesthetized, and a graft bed is prepared by removing a patch of skin from the shaved flank.
  • the patch is approximately 0.5 ⁇ 0.5 cm.
  • the skin from the donor is shaped to fit the graft bed, positioned, covered with gauze, and bandaged.
  • the grafts can be inspected daily beginning on the sixth post-operative day, and are considered rejected when more than half of the transplanted epithelium appears to be non-viable.
  • Agents of the invention e.g., a combination of mutant IL-15/Fc and an antibody that binds to and inhibits IL-2 or IL-2R, or a combination of a mutant IL- 15/FC, IL-2/Fc, and rapamycin
  • a combination of mutant IL-15/Fc and an antibody that binds to and inhibits IL-2 or IL-2R, or a combination of a mutant IL- 15/FC, IL-2/Fc, and rapamycin would be considered effective in reducing skin graft rejection if hosts that received these agents experienced a longer period of engraftment of the donor skin than did untreated hosts.
  • DBA/2 J islet cell allografts can be transplanted into rodents, such as 6-8 week-old B6 AFI mice rendered diabetic by a single intraperitoneal injection of streptozotocin (225 mg/kg; Sigma Chemical Co., St. Louis, Mo.).
  • streptozotocin 225 mg/kg
  • streptozotocin 225 mg/kg
  • syngeneic islet cell grafts can be transplanted into diabetic mice.
  • Islet cell transplantation can be performed by following published protocols (for example, see Gotoh et al., Transplantation 42:387, 1986). Briefly, donor pancreata are perfused in situ with type IV collagenase (2 mg/ml; Worthington Biochemical Corp., Freehold, N.J.).
  • the islets are isolated on a discontinuous Ficoll gradient. Subsequently, 300-400 islets are transplanted under the renal capsule of each recipient. Allograft function can be followed by serial blood glucose measurements (Accu-Check IIITM; Boehringer, Mannheim, Germany).
  • Primary graft function is defined as a blood glucose level under 11.1 mmol/l on day 3 post-transplantation, and graft rejection is defined as a rise in blood glucose exceeding 16.5 mmol/l (on each of at least 2 successive days) following a period of primary graft function.
  • Models of autoimmune disease provide another means to assess combinations of the agents of the invention in vivo. These models are well known to those of ordinary skill in the art and can be used to determine whether a given combination of agents, which includes, for example, an agent that targets an IL-15R, would be therapeutically useful in treating a specific autoimmune disease when delivered either directly, via genetic therapy, or via cell-based therapies.
  • Autoimmune diseases that have been modeled in animals include rheumatic diseases, such as rheumatoid arthritis and systemic lupus erythematosus (SLE), type I diabetes, and autoimmune diseases of the thyroid, gut, and central nervous system.
  • rheumatic diseases such as rheumatoid arthritis and systemic lupus erythematosus (SLE), type I diabetes, and autoimmune diseases of the thyroid, gut, and central nervous system.
  • animal models of SLE include MRL mice, BXSB mice, and NZB mice and their F 1 hybrids. These animals can be crossed in order to study particular aspects of the rheumatic disease process; progeny of the NZB strain develop severe lupus glomerulonephritis when crossed with NZW mice (Bielschowsky et al., Proc. Univ. Otago Med. Sch.
  • the general health of the animal as well as the histological appearance of renal tissue can be used to determine whether the administration of agents that target an IL-15R and, e.g., target the IL-2R, can effectively suppress the immune response in an animal model of SLE.
  • MRL-lpr/lpr One of the MRL strains of mice that develops SLE, MRL-lpr/lpr, also develops a form of arthritis that resembles rheumatoid arthritis in humans (Theofilopoulos et al., Adv. Immunol. 37:269, 1985).
  • an experimental arthritis can be induced in rodents by injecting rat type II collagen (2 mg/ml) mixed 1:1 in Freund's complete adjuvant (100 ⁇ l total) into the base of the tail. Arthritis develops 2-3 weeks after immunization.
  • nucleic acid molecules encoding agents of the invention e.g., agents that target the IL-15R and agents that target the IL-2R or that bind to and inactivate antigen-activated T cells
  • agents of the invention e.g., agents that target the IL-15R and agents that target the IL-2R or that bind to and inactivate antigen-activated T cells
  • T lymphocytes One way to target T lymphocytes is as follows. Spleen cell suspensions are prepared 2-3 days after the onset of arthritis and incubated with collagen (100 ⁇ g/ml) for 48 hours to induce proliferation of collagen-activated T cells. During this time, the cells are transduced with a vector encoding the polypeptide agent of interest. As a control, parallel cultures are grown but not transduced or, transduced with an “empty” vector.
  • the cells are then injected intraperiotoneally (5 ⁇ 10 7 cells/animal).
  • the effectiveness of the treatment is assessed by following the disease symptoms during the subsequent 2 weeks, as described by Chernajovsky et al. ( Gene Therapy 2:731-735, 1995). Lesser symptoms, compared to control, indicate that the combined agents of the invention, and the nucleic acid molecules that encode them, function as immunosuppressants and are therefore useful in the treatment of immune disease, particularly autoimmune disease.
  • OS chickens consistently develop spontaneous autoimmune thyroiditis resembling Hashimoto's disease (Cole et al., Science 160:1357, 1968). Approximately 15% of these birds produce autoantibodies to parietal cells of the stomach, just as in the human counterpart of autoimmune thyroiditis.
  • the manifestations of the disease in OS chickens include body size, fat deposit, serum lipids, cold sensitivity, and infertility.
  • Models of autoimmune disease in the central nervous system can also be experimentally induced.
  • An inflammation of the CNS which leads to paralysis, can be induced by a single injection of brain or spinal cord tissue with adjuvant in many different laboratory animals, including rodents and primates.
  • This model referred to as experimental allergic encephalomyelitis (EAE) is T cell mediated.
  • EAE experimental allergic encephalomyelitis
  • mice can also be produced by a single injection of acetylcholine receptor with adjuvants (Lennon et al., Ann. N.Y. Acad. Sci. 274:283, 1976).
  • Polypeptide agents of the invention including those that are fusion proteins (e.g., the mutant IL-15/Fc and IL-2/Fc molecules) can not only be obtained by expression of a nucleic acid molecule in a suitable eukaryotic or prokaryotic expression system in vitro and subsequent purification of the polypeptide agent, but can also be administered to a patient by way of a suitable gene therapeutic expression vector encoding a nucleic acid molecule. Further more a nucleic acid can be introduced into a cell of a graft prior to transplantation of the graft. Thus, nucleic acid molecules encoding the agents described above are within the scope of the invention.
  • nucleic acid molecules encoding them will necessarily have a certain identity with those that encode the corresponding wild-type polypeptides.
  • the nucleic acid molecule encoding a mutant IL-15 polypeptide can be at least 65%, preferably at least 75%, more preferably at least 85%, and most preferably at least 95% (e.g., 96%, 97%, 98%, or 99% ) identical to the nucleic acid encoding wild-type IL-15.
  • the length of the sequences compared will generally be at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 110 nucleotides.
  • nucleic acid molecules that encode agents of the invention can contain naturally occurring sequences, or sequences that differ from those that occur naturally, but, due to the degeneracy of the genetic code, encode the same polypeptide.
  • These nucleic acid molecules can consist of RNA or DNA (for example, genomic DNA, cDNA, or synthetic DNA, such as that produced by phosphoramidite-based synthesis), or combinations or modifications of the nucleotides within these types of nucleic acids.
  • the nucleic acid molecules can be double-stranded or single-stranded (i.e., either a sense or an antisense strand).
  • nucleic acid molecules of the invention are referred to as “isolated” because they are separated from either the 5′ or the 3′ coding sequence with which they are immediately contiguous in the naturally occurring genome of an organism.
  • the nucleic acid molecules are not limited to sequences that encode polypeptides; some or all of the non-coding sequences that lie upstream or downstream from a coding sequence can also be included.
  • Those of ordinary skill in the art of molecular biology are familiar with routine procedures for isolating nucleic acid molecules. They can, for example, be generated by treatment of genomic DNA with restriction endonucleases, or by performance of the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • nucleic acid molecule is a ribonucleic acid (RNA) molecules can be produced by in vitro transcription.
  • the isolated nucleic acid molecules of the invention can include fragments not found as such in the natural state.
  • the invention encompasses recombinant molecules, such as those in which a nucleic acid sequence (for example, a sequence encoding a mutant IL-15) is incorporated into a vector (for example, a plasmid or viral vector) or into the genome of a heterologous cell (or the genome of a homologous cell, at a position other than the natural chromosomal location).
  • agents of the invention can be fusion proteins.
  • a nucleic acid molecule encoding an agent of the invention can contain sequences encoding a “marker” or “reporter.”
  • marker or reporter genes include ⁇ -lactamase, chloramphenicol acetyltransferase (CAT), adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo r , G418 r ), dihydrofolate reductase (DHFR), hygromycin-B-phosphotransferase (HPH), thymidine kinase (TK), lacZ (encoding ⁇ -galactosidase), and xanthine guanine phosphoribosyltransferase (XGPRT).
  • CAT chloramphenicol acetyltransferase
  • ADA adenosine deaminase
  • DHFR dihydrofo
  • the nucleic acid molecules of the invention can be obtained by introducing a mutation into an agent of the invention (e.g., an IL-15 molecule or an IL-2 molecule) obtained from any biological cell, such as the cell of a mammal, or produced by routine cloning methods.
  • an agent of the invention e.g., an IL-15 molecule or an IL-2 molecule
  • the nucleic acids of the invention can be those of a mouse, rat, guinea pig, cow, sheep, horse, pig, rabbit, monkey, baboon, dog, or cat.
  • the nucleic acid molecules will be those of a human.
  • nucleic acid molecules described above can be contained within a vector that is capable of directing their expression in, for example, a cell that has been transduced with the vector. Accordingly, in addition to polypeptide agents, expression vectors containing a nucleic acid molecule encoding those agents and cells transfected with those vectors are among the preferred embodiments.
  • Vectors suitable for use in the present invention include T7-based vectors for use in bacteria (see, e.g., Rosenberg et al., Gene 56:125, 1987), the pMSXND expression vector for use in mammalian cells (Lee and Nathans, J. Biol. Chem. 263:3521, 1988), yeast expression systems, such as Pichia pastoris (for example the PICZ family of expression vectors from Invitrogen, Carlsbad, Calif.) and baculovirus-derived vectors (for example the expression vector pBacPAK9 from Clontech, Palo Alto, Calif.) for use in insect cells.
  • T7-based vectors for use in bacteria see, e.g., Rosenberg et al., Gene 56:125, 1987
  • the pMSXND expression vector for use in mammalian cells Lee and Nathans, J. Biol. Chem. 263:3521, 1988
  • yeast expression systems such as Pichia pastoris (for example the PICZ
  • the nucleic acid inserts which encode the polypeptide of interest in such vectors, can be operably linked to a promoter, which is selected based on, for example, the cell type in which expression is sought.
  • a promoter can be used in bacteria
  • a polyhedrin promoter can be used in insect cells
  • a cytomegalovirus or metallothionein promoter can be used in mammalian cells.
  • tissue-specific and cell type-specific promoters are widely available. These promoters are so named for their ability to direct expression of a nucleic acid molecule in a given tissue or cell type within the body.
  • One of ordinary skill in the art is well aware of numerous promoters and other regulatory elements that can be used to direct expression of nucleic acids.
  • vectors can contain origins of replication, and other genes that encode a selectable marker.
  • neomycin-resistance (neo r ) gene imparts G418 resistance to cells in which it is expressed, and thus permits phenotypic selection of the transfected cells.
  • Other feasible selectable marker genes allowing for phenotypic selection of cells include various fluorescent proteins, e.g. green fluorescent protein (GFP) and variants thereof.
  • GFP green fluorescent protein
  • Viral vectors that can be used in the invention include, for example, retroviral, adenoviral, and adeno-associated vectors, herpes virus, simian virus 40 (SV40), and bovine papilloma virus vectors (see, e.g., Gluzman (Ed.), Eukaryotic Viral Vectors , CSH Laboratory Press, Cold Spring Harbor, N.Y.).
  • Prokaryotic or eukaryotic cells that contain a nucleic acid molecule that encodes an agent of the invention and express the protein encoded in that nucleic acid molecule in vitro are also features of the invention.
  • a cell of the invention is a transfected cell, i.e., a cell into which a nucleic acid molecule, for example a nucleic acid molecule encoding a mutant IL-15 polypeptide, has been introduced by means of recombinant DNA techniques. The progeny of such a cell are also considered within the scope of the invention.
  • the precise components of the expression system are not critical.
  • a mutant IL-15 polypeptide can be produced in a prokaryotic host, such as the bacterium E.
  • a eukaryotic host such as an insect cell (for example, Sf21 cells), or mammalian cells (e.g., COS cells, CHO cells, 293 cells, NIH 3T3 cells, or HeLa cells). These cells are available from many sources, including the American Type Culture Collection (Manassas, Va.). In selecting an expression system, it matters only that the components are compatible with one another. One of ordinary skill in the art is able to make such a determination. Furthermore, if guidance is required in selecting an expression system, one can consult Ausubel et al. ( Current Protocols in Molecular Biology , John Wiley and Sons, New York, N.Y., 1993) and Pouwels et al. ( Cloning Vectors: A Laboratory Manual, 1985 Suppl. 1987).
  • Eukaryotic cells that contain a nucleic acid molecule that encodes the agent of the invention and express the protein encoded in such nucleic acid molecule in vivo are also features of the invention.
  • eukaryotic cells of the invention can be cells that are part of a cellular transplant, a tissue or organ transplant.
  • Such transplants can comprise either primary cells taken from a donor organism or cells that were cultured, modified and/or selected in vitro before transplantation to a recipient organism (e.g., eurkaryotic cells lines, including stem cells or progenitor cells). Since, after transplantation into a recipient organism, cellular proliferation may occur, the progeny of such a cell are also considered within the scope of the invention.
  • a cell being part of a cellular, tissue or organ transplant, can be transfected with a nucleic acid encoding a mutant Il -15 polypeptide and subsequently be transplanted into the recipient organism, where expression of the mutant IL-15 polypeptide occurs.
  • a cell can contain one or more additional nucleic acid constructs allowing for application of selection procedures, e.g. of specific cell lineages or cell types prior to transplantation into a recipient organism.
  • the expressed polypeptides can be purified from the expression system using routine biochemical procedures, and can be used as diagnostic tools or as therapeutic agents, as described below.
  • Agents that target an IL-15R can be used to determine whether a patient has a disease (e.g., an immune disease, particularly autoimmune disease) that is amenable to treatment with a combination of the agents described herein.
  • the diagnostic method can be carried out, for example, by obtaining a sample of tissue from a patient suspected of having an immune disease, particularly autoimmune disease or a cancer that is manifest as malignant immune cells and exposing that tissue to an antigenically-tagged polypeptide that targets an IL-15R.
  • the sample may be any biological sample, such as a blood, urine, serum, or plasma sample.
  • the sample may be a tissue sample (e.g.., biopsy tissue), or an effusion obtained from a joint (e.g., synovial fluid), from the abdominal cavity (e.g., ascites fluid), from the chest (e.g., pleural fluid), or from the central nervous system (e.g., cerebral spinal fluid).
  • the sample may also consist of cultured cells that were originally obtained from a patient (e.g., peripheral blood mononuclear cells).
  • the sample can be obtained from a mammal, such as a human patient. If the sample contains cells that are bound by the agent to which they are exposed, it is highly likely that they would be bound by that agent (e.g.
  • compositions of the invention are useful in inhibiting T cells that are involved, or would be involved, in an immune response (e.g., a cellular immune response) to an antigen; in inhibiting other cells involved in the pathogenesis of immunological disorders (e.g., monocytes, macrophages, and other antigen presenting cells such as dendritinc cells, NK cells, and granulocytes); and in destroying hyperproliferating cells (as seen, for example, in tissues involved in immunological disorders such as synovial fibroblasts (which are affected in rheumatoid arthritis) keratinocytes (which are affected in psoriasis), or dermal fibroblases (which are affected in systemic lupus erythematosis).
  • an immune response e.g., a cellular immune response
  • immunological disorders e.g., monocytes, macrophages, and other antigen presenting cells such as dendritinc cells, NK cells, and gran
  • compositions of the invention can be used to treat patients who are suffering from an immune disease, particularly autoimmune disease, including but not limited to the following: (1) a rheumatic disease such as rheumatoid arthritis, systemic lupus erythematosus, Sjögren's syndrome, scleroderma, mixed connective tissue disease, dermatomyositis, polymyositis, Reiter's syndrome or Behcet's disease (2) type I or type II diabetes (3) an autoimmune disease of the thyroid, such as Hashimoto's thyroiditis or Graves' Disease (4) an autoimmune disease of the central nervous system, such as multiple sclerosis, myasthenia gravis, or encephalomyelitis (5) a variety of phemphigus, such as phemphigus vulgaris, phemphigus vegetans, phemphigus foliaceus, Senear-Usher syndrome, or Brazilian phemphigus, (6)
  • Combinations of the agents of the invention can also be used to treat acquired immune deficiency syndrome (AIDS).
  • methods by which these agents are administered can be used to treat a patient who has received a transplant of synthetic or biological material, or a combination of both.
  • transplants can be organ, tissue or cell transplants, or synthetic grafts seeded with cells, for example, synthetic vascular grafts seeded with vascular cells.
  • GVHD vascular grafts seeded with vascular cells.
  • the invention encompasses administration of a target-cell depleting form of an agent that targets the IL-15R (or an IL-2 receptor, or a combination of IL-15 or the IL-15R and IL-2 or the IL-2R), it is possible to selectively kill autoreactive or “transplant destructive” immune cells without massive destruction of normal T cells. Accordingly, the invention features a method of killing cells that express the IL-15R in vivo, which includes activated or autoreactive or “transplant destructive” immune cells or malignant cells.
  • These methods can be carried out by administering to a patient a combination of agents that includes an agent that targets the IL-15R and that activates the complement system, lyses cells by the ADCC mechanism, or otherwise kills cells expressing the wild-type IL-15 receptor complex.
  • This method can be used to treat patients who have IL-15R + leukemia, lymphoma, or other IL-15R + malignant diseases, such as colon cancer.
  • the methods of the present invention and the therapeutic compositions used to carry them out contain “substantially pure” agents.
  • the agent is a polypeptide
  • the polypeptide is at least 60% by weight (dry weight) the polypeptide of interest, e.g., a polypeptide that binds and destroys IL-15R-bearing cells.
  • the agents e.g., the polypeptides
  • the agents are at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, the agent of interest. Purity can be measured by any appropriate standard method, e.g., column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
  • agents useful in the methods of the present invention can be obtained from naturally occurring sources, they can also be synthesized or otherwise manufactured (e.g., agents that bind and destroy IL-15R-bearing cells can be produced by expression of a recombinant nucleic acid molecule).
  • Polypeptides that are derived from eukaryotic organisms or synthesized in E. coli , or other prokaryotes, and polypeptides that are chemically synthesized will be substantially free from their naturally associated components.
  • polypeptide in the event the polypeptide is a chimera, it can be encoded by a hybrid nucleic acid molecule containing one sequence that encodes all or part of the agent (e.g., a sequence encoding a mutant IL-15 polypeptide and sequence encoding an Fc region of IgG).
  • Agents of the invention e.g., polypeptides
  • a mutation that consists of a substitution of one or more of the amino acid residues in IL-15 can be created using the PCR-assisted mutagenesis technique described herein for the creation of the mutant IL-15 polypeptide in which glutamine residues at positions 149 and 156 were changed to aspartic acid residues.
  • Mutations that consist of deletions or additions of amino acid residues can also be made with standard recombinant techniques.
  • agents of the invention can be administered with a physiologically acceptable carrier, such as physiological saline.
  • the therapeutic compositions of the invention can also contain a carrier or excipient, many of which are known to one of ordinary skill in the art.
  • Excipients that can be used include buffers (e.g., citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, proteins (e.g., serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol.
  • buffers e.g., citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer
  • amino acids e.g., amino acids, urea, alcohols, ascorbic acid, phospholipids, proteins (e.g., serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol.
  • the agents of the invention can be formulated in various ways, according to the corresponding route of administration. For example, liquid solutions can be made for ingestion or injection; gels or powders can be made for ingestion, inhal
  • Routes of administration are also well known to skilled pharmacologists and physicians and include intraperitoneal, intramuscular, subcutaneous, and intravenous administration. Additional routes include intracranial (e.g., intracisternal or intraventricular), intraorbital, opthalmic, intracapsular, intraspinal, intraperitoneal, transmucosal, topical, subcutaneous, and oral administration. It is expected that the intravenous or intra-arterial routes will be preferred for the administration of agents that target an IL-15 receptor.
  • the subcutaneous route may also be used frequently as the subcutaneous tissue provides a stable environment for polypeptides, from which they can be slowly released.
  • the cells/tissues/organs could either be transfected by incubation, infusion or perfusion prior to transplantation with a nucleic acid composition, such that the therapeutic protein is expressed and subsequently released by the transplanted cells/tissues/organs within the recipient organism.
  • the cells/tissues/organs could undergo a pretreatment by perfusion or simple incubation with the therapeutic protein prior to transplantation in order to eliminate transplant-associated immune cells adherent to the donor cells/tissues/organs (although this is only a side aspect, which will probably not be of any clinical relevance).
  • the cells may be administered either by an implantation procedure or with a catheter-mediated injection procedure through the blood vessel wall.
  • the cells may be administered by release into the vasculature, from which the subsequently are distributed by the blood stream and/or migrate into the surrounding tissue (this is done in islet cells transplantation, where the islet cells are released into the portal vein and subsequently migrate into liver tissue).
  • dosages for any one patient depend on many factors, including the general health, sex, weight, body surface area, and age of the patient, as well as the particular compound to be administered, the time and route of administration, and other drugs being administered concurrently.
  • Dosages for the polypeptide of the invention will vary, but can, when administered intravenously, be given in doses on the order of magnitude of 1 microgram to 10 mg/kg body weight or on the order of magnitude of 0.01 mg/l to 100 mg/l of blood volume.
  • a dosage can be administered one or more times per day, if necessary, and treatment can be continued for prolonged periods of time. Determining the correct dosage for a given application is well within the abilities of one of ordinary skill in the art.
  • recombinant human IL-2 was obtained from Hoffman-La Roche (Nutley, N.J.); rapamycin was obtained from Wyeth-Ayerst (Princeton, N.J.); cyclosporine-A (CsA) was obtained from Sandoz (East Hanover, N.J.); RPMI-1640 and fetal calf serum (FCS) were obtained from BioWittaker (Walkersville, Md.); penicillin, streptomycin, G418, and strepavidin-RED670 were obtained from Gibco-BRL (Gaithersburg, Md.); dexamethasone, PHA, lysozyme, Nonidet P-40, NaCl, HEPES, and PMSF were obtained from Sigma (St.
  • pRcCMV was obtained from InVitrogen Corporation (San Diego, Calif.); genistein was obtained from ICN Biomedicals (Irvine, Calif.); disuccinimidyl suberate (DSS) was obtained from Pierce (Rockford, Ill.); restriction endonucleases were obtained from New England Biolabs (Beverly, Mass.); [ 3 H]TdR was obtained from New England Nuclear (Boston, Mass.); and fluorescent dye conjugated antibodies CD25-PE 3 , CD14-PE, CD16-PE, CD122-PE, CD4-FITC, CD8-FITC, IgG1-PE or IgG1-FITC were obtained from Beckton/Dickinson (San Jose, Calif.). FLAG peptide was synthesized in the Peptide Synthesis Facility at Harvard Medical School.
  • FLAG-HMK-IL-15 an IL-15 polypeptide having an N-terminus covalently bound to the 18 amino acid FLAG-HMK-sequence (FLAG-HMK-IL-15).
  • FLAG sequences are recognized by biotinylated, highly specific anti-FLAG antibodies (Blanar et al., Science 256:1014, 1992); LeClair et al., Proc. Natl. Acad. Sci.
  • HMK Heart Muscle Kinase recognition site
  • a 322 bp cDNA fragment encoding mature IL-15 protein was amplified by PCR utilizing synthetic oligonucleotides [sense 5′-GGAATTCAACTGGGTGAATGTAATA-3′ (SEQ ID NO: 5; EcoRI site (underlined) plus bases 145-162); antisense
  • the backbone of the pAR(DRI)59/60 plasmid contains in frame sequences encoding the FLAG and HMK recognition peptide sequences (Blanar et al, Science 256:1014, 1992; LeClair et al., Proc. Natl. Acad. Sci. USA 89:8145, 1992).
  • the IL-15-related fusion construct FLAG-HMK-IL-15
  • FLAG-HMK-IL-15 was expressed in BL-21 strain E. coli and affinity purified with anti-FLAG coated beads as described (Blanar et al., Science 256:1014, 1992; LeClair et al., Proc. Natl. Acad. Sci. USA 89:8145, 1992).
  • the fusion protein was eluted from affinity columns after extensive washing with 0.1 M glycine (pH 3.0).
  • the eluate containing FLAG-HMK-IL-15 was dialyzed against a buffer containing 50 mM Tris (pH 7.4) and 0.1 M NaCl for 18 hours at 4° C., filtered through a 0.2 ⁇ m membrane, and stored at ⁇ 20° C.
  • FLAG-HMK-IL-15 binds the IL-15R ⁇ subunit
  • the purified FLAG-HMK-IL-15 fusion protein was tested to determine whether it interacts with cell surface IL-15 receptors.
  • [ 32 P]-FLAG-HMK-IL-15 was added to cultures of PBMCs that were activated by a mitogen, PHA.
  • the chemical cross-linker disuccinimidyl suberate (DSS) was added. The cells were washed, lysed, centrifuged, and detergent-soluble proteins were separated by SDS-PAGE.
  • FLAG-HMK-IL-15 is a Biologically Active Growth Factor that Requires Expression of IL-2R ⁇
  • the FLAG-HMK-IL-15 fusion protein was tested to determine whether it could function as a biologically active growth factor.
  • PHA-activated human PBMCs proliferate in response to either FLAG-HMK-IL-15 or human recombinant IL-2, as detected via the [ 3 H]-TdR incorporation assay.
  • a FLAG peptide lacking the IL-15 sequence does not stimulate cell proliferation.
  • the FLAG-HMK-IL-15 fusion protein stimulates proliferation of IL-2R ⁇ + BAF-BO3 cell transfectants that express the IL-2 R ⁇ subunit.
  • FLAG-HMK-IL-15 fusion protein does not, however, stimulate the proliferation of parental BAF-BO3 cells that were transfected with a vector lacking IL-2R ⁇ chain sequences.
  • FLAG-HMK-IL-15 is a biologically active growth factor that requires expression of IL-2R ⁇ chains upon target cells in order to stimulate cellular proliferation.
  • the FLAG-HMK-IL-15 fusion protein, biotinylated anti-FLAG antibody, and streptavidin-RED670 were employed to detect expression of IL-15 binding sites on human PBMCs by cytofluorometric analysis.
  • the PBMCs tested were either freshly isolated or PHA-activated. These cells were washed and incubated with either medium alone or FLAG-HMK-IL-15 followed by anti-FLAG biotinylated Ab and streptavidin-RED670. The stained cells were analyzed by flow cytometry. PBMCs that were activated with PHA expressed IL-5 R ⁇ proteins but resting PBMCs did not.
  • the IL-2R ⁇ Subunit is Critical for both IL-2 and IL-15 Signal Transduction
  • lymphokines can produce various undesirable events, such as allograft rejection.
  • resting T cells and long-term memory T cells do not express lymphokine receptors. This difference in receptor expression provides a means to target activated immune cells without interfering with resting cells.
  • Molecules designed to recognize some subunit of the IL-15R will recognize activated monocytes/macrophages as well as activated T cells and can be used to selectively inhibit or destroy these cells.
  • Derivatives of IL-15 that bind to an IL-15R subunit but that lack IL-15 activity, either because they block the binding and/or uptake of bona fide IL-15, are useful in the method of the invention.
  • the mutant IL-15 molecule described below provides a working example of such a derivative.
  • the human IL-15 protein bearing a double mutation (Q149 D; Q156 D) was designed to target the putative sites critical for binding to the IL-2R ⁇ subunit.
  • the polar, but uncharged glutamine residues at positions 149 and 156 were mutated into acidic residues of aspartic acid utilizing PCR-assisted mutagenesis.
  • a cDNA encoding the double mutant of IL-15 was amplified by PCR utilizing a synthetic sense oligonucleotide [5′-G GAATTC AACTGGGTGAATGTAATA-3′ (SEQ ID NO: ______ ); EcoRI site (underlined hexamer) plus bases 145-162] and a synthetic antisense oligonucleotide (5′-CG GGATCC TCAAGAAGTGTTGATGAACAT G T C GACAAT-ATGTACAAAACT G T C CAAAAAT-3′(SEQ ID NO: ______); BamHI site (underlined hexamer) plus bases 438-489; mutated bases are singly underlined].
  • a synthetic sense oligonucleotide [5′-G GAATTC AACTGGGTGAATGTAATA-3′ (SEQ ID NO: ______ ); EcoRI site (underlined hexamer) plus bases 145-162] and a synthetic antisense oligonu
  • the template was a plasmid containing cDNA that encodes human FLAG-HMK-IL-15.
  • the amplified fragment was digested with EcoRI/BamHI and cloned into the pAR(DRI)59/60 plasmid digested with EcoRI/BamRI as described (LeClair et al., Proc. Natl. Acad. Sci. USA 89:8145, 1989).
  • the presence of a mutation at residue 156 was confirmed by digestion with SalI; the mutation introduces a new SalI restriction site.
  • mutations were verified by DNA sequencing, according to standard techniques.
  • the FLAG-HMK-IL-15 (Q149D; Q156D) double mutant protein was produced, purified, and verified by sequencing as described above for the FLAG-HMK-IL-15 wild-type protein.
  • mutants that contain a single amino acid substitution either at position 149 or at position 156 were prepared. As described above, these positions (149 and 156) correspond to positions 101 and 108, respectively, in the mature IL-15 polypeptide, which lacks a 48-amino acid signal sequence.
  • this strategy can be used to incorporate any other amino acid in place of the glutamine residues at positions 149 or 156 or to introduce amino acid substitutions at positions other than 149 and/or 156.
  • the double mutant IL-15 polypeptide may inhibit BAF-BO3 proliferation in a dose dependent manner: addition of 30 ⁇ m (approximately 50 ⁇ g/ml) of the double mutant IL-15 inhibited proliferation more completely than did addition of 20 ⁇ L of the same concentration of the double mutant IL-15.
  • the ability of the FLAG-HMK-IL-15 double mutant polypeptide to bind PHA activated human PBMCs was demonstrated as follows. PHA-activated PBMCs were washed and incubated with medium alone, or with the FLAG-HMK-IL-15 double mutant. The cells were then incubated with an anti-FLAG biotinylated antibody and stained with streptavidin conjugated to RED670. The stained cells were analyzed by flow cytometry.
  • mutant IL-15 or IL-2 can be linked to the Fc fragment of the IgG subclass of antibodies according to the following method.
  • cDNA for Fc ⁇ 2a can be generated from mRNA extracted from an IgG2a secreting hybridoma using standard techniques with reverse transcriptase (MMLV-RT; Gibco-BRL, Grand Island, N.Y.) and a synthetic oligo-dT (12-18) oligonucleotide (Gibco BRL).
  • the mutant IL-15 cDNA can be amplified from a plasmid template by PCR using IL-15 specific synthetic oligonucleotides.
  • the 5′ oligonucleotide is designed to insert a unique NotI restriction site 40 nucleotides 5′ to the translational start codon, while the 3′ oligonucleotide eliminates the termination codon and modifies the C-terminal Ser residue codon usage from AGC to TCG to accommodate the creation of a unique BamHI site at the mutant IL-15/Fc junction.
  • Synthetic oligonucleotides used for the amplification of the Fc ⁇ 2a domain cDNA change the first codon of the hinge from Glu to Asp in order to create a unique BamHI site spanning the first codon of the hinge and introduce a unique XbaI site 3′ to the termination codon.
  • the Fc fragment can be modified so that it is non-target-cell depleting, i.e., not able to activate the complement system.
  • oligonucleotide site directed mutagenesis is used to replace the C′1q binding motif Glu318, Lys320, Lys322 with Ala residues.
  • Leu235 is replaced with Glu to inactivate the Fc ⁇ R I binding site.
  • cytokine and Fc ⁇ components in the correct translational reading frame at the unique BamHI site yields a 1,236 basepair open reading frame encoding a single 411 amino acid polypeptide (including the 18 amino acid IL-15 signal peptide) with a total of 13 cysteine residues.
  • the mature secreted homodimeric IL-15/Fc is predicted to have a total of up to eight intramolecular and three inter-heavy chain disulfide linkages and a molecular weight of approximately 85 kDa, exclusive of glycosylation.
  • mIL-15/Fc Proper genetic construction of mIL-15/Fc can be confirmed by DNA sequence analysis following cloning of the fusion gene as a NotI-XbaI cassette into the eukaryotic expression plasmid pRc/CMV (In vitrogen, San Diego, Calif.).
  • This plasmid carries a CMV promoter/enhancer, a bovine growth hormone polyadenylation signal and a neomycin resistance gene for selection with G418.
  • Plasmids carrying the mIL-15/Fc fusion gene is transfected into Chinese hamster ovary cells (CHO-K1, available from the American Type Culture Collection) by electroporation (1.5 kV/3 ⁇ F/0.4 cm/PBS) and selected in serum-free Ultra-CHO media (BioWhittaker Inc., Walkerville, Md.) containing 1.5 mg/ml of G418 (Geneticin, Gibco BRL). After subcloning, clones that produce high levels of the fusion protein are selected by screening supernatants from IL-15 by ELISA (PharMingen, San Diego, Calif.). mIL-15/Fc fusion proteins are purified from culture supernatants by protein A sepharose affinity chromatography followed by dialysis against PBS and 0.22 ⁇ m filter sterilization. Purified proteins can be stored at ⁇ 20° C. before use.
  • PE-anti-mouse CD25 (IL-2R ⁇ chain, IgG1, PC61), rat anti-mouse CD122 (IL-2R ⁇ chain, IgG2b, TM-b1), rat anti-mouse CD132 (IL-2R ⁇ c, IgG2b, TUGm2), hamster anti-mouse CD3 (IgG, 145-2C11), hamster anti-mouse CD28 (IgG, 37.51), PE-anti-mouse CD62 (IgG2a, MEL14), PE conjugated hamster anti-mouse Bcl-2 (IgG, 3F11), PE conjugated anti-mouse IL-2 (IgG2b, JES6-5H4), PE-annexin V, biotinylated anti-rat IgG2b, PE-streptoavidin, PE-CyChrome, and PE conjugated is
  • a biotinylated mouse anti-FLAG mAb and a rat IgG1 control mAb were obtained from Sigma Chemical Co. (St Louis, Mo.).
  • a B-cell hybridoma secreting rat anti-mouse CD25 mAb (TIB 222, IgG1) was obtained from the American Type Culture Collection (ATCC; Manassas, Va.). Cells were grown in serum free UltraCulture medium (BioWhittaker, Walkerville, Md.) and the mAb in the culture supernatant was purified with a protein G column.
  • IL-2 and IL-15 were purchased from R & D System (Minneapolis, Minn.). IL-15-FLAG and IL-15 mutant/Fc fusion proteins were constructed, expressed, and tested as previously reported (Chae et al., J. Immunol. 157:2813-2819, 1996; Kim et al., J. Immunol. 161:5742-5748, 1998). Rat anti-mouse ⁇ c mAbs (4G3/3E12, IgG2b) were used as previously reported (Li et al. J. Immunol. 164:1193-1199, 2000).
  • Lymphocytes were labeled with fluorochrome 5-carboxyfluorescein diacetate succinimidyl ester (CFSE; Molecular Probes, Inc., Portland, Ore.) as follows. Spleens and peripheral lymph nodes were harvested from donor mice and single cell suspensions were prepared in Hanks balanced salt solution (HBSS). Red blood cells were lysed by hypotonic shock. Cells were resuspended in HBSS at 1 ⁇ 10 7 /ml and labeled with CFSE as described by Wells et al. ( J. Clin. Invest. 100:3173-3183, 1997).
  • CFSE fluorochrome 5-carboxyfluorescein diacetate succinimidyl ester
  • mice were irradiated (1000 rad) with a Gammacell Exactor (Kanata, Ontario, Canada). Each mouse then received 4 to 6 ⁇ 10 7 CFSE-labeled cells in 0.5 ml HBSS via the tail vein. Three days later, the host mice were sacrificed and spleens and peripheral lymph nodes were harvested separately. Single cell suspensions were prepared for cell surface staining and FACS analysis.
  • irradiated host mice were treated with anti-CD25 mAb or anti- ⁇ c mAbs (i.p. at 1 mg/day for 3 days starting at i.v. injection of CFSE-labeled cells).
  • Cell division in vivo was determined on the third day following injection of CFSE-labeled cells.
  • Treatment with IL-15 mutant /Fc fusion protein consisted of 1.5 ⁇ g i.p. daily, for three days, starting at i.v. injection of labeled cells.
  • CFSE-labeled cells activated in vivo in irradiated allogeneic hosts were stained for the expression of IL-2 and IL-15 receptor subunits.
  • IL-2 receptor ⁇ chain expression cells (2 ⁇ 10 6 ) were stained with PE-anti-mouse CD25 mAb on ice for 30 minutes, washed, and resuspended in 1 ml PBS containing 0.5% BSA.
  • IL-2R ⁇ , and ⁇ c expression cells were incubated with a rat anti-mouse ⁇ chain (IgG2b) or ⁇ c mAb (IgG2b) on ice for 30 minutes, followed by incubation with a biotinylated anti-rat IgG2b. Cells were washed and further stained with PE-streptoavidin for 20 minutes. Cells were washed and resuspended in PBS-0.5% BSA for analysis. To detect IL-15R ⁇ chain expression, cells were incubated with an IL-15-FLAG fusion protein that binds to the ⁇ chain (Chae et al., J. Immunol.
  • Apoptosis of dividing T cells in vivo was analyzed as follows. CFSE-labeled lymphocytes were stimulated in vivo in irradiated allogeneic hosts as described above. Cells were harvested from the host spleen or peripheral lymph nodes three days later and stained with PE conjugated annexin V on ice for 15 minutes in labeling buffer. Cell division was identified based on the cells' CFSE profile, and apoptotic cell death in each distinct cell division was analyzed by annexin V staining.
  • Cells were also stained for intracellular IL-2 and Bcl-2 cytokine expression.
  • CFSE-labeled cells that had been activated in vivo for three days were harvested from the host spleen and lymph nodes.
  • Cells were restimulated in vitro with PMA (50 ng/ml) and ionomycin (500 ng/ml) for four hours and GolgiStopTM (PharMingen) was added for the last two hours of culture.
  • Cells were fixed and permeablized with Cytofix/Cytoperm (PharMingen) at 4° C.
  • CFSE-labeled cells were prepared from irradiated allogeneic hosts three days after i.v. injection of labeled cells. Cell proliferation in vivo was identified through analysis of their CFSE profiles. The second cell divisions were selected, gated, and sorted with FACS VantageTM sorter (Becton Dickinson) at 2000 events/second. The sorted cells were resuspended in RPMI 1640 medium supplemented with 10% FCS and 1% penicillin and streptomycin at 5 ⁇ 10 5 /ml and plated on anti-CD3 (2 ⁇ g/ml) coated plates along with anti-CD28 mAb (1 ⁇ g/ml). Three days later, cells were harvested and stained with PE-conjugated anti-mouse CD25 and isotype control Ab. Cell proliferation and IL-2 receptor ⁇ chain expression were analyzed by FACS.
  • CFSE-labeled cells were prepared from irradiated allogeneic hosts three days after intravenous injection of labeled cells, and cell proliferation in vivo was identified by analysis of the cells' CFSE profile. The second cell division was selected, gated, and sorted with FACS VantageTM.
  • Cells (1 ⁇ 10 4 /ml) were resuspended in RPMI 1640 medium with 10% FCS and 1% penicillin and streptomycin, and stimulated with IL-2 (40 ⁇ ml to 500 ⁇ /ml) or IL-15 (5 ng/ml) for 48 hours. Cells were pulsed with 1 mCi 3H-TdR (Amersham, Boston, Mass.) for 16 hours and 3 H-TdR uptake was determined by scintillation counting (Beckman Instrument, Columbia, Md.).
  • the IL-2 receptor ⁇ chain which is required for high affinity IL-2 receptor signaling, could not be detected during the first 5 divisions, i.e., this receptor subunit is expressed only after five cell divisions.
  • ⁇ subunits of the IL-2 receptor were expressed constitutively by all dividing T cells, and their level of expression was increased progressively as cells continued to divide.
  • the pattern of ⁇ c expression in vivo differed strikingly from that of the ⁇ chain and the ⁇ chain (FIG. 3A).
  • Undivided T cells (0 division) expressed very low levels of ⁇ chain ( ⁇ 10% ).
  • ⁇ chain was highly expressed by dividing T cells, and the levels of expression continued to increase after each consecutive cell division. After five cell divisions, however, ⁇ chain expression was drastically down regulated, nearly reaching the basal level after the sixth cell division (FIG. 3A).
  • IL-2 receptor subunits are not due to selective accumulation of a subset of activated T cells in the host spleen, as CFSE-labeled cells harvested from peripheral lymph nodes displayed a remarkably similar pattern of expression for the three subunits of the IL-2 receptor.
  • T cells at the second cell division which did not express IL2 receptor ⁇ chain, were sorted and stimulated in vitro with immobilized anti-CD3 and soluble anti-CD28 for three days. These sorted T cells continued to divide upon in vitro restimulation, and all dividing T cells expressed the IL-2 receptor ⁇ chain.
  • expression of IL-2 receptor ⁇ chain in vivo and in vitro is differentially regulated.
  • IL-15 As the receptor for IL-15 also uses the IL-2 receptor ⁇ and ⁇ chains as critical signaling components (Tagaya et al., Immunity 4:329-336, 1996), which are highly expressed during the first five cell divisions, we asked whether cells express an IL-15 receptor a chain that renders them responsive to IL-15 during initial cell divisions.
  • Application of an IL-15-FLAG fusion protein as a primary staining reagent (Chae et al., J. Immunol. 157:2813-2819, 1996), demonstrated that the IL-15 receptor ⁇ chain is clearly detectable, albeit at low levels, on dividing T cells regardless the number of cell divisions (FIG. 4A).
  • the ⁇ chain for IL-2 receptor was not detected on all dividing T cells in vivo.
  • IL-2 production was assessed in dividing T cells in vivo. Intracellular IL-2 staining revealed that IL-2 was highly expressed only by cells that have divided more than five times. Treatment of host mice with saturating doses of cytolytic anti-CD25 mAb failed to inhibit the first five cell divisions (relative to control Ab treated mice), and dividing cells in the first and fifth divisions were remarkably similar in anti-CD25 treated mice and in control mice. Furthermore, T cells at the second cell division in vivo were sorted and cultured in vitro in the presence of IL-2 or IL-15, and cell proliferation was analyzed by 3 H-TdR uptake. IL-2, provided in doses as high as 500 u/ml in culture, failed to support T cell proliferation. In contrast, IL-15 stimulated vigorous cell proliferation (FIG. 4B). See Li et al. Nature Medicine 7:114-118, 2001
  • the ⁇ chain is a critical signaling element for all known T cell growth factors and ⁇ chain signals are essential for cell survival, which is accomplished at least in part via sustained expression of Bcl-2 family anti-apoptotic proteins (Nakajima et al., J. Exp. Med. 185:189-195, 1997).
  • Bcl-2 family anti-apoptotic proteins Bcl-2 family anti-apoptotic proteins
  • IL-15 is a critical growth factor in initiating T cell division in vivo and IL-2's unique role in vivo is to control the magnitude of clonal expansion by regulating y chain expression on cycling T cells.
  • Lytic IL-2/Fc lyses IL-2R-bearing cells and binds to FcRI
  • CTL-2 cells Cells of a T cell line (CTLL-2 cells; 10 6 ) were labeled with 100 mCi 51 Cr and incubated with a lytic form of IL-2/Fc and rat low-toxic complement (C′), a non-lytic form of IL-2/Fc and C′, murine immunoglobulin and C′ (a negative control) or C′ alone (a negative control at 0.5 ⁇ g/ml).
  • C′ lytic form of IL-2/Fc and rat low-toxic complement
  • C′ a non-lytic form of IL-2/Fc and C′
  • murine immunoglobulin and C′ a negative control
  • C′ alone a negative control at 0.5 ⁇ g/ml
  • Another group of the same cells was treated with a detergent (1% NP40)(a positive control). Cell lysis was measured by 51 Cr release. The degree of lysis observed in the presence of the detergent represents 100% lysis.
  • FcRI transfectants were pre-incubated with PBS, mIgG2a, lytic IL-2/Fc, or nonlytic IL-2/Fc. After washing, fluorescent-conjugated goat anti-mouse Fc was used to stain the cells for FACS analysis. As shown in FIG. 7, cytolytic IL-2/Fc can bind FcRI, but lytic IL-2/Fc cannot.
  • Lytic IL-2/Fc is effective in preventing diabetes in an adoptive transfer model
  • IL-2/Fc Two different variants of IL-2/Fc were created. The first contained an Fc terminus derived from murine IgG2a that will mediate CDC and CDCC (IL-2/Fc), and the second was a point mutated Fc portion that would not activate CDC or CDCC (IL-2/Fc-/-). Whereas IL-2/Fc mediates CDC in IL-2R bearing cells (such as those of the murine CTLL-2 T cell line) and binds to FcRI, IL-2/Fc-/- does not (FIGS. 6 and 7).
  • IL-2R bearing cells such as those of the murine CTLL-2 T cell line
  • the lytic IL-2/Fc molecule will prevent the development of diabetes in an NOD adoptive transfer model, but a non-lytic form of the molecule (IL-2/Fc-/-) is uneffective (FIG. 13).
  • monodispersed spleen cells were depleted of erythrocytes by treatment with ACK Lysing Buffer (BioWhittaker Inc., Walkersville, Md.).
  • BGL Blood glucose levels
  • Rapamycin inhibits T cell proliferation in an in vivo graft versus host model, but does not inhibit apoptosis of activated T cells
  • rapamycin will inhibit the proliferation of CD4 + and CD8 + T cells, even in the presence of IL-2/Fc, but will allow the expression of a functional IL-2R.
  • Annexin V staining antigen activated host reactive T cells will undergo apoptosis in the presence of IL-2/Fc and rapamycin (FIG. 10).
  • compositions of the invention permit long-term survival of islet and skin allografts

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Diabetes (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Epidemiology (AREA)
  • Endocrinology (AREA)
  • Neurology (AREA)
  • Rheumatology (AREA)
  • Virology (AREA)
  • Dermatology (AREA)
  • Biomedical Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Emergency Medicine (AREA)
  • Oncology (AREA)
  • Transplantation (AREA)
  • Pain & Pain Management (AREA)
  • AIDS & HIV (AREA)
US09/953,323 2000-09-14 2001-09-14 Modulation of IL-2- and IL-15-mediated T cell responses Abandoned US20020114781A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US09/953,323 US20020114781A1 (en) 2000-09-14 2001-09-14 Modulation of IL-2- and IL-15-mediated T cell responses
US10/749,699 US7579439B2 (en) 2000-09-14 2003-12-30 Modulation of IL-2- and IL-15-mediated T cell responses

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US23225100P 2000-09-14 2000-09-14
US09/953,323 US20020114781A1 (en) 2000-09-14 2001-09-14 Modulation of IL-2- and IL-15-mediated T cell responses

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/749,699 Continuation US7579439B2 (en) 2000-09-14 2003-12-30 Modulation of IL-2- and IL-15-mediated T cell responses

Publications (1)

Publication Number Publication Date
US20020114781A1 true US20020114781A1 (en) 2002-08-22

Family

ID=22872402

Family Applications (2)

Application Number Title Priority Date Filing Date
US09/953,323 Abandoned US20020114781A1 (en) 2000-09-14 2001-09-14 Modulation of IL-2- and IL-15-mediated T cell responses
US10/749,699 Expired - Fee Related US7579439B2 (en) 2000-09-14 2003-12-30 Modulation of IL-2- and IL-15-mediated T cell responses

Family Applications After (1)

Application Number Title Priority Date Filing Date
US10/749,699 Expired - Fee Related US7579439B2 (en) 2000-09-14 2003-12-30 Modulation of IL-2- and IL-15-mediated T cell responses

Country Status (15)

Country Link
US (2) US20020114781A1 (https=)
EP (2) EP1349873B1 (https=)
JP (1) JP2004525076A (https=)
CN (1) CN1317301C (https=)
AT (1) ATE427318T1 (https=)
AU (1) AU2001292645A1 (https=)
BR (1) BR0113906A (https=)
CA (1) CA2422294C (https=)
DE (1) DE60138222D1 (https=)
ES (1) ES2322936T3 (https=)
IL (1) IL154925A0 (https=)
MX (1) MXPA03002278A (https=)
RU (1) RU2280255C2 (https=)
WO (1) WO2002022805A2 (https=)
ZA (1) ZA200302933B (https=)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050002929A1 (en) * 2003-01-31 2005-01-06 Francisco Sanchez-Madrid Immune regulation based on the targeting of early activation molecules
US20050069521A1 (en) * 2003-08-28 2005-03-31 Emd Lexigen Research Center Corp. Enhancing the circulating half-life of interleukin-2 proteins
US20050202021A1 (en) * 2004-01-22 2005-09-15 Emd Lexigen Research Center Corp. Anti-cancer antibodies with reduced complement fixation
US20090082299A1 (en) * 2006-01-13 2009-03-26 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Codon optimized il-15 and il-15r-alpha genes for expression in mammalian cells
US20110020269A1 (en) * 2007-05-08 2011-01-27 Beth Israel Deaconess Medical Center, Inc. Methods and compositions for modifying t cell immune responses and inflammation
EP2665486A4 (en) * 2011-01-18 2014-06-25 Bioniz Llc COMPOSITIONS AND METHOD FOR MODULATING A GAMMA C CYTOKINE ACTIVITY
US8871191B2 (en) 2009-08-14 2014-10-28 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of IL-15 preparations to treat lymphopenia
US20170319659A1 (en) * 2012-06-28 2017-11-09 University Of Central Florida Research Foundation, Inc. Methods and compositions for natural killer cells
US9959384B2 (en) 2013-12-10 2018-05-01 Bioniz, Llc Methods of developing selective peptide antagonists
US10030058B2 (en) 2015-10-09 2018-07-24 Bioniz, Llc Modulating gamma-C-cytokine activity
US11661459B2 (en) 2020-12-03 2023-05-30 Century Therapeutics, Inc. Artificial cell death polypeptide for chimeric antigen receptor and uses thereof
US12030936B2 (en) 2019-05-03 2024-07-09 Bioniz Therapeutics, Inc. Modulating the effects of gamma-c-cytokine signaling for the treatment of alopecia and alopecia associated disorders
US12269888B2 (en) 2020-12-03 2025-04-08 Century Therapeutics, Inc. Artificial cell death polypeptide for chimeric antigen receptor and uses thereof
US12600757B2 (en) 2017-04-07 2026-04-14 Bioniz Therapeutics, Inc. Peptides inhibiting gamma-c-cytokine activity and methods of use

Families Citing this family (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7541184B2 (en) 2000-02-24 2009-06-02 Invitrogen Corporation Activation and expansion of cells
US7572631B2 (en) 2000-02-24 2009-08-11 Invitrogen Corporation Activation and expansion of T cells
US7247304B2 (en) 2001-08-23 2007-07-24 Genmab A/S Methods of treating using anti-IL-15 antibodies
US20050084967A1 (en) 2002-06-28 2005-04-21 Xcyte Therapies, Inc. Compositions and methods for eliminating undesired subpopulations of T cells in patients with immunological defects related to autoimmunity and organ or hematopoietic stem cell transplantation
ATE500267T1 (de) 2003-07-21 2011-03-15 Transgene Sa Multifunktionelle cytokine
DE602004031341D1 (de) 2003-07-21 2011-03-24 Transgene Sa Multifunktionelle cytokine
EP3263581B2 (en) 2005-05-17 2025-07-09 University of Connecticut Compositions and methods for immunomodulation in an organism
EP1777294A1 (en) * 2005-10-20 2007-04-25 Institut National De La Sante Et De La Recherche Medicale (Inserm) IL-15Ralpha sushi domain as a selective and potent enhancer of IL-15 action through IL-15Rbeta/gamma, and hyperagonist (IL15Ralpha sushi -IL15) fusion proteins
WO2007124331A2 (en) * 2006-04-19 2007-11-01 Virginia Commonwealth University Cardioprotective and other uses of mammalian target of rapamycin (m-tor) inhibitors
CN101743249B (zh) 2007-05-11 2017-08-08 阿尔托生物科学有限公司 融合分子与il‑15变异体
NZ599338A (en) 2007-06-27 2013-11-29 Marinepolymer Tech Inc Complexes of il-15 and il-15ralpha and uses thereof
JP2009065938A (ja) * 2007-09-14 2009-04-02 Matsumoto Shika Univ タンパク質、破骨細胞分化阻害剤、炎症性骨破壊治療薬、遺伝子、組み替えベクター、及びタンパク質の製造方法
US8962274B2 (en) 2009-02-27 2015-02-24 Novartis Ag Methods for selecting eukaryotic cells expressing a heterologous protein
US8507222B2 (en) 2010-09-21 2013-08-13 Altor Bioscience Corporation Multimeric IL-15 soluble fusion molecules and methods of making and using same
US11053299B2 (en) 2010-09-21 2021-07-06 Immunity Bio, Inc. Superkine
US11401312B2 (en) 2013-04-19 2022-08-02 Cytune Pharma Cytokine derived treatment with reduced vascular leak syndrome
EP2915569A1 (en) 2014-03-03 2015-09-09 Cytune Pharma IL-15/IL-15Ralpha based conjugates purification method
KR102762243B1 (ko) 2014-06-30 2025-02-05 알토 바이오사이언스 엘엘씨 Il-15-베이즈드 분자 및 이의 사용 방법
AU2015301936B2 (en) 2014-08-11 2019-03-07 Delinia, Inc. Modified IL-2 variants that selectively activate regulatory T cells for the treatment of autoimmune diseases
WO2017062832A1 (en) 2015-10-08 2017-04-13 Nektar Therapeutics Combination of an il-2rbeta-selective agonist and a long-acting il-15 agonist
AU2016341529B2 (en) 2015-10-22 2023-03-30 Juno Therapeutics Gmbh Methods for culturing cells and kits and apparatus for same
WO2017096262A1 (en) 2015-12-04 2017-06-08 Jomoco, Corp. Compositions and methods to mitigate or prevent an immune response to an immunogenic therapeutic molecule in non-human primates
US20170204154A1 (en) 2016-01-20 2017-07-20 Delinia, Inc. Molecules that selectively activate regulatory t cells for the treatment of autoimmune diseases
CN106591368A (zh) * 2016-10-12 2017-04-26 郑州大学 携带il‑15r/il‑15融合基因的b亚群腺病毒11载体及其构建和用途
EP4613776A3 (en) 2016-10-21 2025-11-26 Altor BioScience Corporation Multimeric il-15-based molecules
EP3538548A4 (en) 2016-11-08 2020-08-19 Delinia, Inc. IL-2 VARIANTS FOR THE TREATMENT OF AUTOIMMUNE DISEASES
US11629340B2 (en) 2017-03-03 2023-04-18 Obsidian Therapeutics, Inc. DHFR tunable protein regulation
EP3612210A4 (en) 2017-04-19 2021-01-27 Board Of Regents, The University Of Texas System MANIPULATED ANTIGEN RECEPTORS EXPRESSING IMMUNE CELLS
RU2698048C2 (ru) * 2017-10-03 2019-08-21 Закрытое Акционерное Общество "Биокад" МОНОКЛОНАЛЬНОЕ АНТИТЕЛО К IL-5Rα
US12473336B2 (en) 2018-02-21 2025-11-18 Board Of Regents, The University Of Texas System Methods for activation and expansion of natural killer cells and uses thereof
WO2021050789A1 (en) 2019-09-10 2021-03-18 Obsidian Therapeutics, Inc. Ca2-il15 fusion proteins for tunable regulation
WO2021222178A1 (en) * 2020-04-27 2021-11-04 The Trustees Of Indiana University Adjunct therapy for suppressing immune response against gene therapy
CN113209277A (zh) * 2021-05-17 2021-08-06 武汉大学 Neogenin在制备预防、缓解和/或治疗心肌梗死及其相关疾病药物中的应用
CN114773433B (zh) * 2022-06-23 2022-09-06 北京肿瘤医院(北京大学肿瘤医院) 一种cd25靶向多肽、分子探针及应用
WO2024138175A1 (en) * 2022-12-22 2024-06-27 Forte Subsidiary, Inc. Methods of treating acute and chronic graft versus host diseases

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5011684A (en) 1985-09-05 1991-04-30 Beth Israel Hospital Association Lysing or blocking unwanted cells with IL-2 receptor-specific binding substance
JP3101690B2 (ja) 1987-03-18 2000-10-23 エス・ビィ・2・インコーポレイテッド 変性抗体の、または変性抗体に関する改良
US5116964A (en) 1989-02-23 1992-05-26 Genentech, Inc. Hybrid immunoglobulins
ES2074879T3 (es) 1991-01-16 1995-09-16 Schering Corp Uso de interleuquina-10 en inmunoterapia adoptiva de cancer.
IL101353A0 (en) * 1991-04-03 1992-11-15 American Home Prod Pharmaceutical compositions for treating diabetes
WO1994006473A1 (en) 1992-09-18 1994-03-31 Schering Corporation Restoration of immunocompetency to t helper cells in hiv infected patients
US5574138A (en) 1993-03-08 1996-11-12 Immunex Corporation Epithelium-derived T-cell factor
US5747024A (en) 1993-03-08 1998-05-05 Immunex Corporation Vaccine adjuvant comprising interleukin-15
US5552303A (en) 1993-03-08 1996-09-03 Immunex Corporation DNA encoding epithelium-derived T-cell factor
IL111004A (en) * 1993-09-30 1998-06-15 American Home Prod Oral formulations of rapamycin
US5795966A (en) 1995-02-22 1998-08-18 Immunex Corp Antagonists of interleukin-15
WO1997041232A1 (en) * 1996-04-26 1997-11-06 Beth Israel Deaconess Medical Center Antagonists of interleukin-15
ATE229342T1 (de) * 1997-02-21 2002-12-15 Vlaams Interuniv Inst Biotech Verwendung von interleukin-15
DE19823351A1 (de) 1997-05-16 1998-12-10 Krause Hans Mittel zur Verhinderung der Zellapoptose bei Krankheiten

Cited By (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7867475B2 (en) * 2003-01-31 2011-01-11 Universidad Autonoma De Madrid Immune regulation based on the depletion of CD69+ cells
US20050002929A1 (en) * 2003-01-31 2005-01-06 Francisco Sanchez-Madrid Immune regulation based on the targeting of early activation molecules
US20050069521A1 (en) * 2003-08-28 2005-03-31 Emd Lexigen Research Center Corp. Enhancing the circulating half-life of interleukin-2 proteins
US10017579B2 (en) 2004-01-22 2018-07-10 Meck Patent Gmbh Anti-cancer antibodies with reduced complement fixation
US20050202021A1 (en) * 2004-01-22 2005-09-15 Emd Lexigen Research Center Corp. Anti-cancer antibodies with reduced complement fixation
US7432357B2 (en) * 2004-01-22 2008-10-07 Merck Patent Gmbh Anti-cancer antibodies with reduced complement fixation
US10633452B2 (en) 2004-01-22 2020-04-28 Merck Patent Gmbh Anti-cancer antibodies with reduced complement fixation
US20090148441A1 (en) * 2004-01-22 2009-06-11 Merck Patent Gmbh Anti-Cancer Antibodies With Reduced Complement Fixation
US9617349B2 (en) 2004-01-22 2017-04-11 Merck Patent Gmbh Anti-cancer antibodies with reduced complement fixation
US8835606B2 (en) * 2004-01-22 2014-09-16 Merck Patent Gmbh Anti-cancer antibodies with reduced complement fixation
US20090082299A1 (en) * 2006-01-13 2009-03-26 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Codon optimized il-15 and il-15r-alpha genes for expression in mammalian cells
US10428133B2 (en) 2006-01-13 2019-10-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Codon optimized IL-15 and IL-15R-alpha genes for expression in mammalian cells
US11339198B2 (en) 2006-01-13 2022-05-24 The United States Of America, As Represented By, The Secretary, Department Of Health And Human Services Codon optimized IL-15 and IL-15R-alpha genes for expression in mammalian cells
US9303080B2 (en) 2006-01-13 2016-04-05 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, National Institutes Of Health Codon optimized IL-15 and IL-15R-alpha genes for expression in mammalian cells
US9790261B2 (en) 2006-01-13 2017-10-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Codon optimized IL-15 and IL-15R-alpha genes for expression in mammalian cells
US9725492B2 (en) 2006-01-13 2017-08-08 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Codon optimized IL-15 and IL-15R-alpha genes for expression in mammalian cells
US20110020269A1 (en) * 2007-05-08 2011-01-27 Beth Israel Deaconess Medical Center, Inc. Methods and compositions for modifying t cell immune responses and inflammation
US8871191B2 (en) 2009-08-14 2014-10-28 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of IL-15 preparations to treat lymphopenia
US10894816B2 (en) 2009-08-14 2021-01-19 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of IL-15 to increase thymic output and to treat lymphopenia
US11041008B2 (en) 2009-08-14 2021-06-22 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Heterodimers of IL-15 and IL-15R alpha to increase thymic output and to treat lymphopenia
US10093710B2 (en) 2009-08-14 2018-10-09 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Heterodimers of IL-15 and IL-15R alpha to increase thymic output and to treat lymphopenia
US9975937B2 (en) 2009-08-14 2018-05-22 The United Sstates Of America, As Represented By The Secretary, Department Of Health And Human Services Heterodimers of IL-15 and IL-15R alpha to increase thymic output and to treat lymphopenia
US9133243B2 (en) 2011-01-18 2015-09-15 Bioniz, Llc Compositions and methods for modulating γ-c-cytokine activity
US9133244B2 (en) 2011-01-18 2015-09-15 Bioniz, Llc Compositions and methods for modulating gamma-c-cytokine activity
EP4461742A3 (en) * 2011-01-18 2024-12-25 Bioniz Therapeutics, Inc. Compositions and methods for modulating gamma-c-cytokine activity
US11834519B2 (en) 2011-01-18 2023-12-05 Bioniz Therapeutics, Inc. Compositions and methods for modulating γ-c-cytokine activity
US10227382B2 (en) 2011-01-18 2019-03-12 Bioniz, Llc Method of designing a peptide and/or peptide derivative for modulating gamma-c-cytokine activity
US9951105B2 (en) 2011-01-18 2018-04-24 Bioniz, Llc Methods of developing selective peptide antagonists
US11708392B2 (en) 2011-01-18 2023-07-25 Bioniz, Llc Peptide conjugates
EP3636274A1 (en) * 2011-01-18 2020-04-15 Bioniz, LLC Compositions and methods for modulating gamma-c-cytokine activity
EP2665486A4 (en) * 2011-01-18 2014-06-25 Bioniz Llc COMPOSITIONS AND METHOD FOR MODULATING A GAMMA C CYTOKINE ACTIVITY
US10808009B2 (en) 2011-01-18 2020-10-20 Bioniz, Llc Peptide conjugates
US9675672B2 (en) 2011-01-18 2017-06-13 Bioniz, Llc Compositions and methods for modulating gamma-C-cytokine activity
US11617781B2 (en) 2012-06-28 2023-04-04 University Of Central Florida Research Foundation, Inc. Methods and compositions for natural killer cells
US12280094B2 (en) 2012-06-28 2025-04-22 University Of Central Florida Research Foundation, Inc. Methods and compositions for natural killer cells
US20170319659A1 (en) * 2012-06-28 2017-11-09 University Of Central Florida Research Foundation, Inc. Methods and compositions for natural killer cells
US10463715B2 (en) * 2012-06-28 2019-11-05 University Of Central Florida Research Foundation, Inc. Methods and compositions for natural killer cells
US10874715B2 (en) 2012-06-28 2020-12-29 University Of Central Florida Research Foundation, Inc. Methods and compositions for natural killer cells
US11462297B2 (en) 2013-12-10 2022-10-04 Bioniz, Llc Selective peptide antagonists
US10854312B2 (en) 2013-12-10 2020-12-01 Bioniz, Llc Selective peptide antagonists
US9959384B2 (en) 2013-12-10 2018-05-01 Bioniz, Llc Methods of developing selective peptide antagonists
US10030058B2 (en) 2015-10-09 2018-07-24 Bioniz, Llc Modulating gamma-C-cytokine activity
US11400134B2 (en) 2015-10-09 2022-08-02 Bioniz, Llc Modulating gamma-c-cytokine activity
US10030059B2 (en) 2015-10-09 2018-07-24 Bioniz, Llc Modulators of gamma-C-cytokine activity
US12600757B2 (en) 2017-04-07 2026-04-14 Bioniz Therapeutics, Inc. Peptides inhibiting gamma-c-cytokine activity and methods of use
US12030936B2 (en) 2019-05-03 2024-07-09 Bioniz Therapeutics, Inc. Modulating the effects of gamma-c-cytokine signaling for the treatment of alopecia and alopecia associated disorders
US12269888B2 (en) 2020-12-03 2025-04-08 Century Therapeutics, Inc. Artificial cell death polypeptide for chimeric antigen receptor and uses thereof
US11661459B2 (en) 2020-12-03 2023-05-30 Century Therapeutics, Inc. Artificial cell death polypeptide for chimeric antigen receptor and uses thereof

Also Published As

Publication number Publication date
AU2001292645A1 (en) 2002-03-26
US20040185048A1 (en) 2004-09-23
BR0113906A (pt) 2004-12-07
ES2322936T3 (es) 2009-07-02
JP2004525076A (ja) 2004-08-19
EP2123672A1 (en) 2009-11-25
ATE427318T1 (de) 2009-04-15
US7579439B2 (en) 2009-08-25
HK1061408A1 (en) 2004-09-17
CN1317301C (zh) 2007-05-23
EP1349873A2 (en) 2003-10-08
RU2280255C2 (ru) 2006-07-20
IL154925A0 (en) 2003-10-31
WO2002022805A3 (en) 2003-07-17
DE60138222D1 (de) 2009-05-14
CN1478098A (zh) 2004-02-25
EP1349873B1 (en) 2009-04-01
CA2422294C (en) 2012-12-04
WO2002022805A2 (en) 2002-03-21
CA2422294A1 (en) 2002-03-21
ZA200302933B (en) 2004-07-14
MXPA03002278A (es) 2004-12-03

Similar Documents

Publication Publication Date Title
US7579439B2 (en) Modulation of IL-2- and IL-15-mediated T cell responses
US7347995B2 (en) Compositions and methods for achieving immune suppression
EP0927254B1 (en) Antagonists of interleukin-15
US6998476B2 (en) Nucleic acids encoding antagonists of interleukin-15
WO2003087320A2 (en) Antagonists of il-21 and modulation of il-21-mediated t cell responses
AU2001261585A1 (en) Compositions and methods for achieving immune suppression
KR20170094341A (ko) 인터류킨 15 단백질 복합체 및 그의 용도
HK1061408B (en) Modulation of il-2-and il-15-mediated t cell responses
EP1627918A1 (en) Antagonists of interleukin-15
AU2006246489A1 (en) Compositions and methods for achieving immune suppression
HK1092177A (en) Antagonists of interleukin-15

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

AS Assignment

Owner name: BETH ISRAEL DEACONESS MEDICAL CENTER, INC., MASSAC

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:STROM, TERRY B.;LI, XIAN CHANG;ZHENG, XIN XIAO;REEL/FRAME:017300/0339;SIGNING DATES FROM 20011204 TO 20060119