SK279041B6 - Dna construct, a transformed cell and the method of a foreign protein in the transformed cell formation - Google Patents

Abstract

The DNA construct comprises a transferred signal peptide part of BAR 1 gene from Saccharomyces cerevisiae and, at least one structural gene, which is foreign to a host cell transformed by this construct. Transformation of host organisms through this construct causes the expression of the primary translatory product, which comprises structural protein coded by the foreign gene and fused to the signal peptide BAR 1. Protein is treated in a secretive path of the host cell from which it can be liberated into cultivation medium or into peri-plasma medium.

Description

The present invention relates to a DNA construct. Transformation of host organisms by such constructs results in the expression of a primary translation product that contains a structural protein encoded by the foreign gene. Fused to the BAR1 signal peptide, such that the protein is processed in the secretory pathway of the host cell and secreted into the culture medium or periplasmic space.

BACKGROUND OF THE INVENTION

As hosts for the production of foreign polypeptides, i. j. A variety of prokaryotic and eukaryotic microorganisms are used for polypeptides that are not naturally produced by the host via recombinant DNA. Of particular interest are various types of eukaryotic fungi, including Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus and Neuurospora. Extremely much work has been done on the yeast S. cerevisiae. The yeast cells, upon transformation with a suitable DNA construct, such as a plasmid, express the foreign genes present in the plasmid. However, the main limitation of this technology is that in many cases protein products are not secreted by the host cells into the environment. Thus, it is necessary to break up the cells and purify the desired protein from various contaminating cellular components so as not to denature or deactivate them. Thus, it is desirable to be able to direct transformed cells to the secretion of such a foreign product, which would facilitate purification of the product. Furthermore, it may be desirable that some proteins enter the secretory pathway of the host cell, thereby facilitating the respective processing, i. disulfide bond formation.

It is known that S. cerevisiae secrete some of their naturally produced proteins, although the knowledge of this process is rather limited compared to what is known about protein secretion from bacteria and mammalian cells. Most of the secreted yeast proteins appear to be enzymes that remain in the periplasmic space, although the enzymes invertase and acid phosphatase may also be included in the cell wall. Cellular proteins known to be secreted by yeast S. cerevisiae include sex pheromones (α-factor and α-factor), killing toxin and proteins affecting Barrier activity (hereinafter referred to as "Barrier") ,,). Cell wall secretion into the environment is also referred to as " export ". Gender-type 5 cerevisiae cells produce α-factor, which is secreted into the culture medium, while sex-type α cells produce two secreted polypeptides, α-factor Barrier protein. The α-factor gene has been cloned, sequenced and analyzed (see: Kurjan and Herskowitz: Cell 3, 933, (1982)). Signal peptide (a short peptide sequence believed to lead cells to secrete a fusion protein), a leader sequence (containing a precursor polypeptide that is cleaved from the mature α-factor), and non-translational gene sequences (including promoter and regulatory regions) from the gene α-factor can be used to control the secretion of foreign proteins produced by yeast (Brake et al., Natl. Acad. Sci. USA 81, 4682 (1984)). Processing of the α-factor precursor into mature protein appears to require at least two stages, which are believed to be under the control of the STE-13 and KEX2 genes.

In contrast to α-factor, the Barrier protein appears to be glycosylated because of its ability to bind concavalin A. Barrier is produced by cell type a and expression appears to be under the control of the MAT 2 gene. Except for possible cleavage of the signal peptide, no processing of the precursor Barrier was demonstrated, and therefore the STE-13 and KEX2 genes are not expected to play a role in Barrier expression.

Because of the differences between expression control and d-factor processing and Barrier, it is not possible to say in advance which of these yeast genes is more suitable for controlling the secretion of said foreign protein. Since both proteins appear to be processed in different secretory pathways, it would be desirable to utilize the properties of the Barrier secretion system.

SUMMARY OF THE INVENTION

It is an object of the present invention to obtain DNA constructs comprising a segment of the BAR1 gene that encodes at least a signal peptide and a structural gene of a foreign protein that is processed on a secretory pathway of a host cell in a microbial host.

Another object of the invention is a transformed cell comprising the DNA construct described above.

Another object of the invention is a method of producing a foreign protein in a transformed cell by transforming a host cell with a DNA construct encoding said foreign protein and a selection marker, and then culturing the transformed cell under culture conditions suitable for producing the foreign protein.

Another object of the invention is a method of expressing foreign genes in a microbial host, which expression results in secretion of the foreign protein or a portion thereof (encoded by such a gene) that is processed on a secretory pathway from the host cell.

Another object of the present invention is a method of preparing a protein having the amino acid sequence of human proinsulin or insulin.

The present invention relates to DNA structures and to a method for their use. These constructs comprise at least a signal peptide encoding a BAR1 gene sequence of Saccharomyces cerevisiae, at least one structural gene foreign to the host organism, and a promoter that controls expression of a fusion protein comprising the BAR1 signal peptide and the foreign protein in the host organism.

The term "DNA construct" or "DNA construct" as used herein means any DNA molecule, including a plasmid, that is modified by human intervention so that the nucleotide sequence in that molecule is not identical to that produced naturally. The term " DNA construct " also includes clones of DNA molecules that are modified in this way. The terms "expression vector" and "expression plasmid" are defined as a DNA construct that comprises a transcription initiation site and at least one produced by expression in a host organism. The expression vector will usually also contain a selection marker, such as an antibiotic resistance gene or a nutritional marker.

The term "DNA construct" also includes portions of an expression vector integrated into the host chromosome.

SK 279041 Β6

The term "plasmid" has its generally accepted meaning, i. j. means an autonomously replicating DNA construct, usually a closed loop.

The term "signal peptide" refers to the portion of the primary translation product that secures protein secretion. The signal peptide is usually cleaved from the rest of the nascent polypeptide by the signal peptidase during this process. The signal peptide is characterized by the presence of individual hydrophobic amino acids, occurs at the amino terminus of the primary translation product, and is typically about 17 to 25 amino acids in length. The signal peptidase cleavage site was characterized by von Heinj (Eur. J. Biochem. 133. 17 (1983)). The term "signal peptide" as used herein may also mean functional portions of a naturally occurring signal peptide.

The present invention describes a method for preparing transformed cells that produce foreign proteins by secretion.

According to the invention, a method for producing a foreign protein in a host organism is to transform a host cell represented by a fungal cell with a DNA construct comprising a portion of the Saccharomyces cerevisiae BAR1 gene comprising at least a sequence encoding said foreign protein and a promoter that controls expression of the fusion protein. comprising a signal peptide and a foreign protein, wherein the diffusion protein is produced and secreted from the transformed cell.

The proteins thus produced are secreted into the periplasmic space or into the culture medium. The yeast BAR1 gene encodes Barrier activity, which is believed to be due to glycosylated protein secreted by sex-like S. cerevisiae cells. Secreted Barrier-protein allows cells of the sex type to overcome the cell cycle arrest in the G1 phase, which is stimulated by α-factor. It is believed that the Barrier protein may be a protease (see Manney: J. Bacteriol. 155, 291 (1983)). Transcription of the BAR1 gene is stimulated by α-factor. Barrier as an analogous activity is not detected in α and / or α / cc cells and the BAR1 gene is not transcribed in this type of cells.

In FIG. 1 shows a sequence of 2750 nucleotide pairs surrounding the BAR1 gene together with a deduced amino acid sequence of a primary translation product. The ATG translation initiation site of BAR1 is in the position of FIG. 1, which was not subcloned from the fragment obtained from the yeast genomic library (Nasmyth and TatchelkCell 19, 743 (1980)). The open reading frame starts with the ATG codon at +1 and leads up to 1761 nucleotide pairs in the 3 'direction. The sequence of the first 24 amino acids of the BAR1 primary translation product appears to be similar to the sequences of known yeast and mammalian signal peptides. Thus, alanine at position 24 can be used as a cleavage site for yeast invertase and acid phosphase.

Cleavage can also occur downstream of amino acid 23. There are at least nine potential asparagine-binding glycosylation sites in the primary translation product, although the extent of glycosylation of the mature secreted Barrier protein is not yet known. The promoter and regulatory regions of the BAR1 gene are located within a region of approximately 680 nucleotide pairs at the 5 'end of the translation initiation codon.

The DNA construct of the invention preferably encodes a cleavage site at the junction of the Barrier and the foreign protein. Such a preferred site is the KEX2 cleavage site, an amino acid sequence that is recognized and cleaved by the product of the S. cerevisiae KEX2 gene (Julius et al., Cell 37, 1075 (1984)). The KEX2 site is characterized by a pair of basic amino acids such as lysine and arginine. A preferred sequence of the KEX2 site is Lys-Arg or Arg-Arg. The BAR1 primary and translation product contains two such pairs located in the structural region: Arg-Arg at position 177-178 and Lys-Lys at position 405-406. As mentioned, the KEX2 gene is not involved in the post-translational processing of the Barrier precursor protein. From this, it can be concluded that potential processing sites are blocked by protein conformation or glycosylation thereof, and further that the Barrier protein can normally be processed in a way other than that utilized by KEX2 processed proteins, such as the KEX2 process factor a fusion protein containing a portion of the primary translation product of the BAR1 gene, the signal peptide, together with the protein of interest, is a fusion protein cleaved at the KEX2 site, resulting in secretion of the protein of interest. It has also been found that reducing the cleavage efficiency of the signal peptidase of a portion of the Barrier-protein fusion protein containing the KEX2 cleavage site increases the level of the respective protein exported. The KEX2 cleavage site can be made to the BAR1 sequence, in the appropriate structural gene, or can be fused by addition of a linker, site-specific mutagenesis, etc.

Thus, according to the invention, a portion of the BAR1 gene containing the ATG initiation codon and the signal peptide coding sequence can be linked to a foreign gene of interest and thus transformed into a eukaryotic host cell. The resulting fusion gene comprises a protein processing site (process), preferably also a KEX2 cleavage site, located at the site where the BAR1 sequence joins the sequence containing the foreign genes. Such a construct may also contain regulatory regions and a promoter from the 5 'non-coding region of the BAR1 gene, or may contain regulatory regions and / or promoters of other genes. In addition to the promoter from the BAR1 gene, other promoters may be used, including promoters from the S. cerevisiae alcohol or dehydrogenase II genes, the S. cerevisiae glycolithic pathway genes, such as the TPI1 promoter and the corresponding genes from other species, including the yeast Schizosaccharomyces pombe, which reproduces by division (Russel and Hali: J. Biol. Chem. 258. 143 (1983) and Russel: Nature 301, 167 (1983)). The S. cerevisiae alcohol dehydrogenase I gene has been described by Ammer: Methods in Enzymology 101, 192 (1983). The Alkoholdehydrogenase II gene has been described by Russel et al., J. Biol: Chem. 258. 2674 (1983). Glycolytic genes from 5. cerevisiae have been described by Kawasaki: Ph. D. Thesis, University of Washington, 1979, and Hitzeman et al., J. Biol. Chem. Res. Com. 108, 1107 (1982) and Alber and Kawasaki: J. Mol. Appl. Genet. 1,419 (1982).

In a preferred embodiment, the coding sequence of the signal peptide of the BAR1 gene is exchanged. This reduces the cleavage efficiency of the signal peptidase of the Barrier portion of the fusion protein containing the KEX2 cleavage site by the signal peptidase. This can be achieved by site-specific mutagenesis of potential cleavage sites, preferably sites joining amino acids 23 and 24 (Barrier protein sequences) or linking amino acids 24 and 25.

Methods used to construct the DNA constructs of the invention include conventional techniques. The BAR1 structural gene or a portion thereof and the structural gene to be expressed are preferably under the control of a signaling promoter. Methods for ligation of DNA fragments are extensively described and are well known to those skilled in the art. The DNA encoding the protein sequence that can be expressed can be essentially the sequence of any of the following proteins, in particular proteins of commercial importance such as interferons, insulin, proinsulin, α-1-antitrypsin, growth factors, and tissue plasminogen activator.

After preparation of the DNA construct containing the BAR1 gene or a portion thereof and the structural gene to be expressed, the construct is transformed into a host organism under suitable transformation conditions. Techniques for transforming prokaryotes and eukaryotes (including mammalian cells) are known in the literature.

The host organism is preferably a strain of budding yeast Saccharomyces cerevisiae, but other species may also be used, including dividing yeast Schizosaccharomaces pombe, and filamentous fungi Aspergillus nidulans and Neurospora sp.

Restriction endonucleases were obtained from Bethesda Research Laboratories, New England Biolabs and Boehringer Mannheim Biochemicals. Restriction endonucleases were used according to the manufacturer's instructions, usually pancreatic RNAase (10 g / ml) was added for cleavage. T4 DNA ligase was obtained from Bethesda Research laboratories or Boehring-Mannheim Biochemicals and was used as instructed. Host strains and vectors M13 and p1C were obtained from Bethesda Chemical Laboratories. M13 cloning was performed according to the method described by Messing: Methods in Enzymology 101, 20 (1983). DNA polymerase I (Klenow fragment) was used according to Maniotis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, (1982). E. coli cultures were transformed according to the method of Bolivar et al., Gene 2

95 (1977). S. cererevisiae cultures were transformed by the method of Beggs: Nature 275, 104 (1978), which modified MacKay: Methods in Enzymology 101, 325 (1983). S. pombe is transformed according to Russel: Nature 301, 167 (1983). The sex pheromone α-factor was prepared according to the method of Duntz et al., Eur. J. Biochem 35, 357 (1973) modified by Manneya et al., J. Cell. Biol.

96, 1592 (1983) or obtained from Sigma Chemical Co. Oligonucleotides were synthesized on an Applied Biosystems Model 380A DNA Synthesizer and purified by PAAG electrophoresis on denatured gels.

Barrier protein activity assay

The assay used to detect Barrier production by transformed yeast cells is based on Barrier's ability to restore the growth of susceptible α-type cells and inhibited by α-factor. The test strain is one of the strains that are abnormally susceptible to α-factor, such as strain RC629 (MAT and Barl) because it has no Barrier activity. This strain is used to prepare a continuous cell layer on agar plates. To this layer was added an amount of α-factor (0.05 to 1 unit as determined by Manney) sufficient to inhibit cell growth. Transformants that are tested for Barrier production are spotted on the surface of the overgrown plates. Secretion of the Barrier protein by the transformed cells alters the α-factor-induced growth inhibition in the immediate vicinity of the spot, allowing sensitive cells to regenerate. These cells are observed as flanks growing around the normal smooth end of the colony of transformed cells. The presence of this flange indicates that the plasmid in the transformed strain directs Barrier expression and secretion.

IRI and IRC tests

IRI and IRC assays are performed using commercially available kits obtained from Novo Industri, Bagsvaerd, Denmark. Guinea pig anti-pig insulin and guinea pig anti-human C-peptide antibodies are supplied in kits.

IRI microliter sample assay in NaFAM (0.04 M phosphate buffer, pH 7.5, containing bovine serum albumin) 50 μΐ of antibody (stock diluted 1:30) for 16 to 24 hours at 4 ° C ^μΐ125 I-insulin ( diluted 1: 100) 2 hours at 4 ° C μΐ 1% Staphylococcus aureus in NaFAM 45 minutes at 0 ° C, wash twice with 1% BSA / THEN * centrifuge and count the pellets

The different steps may advantageously be carried out in microtiter plates until the pellets are transferred to scintillation vials.

IRC microlitre assay sample in NaFAM μΐ antibody (stock dilution 1:50) up to 24 hours at 4 ° C μΐ ¹²⁵ 1-C peptide (stock dilution 1:30) up to 4 hours at 4 ° C μΐ 1% Staphyloccocus aureus in NaFAM minutes at 0 ° C, wash twice with 1% BSA / THEN * centrifuge and count pellets * THEN is 20 mM Tris, pH 8.0, 100 ml NaCl, 1 mM EDTA and 0.5% NP-40

Α-factor activity assay

The assay used to detect α-factor export by transformed yeast utilizes the ability of α-factor to inhibit the growth of susceptible α-type cells. The test strain (such as S. cerevisiae strain RO629 (MATa barl) contains a mutation in the BAR1 gene that prevents Barrier protein production and provides α-factor supersensitive cells. On a soft agar layer on a standard yeast selective synthetic medium (e.g. The transformants to be tested for α-factor export are sown on the lawn and incubated at 30 ° C. The secretion of α-factor transformantomi inhibits growth in the layer of sensitive cells immediately surrounding the colony. inhibition of the growth of the test cell layer means that the colony exports active α-factor, and comparing the size of the zones makes it possible to estimate the relative small amount of α-factor exported to the respective transformants.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 depicts the nucleotide sequence of the BAR1 gene and the deduced amino acid sequence of the primary translation product. The MAT 2 binding site is underlined. The predicted cleavage site of the signal peptide is indicated by an arrow and potential glycosylation sites are indicated by asterisks.

Figure 2 is a diagram of plasmid pZV9.

Figure 3 illustrates the construction of plasmid p245.

Figure 4 illustrates the construction of plasmids pZV30, pZV31, pZV32 and pZV33.

5A and 5B illustrate the construction of plasmid pZV50.

Figure 6 illustrates the construction of plasmid ml 15. Figure 7 illustrates the construction of plasmid pZV49. Figure 8 illustrates the construction of plasmid pZV134 which contains the TPI1 promoter.

Figure 9 illustrates subcloning of a portion of the MF 1 gene. Figure 10 illustrates the construction of plasmid pZV75. Figure 11 illustrates the construction of plasmids containing the TPI1 promoter and the BAR1-MF 1 fusion.

Figure 12 illustrates the construction of plasmid pSW22.

Figure 13 illustrates the construction of plasmids containing BAR1-MF 1 fusion.

Figure 14 illustrates the construction of plasmid pZV100. Figure 15 illustrates the construction of plasmid pZV102. Figure 16 illustrates the construction of plasmid pSW96. Figure 17 illustrates the construction of plasmid PSW97.

Figure 18 illustrates the construction of plasmids pSW98 and pSW99.

Triangle denotes a mutation at codon 25.

DETAILED DESCRIPTION OF THE INVENTION

The following examples are intended to be exemplary only and not to limit the scope of the invention. Unless otherwise stated, standard molecular biology methods are used.

Example 1

Proinsulin expression in S. cerevisiae using the BAR1 gene A recombinant plasmid containing the complete yeast genome is constructed (Nasmyth and Tatchell: Cell U, 753 (1980)). Using the binary vector YEp13 (Broach et al., Gene 18, 121 (1979)). The yeast DNA fragments produced by partial digestion with Sau 3A were inserted into Bam HI digested YEp13. The plasmid was used to transform S. cerevisiae strain XP635-10C (MAT leu 2-3 leu 2-122 bar 1-1 gal2: ATCC No. 20,679). Transformants were selected for leucine prototrophy and grown at a concentration of α-factor that inhibited α-type cells. The resulting colonies are then tested for their ability to secrete protein with Barrier activity.

Two colonies that were not dependent on leucine and capable of secreting Barrier were found. These colonies carry plasmids designated pBAR2 and pBAR3.

Plasmid DNA isolated from the two transformants was used to transform E. coli strain RRI (ATCC # 31343). Transformants were selected for ampicillin resistance. The plasmids pBAR2 and pBAR3 were isolated from these transformants. They are characterized by restriction endonuclease digestion and electrophoresis on agarose or acrylamide gels. Plasmid pBAR2 contains an insert of approximately 9200 nucleotide pairs. £. coli RRI transformed with plasmid pBAR2 was deposited with ATCC under number 39410.

Subcloning showed that the pBAR3 plasmid insert contains part of the pBAR2 insert, but is oriented in the opposite direction in the vector. Further subcloning and Barrier secretion testing localized the functional BAR1 gene sequence in a region of approximately 2750 nucleotide pairs. This fragment contains a coding sequence, transcribed but not translational sequences, a promoter, regulatory regions, a transcriptional terminator, and flanking chromosomal sequences.

Plasmid pBAR2 was digested with Hind III and Xho I restriction endonucleases. A fragment of approximately 3000 bp was purified by agarose gel electrophoresis. This fragment is inserted into plasmid pUC13 which has been digested with Hind III and Sal I. The resulting recombinant plasmid, which is designated pZV9 (FIG. 2), can be used to transform E. coli but does not have an origin of replication and a selectable marker. for its use as a yeast vector. Plasmid pZV9 in the transformed E. coli strain was deposited with ATCC under number 53 283.

For the BAR1 gene that is used to control proinsulin secretion, fragments of the BAR1 gene containing the 5 ', regulatory region and part of the coding region are used. Coupling of BAR1 and proinsulin gene fragments is performed at the appropriate reading region and at that point in the BAR1 sequence at which the resulting fusion polypeptide can be cleaved, preferably in vivo. There are several potential cleavage sites in the BAR1 gene. The Arg-Arg site at position 177-178 was selected as the test site for its fusion with proinsulin. The 5'-regulatory sequences and the coding sequences of approximately 800 bp of BAR1 are isolated from plasmid pZV9 as a Hind III-Sal I fragment of 1900 bp.

Figure 3 shows a method of subcloning human proinsulin DNA. The human preproinsulin cDNA (for BCA clone), p27, is produced by digesting pBR327 with Pst I, producing a fragment with G-terminus and insertion of C-terminal DNA prepared by reverse transcription of total RNA from human pancreas. Plasmid pBR327 is described by Soberon et al., Gene 9, 287 (1980). The sequence of human preproinsulin is described by Bell et al., Nature 232, 525 (1979); the complete translated sequence was cleaved as an Nco I - Hga I fragment. The overlapping ends are filled with DNA polymerase I (Klenow fragment), at the same time synthetic Eco RI linkers (GGAATTCC) and Xba I linkers (CTCTAGAG) are attached. The fragment was subcloned into pUC13 (Vieira and Messing: Gene 19, 259 (1982) and Messing: Methods in Enzymology 101, 20 (1983)), which had been digested with EcoRI and Xba I. NcoI (CCATGG) at the initiation codon, plasmids were tested for the presence of EcoRI, NcoI and Xba I sites surrounding the 340 bp insert. A plasmid having these properties is designated p47 as shown in Figure 3. The 5 'blunt-ended proizoline (BCA) fragment is regenerated by repair synthesis of the plasmid p47 primer (Lawn et al., Nucl. Acids Res. 9, 6103 (1981)). ). Subsequent digestions with Xba I yield a fragment of 270 bp which is inserted into PUCl 2 (Vieira and Messing: and Messing). The vector was prepared by digestion with Hind III, blunt-ended with DNA polymerase I (Klenow fragment), digested with Xba I, and gel purified. The resulting vector fragment containing the blunt-ended and Xba overhangs is ligated with said BCA fragment. Since mature BCA begins with the amino acid phenylalamine (TTT codon), it is necessary to restore the Hind III restriction site, which is achieved at the junction of these fragments by blunt ending and ligation. Plasmids are tested first to regenerate the Hind III site and then sequencing along the junction using an M13 sequencing diameter. Plasmid p254 has the correct sequence.

In FIG. 4 shows that the plasmid p254 was digested with the restriction endonucleases Hind III and EcoRI. The proin zulin fragment of approximately 270 bp is gel purified. The ends of the fragment are aligned with DNA polymerase 1 (Klenow fragment) together with deoxynucleotide triphosphates. Sal I linker sequences (GGTCGACC) are treated with T4 polynucleotide kinase and γ- ³² P-ATP is ligated to the blunt ends of the proinsulin fragment. Digestion with SalI and Bam HI and subsequent electrophoresis on a 1.5% agarose gel yields a proinsulin fragment with SalI and Bam HI cohesive ends.

The proinsulin fragment and the 1900 bp BAR1 fragment were ligated together in pUC13 which had been digested with Hind III and Bma HL. This construct was used to transform E. coli K12 (JM83).

Transformed cells are assayed for ampicillin resistance and for white colony production. Further restriction endonuclease digestion with Hind III, Bam HI and Sal I identified a plasmid (pZV27) containing the Hind III-Bam H1 fragment of the appropriate size with a single Sal I site.

In order for the first amino acid of proinsulin to be linked to the Arg-Arg of the BAR1 gene, the potential processing site of the product, the intervening material is omitted from the BAR1-proinsulin linkage. Synthetic eligonucleotides are used to control the removal of these foreign materials from the loop as follows.

In FIG. 4 shows that the plasmid PZV27 was digested with Hind III and Bam HI. A gel of approximately 2200 bp of the Barl-proinsulin fusion was purified on the gel. This fragment was then inserted into the replicating form of the phage vector M13mpl1 (Messing: Meth. In Ensymology 101, 20 (1983)), which was digested with Hind III and Bam HI. This recombinant DNA was used to transfect E. coli K12 (JM103) (Messing). Recombinant phage replication forms were tested for the correctness of the restriction structures by double enzyme digestion using Hind III + Sal I and Sal I + Bam HI. A construct that exhibits the desired structure is known as mpl1-ZV29. The oligonucleotide primer (sequence: 3'GGATCTTCTAAACACTTG 5) was labeled with γ- ³² Ρ-ΑΤΡ and T4 polynucleotide kinase. The 7.5 pmol kinase primer was then combined with 80 ng of a sequencing average of M13 (Bethesda Research Laboratories, Inc.). This mixture was annealed with 2 g of single stranded mpl1-ZV29. The second strand is lengthened with T4 DNA ligase and DNA polymerase I (Klenow fragment) as described for oligonucleotide-directed mutation (two-primers method) by Zoller et al. (Manual for Advanced Techniques in Molecular Cloning Course, Cold Spring Harbor Laboratory, (1983)). DNA prepared in this way was used to transfect E. coli K12 (JM103). Plaques are screened using a kinase oligomer probe (Zoller et al.). The plaques thus identified are used to prepare phage replication form (RF) DNA (Messing). The restriction enzyme digestion of RF DNA identifies two clones having the appropriate Xba I restriction pattern (7500, 810 and 650 bp fragments), but lacking a Sal I restriction site (which was present in the deleted BAR1-proinsulin fusion region).

RF DNA from these two clones was digested with Hind III and Bam HI. The gel fragment is purified with a 1900 bp fragment from each clone. These fragments were ligated to the pUC13 and Yep13 vectors (Broach et al., Gene 8, 121 (1979)) which had been digested with Hind III and Bam HI. The pUC / Barl-proinsulin hybrid plasmids for subsequent sequencing were used to transform E. coli KI2 (JM83). Two of these plasmids were designated pZV32 and pZV33. YEp13-derived recombinants are used to transform E.coli RR1 (Nasmyth and Reed: Proc. Nastl. Acad. Sci. USA 77, 2119 (1980)). Two of these plasmids were designated pZV30 and pZV31 (Figure 4).

Plasmids pZV32 and pZV33 were sequenced according to the method of Maxam and Gilbert (Meth. In Ensymology 65, 57 (1980)). The BAR1-proinsulin fusion is sequenced from the Bgl II site, which is located approximately 190 bp to the 5 'side of the junction, from the Sau 961 site, which is located approximately 140 bp to the 3' side of the junction (in the proinsulin gene). The data from these experiments confirmed that the desired fusion between the BAR1 gene and the proinsulin gene was constructed.

S. cerevisiae strain XP635-10C is transformed with plasmids pZV30 and pZV31. One liter of each culture is grown in standard leucine free synthetic medium. After 34 hours, α-factor was added to 10 ml aliquots of each culture. After an additional 11 hours, the cultures are centrifuged. Cell pellets and supernatants are tested for the presence of insulin or insulin-like material. The results of two such supernatant assays of the culture transformed with plasmid pZV31 showed 3 pmoles of IRI material per ml of culture medium and 5.8 pmoles of IRC material per ml of culture medium. IRI is insulin, proinsulin, or degradation products thereof in native conformation. IRC is free C-peptide, proinsulin, or degradation products thereof in the wrong conformation.

Example 2

Expression of S. cerevisiae proinsulin using the alcohol dehydrogenase I promoter, BAR1 gene and triose phosphate isomerase terminator.

The S. cerevisiae alcohol dehydrogenase I promoter (hereinafter referred to as the ADHI promoter also known as the ADCI promoter) is tested for use in controlling expression of foreign polypeptides in conjunction with BAR1 equivalents. A plasmid containing these sequences is constructed. Plasmid pZV50 (Figure 5B) contains the ADHI promoter S cerevisiae, said BAR1-proinsulin fusion and the S. cerevisiae triose phosphate isomerase terminator gene (TP11) (Alber and Kawasaki: J. Molec. Appl. Genet. 1, 419 (1982)) . The plasmid was constructed as follows. Plasmid pAH5 (Amerer) shown in FIG. 5A is digested with Hind III and Bma H1. The ADHI promoter fragment of 1500 bp is purified on the gel. This fragment together with the Hind III-EcoRI polylinker fragment of PUC13 was inserted into EcoRI and Bam HI digested plasmid pBR327 using T4 DNA ligase. The resulting plasmid, designated pAM5, was digested with SphI and Xba I. The 2% agarose gel was purified with an ADHI promoter fragment having approximately 400 pairs of nukeotides. Plasmid pZV9 was digested with Xba I. The BAR1 fragment of approximately 2000 bp, which contains the complete coding region of BAR1, was gel purified in a similar manner. The two fragments (ADHI promoter and BAR1 sequence) were ligated into the plasmid YEp13 which had been digested with the restriction endonucleases XbaI and Sph I. This gave plasmid pZV24. Cleavage of plasmid pZV24 with sSpH I and Bgl II and subsequent gel purification yields an ADHI promoter-BAR I fusion of approximately 800 bp that contains an ATG initiation translation codon but does not contain codons for potential processing of the protein at the Arg-Arg site. Plasmid pZV33, which contains the BAR1-proinsulin fusion, is digested with Bgl II and Xba I and the fusion fragment (about 500 bp) containing the Arg-Arg codons is purified.

The TPI1 terminator (shown in Figure 6) was obtained from plasmid pF61 (Alber and Kawasaki). Plasmid pF61 was digested with EcoRI. The linearized ends of the plasmid were aligned with DNA polymerase I (Klenow fragment) and Bam H1 linker sequences (CGGATCCA) were added. The fragment was digested with Bam HI and ligated again to give plasmid p136. The 700 bp TPI1 terminator was purified from plasmid p 136 as an Xba I-Bam H1 fragment. This fragment was inserted into the plasmid YEp13 which had been digested with XbaI and Bam HI, digested with Hind III, blunt-ended with DNA polymerase I (Klenow fragment), and re-ligated to obtain plasmid p270. The TPI1 terminator was purified from plasmid p270 as an Xba I-Bam H1 fragment and inserted into plasmid pUC13, which had previously been digested with Xba I and Bam HL to obtain plasmid ml15.

The TPI1 terminator (FIG. 5B) is removed from plasmid m115 by Xba I and Sst I digestion followed by gel purification. Three fragments were inserted into plasmid pUC18 (Norrander et al., Gene 26, 101 (1983)) which had been digested with SphI and Sst I: the ADHI-BAR1 fusion, the BAR1-proinsulin fusion and the ΤΡΠ terminator. This DNA was used to transform E. coli K12 (JM83). Selection for ampicillin resistance and screening for white colony production identifies a plasmid (pZV45) that contains the inserted sequences. Plasmid pZV45 was subsequently digested with SphI and Bam HI. The ADHI-BAR1-proinsulin-TPI terminator sequence is purified on the gel. Plasmid YEp13 was digested with Sph f and Bam HI. An ADHI-BAR1-Proinsulin-TPI1 terminator fragment was inserted into this digested fragment. The S. cerevisiae expression vector pZV50 is obtained.

S. cerevisiae strain XP635-10C is transformed with plasmid pZV50, cultured and tested as described in Example 1. No IRI product was found in the medium, the IRC product was less than 0.5 pmoles per milliliter. Cells that were extracted with 0.1% Nonidet P-40 showed 1 pmol of IRC product per ml of cell extract.

Example 3

Proinsulin expression in Schizosaccharomyces pombe using the BAR1 gene and the 5th pombe alcohol dehydrogenase promoter

This example demonstrates the use of a portion of the BAR1 gene to direct secretion of foreign polypeptides that are obtained by expression in a transformed host, Schizosaccharomyces pombe. A plasmid is constructed that contains a combination of the promoter of the S. pombe alcohol dehydrogenase (ADH) gene and the BAR1-proinsulin gene fusion.

The 5th pombe ADH promoter was obtained from a library of DNA fragments derived from S. pombe strain 972h '(ATCC No. 24,843), which was cloned from plasmid YEp13 as described by Russel and Hali (J. Biol. Chem. 258, 143). (1983)). The promoter sequence was purified as Sph I - Eco RI - Hind III polylinker fragment from plasmid pUC12 was ligated into plasmid YEp13 that had previously been digested with Sph I and Hind III. The resulting plasmid is known as plasmid pEVP-11.

In constructing the S. pombe expression vector (Figure 7), the ADH promoter is purified from pEVP-11 as a Sph I-Yba I fragment. Plasmid pZV33 was digested with XbaI and Bgl II. A BAR1 fragment of about 340 bp that contains the ATG initiation codon is purified. Plasmid pZV33 was digested with Bgl II and SST I and the BARI-proinsulin fusion sequence was purified. These three fragments were ligated with plasmid pUC18, previously digested with Sph

I and Sst I. The plasmid pZV46 is obtained. Since plasmid pUC18 is not efficient in transforming S. pombe, the plasmid is subjected to double digestion with the enzyme. The ADH promoter-BAR1 fusion fragment is purified from Hind III and Bgl II grafts and the BAR1-proinsulin fusion sequence is purified from Bgl II and Xba I grafts. These fragments were inserted into the plasmid YEp13 previously digested with Hind III and Xba I. The S. pombe expression vector pZV49 was obtained.

One liter of transformed 5th pombe strain 118-4h '(ATCC No. 20680) was grown for 36 hours at 30 ° C in standard yeast synthetic medium (-leu D) containing 200 mg / L aspartic acid, 100 mg / 1 histidine, 100 mg / l adenine and 100 mg / l uracil. The culture is centrifuged and the supernatant is tested by IRI and IRC assays. Two samples from cells transformed with plasmid pTV49 contained 1.6 picomolar / ml IRI material and 0.5 molar / ml IRC material. Control samples from culture transformed with plasmid YEp13 did not contain any detectable IRC material.

Example 4

Α-factor export using BAR1 signal peptide

The BAR1 signal peptide is tested for its ability to control the export of α-factor from a yeast transformant. Several plasmids containing DNA fragments that encode fusion of proteins of different lengths (from BAR1 protein) and 1 or 4 copies of mature α-factor are constructed. These plasmids transform a diploid host strain of type a / a. Transformants are tested for α-factor production by a ring assay.

Plasmids pSW94, pSW95, pSW96 and pSW97 contain the S. cerevisiae triozophosphate isomerase (TPI1) promoter, a 355 bp or 756 bp BAR1 gene fragment (containing 114 or 251 codons from the 5 'end of the BAR1 coding sequence) and either one or four copies of the α-factor (MF1) coding sequence gene. These constructions are described in Table L

plasmid fragment BAR 1 -factor pSW94 355 pairs of nucleotides 4 copies pSW95 767 nucleotide pairs 4 copies pSW96 355 pairs of nucleotides 1 copy pSW97 767 nucleotide pairs 1 copy

Plasmid pM220 (also known as plasmid pM210) was used as a source of the TPI1 promoter fragment. E. coli RRI transformed with plasmid pM220 is deposited with ATCC under number 39853. Plasmid pM220 is digested with EcoRI. An 900 bp fragment containing the TPI1 promoter was isolated by agarose gel electrophoresis. The ends were blunt-ended with DNA polymerase I (Klenow fragment). Kinase Xba 1 linkers are added to the fragment. This fragment is then digested with Bgl II and Xba

This modified TPI1 promoter fragment was ligated into the Bgl II-Xba I vector fragment (3400 bp) from plasmid pDR1107. Plasmid pZV118 is obtained. Plasmid pDR1107 was constructed by subcloning the Bgl Π-EcoRI TPI1 promoter fragment (900 bp) from plasmid pM220 into plasmid pIC7 (Marsh, Erfle and Wykes: Gene 32, 481 (1984)) to generate plasmid pDRHO1. Plasmid pDRHO1 was digested with Hind III and Sph I. A partial fragment of the TP11 promoter of 700 bp was isolated. Plasmid pDR100 containing the Xba I-Bam HI TPI1 terminator fragment of 800 bp from plasmid pM220 subcloned into plasmid pUC18 was digested with Hind III and Sph I.

The 700 bp partial promoter ΤΡΙ1 was ligated into the linearized plasmid pDR100 to give plasmid pDR1107. The EcoRI site at the 3 'end of the TPI1 promoter in plasmid pZV118 is removed. The plasmid was digested with Hind III and Eco RI. A 900 bp fragment was isolated and ligated into a synthetic linker constructed by annealing the ZC708 (5AATTGCTCGAGT 3 ') and ZC709 (3GAGAG-CAGTC 5') oligonucleotides. Addition of the linker eliminates the EcoRI site at the 3 'end of the TPI1 promoted fragment and adds Xho I and Xba I sites. This fragment is then ligated with plasmid pUC13, which had been previously digested with Hind III and Xba I restriction endonucleases.

The resulting plasmid was designated pZV134 (Figure 8).

Cloning of the yeast sex pheromone α-factor (MFa1) has been described by Kurjan and Herskowitz. The gene was isolated from this yeast genomic library of portions of the Sau 3A fragments cloned into the Bam HI site of plasmid YEp13 (Nasmyth and Tatchell: Cell 19, 753 (1980)) in this laboratory and the like. A plasmid that expresses α-factor in a diploid yeast homozygous for mata2-34 mutation is isolated from this library (Manney et al., J. Cell. Biol. 96, 1592 (1983)). The clone contained an insert overlapping the MFa1 gene characterized by Kurjan and Herskowitz. This plasmid, known as pZA2, was digested with EcoRI. A 1700 bp fragment was isolated and ligated into EcoRI digested plasmid pUC13. The resulting plasmid, designated p 192, was digested with EcoRI. The resulting 1700 bp MF1 fragment was isolated and digested with Mbo II restriction endonuclease. The 550 bp Mbo II - Eco RI fragment is isolated and ligated into the kinase Sal I linker. The bound fragment was digested with Sal I. The resulting 300 bp Sal I fragment was ligated into Sal I-digested plasmid pUC4 (Vieira and Messing: Gene 19, 259 (1982)). A plasmid, which is designated p489 (FIG. 9), is obtained.

A fusion of a gene comprising BAR1 portions (114 codons) and coding for the MFa1 sequence is constructed. Plasmid pZV24 (Example 2) was digested with Sph I and Bgl II. The 800 bp ADHI promoter-Bar1 fragment is isolated. Plasmid p489 was digested with Bam HI. A 300 bp MF1 fragment is isolated. The two fragments were ligated into a three-part ligation into the plasmid YEp13 digested with Sph I and Bam HI. The resulting plasmid was designated pZV69 (Figure 11).

A second fusion of the gene encoding the 251 amino acids of the Barrier protein linked to a portion of the α-factor precursor is constructed. Plasmid pZV10 containing the 767 bp Xba I-Sal I BAR1 fragment from plasmid pZV9 (Example 1) ligated into plasmid pUC13, which had been digested beforehand with Xba I and Sal I, was linearized by Sal I digestion. was coupled to a Sal I fragment of 300 bp from plasmid p489 encoding four copies of α-factor. The plasmid containing the BAR1-MFal fusion in the correct orientation is designated pZV71. The BAR1-MFal fusion from plasmid pZV71 is then ligated to the ADHI promoter. Plasmid pTV71 was digested with Xba I and Pst I and the 1070 bp fragment was isolated. The ADHI promoter was isolated as a Sph X -Xba I fragment (420 bp) from plasmid pZV24. The two fragments were ligated in three-part ligation with the plasmid pUC18, which had previously been digested with Sph I and Bam HI. A 1500 bp fragment containing the expression unit is isolated. This fragment was ligated into plasmid YEp13, which was digested with Sph I and Bam HI. This resulted in plasmid pZV75 (Figure 10).

For manipulation, BAR1-MF 1 fusion units from plasmid pZV69 and pZV75 are subcloned with the TPI1 promoter into plasmid pUC18 (Figure 11). Plasmid pZV69 was digested with EcoRI and BamHI. The 550 bp fragment containing the fusion is isolated. The 900 bp TPI1 promoter fragment was isolated from plasmid pZV118 by digestion with Hind III and EcoRI. The three-part ligation was performed using a 550 bp BAR1-NFal fragment, a 900 bp TP11 promoter fragment, and a pUC19 plasmid that had been digested with Hind III and Bam HI. The resulting plasmid was designated pSW59. Plasmid pZV75 was digested with EcoRI and Bam HI. A 954 bp BAR1MFal fusion fragment was isolated. This BAR1-MF 1 fragment was ligated in three-part ligation with the Hind III-Eco RI TPI1 promoter fragment of 900 bp and the pUC18 plasmid digested with Hind III and Bam HI. The plasmid pSW60 is generated.

In constructing the expression plasmids, the pSW22 plasmid, which was constructed as follows (Figure 12), was used as the source of the 5 'sequence encoding BAR1 with 116 bp. The BAR1 coding region found in plasmid pSW22 originates from pZV9. Plasmid pZV9 (Example 1) was digested with Sal I and Bam HI. A BAR1 fragment of 1300 bp is isolated. This fragment was subcloned into plasmid pUC13, which was digested with Sal I and Bam HI. This yields a plasmid that is designated pZV 17. Plasmid pZV17 is digested with EcoRI to remove the 3 ' largest coding region of BAR1 of 500 bp. The BAR1 vector fragment was re-ligated. A plasmid designated pJH66 was generated. Plasmid pJH66 was linearized with Eco RI. The ends are aligned with Klenow fragments. Linearized Bam HI linkers (5'CCGGATCCGG 3 ') are added. Excess linkers are removed by digestion with Bam HI before re-ligation. The resulting plasmid pSW8 was then digested with Sal I and Bam HI. An 824 bp fragment encoding amino acids 252-525 of BAR1 is isolated. This BAR1 fragment is fused to the fragment encoding the C-terminal portion of substance P (Munro and Pelham: EMBO J. 3, 3087 (1984)). Plasmid pPM2 containing a synthetic oligonucleotide sequence encoding the dimeric form of substance P at M13mp8 was obtained from Munro and Pellham. Plasmid pPM2 is linearized by digestion with Bam HI and Sal I and ligated with a BAR1 fragment of 824 bp. The resulting plasmid pSW14 was digested with Sal I and Sma I. An 871 bp BAR1 substance P fragment was isolated. Plasmid pZV16 (Figure 10) was digested with Xba I and Sal I.

The 767 bp 5 'coding sequence of BAR1 is isolated. This fragment was ligated with the 871 bp BAR1 fragment of P in the three-part ligation with Xba I and Sma I digested pUC18 plasmid. The resulting plasmid was designated pSW15. Plasmid pSW15 was digested with Xba I and Sma I. A 1640 bp BAR1 fragment of P was isolated. The ADHI promoter is obtained from plasmid pRL29, which contains a 540 bp Sph I-EcoRI fragment containing the ADHI promoter and a 5 'coding region of BAR1 of 116 bp from plasmid pZV24 in pUC18. Plasmid pRL029 was digested with Sph I and Xba I. A 420 bp ADHI promoter fragment was isolated. TPI1 terminator

SK 279041-6 (Alber and Kawasaki: J. Mol. Appl. Gen. 1, 419 (1982)) is obtained as an Xba I-EcoRI fragment in pUC18 with 700 bp. The linearized fragment containing TP11 terminator and pUC18 with Klenow supplemented with the Xba 1 end was ligated with a 420 bp ADH1 promoter fragment and a 1640 bp BAR1 fragment of P in a three-part ligation. This produces plasmid pSW22.

The plasmid pSW94 is then constructed (Figure 13). A 2300 bp fragment containing the BARf-substance P fusion and the TPI1 terminator was isolated with pSW22 as an Xba f-Sst fragment.

The Hind ΠΙ-Xba I TPI1 promoter fragment isolated from plasmid pZV134 was ligated to the BAR1-substance P-TPI1 promoter fragment in three-part ligation with plasmid pUC18, which had been previously digested with Hind III and Sst I. The resulting plasmid pSW81 was digested with Hind III. and EcoRI. A 1020 bp fragment and a 5 'BAR1 fragment of 116 bp are isolated. Plasmid pSW59 was digested with EcoRI and Bam HL A 550 bp BAR1-MFal fusion fragment was isolated. This fragment was then ligated in three-part ligation with the TPI1-BAR1 promoter fragment from plasmid pSW81 and YEp13 linearized with Hind III and Bam HI. The result is plasmid pSW94,

The construction of pSW95 is shown in Figure 13. Plasmid pSW60 was digested with EcoRI and BamHI. A 954 bp BAR1-MFal fusion fragment was isolated. Plasmid pSW61 was digested with Hind III and EcoRI. The 1020 bp TPI1 promoter-BAR1 fragment was isolated and ligated to the BAR1-MFal fusion fragment by three-part ligation with the plasmid Yrp13 which had been previously digested with Hind III and Bam HI. The resulting plasmid was designated pSW95.

The construction of the TPI1-BAR1-MF1 promoter fusion containing only one copy of α-factor originates from the BAR1-MFα1 junction (encoding four copies of α-factor) that contains the TPI1 promoter and MFal preprequence (see Figures 14, 15 and 16). Plasmid pZV16 was digested with EcoRI and SalI. An isolated 651 bp BAR1 fragment was ligated with the kinase Hind ΠΙ-EcoRI BAR1 specific adapter (produced by annealing the oligonucleotides ZC566 5'AGCTTTAACAAACGATGGCACTGGTCACTTAG3 'and ZC567 5' AATTCTAAGTGACCAGTGCCATmPiIpI 'pItI') The resulting plasmid pZV96 was digested with Hind III and Sal I, and a 684 bp BAR1 fragment was isolated. Plasmid pM220 gave the TPI1 promoter fused to the MFa1 prepro sequence. The plasmid pM220 was digested with BglII and Hind II. The TPI1-MFα1 promoter preprofragment of 1200 bp is isolated. The 3 'portion of the BAR1 coding region is obtained by digestion of pZV9 with Sal I and Bam HI. A 1300 bp BAR1 fragment is isolated. The Hind IH-Sal I BAR1 fragment of 684 bp, the Bgl II-Hind III TPI1 promoter-MFal preprofragment of 1200 bp was ligated in a four-part ligation with the plasmid YEp13 which was linearized with Bam HI. The construct with the desired promoter orientation and MF 1-BAR1 fusion was designated pZV100 (Figure 14).

For ease of manipulation, the MF1 prep1-BAR1 fusion fragment cleaved from plasmid pZV100 was subcloned into plasmid pUC13 as a Pst I-Bam HI fragment of 1600 bp. The resulting plasmid pUV100 was digested with Pst I and EcoRI. A 270 bp MFro prepro-BAR1 fragment was isolated. Plasmid pZV69 was digested with EcoRI and Bam HI. A 550 bp BAR1-MFα1 fusion fragment (encoding four α-factor copies) is isolated. This fragment and the 270 bp prepro-BAR1 fragment were ligated in three-part ligation to plasmid pUC 13, which had been digested with Pst I and Bam HL. The resulting plasmid was designated pZV102 (Figure 15).

An expression unit is then constructed that contains the TPI1 promoter, a portion of BAR1 and one copy of the α-factor coding sequence (Figure 16). Plasmid pZV102 was digested with Pst I and Bam HL. A 820 bp MFal prepro-BAR1 fragment was isolated. The 1000 bp Hind III-Pst I fragment, which contains the TPI1 promoter and the MFa 1 preprocessed from the plasmid pM220, was ligated with the plasmid pM220. to a 820 bp MFro prepro-BAR1 fragment isolated from plasmid pZV102 in three-part ligation with Hind III and Bam HL digested plasmid YEp13. The resulting plasmid was designated pZV105. Plasmid pZV105 was digested with Hind III. A 1200 bp TPI1-MFa1 promoter fragment was isolated. Plasmid pZV102 was digested with Hind III endonuclease. A vector fragment containing a copy of the terminal α-factor is isolated. This 2800 bp vector-MFal fragment was ligated to the TPI1-MF 1 promoter fragment and prepro to 1200 bp. The plasmid with the correct orientation and a single copy of the MF 1 coding sequence was designated pSW61. Plasmid pSW61 was linearized by partial digestion with Hind III. HindIII digests the plasmid pZV102 and isolates a 361 bp BAR1-MFa1 fragment. This fragment was ligated into the linearized plasmid pSW61. The plasmid with the insert having the correct orientation at the Hind III site 264 bp at the 3 'end of the MF 1 initiation codon is designated pSW70. Plasmid pSW70 was digested with EcoRI and Bam HI. A BAR1-MFα1 fragment with 361 pairs of nuclotides is isolated. By digesting the plasmid pSW81 (Figure 13) with Hind III and EcoRI, a 1200 bp TPI1-BAR1 fragment was isolated. This fragment was ligated to the BAR1-MFa1 fragment in a three-part ligation with HindIII and Bam HI linearized plasmid YEp13. The resulting plasmid pSW96 contains the TPI12 promoter and the 5 'coding sequence of BAR1 with 356 bp linked to one copy of the α-factor coding sequence.

A second BAR1-MFa1 construct containing 767 pairs of BAR1 nucleotides linked to a single copy of the MFa1 coding sequence was prepared using plasmid pZV75 as the source of the BAR1 fragment (Figure 17). Plasmid pZV75 was digested with EcoRI and Bam HI and a 954 bp BAR1-MF1 fragment was isolated. Plasmid pZV101, which contains the MFa1 prepro sequence linked to BAR1, is digested with Pst I and EcoRI.

A 270 bp prepro-BAR1 fragment was isolated. This fragment was ligated with the 954 bp BAR1-MF 1 fragment in three-part ligation with the plasmid pUC13 which had been previously digested with HindIII.

III. The resulting plasmid pZV104 was digested with Hind III. A 700 bp BAR1-MFal fragment is isolated. This fragment was ligated with plasmid pSW61 which was linearized by partial digestion with Hind III. The plasmid having the insert having the correct orientation at the Hind III site of 264 nucleotides from the 3 'initiation codon of MF 1 is designated pSW74. Plasmid pSW74 was then digested with EcoRI and Bam HI. A 738 bp BAR1-MFa1 fragment was isolated. Plasmid pSW81 was digested with Hind III and EcoRI, and the 1020 bp TPI1-BAR1 fragment was isolated. This fragment is ligated to a 738 bp BAR1-MF 1 fragment in three-part ligation with the plasmid YEp13 previously digested with Hind III and Bam HL. The resulting plasmid pSW97 contains the TPI1 promoter and 767 bp from the 5 'end of BAR1 linked to a single copy. α-factor coding sequence.

a .alpha.-diploid S. cerevisiae strain XP733 (Mata leu 2-3 leu 2-112 bar I -1 gal2 / MAT leu 2-3 leu 2-112 barl -1 gal2) was transformed with plasmids pSW73, pSW94 and pSW95. Plasmid pSW73 contains the sequences of the TPI1 promoter, the MFa1 signal peptide, the MFa1 prepro sequence, and the coding region of four α-factor copies in plasmid YEp13.

The transformants were plated on a continuous layer of soft agar grown S. cerevisiae RC629 cells on a selective medium plate and incubated overnight at 30 ° C. A comparison of the size of the inhibition zones for the test cells with plasmid pSW73 and for control shows that the control culture with pSW94 exports approximately 15% of the amount of α-factor produced by the culture with plasmid pSW73.

A construct containing BAR1 per copy of the MFal coding sequence is tested for α-factor export in the same manner. As a control for plasmids pSW96 and pSW97, plasmid pSW67 was used, which consists of the TPI1 promoter, the MFa1 signal peptide, the prepro MFa1, and the region encoding a single copy of α-factor in plasmid Y-Ep13. Comparison of the size of the inhibition zones shows that the plasmid pSW96 controls the secretion of about 30 to 40% α-factor compared to the plasmid pSW67 and that the plasmid pSW97 controls the secretion of about 10 to 15% α-factor compared to the plasmid pSW67.

Example 5

Mutation of the BAR1 signal peptide cleavage site

As mentioned above, it has been found that by changing the cleavage site of the precursor Barrier signal peptide, it can be expected to simplify the processing and export of the Barrier-fused proteins via the KEX2 pathway. The potential cleavage sites are between amino acids 23 and 24, and between amino acids 24 and 25. Thus, the DNA sequence encoding the primary translation product BAR1 is mutated so that at position 25 it encodes a proline residue. Plasmids pSW98 and pSW99 are plasmids based on plasmid YEp13, containing the S cerevisiae TPI1 promoter, a BAR1 gene fragment of 355 bp and 767 bp, including a mutated signal peptide cleavage site, and one copy of the α-factor coding sequence.

Mutation of the signal peptide is performed by standard in vitro mutation methods (Zoller et al., "Manual for Advanced Techniques in Molecular Cloning Course.", Cold Spring Harbor Laboratory, (1983)) using a M13 phage template and a synthetic mutagenic oligonucleotide sequence 5'ATTACTGCTCCTACAAACGAT 3 '. The phage template of pSW54 is constructed by ligation of a 540 bp Sph Ι-EcoRI fragment of pSW22 with MphI19 digested with SphI and EcoRI. After in vitro mutation, potentially mutated plaques are assayed by plaque hybridization with a ³² ? -Labeled mutagenic oligonucleotide. Sequencing confirms the presence of mutations. The replication form of one of the confirmed mutated phages mZC634-7 was digested with SphI and EcoRI. The resulting plasmid pSW66 (Figure 18) was digested with Flind III and Xba I to remove the ADH1 promoter. The fragment containing the BAR1 vector sequences was ligated with the Hind III-Xba I promoter TPI1 with 900 pairs obtained from plasmid pZV139 by treatment with Hind III and Xba I.

This plasmid with the TPI1 promoter and 119 nucleotide pairs having the 5 'end of BAR1, including mutation of the signal peptide cleavage site, was designated pSW82.

As shown in Figure 18, plasmid pSW82 was digested with Hind III and EcoRI and Bgl II and EcoRI. The resulting 1020 bp fragment was isolated. The Hind ΠΙ-EcoRI fragment from plasmid pSW82 was ligated to the EcoriBam H1 fragment of plasmid pSW74 and to the plasmid pSW99 cut with YEp13 digested with Hind III and Bam H1. The Bgl Π-EcoRI fragment from plasmid pSW82 was ligated to an EcoRI-Bam H1 fragment of 3000 bp from plasmid pSW70 and to the plasmid pSW98 with the Bam HI digestion plasmid YEp13. Plasmid pSW98 comprises the TPI1 promoter, 355 pairs of nucleotides from the 5 'end of the mutated BAR1 sequence, and one copy of the sequence encoding one copy of the factor. Plasmid pSW99 contains an identical expression unit except that the mutated BAR1 sequence has 767 nucleotide pairs.

Analysis by ring assay showed that mutation of the cleavage site increased α-factor export when plasmids encoding a single copy of α-factor were used. Transformants containing plasmid pSW98 export about 50% more α-factor than those containing plasmid pSW96 (i.e., compared to the non-mutated type).

Claims (23)

PATENT CLAIMS A DNA construct comprising individual sequences downstream of the 5 'to the 3' end as follows: a transcription promoter, a portion of the BAR1 gene from Saccharomyces cerevisiae, shown in FIG. 1 encoding a signal peptide preferably comprising 24 to 405 amino acids is the amino terminal sequence of the BAR1 gene starting with the initiating mationin, and at least one structural gene extraneous to the selected host. The DNA construct of claim 1, further comprising a KEX2 cleavage site for linking the BAR1 gene and the foreign genes. The DNA construct of claim 2, wherein the BAR1 gene sequence encoding the signal peptide is altered to reduce the cleavage efficiency of the fusion polypeptide or protein by the signal peptidase. The DNA construct of claim 1, wherein the promoter is a yeast glycolytic pathway gene promoter. The DNA construct according to claim 1, wherein the promoter is selected from the group consisting of 5. cerevisiae BAR1 promoter, 5. cerevisiae alcohol dehydrogenase I promoter and Schizosaccharomyces pombe alcohol dehydrogenase promoter. The DNA construct of claim 1, further comprising a transcription termination region of Saccharomyces cerevisiae of the triosophosphate isomerase gene. The DNA construct of claim 1, wherein the region of the BAR1 gene further comprises a 5 'non-translational sequence of 680 bp adjacent the translation translation initiation site. A transformed cell comprising the construct of any one of claims 1 to 7. The transformed cell of claim 8, wherein the cell is a fungal cell. The transformed cell of claim 9, wherein the fungus is Saccharomyces cerevisiae. The transformed cell of claim 9, wherein the fungus is Schizosaccharomyces pombe. The transformed cell of claim 9, wherein the fungus is Aspergillus or Neurospora. 13. A method for producing a foreign protein in a transformed cell by transforming a host cell with a DNA construct encoding said foreign protein and a selectable marker, and then culturing the transformed cell under culture conditions suitable for producing the foreign protein, wherein the host cell represented by the fungal cell is transformed with DNA, which comprises, in the transcription direction, a portion of the BAR1 gene of Saccharomyces cerevisiae shown in FIG. 1, encoding a signal peptide preferably comprising 24 to 405 amino acids, which is the amino terminal sequence of the BAR1 gene starting with the initiating methionine, at least one structural gene foreign to the selected host, wherein the fusion protein comprising the signal peptide and the foreign protein is produced in a transformed cell and directed to the secretory pathway of the cell. 14. The method of claim 13, wherein said cell is a fungal cell. Method according to claim 14, characterized in that Saccharomyces cerevisiae is used as the fungus. 16. The method of claim 14 wherein the fungus is Schizosaccharomyces pombe. Method according to claim 14, characterized in that Aspergillus or Neurospora is used as the fungus. The method of claim 14, wherein the fungal cell is transformed with a DNA construct comprising a promoter that controls expression of a fusion protein comprising a KEX2 cleavage site in the transformed cell. The method according to claim 18, characterized in that the sequence of the BAR1 gene encoding the signal peptide is altered by site-specific mutagenesis of potential cleavage sites, preferably sites joining amino acids 23 and 24 or 24 and 25. 20. The method of claim 14, wherein the fungal cell is transformed with a DNA construct comprising a promoter selected from the group consisting of the Saccharomyces cerevisiae BAR1 promoter, the Saccharomyces cerevisiae alcohol dehydrogenase I promoter, and the Schizosaccharomyces pombe alcohol dehydrogenase promoter. 21. The method of claim 14, wherein the fungal cell is transformed with a DNA construct comprising a yeast glycolithic pathway gene promoter. The method of claim 13, wherein the foreign protein is exported from the cell. starting materials to produce a protein comprising proinsulin or insulin. 21 drawings Method according to claim 13, characterized in that they are used accordingly