US10214759B2 - Probability-directed isolation of nucleotide sequences (PINS) - Google Patents

Probability-directed isolation of nucleotide sequences (PINS) Download PDF

Info

Publication number
US10214759B2
US10214759B2 US14/653,795 US201314653795A US10214759B2 US 10214759 B2 US10214759 B2 US 10214759B2 US 201314653795 A US201314653795 A US 201314653795A US 10214759 B2 US10214759 B2 US 10214759B2
Authority
US
United States
Prior art keywords
target dna
dna molecule
sample
pcr
pins
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active, expires
Application number
US14/653,795
Other languages
English (en)
Other versions
US20160053291A1 (en
Inventor
Thomas Kvist
Marie Just Mikkelsen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Samplix ApS
Original Assignee
Samplix ApS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Samplix ApS filed Critical Samplix ApS
Assigned to SAMPLIX S.A.R.L. reassignment SAMPLIX S.A.R.L. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KVIST, THOMAS, MIKKELSEN, MARIE JUST
Publication of US20160053291A1 publication Critical patent/US20160053291A1/en
Assigned to SAMPLIX APS reassignment SAMPLIX APS ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SAMPLIX S.A.R.L.
Application granted granted Critical
Publication of US10214759B2 publication Critical patent/US10214759B2/en
Active legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6848Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00Reactions demanding special reaction conditions
    • C12Q2527/137Concentration of a component of medium
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/149Sequential reactions
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/159Reduction of complexity, e.g. amplification of subsets, removing duplicated genomic regions

Definitions

  • the invention relates to a method for isolating a complex nucleotide fragment comprising a known nucleotide sequence element, i.e. a sequence encoding a conserved active site or domain, the method being applicable i.e. to high throughput screening for DNA fragments containing a known sequence element.
  • PCR tests have been extensively developed for routine diagnostics of infectious diseases in clinical microbiology.
  • PCR is suited for rapid detection of bacteria directly in clinical specimens, allowing early, sensitive and specific laboratory confirmation of related diseases [1].
  • it allows a rapid assessment of the presence of antibiotic resistance genes or gene mutations.
  • An approach combining pathogen detection, their mechanisms of antibiotic resistance, their virulence factors and bacterial load in clinical samples could lead to profound changes in the care of these infected patients. Therefore, complex and multiplex PCR assays are currently being developed to enhance the field of molecular diagnostics.
  • PCR based diagnoses from mixed samples are often associated with challenges, as the presence of PCR products can arise from more than one DNA source in mixed complex samples.
  • the presence of a specific antibiotic gene combined with the presence of specific bacterial strain does not necessarily mean that a resistant bacterial strain was present in the original sample. It only indicates that both a resistance gene and the bacterial strain were present in the sample, not necessarily that they arise from the same cell.
  • Approaches to circumvent this problem have been suggested where the integration site of the antibiotic resistance gene was targeted by specific primers also known to target a specific bacterial strain. However, the exact integration site will then need to be known and this limits the use of the method.
  • Metagenomics refers to a general sequencing approach, where a complex mixture of DNA is differentiated into small fractions and sequenced individually.
  • the system does not rely on culturability and is, thus, applicable for both samples that can and cannot be cultivated in a laboratory.
  • Targeted enrichment of DNA fragments encoding industrially relevant proteins or enzymes would substantially decrease the required amount of sequencing.
  • the present invention provides in vitro method for enriching and/or isolating a target DNA molecule from a mixed polynucleotide sample comprising the steps:
  • FIG. 1 The figure shows a 2% agarose gel of nine negative PCR reactions from the initial mixture.
  • the boxed area indicates where a positive PCR product would be present in the gel.
  • the PCR products outside the box are unspecific products and are disregarded in this context.
  • FIG. 2 The figure shows a 2% agarose gel of ten PCR samples after the first round of PINS.
  • Five Samples (A, B, C, D, & I) contain PCR products of the expected size whereas the remaining five samples do not.
  • the correct product size is arrowed in the gel (left).
  • the PCR products in other locations (not arrowed) are unspecific products and are disregarded in this context.
  • FIG. 3 The figure shows a 2% agarose gel of ten PCR samples following the re-amplification of sample #10. Six samples (A, C, E, F, I, & J) contain PCR products of the expected size whereas the remaining four samples do not. The correct product size is arrowed in the gel (left). The PCR products in other locations (not arrowed) are unspecific products and are disregarded in this context.
  • FIG. 4 The figure shows a 2% agarose gel of ten PCR samples after the second round of PINS using 2E-1 dilution prior to PCR.
  • Five samples (C, D, E, G, & I) contain PCR products of the expected size whereas the remaining four samples do not.
  • the correct product size is arrowed in the gel (left).
  • the PCR products in other locations (not arrowed) are unspecific products and are disregarded in this context.
  • FIG. 5 The figure shows a schematic illustration of two rounds of PINS with the following parameters:
  • FIG. 6 The figure shows a 2% agarose gel of ten negative PCR reactions generated from an initial mixed polynucleotide sample comprising the target HPV18-DNA molecule.
  • the boxed area indicates where a positive PCR product would be present in the gel.
  • the PCR products outside the box are unspecific products and are disregarded in this context.
  • FIG. 7 The figure shows a 2% agarose gel of the products of three PCR designed to detect the presence of the target HPV18-DNA molecule.
  • Lane #1 is a positive control PCR reaction;
  • lane #2 is the PCR product of the PINS (MDA-mediate) enriched mixed polynucleotide sample containing 2.5 target copies/pi; and
  • lane #3 is a negative PCR control.
  • the arrow indicates the relative mobility of a DNA molecule of ⁇ 667 bp in the agarose gel.
  • FIG. 8 The figure shows a 2% agarose gel of the PCR product obtained by re-amplification of the target HPV18-DNA molecule shown in FIG. 7 .
  • the arrow indicates the relative mobility of a DNA molecule of ⁇ 667 bp in the agarose gel
  • FIG. 9 Alignment of the retrieved sequences for the PINS enriched target HPV18-DNA molecule with HPV18 sequence (HPU89349), showing that the sequence is perfectly aligned with zero mismatches.
  • FIG. 10 Primers and partial alignments of the sequences of retrieved microbial genes encoding endoglucanase.
  • FIG. 11 The figure illustrates the nucleotide sequence of a gene encoding endoglucanase enriched by PINS. Restriction sites (MboI, EcoRI, and HindIII) used for RGW are inserted in boxes. ⁇ 35 & ⁇ 10 illustrates the position of the putative promoter location and SD is the position of the ShineDalgarno. EndoGlu-Fw & EndoGlu-Re are the primers used during PINS. ORF indicates the position of the open reading frame.
  • the present invention pertains to an in vitro method in which the frequency of the targeted nucleotide sequence containing the DNA fragment of interest is increased stepwise, by several rounds of 1) dilution of a sample containing the DNA fragment of interest in several replicates (separation), 2) randomly amplifying DNA in the replicates (concentration), 3) detecting the DNA fragment of interest in at least one of the diluted and amplified replicates (selection) and repeating steps 1) through 3) until the DNA fragment of interest can be sequenced by standard sequencing techniques.
  • the invention is based on the principle that if a selected DNA fragment of interest, present in a mixed sample, is located at a dilution where the probability of finding it is small, the frequency of the DNA fragment of interest will be higher at that dilution than in the mixed sample, and its frequency can be further increased by rounds of selection (as above), until it can be sequenced by standard methods such as Sanger sequencing or Pyro sequencing or similar detection of DNA sequence or by PCR, hybridization or other detection assays.
  • the method of the invention is surprisingly efficient, whereby the extent of screening can be reduced from screening of hundreds of thousands of clones in a clone library according to traditional screening methods [17], to screening less than a few hundred DNA samples (Table 1).
  • Each cycle of PINS provides an estimated 10 ⁇ increase in the prevalence of the genetic element of interest.
  • the number of tests required to increase the prevalence from the starting level to the desired ending level can be calculated, i.e. 78 tests are required to increase the prevalence from 1/10 6 to 1/10 2 (based on estimated 10 ⁇ /cycling).
  • PINS can be adapted to perform multiplex PINS.
  • Multiplex PINS employs additional features that are designed to detect a 2nd consecutive sequence of at least 10 (or 15) nucleotides in the sample of mixed polynucleotides analysed, by amplification of this 2nd consecutive sequence with sequence specific primers to generate a 2nd target DNA fragment. If the 1st and 2nd consecutive sequence co-purify, at each cycle of PINS, then they must be located on the same MDA-amplified target DNA molecule.
  • PINS may be applied to a sample of mixed polynucleotides known to comprise a target DNA molecule.
  • a sample of mixed polynucleotides comprises a population of DNA molecules (e.g. chromosomal DNA molecules or plasmid DNA molecules) where the individual DNA molecules within the population differ with respect to a known consecutive sequence of at least 10 (or 15) nucleic acid base pairs in their DNA, such that a target molecule comprising the known consecutive sequence differs from and can be distinguished from non-target molecules in the sample.
  • the sample of mixed polynucleotides may additionally comprise single stranded RNA or DNA polynucleotides.
  • the population of DNA molecules in the sample of mixed polynucleotides comprises the target DNA molecule.
  • a target DNA molecule comprises one or more known consecutive sequence of at least 10 (or 15) unique nucleic acid base pairs (or nucleotides).
  • a target DNA molecule can be selected from a sample of mixed polynucleotides, by selecting for a target DNA molecule comprising this consecutive sequence of at least 10 nucleic acid base pairs (or nucleotides).
  • the target DNA molecule can also be selected from the sample of mixed polynucleotides, by selecting for a target DNA molecule comprising at least two consecutive sequences of at least 10 (or 15) nucleic acid base pairs (or nucleotides), wherein the two consecutive sequences are comprised within a DNA molecule of 50 to 100,000 nucleic acid base pairs, preferably 150 to 3,000 nucleic acid base pairs, more preferably 150 to 1500 nucleic acid base pairs.
  • the method of the invention is particularly suitable where the frequency of the target DNA molecule in the sample of mixed polynucleotides is less than 10 ⁇ 3 .
  • the method of the invention is also suitable where the frequency of the target DNA molecule in the sample of mixed polynucleotides is 10 ⁇ 4 , 10 ⁇ 5 , 10 ⁇ 6 , 10 ⁇ 7 , or lower.
  • the sample of mixed polynucleotides will be derived from a cell population comprising genomic DNA, while in other instances, the sample may be derived from samples where the polynucleotides are of diverse origin, such as samples collected from nature.
  • the frequency of the target DNA molecule is defined as the number of genomes or genome equivalents containing the target DNA divided by the number of total genome equivalents.
  • the frequency of the target DNA molecule in the sample of mixed polynucleotides is determined by making a dilution series in triplicate, detecting the presence or absence of target and determining the number of targets using, for instance, most probable number methods.
  • the concentration of DNA is measured and the number of total genome equivalents is determined by dividing this concentration by the average molecular weight of the genome.
  • the target DNA molecule is derived from the genome of a cell, where the genome may be either chromosomal or extrachromosomal DNA. Further, the target DNA molecule may be derived from a cell, where the cell is selected from amongst a microbial cell, a plant cell, an animal cell, or a mammalian cell.
  • the mammalian cell may be a human cell.
  • the microbial cell may be a bacterial cell, a yeast cell or a fungal cell.
  • target DNA molecule may be derived from a fungal mycelium or fungal spores.
  • the cell(s) may be part of a multicellular tissue or multicellular organism.
  • the target DNA molecule may be derived from one or more viral particles, where the virus has an RNA or DNA genome.
  • the target DNA molecule may be derived from a host genome comprising integrated DNA derived from a virus.
  • the target DNA molecule may also be derived from a bacteriophage.
  • the target DNA or RNA molecule is present in a sample of mixed polynucleotides, where the mixed polynucleotides may be derived from a sample collected from nature, for example a sample of soil, water or air.
  • the sample may be derived from a multicellular organism, such as a mammal, for example an animal or a human subject.
  • the sample for example a biopsy
  • the sample may be derived from a body fluid (e.g. blood, plasma, serum, lymph and urine), from faeces or from a body tissue or organ.
  • the multicellular organism from which the sample is derived may be a living or may be a dead organism.
  • the sample of mixed polynucleotides comprising the target DNA molecule may be prepared from a sample collected from nature or from an organism (e.g. a biopsy). Methods for selective extraction of polynucleotides comprising DNA or RNA are known in the art [5].
  • the step of cell disruption or cell permeabilisation is normally required in order to release total nucleic acid molecules (including DNA or RNA) from a cell, this step preceeding the subsequent step of selective extraction of polynucleotides comprising DNA or RNA.
  • the target DNA molecule is derived from an RNA genome
  • the RNA genome or parts thereof are first reverse transcribed to provide a cDNA molecule, where the nucleotide sequence of the cDNA corresponds to (is a reverse transcript of) the RNA genome.
  • MDA Multiple Displacement Amplification
  • MDA employs a strand displacement polymerase that possesses two enzymatic activities: DNA synthesis (polymerase) and an exonucleolytic activity that degrades single stranded DNA in the 3′- to 5′-direction, as exemplified by bacteriophage phi29 DNA polymerase, that belongs to eukaryotic B-type DNA polymerases (UniProtKB/TrEMBL: Q38545).
  • Other useful polymerases include BstI polymerase.
  • Isolation of the target DNA molecule by PINS is based on detection of one or more unique consecutive sequence of at least 15 nucleotides in said DNA molecule.
  • detection is based on PCR, where the one or more unique consecutive sequences are amplified to generate a target DNA fragment, the nucleotide sequence of this fragment can be determined.
  • the nucleotide sequences flanking the target DNA fragment in the 5′ and 3 ′ direction can be determined by rapid genome walking (RGW)[7].
  • RGW is a simple, PCR-based method for determining sequences upstream or downstream in a larger DNA molecule starting from a known sequence, such as a target DNA fragment. RGW enables individual amplification of up to 6 kb in a large DNA molecule using PCR.
  • sequences can be extended simply by taking multiple cycles of RGW, using new primers based on the sequence obtained in previous cycles.
  • libraries are constructed from a purified sample of the large target DNA molecule, by digesting the DNA separately with four different restriction enzymes and ligating the products to a specially designed adaptor.
  • the ligated DNA is then sequenced with primers annealing to the adaptors or to known sequences within the DNA, using the desired DNA sequencing method, such as Sanger sequencing, pyro sequencing, sequencing by synthesis, ligation or two base-coding sequencing or similar methods [8].
  • PINS PINS to isolate or enrich target DNA in mixed polynucleotide samples extracted from samples collected from nature, provides direct access to the genome, or parts thereof, of microorganisms that exist in nature and that frequently cannot be obtained as axenic cultures.
  • PINS is particularly useful for isolating or enriching DNA encoding enzymes involved in producing chemical building blocks or active agents such as:
  • PINS is particularly useful for isolation or enrichment of target DNA encoding enzymes selected among an oxidoreductase, transferase, hydrolase, lyase, isomerase or ligase.
  • Multiplex PINS is particularly useful for isolation or enrichment of target DNA comprising an operon of two or more open reading frames encoding two or more enzymes, where the enzymes may be part of a multifunctional enzyme complex, as the technique can take advantage of high fidelity of polymerases (like Phi29) in the MDA amplification to generate large amplified DNA fragments of up to 100000 bp.
  • PINS or Multiplex PINS may be used to analyse target DNA in samples derived from multicellular organisms, such as biopsy or sample of body fluid or faeces obtained from a subject (e.g. human or animal subject), for the diagnosis or monitoring the progress of a medical indication or disease.
  • samples derived from multicellular organisms such as biopsy or sample of body fluid or faeces obtained from a subject (e.g. human or animal subject)
  • a subject e.g. human or animal subject
  • Diagnosis of a wide range of medical indications in a subject such as a disease caused by an infectious agent (e.g. micro-organism or virus) can be assisted by the isolation or enrichment and detection of a target DNA or RNA molecule that is derived from the genome of the infectious agent by PINS or Multiplex PINS, where the target DNA molecule is detected in a sample of mixed polynucleotides derived from a biopsy or sample of body fluid obtained from a patient.
  • infectious agent e.g. micro-organism or virus
  • multiplex PINS in target DNA molecule isolation provides the additional feature, that additional diagnostic features of the disease can be determined.
  • the genome of the infectious agent comprises resistance genes that confer resistance to certain therapeutic agents
  • co-enrichment of a resistance gene and a sequence describing the infectious agent in the PINS procedure will indicate that the infectious agent is carrying the resistance gene.
  • PINS or Multiplex PINS may also be used to assist diagnosis of a disease caused by, or originating from the presence of a viral agent in a subject.
  • the presence and/or chromosomal integration of DNA that is derived from a viral genome, in a biopsy or sample of body fluid obtained from a patient can be detected by PINS by sequencing the entire DNA fragment comprising the viral DNA sequence.
  • Using multiplex PINS the presence or absence of viral DNA at a known integration site can be determined by tracking the co-enrichment of the viral DNA and integration site DNA sequence.
  • PINS is based on specifically selecting samples where amplification of a desired DNA region from a complex, mixed DNA sample has occurred.
  • Phi29 based amplification MDA
  • MDA Phi29 based amplification
  • Pan et al. [18] states in general terms that a highly specific whole genome amplification (WGA) of complex DNA pools which avoids amplification bias remains a challenge.
  • WGA whole genome amplification
  • the challenge of TIP/bias is not seen when applying the PINS technique even though the initial concentration of the target DNA molecule is very low.
  • the minimal negative TIP/bias observed in the PINS system is significantly lower than the overall gain obtained from the amplification process and the net result is therefore a substantial enrichment of the target DNA molecule with each cycle.
  • the method does not require a dilute initial DNA template, as high concentrations of DNA also can efficiently be subjected to PINS. In this case only a few fold amplification by the WGA method is needed.
  • Enzymes and Reagents If not stated otherwise enzymes were supplied by MBI Fermentas (Germany) and used according to the suppliers recommendations.
  • Amplification and Detection Methods If not stated otherwise, the following procedures and conditions were employed for DNA fragment amplification by PCR; genome amplification by MDA; and extension of DNA fragment into flanking regions using RGW. The target DNA fragment was detected by 2% agarose gel electrophoresis.
  • PCR reactions were: carried out in 20 ⁇ l reactions by mixing: nuclease free water (7 ⁇ l), 10 ⁇ l 2 ⁇ SSO Advance Sybr TR-Mixture (BioRad), 5 ⁇ M fw-primer (1 ⁇ l), 6 ⁇ M Re-primer (1 ⁇ l), with 1 ⁇ l DNA template.
  • the composition of the 2 ⁇ SSO Advance Sybr TR-Mixture is: dNTPs, Sso7d fusion polymerase, MgCl2, SYBR® Green I, and stabilizers.
  • PCR amplification conditions were (15 sec/15 sec/15 sec) ⁇ 25 at temperatures (94° C./65.8° C./72° C.). The PCR reactions were performed in a BioRad Connect RT-PCR machine.
  • MDA amplification was verified by loading 2 ⁇ l onto a 0.7% agarose gel. All MDA gels were run at 80V in 0.7% agarose for approximately 30 minutes.
  • the molecular marker on all agarose gels was Fermentas 1 bk + ladder, with the band sizes (75, 200, 300, 400, 500, 1000, 2000, 3000, 4000, 5000, 7000, 10.000, 20.000).
  • the probability of detecting a target DNA molecule in a sample was calculated using hypergeometric distribution, where the population is the originalsample volume of liquid in which the target is either present (positive) or not present and the test sample is the volume of liquid withdrawn from the original sample. Because the nucleic acid molecules only contribute to a minor part of the volume, both the population volume and test sample volumes are multiplied by 1000 in the calculations.
  • the probability of detecting the target DNA molecule in at least one of the replicate dilution samples is:
  • n the volume of (diluted) test sample*1000
  • M number of target DNA molecules in the original sample (population)
  • N the volume of the original sample (population)*1000.
  • a mixed polynucleotide sample was prepared from reference DNA that was spiked with DNA derived from HeLa cells.
  • the HeLa DNA was obtained from New England Biolabs (100 ⁇ g/ml) as a purified DNA sample.
  • the reference DNA was extracted from cells derived from a human volunteer.
  • the target DNA molecule in the HeLa DNA was efficiently amplified by the selected target PCR primers [SEQ ID NO: 1 and SEQ ID NO: 2], whereas the human reference DNA did not yield an amplification product with this primer pair. Both types of DNA were amplified separately using the MDA protocol prior to setting up the mixture.
  • the quantity of target DNA copies in MDA amplified HeLa DNA was determined to be 71750 copies/ ⁇ l using most probable number (MPN) calculation on triplicate 10-fold dilutions of HeLa DNA.
  • the target DNA was diluted by a factor of 1:2.500.000 in undiluted MDA amplified reference DNA (employing serial dilution) to create the final spiked mixture containing 0.029 targets copies/ ⁇ l and having a total DNA concentration of 0.187 ⁇ g/ ⁇ l.
  • the total volume of mixed DNA sample was 45 ⁇ l.
  • the probability of detecting the target DNA molecule in 3.5 ⁇ l mixed polynucleotide sample is 0.078 (1 ⁇ hypgeo(0; 3500; 1; 45000)); i.e. less than 0.75.
  • 3.5 ⁇ l is the volume of sample used in the first round of PINS.
  • DNA sequence from HPV18 was obtained from GenBank (GQ180790), and the following 2 primers were designed manually to target a DNA fragment of 96 bp in the HPV18 genome (GenBank Acc. No: GQ180790):
  • Fw primer [SEQ ID NO: 1] GTTTAGTGTGGGCCTGTGC Rev primer: [SEQ ID NO: 2] GGCATGGGAACTTTCAGTGT 1.2 Initial Mixture—Below Limit of Detection:
  • PCR analysis was carried out to verify that the number of target DNA molecules was below the limit of PCR detection in the initial polynucleotide mixture.
  • Nine polynucleotide mixture samples (each with 1 ⁇ l of initial mixture) were used as DNA template for PCR amplification with the primer pair [SEQ ID NO: 1 and 2], but no PCR products of the expected 96 bp were found in any of the samples.
  • An agarose gel showing the individual negative PCR samples from the initial mixture can be found in FIG. 1 .
  • the abundance of the HPV18 target before first round of PINS was 1/1.97*10 6 HPV18 positive genome equivalent/total genome equivalents.
  • the corresponding abundance after first and second round of PINS was 1.02*10 5 and 2.49*10 4 , respectively. This enrichment was achieved using 21 tests and the requirement for required number of traditional tests such as sequencing was decreased by a factor of 79 as can be seen in Table 1.
  • the use of PINS to facilitate the sequencing of a target DNA molecule present in a mixed polynucleotide sample, where the amount of target DNA is below the limit of detection by PCR is demonstrated in this example.
  • the selected target DNA molecule was a polynucleotide located within HPV18 genome.
  • the amount of this target DNA molecule in the mixed sample corresponded to 0.0286 copies/ ⁇ l.
  • the mixed sample was prepared as described in Example 1. Using standard PCR protocols, the amount of template solution added to a PCR reaction is normally 1 ⁇ l, and the minimum target DNA concentration required for its positive detection by PCR is 1 copy/ ⁇ l.
  • the amount of target DNA molecule in the mixed polynucleotide sample was approximately 35 times below that required for PCR amplification and subsequent sequencing.
  • the example demonstrates how PINS can be used to determine the sequence of target DNA in a mixed sample, which has otherwise been unattainable by known standard PCR based procedures.
  • HPV-264f [SEQ ID NO: 3] 5′-GTGGTGTATAGAGACAGTATACC-3′
  • HPV-911f [SEQ ID NO: 4] 5′-CCTTCTGGATCAGCCATTGT
  • the initial copy number of the target DNA molecule in the mixed polynucleotide sample (0.0286 target copies/pi) was increased to a final quantity of 2.5 target copies/ ⁇ l by the implementation of PINS as described in Example 1.
  • the MDA amplification products generated by performing 1 st round PINS on the initial mixed polynucleotide sample, were analysed by PCR as described above using 1 ⁇ l of the MDA amplified sample. A PCR product of the expected size (667 bp) was obtained as shown in FIG. 7 .
  • Low levels of non-specific amplification of the initial mixed polynucleotide sample generated a low background detectable as a smear in lane #2 of FIG. 7 .
  • the detectable product of ⁇ 667 bp in lane #2 was isolated by gel-out (GeneJet Gel-out kit, Thermo Fischer Scientific) and PCR re-amplified to increase the amount of the target DNA molecule to allow subsequence sequencing (lane #A, FIG. 8 ).
  • the purified product isolated from lane #A ( FIG. 8 ) was sequenced forward and reverse using both primers [SEQ ID NO: 3 and 4].
  • the retrieved sequences were aligned to the sequence of HPV18 (HPU89349) resulting in a perfect alignment with zero mismatches ( FIG. 9 ).
  • the example confirms the efficacy of PINS for enriching for rare sequences to a level where their sequence can be determined.
  • the selected primers are estimated to result in a PCR amplification product of 481 bp.
  • the sizes of PCR products may deviate from the expected size.
  • Samples (8) of forest soils are collected as a source of diverse soil micro-organisms. DNA from the 8 different samples are extracted using Bead Beating, as described by Kvist et. al [10]. Each extraction is amplified using MDA Repli-g Mini kit, using MDA amplification conditions as defined above (Materials and general methods). The quality of the amplified DNA is verified by visualization on 0,7% agarose gels.
  • the initial PCR analysis is carried out to evaluate if the target DNA sequence could be observed using the selected primers [SEQ ID NO: 5 and 6] using the selected PCR conditions: 94° C. (30 sec)+60° C. (30 sec)+72° C. (30 sec) and 30 cycles is carried out.
  • PCR product is evaluated to have approximately the correct predicted size on an agarose gel.
  • RT-PCR Real Time PCR
  • the abundance of the target DNA molecule encoding a putative endoglucanase
  • primers [SEQ ID NO: 5 and 6] are determined using primers [SEQ ID NO: 5 and 6] and compared to the abundance of 16S rRNA genes using primers [SEQ ID NO: 7 and 8] (where the 16S rRNA gene is used as a measure of total bacterial DNA abundance). It is found that 16S rRNA genes are approximately 550.000 higher in quantity compared to the putative endoglucanase.
  • DNA samples found to contain the targeted DNA molecule are subjected to PINS as follows:
  • a dilution series is created using a dilution factor (D) of 1:10, aimed at then setting up multiple replicate dilutions of (N), 10 ⁇ 2 .
  • D dilution factor
  • N replicate dilutions of (N)
  • N 10 ⁇ 2
  • Twenty identical samples of 10 ⁇ 2 dilution are prepared and subjected to genomic amplification, using Repli-g Mini kit (Qiagen). Each amplified sample is individually analysed using the PCR primers [SEQ ID NO: 5 and 6] and the RT-PCR conditions described above in 1.3. Three out of 20 samples results in positive PCR amplification, with a DNA product of the predicted size.
  • the associated PINS analysis output data are listed below.
  • a total of at least 20 replicate samples are estimated for next round of replication.
  • 20 samples of dilution 10 ⁇ 3 are prepared (i.e. a 10 fold dilution (D) increase over the previous total dilution of the sample (Dt)), and each of the individual samples are amplified using Repli-g MDA kit.
  • Each sample is subsequently analyzed by RT-PCR using primers [SEQ ID NO: 5 and 6] which shows that one (out of 20) sample yielded a DNA product of the predicted size. This sample is selected for further progress.
  • PINS analysis output data are listed below.
  • the two positive samples from this round of analysis are pooled into one sample, and RT-PCR is carried out on the targeted gene using primers [SEQ ID NO: 5 and 6] and 16S rRNA genes using primers [SEQ ID NO: 7 and 8] in the same sample.
  • Each of the amplification primers are combined with the linker ligation primers of the RGW.
  • the 5 cycles of PINS serves to enhance the presence of the targeted DNA molecule to such extent that the entire gene and a potential operon comprising the targeted DNA molecule, placed can be sequenced by traditional sequencing methods. Consequently, the RGW technique [7] is implemented in which 3 random libraries of the DNA sample, enriched with target DNA molecule are generated by preparing 3 restriction digests (EcoRI, HindIII and BglII/MboI) and then annealing the digests each with RGW primers comprising compatible 5′ overhangs, for example primer pair [SEQ ID NO: 5] and [SEQ ID NO: 6] to form an oligo-cassette.
  • 3 restriction digests EcoRI, HindIII and BglII/MboI
  • the target DNA molecule specific primers used for screening [SEQ ID NO: 5 and 6] are used in combination with the RGW primer [SEQ ID NO: 5] in a PCR amplification to generate larger PCR products that span the target DNA molecule and its flanking regions.
  • This example illustrates the use of PINS to detect the presence of the mecA gene in a mixed sample (e.g. taken from a patient) and to determine whether the gene originates from the genome of Staphylococci present in the sample.
  • This analysis relies on the use of PINS to monitor the simultaneous co-amplification of a Staphylococcus gene located approximately 13000 base pairs up-stream of the mecA gene.
  • the experiment is designed to use the high fidelity of phi29 polymerase for multiple displacement amplification (MDA), allowing genome fragments up to +70000 bp to be generated during amplification.
  • MDA multiple displacement amplification
  • MR-fw [SEQ ID NO: 16] 5′-CAAACTACGGTAACATTGATCGCAAC-3′
  • MR-Re [SEQ ID NO: 17] 5′-CAATATGTATGCTTTGGTCTTTCTGC-3′, and which are predicted to generate a 126 bp PCR product.
  • SA-fw [SEQ ID NO: 18] 5′-CGTGAAGAAACAGAACGAATGATTC-3′
  • SA-Re [SEQ ID NO: 19] 5′-GCCTCTAGAATATTTCATCGCATTTG-3′, and which are predicted to generate a 267 bp PCR product.
  • a sample suspected to contain MRSA is subjected to PINS analysis.
  • the sample is collected from a patient by the use of a “cotton-stick-swab”.
  • Total DNA is extracted from the swab using A&A Biotechnology (Poland) DNA Swab extraction kit.
  • the extracted DNA is used as template for a 10-fold serial dilution.
  • Each of the diluted tubes are directly analyzed by Real-Time (RT) PCR using 1 ⁇ l template in a 25 ⁇ l RT-reaction mix with each of the two sets of primers MR (MR-fw and MR-Re) and SA (SA-fw and SA-re).
  • RT Real-Time
  • sample E one sample from the 10 samples
  • RT-PCR quantification shows that the abundance of MR-PCR product is 1.27*10 3 and the abundance of the SA-PCR product in sample 1.31*10 3 .
  • the ratio has now shifted towards comparable levels of the two target DNA molecules, from having an initial ratio of approximately 1:8, up to a ratio that is closer to 1:1.
  • the next step is to sequence the amplified template to evaluate the identity of the resistance gene mecA and the adjacent genes, and to verify the presence of MRSA rather than MR and SA as independent DNA molecules located in the same sample.
  • Primers designed to target known MRSA are used to generate overlapping PCR products used for sequencing and assembly. 24 PCR products of various lengths are generated and two continuous sequences of 2475 bp. and 19186 bp. are produced by PCR, sequencing, and assembly. An additional 789 bp are obtained by RGW [7] and sufficient overlap is established to combine the two assemblies into one large assembly of 22450 bp. Nucleotide BLAST [11] shows close to identical match (>99.9%) to multiple MRSA strains in the database.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US14/653,795 2012-12-21 2013-12-20 Probability-directed isolation of nucleotide sequences (PINS) Active 2034-04-12 US10214759B2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DKPA201270822 2012-12-21
DKPA201270822 2012-12-21
DK201270822 2012-12-21
PCT/EP2013/077844 WO2014096421A1 (en) 2012-12-21 2013-12-20 Probability-directed isolation of nucleotide sequences (pins)

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2013/077844 A-371-Of-International WO2014096421A1 (en) 2012-12-21 2013-12-20 Probability-directed isolation of nucleotide sequences (pins)

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/238,753 Division US11078507B2 (en) 2012-12-21 2019-01-03 Probability-directed isolation of nucleotide sequences (PINS)

Publications (2)

Publication Number Publication Date
US20160053291A1 US20160053291A1 (en) 2016-02-25
US10214759B2 true US10214759B2 (en) 2019-02-26

Family

ID=49841687

Family Applications (2)

Application Number Title Priority Date Filing Date
US14/653,795 Active 2034-04-12 US10214759B2 (en) 2012-12-21 2013-12-20 Probability-directed isolation of nucleotide sequences (PINS)
US16/238,753 Active 2034-09-27 US11078507B2 (en) 2012-12-21 2019-01-03 Probability-directed isolation of nucleotide sequences (PINS)

Family Applications After (1)

Application Number Title Priority Date Filing Date
US16/238,753 Active 2034-09-27 US11078507B2 (en) 2012-12-21 2019-01-03 Probability-directed isolation of nucleotide sequences (PINS)

Country Status (9)

Country Link
US (2) US10214759B2 (enExample)
EP (1) EP2935617B1 (enExample)
JP (1) JP6522511B2 (enExample)
CN (1) CN105189781B (enExample)
AU (1) AU2013366478A1 (enExample)
CA (1) CA2895904C (enExample)
DK (1) DK2935617T3 (enExample)
ES (1) ES2630377T3 (enExample)
WO (1) WO2014096421A1 (enExample)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11078507B2 (en) * 2012-12-21 2021-08-03 Samplix Aps Probability-directed isolation of nucleotide sequences (PINS)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2016282350A1 (en) 2015-06-26 2018-01-18 Samplix S.A.R.L. Targeted enrichment of long nucleotide sequences using microfluidic partitioning
CN105420375B (zh) * 2015-12-24 2020-01-21 北京大学 一种环境微生物基因组草图的构建方法
CN109402223A (zh) * 2018-11-12 2019-03-01 河南弘腾农业有限公司 一种基于动物粪便样品构建测序文库的方法及其应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030228586A1 (en) 1999-06-30 2003-12-11 Rafick-Pierre Sekaly Method for measuring de novo T-cell production in humans
WO2004058987A2 (en) 2002-12-20 2004-07-15 Qiagen Gmbh Nucleic acid amplification
WO2008096923A1 (en) 2007-02-05 2008-08-14 Korea Research Institute Of Bioscience And Biotechnology Methods for fabrication of uncultivated genome-probing microarrays by amplifying genome derived from a single microbial cell using multiple displacement amplification

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK2935617T3 (en) * 2012-12-21 2017-07-17 Samplix S A R L Likelihood-oriented isolation of nucleotide sequences (PINS)

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030228586A1 (en) 1999-06-30 2003-12-11 Rafick-Pierre Sekaly Method for measuring de novo T-cell production in humans
WO2004058987A2 (en) 2002-12-20 2004-07-15 Qiagen Gmbh Nucleic acid amplification
WO2008096923A1 (en) 2007-02-05 2008-08-14 Korea Research Institute Of Bioscience And Biotechnology Methods for fabrication of uncultivated genome-probing microarrays by amplifying genome derived from a single microbial cell using multiple displacement amplification

Non-Patent Citations (29)

* Cited by examiner, † Cited by third party
Title
Altschul, S.F. et al., "Basic local alignment search tool," J. Mol. Biol. (1990) 215(3):403-410.
Chandler, D.P., "Redefining relativity: quantiative PCR at low template concentrations for industrial and environmental microbiology," J. Industrial Microbiology and Biotechnology, Basingstoke, GB (1998) 21(3):128-140.
Chenna, R. et al., "Multiple sequence alignment with the clustal series of programs," Nucl. Acids. Res. (2003) 31(13) 3497-3500.
Ellison, S. et al., "Routes to improving the reliability of low level DNA analysis using real-time PCR," BMC Biotechnology, Biomed Central Ltd., London (2006) 6(1):33.
Erlandsson, L. et al., "Amp-PCR: combining a random unbiased PHI29-amplification with a specific real-timem PCR, performed in one tube to increase PCR sensitivity," PLOS One (2010) 5(12):e15719.
Galm, U. et al., "Natural product drug discovery: the time have never been better," Chem & Biol. (2007) 14.
Harvey, A.L., "Natural products in drug discovery," Drug Discovery Today (2008) 13(19/20).
Holetsky, A. et al., "Identification of methicillin-resistant Staphylococcus aureus carriage in less than one hour during a hostpital surveilance program," Clin. Infect. Dis. (2005) 40(7):976-81.
Hughes, S. et al., Whole Genome Amplification: Methods Express, Royal College of General Practitioners (2005) Methods and Approaches, p. 5.
Kilstrup, M. et al., "Rapid genome walking: a simplificed oligo-cassette mediated polymerase chain reaction using a single genome-specific primer," Nucl. Acid. Res. (2000) 28(11).
Kralik, P. et al., "development of a predictive model for detection of Mycobacterium avium susp. paratuberculosis in faeces by quantitative real time PCT," Veterinary Microbiology (2011) 149:133-138, 133-135; tables 1-3.
Kvist, T. et al., "Diversity of thermophilic and non-Thermophilic crenarchaeota at 80 degrees," C. Fems Microbiol. Letter (2005) 244(1):61-68.
Kvist, T. et al., "Specific single-cell isolation and genomic amplification of uncultured microorganisms," Appl. Microbiol. Biotechnol., Springer-Verlag (2006).
Lasken, R.S. et al., "Multiple displacement amplification of genomic DNA," in Whole Genome Amplification, S. Hughes, Editor (2005), Scion Publishing Ltd., Oxfordshire, p. 99-118.
Liu, L. et al., "Comparison of next-generation sequencing systems," J. Biomed. Biotech. (2012) 251364.
Lorenz, P. et al., "Metagenomics and industrial applications," Nature Reviews-Microbiology (2005) 3:510-516.
Lorenz, P. et al., "Metagenomics and industrial applications," Nature Reviews—Microbiology (2005) 3:510-516.
Lukyanov et al. (Nucleic Acids Research, 1996, 24(11):2194-2195). *
Lukyanov, K.A. et al., "Molecule by molecule PCR amplification of complex DNA mixtures for direct sequencing: an approach to in vitro cloning," Nucl. Acids REs. (1996) 24(11):2194-2195.
Maurin, M., "Real-time PCR as a diagnostic tool for bacterial diseases," Exp. Rev. Mol. Diagn. (2012) 12(7):731-754.
Milbury et al. (Nucleic Acids Research, 2011, 39(1):e2, p. 1-10). *
Myers, L.E. et al., "Dilution assay statistics," J. Clin. Microbiol. (1994) 732-739.
Newman, D. et al., "Natural products as sources of new drugs over the period 1981-2002," J. Nat. Prod. (2003) 66:1022-1037.
Raghunathan, A. et al., "Genomic DNA amplification from a single bacterium," Appl. Envir. Microbiol. (2005) 71(6):3342-3347.
Sambrook, J. et al., Molecular Cloning a Laboratory Manual (2001) Cold Spring Harbor Laboratory Press.
Shaw, J. et al., "Marker removal system for Thermoanaerobacterium saccharolyticum and development of a markerless ethanologen," Appl. Environ. Microbiol. (2011) 2534-2536.
Shendure, J. et al., "Next-generation DNA sequencing," Nat. Biotech. (2008) 26(10)1135-1145.
Torsvik, V. et al., "High diversity in DNA of soil bacteria," Appl. Environ. Microbiol. (1990) 782-787.
Zhang et al. (BMC Bioinformatics 2004, 5:16, p. 1-8). *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11078507B2 (en) * 2012-12-21 2021-08-03 Samplix Aps Probability-directed isolation of nucleotide sequences (PINS)

Also Published As

Publication number Publication date
DK2935617T3 (en) 2017-07-17
CN105189781B (zh) 2017-06-06
EP2935617B1 (en) 2017-04-12
ES2630377T3 (es) 2017-08-21
AU2013366478A1 (en) 2015-07-09
WO2014096421A1 (en) 2014-06-26
US11078507B2 (en) 2021-08-03
EP2935617A1 (en) 2015-10-28
US20160053291A1 (en) 2016-02-25
US20190233865A1 (en) 2019-08-01
CA2895904A1 (en) 2014-06-26
CA2895904C (en) 2021-06-08
CN105189781A (zh) 2015-12-23
JP6522511B2 (ja) 2019-05-29
JP2016500276A (ja) 2016-01-12

Similar Documents

Publication Publication Date Title
EP3365445B1 (en) Methods for genome assembly, haplotype phasing, and target independent nucleic acid detection
Boughner et al. Microbial ecology: where are we now?
US11078507B2 (en) Probability-directed isolation of nucleotide sequences (PINS)
CN101680027A (zh) 检测hiv耐药变异体的系统和方法
CN106460066A (zh) 通过液滴分选的核苷酸序列排除富集(needls)
WO2016019360A1 (en) Tagging nucleic acids for sequence assembly
US20050026188A1 (en) Methods of identifying, characterizing and comparing organism communities
Huang et al. Suppression Subtractive Hybridization (SSH) and its modifications in microbiological research
EP3105324B1 (en) Ngs systems control and methods involving the same
WO2013173774A2 (en) Molecular inversion probes
JP2018068317A (ja) 標的核酸の定量方法のためのキット
JP2016500276A5 (enExample)
JP2004504014A (ja) 配列に基づくスクリーニング
CN116200475A (zh) 一种检测tet(X)基因及其同源基因的简并引物对及其方法
Liu et al. Epigenetic segregation of microbial genomes from complex samples using restriction endonucleases HpaII and McrB
US20100124748A1 (en) Method for the specific detection of low abundance rna species in a biological sample
Orłowska et al. Evaluation of direct metagenomics and target enriched approaches for high-throughput sequencing of field rabies viruses
Graham et al. PrimerSelect: a transcriptome-wide oligonucleotide primer pair design program for kinetic RT-PCR–based transcript profiling
WO2020232621A1 (zh) 微量dna甲基化高通量测序方法
Ziebolz et al. Toward a new era in sequencing
Verma et al. Gene Manipulation Strategies for Advancing Microbial Biotechnology for Bioproduct Innovation
CN119307628A (zh) 幽门螺杆菌左氧氟沙星耐药基因快速可视化检测系统及方法
JP2025542506A (ja) マイノリティ遺伝子バリアントを検出するための方法
Lee Helen D. Donoghue, Mark Spigelman, Ildikó Pap, Ildikó Szikossy, Oona Y.-C. Lee, David E. Minnikin, Gurdyal S. Besra, Andrew Millard, Martin J. Sergeant, Jacqueline Z.-M. Chan and Mark J. Pallen

Legal Events

Date Code Title Description
AS Assignment

Owner name: SAMPLIX S.A.R.L., LUXEMBOURG

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KVIST, THOMAS;MIKKELSEN, MARIE JUST;REEL/FRAME:036518/0901

Effective date: 20150709

AS Assignment

Owner name: SAMPLIX APS, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SAMPLIX S.A.R.L.;REEL/FRAME:047107/0602

Effective date: 20180524

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 4