JPS61247384A - Development of plasminogen activating factor in yeast - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

DETAILED DESCRIPTION OF THE INVENTION The present invention is directed to methods for expressing plasminogen activators in yeast, NA vectors useful therefor, and protein products expressed thereby.

Obstruction of blood flow through the circulatory system due to the formation of blood clots is a major cause of disease and death. The most serious problems occur when blood flow is cut off to the heart (heart attack), brain (stroke), or lungs (pulmonary embolism). To combat these problems, a group of biological compounds called plasminogen activators work to break up blood clots through what is known as the fibrinolytic system. Through various mechanisms, plasminogen activator generates the active enzyme plasmin,
It breaks down the fibrous structure of the clot to produce soluble products. Two drugs commercially available for thrombolytic therapy that act as plasminogen activators are streptokinase, a bacterial protein, and urokinase,
It is a serine protease isolated from human urine. However, both of these drugs have a major drawback: they are not specific for blood clots. In addition to fibrin, they destroy blood proteins such as fibrinogen, prothrombin, factor V and factor II, which can result in internal bleeding as a side effect of treatment. Therefore, administration of streptokinase and urokinase is usually performed by catheter insertion directly into the site of the clot. This procedure is rather complex and is therefore rarely used.

On the other hand, plasminogen activators are extracted from normal and tumor tissues and are currently divided into urokinase-type plasminogen activator (uPA) and tissue-type plasminogen activator (tPA) depending on their source. being classified. tPA has a higher affinity for fibrin compared to the uPA group of activators. Therefore, it is desirable to produce tPA by genetic engineering techniques in order to increase the supply and variety of tPA available.

The DNA coding sequence of the tPA cDNA was cloned into E. coli (E, colt) using mRNA from Bowes melanoma cells.
enn1ca ) et al.
ture), 301:214-221, 1983).

Wallen et al. [European Journal of Biochemistry (Eur, J, Bi
ochem, ), 132:681-686.1983)
is a human melanoma cell line (Bosmes)
Two variants of the single chain form of plasminogen activator were purified and characterized from . Partial amino acid sequence analysis of the two variants showed that they differ because one contains three additional amino acid residues at the N-terminus. This additional tripeptide sequence, Gly-Ala-Arg, is cleaved from the molecule by plasmin to generate a shorter variant with an amino-terminal amino acid sequence corresponding to that deduced from the nucleotide sequence reported by Pennica et al. It was shown that

The heterologous protein products of Saccharomyces cerevisi
ae) (baker's yeast), it cannot be predicted whether similar results would be obtained with other proteins. Expression of a heterologous gene in a transformed cell is due to many interactions between the host cell and the foreign gene, associated regulatory genes, and gene products.

Such interactions are determined in part by the host species.

Gene-specific interactions include codon usage bias, recognition of promoter and terminator signals, and extrachromosomal elements (e.g., plasmids) that carry foreign genes.
stability and copy number. Protein-specific interactions include enzymatic modifications of protein products, such as processing of precursor forms, glycosylation, disulfide bond formation, and the like. Furthermore, different types of host organisms can differ in their ability to secrete foreign gene products.

Depending on the particular host-product system, such specific modifications may or may not be desirable. Species can differ in their tolerance to the presence of foreign proteins or the culture conditions required for production or isolation of a particular protein on a commercial scale. The unique gene product may in some cases contaminate the desired product and thus be expensive and/or laborious to purify.

Therefore, the eukaryote Saccharomyces cerevisiae s (S
accharomyces cerevisiae)
It would be desirable to develop methods to produce plasminogen activators in yeast and other yeasts to determine such interactions and exploit them for commercial production of plasminogen activators. Generally, these hosts -
Product interactions cannot be predicted a priori;
This must be determined by numerous studies in the laboratory or in large-scale production settings.

It is therefore an object of the present invention to provide a method for producing tPA in yeast.

Another object of the present invention is to be useful for the expression of tPA in yeast.
A. To provide vectors.

Yet another object of the present invention is to produce a protein in yeast that has the activity of human tPA.

The invention comprises growing a culture of yeast transformed with a vector comprising a yeast gene promoter and a segment coding for the structural gene for tPA, such that expression of the plasminogen activator is under control of the promoter. The present invention is directed to a method for producing plasminogen activator in yeast. NA constructs useful in producing such vectors are also described.

The terms "vector,""plasmid," and "rDNA construct" used are tautomeric. All of these terms refer to any DNA that has been modified by humans to contain DNA segments that are combined and juxtaposed in a way that does not occur naturally.
defined as a molecule, i.e. a clone of such a molecule.

Typically, such vectors carry at least one gene to be expressed in the host organism, as well as genetic elements that may be necessary for expression of the gene of interest, such as a promoter, transcription initiation site, and transcription terminator-1. Contains genetic information that ensures its own replication when transformed. The vector can also contain sequences that control the expression of the expressed gene ('R).

The term "expression" is defined in common usage to mean the condition in which the protein product encoded by a gene within a host organism is synthesized by the organism. The presence of a particular gene with all of the necessary control regions in the host organism does not necessarily mean that the gene is necessarily expressed. There are many reasons, many of which are not fully understood due to the lack of expression of the gene in the transformed organism. Furthermore, even if there is some level of representation, there is no reasonable way to predict the level of representation. Thus, although expression can occur in some cases, expression can be at such low levels that the protein product is not produced in quantities that can be useful.

The term "leader sequence" refers to the portion of a gene that encodes a signal peptide or pre-pro peptide. The signal peptide directs the newly synthesized protein into the cellular secretory tract and is cleaved from the rest of the protein during this process. Pre-propeptides are generally removed at a later point during the secretion process.

The term "leader sequence" used can also refer to an inherently occurring leader sequence.

In order to express a heterologous protein in yeast, it is desirable to have expression under the control of a promoter that is native to yeast. Yeast triose phosphate isomerase (T
PI) gene [Albert (8) Ibert and K
awasaki) et al., Molec, Apple, Genid, (J, Molec, Apple, Ge
Net, ), supra: 419-434.1982) is a preferred promoter. One of the advantages of using the yeast TPI promoter is that high levels of transcription can be obtained and a substantial portion of the total protein produced by the yeast cell can be dedicated to the protein of interest.

Other promoter sequences can also be utilized to produce tPA in transformed cultures of S. cerevisiae by modifying the vectors of the present invention to attach said promoters. Other promoters potentially useful in this application include alcohol dehydrogenase l [Ammerer (
^mmerer), Met, In Enzymology (M
eth, in Enzymology), 匪: 1
92-201.1983], alcohol dehydrogenase [Williamson et al., Nature 283: 214-2
16.1980), pyruvate ester kinase, phosphoglucose isomerase, phosphoglycerate mutase, ° hexokinase 1, hexokinase 2, glucokinase, phosphofructokinase, aldolase, etc.
or the promoter of the S. cerevisiae (S. cerevisiae) gene encoding a portion thereof.

The DNA construct of the present invention preferably further includes a transcription terminator sequence on the 3' side of the tPA structural gene. Preferred such terminators are varnish, cerevisiae (S
, cerevisiae) is the terminator of the TPI gene.

The vector for expression and secretion of tPA from the host cell may further include a gene sequence encoding a secretion signal, such as the MFα1 gene [Kurja et al.
(n and Herskowitz), Cell (Ce
ll) 30:933-943.1982) encoded by the yeast pre-pro region or yeast PH05, SUC major and BAR associated with the pheromone alpha factor.
1 gene's signal peptide region as well as the pre-pro region of the tPA gene itself.

The vectors described are Varnish, S. cerevisiae (S.

cerevisiae) results in the production of a protein with the activity of human tissue-type plasminogen activator.

The protein produced by the present invention can have the sequence of one of the two major forms of naturally occurring tPA, or the amino acid sequence can yield a protein that retains the biological activity of tPA, but also has other desirable properties. You can change it like this.

For example, glycosylation sites can be altered by site-directed mutagenesis to reduce glycosylation of tPA polypeptides occurring in yeast. Such modifications can result in high expression levels and/or high specific activity. Additionally, naturally occurring variations can exist, for example due to genetic polymorphisms.

Yeast cells transformed with the described vectors can be grown under standard culture conditions. The preferred growth medium is 2-
1 eu medium supplemented with glucose to a concentration of 6%. Further, it is particularly preferable that the medium contains a buffer solution in order to stabilize the pH of the medium to pH 5.0 to 6.0 during culture growth. Particularly preferred buffers are 0.1 M potassium hydrogen phthalate pH 5.5 and 0.1 M sodium succinate pH
It is 5,5.

The tPA produced by the present invention can be glycosylated or non-glycosylated to varying degrees. Since the presence of carbohydrates can interfere with fibrinolytic activity, it may be desirable to remove carbohydrates in vitro in some cases. A preferred method of removing carbohydrates is treatment with endoglycosidase H.

Standard biochemical techniques were used throughout. Restriction endonucleases were obtained from Bethesda Research Laboratories (Bet
hesda Research Laboratory
es), New England Biolabs (Ne
w tEnglandBioLabs) and Boehringer Mannheim Biochemicals (Boehringer
ger Mannheim Bioche+++ica
1g) and were generally used with addition of pancreatic RNase (10,!f g/ml) according to the manufacturer's instructions. T4 DNA ligase was manufactured by Bethesda Research
Laboratories and Boehringer Mannheim and used as directed. M13 and pUC host strains and vectors (except pUc18 and pUc19) were obtained from Bethesda Research Laboratories. M13 cloning is a meshing
) (Meth, i
n Enzymology), 101:20-7
7.1983). D.N.
A polymerase (Klenow fragment) was developed by Maniatis et al.
): Laboratory Manual, Cold Spring Harbor Laboratory
bor Laboratory), 1982). Escherichia coli (B, colt)
Culture was performed by Bolivar et al.
ene) 2:95-113.1977).

S. cerevisiae culture is performed by Mackay (Meth, in Enzymolog).
y), 101: 325.1983) as modified by
ture) 275: 104-108.1978).

Example 1 Construction of full-length plasminogen activator cDNA clone A, construction of plasmid pUCH Michelson et al.
) US A1 Engineering: 472-476.1983)
Bo & 4es melanoma cell line (Bo & 4es) melanoma cell line (Rieken et al.
Rijkenand Co11en), Journal of Biological Chemistry (J, Bio
l, Cheffi, ) 256 Near 035-7
cDNA library (1ib
rary) was created. The library was screened with oligonucleotide probes whose sequences were based on the common amino acid sequence for serine proteases and on the nucleotide sequence of the tPA gene as determined by Penn1ca et al. (ibid.). Decided. The probe was prepared using the phosphite-triester method [Beaucage and Caruth et al.
ers), Tetrahedron Letters (Tetra
hedron Letters) 22:1859
~1862.1981; and Mattoisii et al.
Eucci and Caruthers), Journal of the American Chemical Society (J
.

Am, CheIII, Soc, ) 103:
3183.1981) by Mattoisii et al.
ucci and Caruthers) (Tetrahedron Letters)
rs) 21:719-722.1980).

4 for screening this library with tPA sequences.
Oligonucleotide probe: 5' probe, "TA
GTGAACCATTCT” (sense strand, nucleotides 191-204); intermediate probe code CT
AGGACTATCCGT” (77 sequences, nucleotides 810-823); 3′ probe, “CTA
CTGTGAATGCT" (antisense, nucleotides 12°82-1295); and a serine protease common probe, "TACGACACACGAC
C” (antisense, nucleotides 1552-1565
) was used. The three partial tPA clones obtained are clone #27, containing tPA sequences from nucleotides 145-303; clone #20, nucleotides 749-1079.
; and clone #48, nucleotides 1156-168
It was 5. Notch 1 translation from these Kron (n1
The tPA DNA sequence was used to screen a cDNA library as described below, yielding two clones that together make up the complete coding sequence for mature tPA.

Referring to Figure 1, pUCF containing the 5' sequence of tPA extending from the Bgl■ site at position 188 to the EcoRI site at 802 has a double-specific primer extension (double 5peciHc primere).
xtension) (Lawn)
et al., Nucreek Acid Research (Nuc, A.
c1ds Res, ) 9:6103-6114.
1981), endonuclease digestion (digesti
on) and BamHI.

EcoRI-digested pUc13 (Vieira et al.
and Messing), Gene
19:259-268.1982 and Messing, Meth, In, Enzymology.
(Meth, in Enzymology) 101:
20-77.19833 (ligation)
n) was obtained from a library constructed by. The first strand fly is "TAGTGAACCATTC"
A”, which is exactly 8 for the array 810-823.
[! It is complementary to the 3' side of the coR1 site. The second strand is an oligonucleotide with a sequence of 155-168" CTAGGACTATCCGT3
5' of the Bgl II site at exactly 188 using '
Primed against the side. [Penn1ca]
et al., ibid]. The library is a clone #27 incision translation insertion (n1ck translated 1ns
ert) was used for screening. As shown in FIG. 1, plasmid pUcF was cut with old ndl[[ and Eco R1, and the plasminogen activator-containing fragment was purified.

To explain Figure 1, after double-stranded DNA synthesis, DNA
A was digested with Bgl ■ and Eco RI, and BaI
Michelson (Michaelson) except that it was cloned into pUc13 digested with IIHl and Eco RI.
puc'r containing the 3' sequence of tPA was obtained from a library constructed as described by Isoguchi et al. This clone was obtained by screening a library with truncated translation inserts from clones #20 and #48. A partial Eco RI digestion of pUCT was used to cut the plasmid at the Eco R1 site upstream of the coding sequence. Next, when digested with Xba I, Eco RI
-Xba I 3' plasminogen activator fragment was generated and purified.

Two fragments, 5′ t PA/HindI
[I-EcoRI and 3′tPA/Eco
RI−χbar, as shown in FIG.
Ligation into I-Xba I digested pUc13 generated plasmid pucw.

To remove the 3' non-coding region of tPA from pUcW, it was converted to Baa HI /Bgl I at 188
Digested with Xho II, which recognizes the I site. This tPA
The XhoII fragment was cloned into the Bam 81 site of pUc13. The separation was chosen with the orientation of the tPA 3' end close to the Xba T site of pUc13 (Figure 2).

This construct was designated pUCH.

B, cDNA sequencing
) The cDNA was sequenced to confirm that the desired sequence was cloned. The sequencing used is outlined in Table 1. Sequencing primer [
Bethesda Research Laboratories
da Research Laboratories
) except for the commercial M13 universal sequencing primer from the phosphite-triester method [Beaucage and Caruthe et al.
rs ) S Tetrahedron Letters (Tetrah
edron Letters) 1-fold: 1859-186
2.1981; and Matteucc et al.
i and Caruthers)% Journal of the American Chemical Society (J,
Ash, Chew, Soc, )
l 0 3 : 3 1 8 3 . 1981
) was manually applied to the polymer support [Mat
teucci and Caruthers), Tetrahedron Letters (Tetrahedron L
etters) 21 Near 19~722.1980
) or Applied Biosystems (8p
plied Biosystems) Model 380-
A. Synthesized using a DNA synthesizer. The Xho U -Xho II t PA fragment from pUCW was purified by M13mph (Messing), Meth, in Enzyme.
mology) 101; 20-77.1983)
It was inserted into the n+HI site with reorientation. Fragments of this insert were subcloned into the M13 vector as shown in Table 1. Sequencing is done using Messi
ng) (ibid.). The resulting sequence is shown in FIG.

The results were announced by the cloned sequence [Penn
It was shown that the sequence differed in four points (Table 2) from the sequence described in [1ca et al., Ibid.]. Differences may have resulted from replication errors made by some method, including mutations in the cell line used as source material for cDNA cloning, or by reverse transcription in the production of cDNA.

Example 2 Cloning and Sequencing of Human Genomic tPA cDNA Genomic tPA cDNA was extracted from a DNA library derived from normal liver tissue to determine the correct sequence of the human tPA gene.
Got Cron. The library is fetal human liver l1l DNA.
The fragment was converted into bacteriophage lambda [loan (L
awn) et al., Cell (Cel) U5-:1157~
1174.1978).

The library was transformed into Escherichia coli (E, colt) strain LE3.
92 (ATCC33572) (Mani
atis L, ibid. p. 504). 0
．． Overnight cultures of cells in broth containing 2% maltose, 10 mM MgSO4 and 50 μg/m 1 thymidine were concentrated 2-fold in 10 mM Mg5Oa. 750 μl of the concentrate was plated with 1 μβ of the phage library (200,000 phages/μl) on broth agar in a NZY amine soft agar top layer using a 22 cm x 22 cm plate. Approximately 1 OS colony was obtained per plate after overnight incubation at 37°C. Colonies were transferred to nitrocellulose and lifted (1 ift) in 0.1 M NaOH, 1,5 M NaOH,
treated with NaCl for 10 min, then neutralized in 0.2 M Tris pH 7,5,1,5 M-NaCl, air dried,
Bake at 80°C for 2 hours. Prehybrid formation and bibrid formation (for full-length truncated translated LPA cDNA probes) were carried out in SET buffer (SET was added at 175 ml per rift).
．． 2g NaCj! , 72.7g) Squirrel, 14.8g
The reaction was carried out at 65° C. in HCj2 (pH 8.0) containing EDTA. Filters were washed in 2x SSC, 0.1% SDS, dried and autoradiographed. Thirteen preliminary positives were identified. Two rounds of plaque purification (screened as above) identified 9 positives from 13 groups.

Nine positive genome clones were isolated from Escherichia coli (E, colt).
) Lysates were prepared by plating on LE392 and growing overnight. CsCl phage! Purified on a gradient and oligonucleotide probe ZC94 (5' TAGGATCCATGGATGCA
ATGAAGAGAGGGGC3'), ZC96 (5'
CTGCTGTGTGGAGCAGTCTTCGTT
TCGCCC3' ), ZC98 (5' TGCCCG
ATTCAGAAGAGGAGCCAGATCTTC3
), ZC88, ZC89, ZC91 and ZC46
A map was created by bibrid formation for (see Figure 3). Probes ZC94, ZC96 and ZC98 hybridize to the signal peptide coding region based on the published series (Pennlc et al., ibid.), and the remaining probes hybridize to the mature peptide coding region. The nine positive isolates were recognized to belong to three distinct classes, both of which span the entire tPA coding region. Insert size was determined by digestion with Eco RI.

For each type, the clones with the largest inserts are Eco RI, Bgl U and Eco RI +
Digested with Bgln and restriction fragments were purified using the satin method (5ou
thern blots) (southern (5outh)
ern), Journal of Molecular Biology (J, Mo1. Biol, ), 98:5
03-517.1975). Clone 9 was found to contain the entire coding sequence for mature tPA (but not the signal peptide coding region). Eco RI insert from Kron 9
and Bgl II-Eco RI fragments were inserted into M13 and pUc13 for sequencing and further analysis. Fragments were obtained using the dideoxy method [Sanger et al., Journal of Molecular Biology (J.

of Mo1. Biol, ), 143: 16
1.1983 and Sanger et al., Proceedings of the National Academy of Sciences, Proc.
ci, ) USA Yu'no 5463.1977) and located at positions 404.605.1069 and 172.
The correct nucleotide in 5 was determined. Sequencing of the 7 kb EcoRI fragment using primer ZC89 showed that the nucleotide at position 605 in the genomic clone was a guanine, consistent with the published sequence. 2, 8 using primer ZC148
Sequencing of the kb EcoRI fragment showed that the correct nucleotide at position 1069 was thymine, consistent with the c DNA sequence of Pennlca et al. (ibid.). Wallen
(ibid.) further provides data indicating that the nucleotide at this position is thymine. At position 1725 the cDNA sequence showed a cytosine in contrast to the adenine found by Pennlca et al. (ibid.). This change does not affect the amino acid sequence of the protein product.

The correct nucleotide at position 404 appears to be thymine based on published data.

The cDNA sequence was tested for site-directed mutagenesis [Zoller et al., Manual for Advances in Molecular Cloning Processes].
vanced Techniques in Mole
cular Cloning Course), Cold Spring Harbor Laboratory (Col.
Spring Harbor Laboratory
), 1983] to correspond to the genome sequence. Sequences can be generated that are modified singly or in various combinations. The modified sequence can then be inserted into an expression vector as described above.

Example 3 Production of plasmid pTE26 The TPI promoter used for expression of tPA in yeast was obtained from plasmid pTE26.

Plasmid YRp7' (Stinch
comb, D, T, ) et al.
ture) 282:39-43.1979) is pBR
Yeast-TR- inserted into the Eco RI site of 322
Contains F'1 and AR3I and has two Eco RI sites.

One was partial digestion with Eco RI endonuclease, which digested and deleted only one of the two sites per molecule on average. The resulting unpaired ends of the linear molecule are filled in by a reaction catalyzed by DNA polymerase I (Flenow fragment), and the resulting plant ends are religated in a DNA ligase-catalyzed reaction to form closed circular DNA.
The molecule was restored. Eco adjacent to the resulting AR3I region
Plasmids carrying the R1 site are called m-engines.

Yeast TPI promoter is plasmid p TPICIO
[Alber et al. (^1ber and Kawasaki
), ibid.]. Referring to Figure 13, this plasmid was partially digested with Bgl II and the region between the Bgl n sites at approximately positions 3000 and 10600 was purified and religated. This construct, known as pTBR, was cut with Kpn I, digested with Ba131, and the ends were planted using DNA polymerase I (Frenow fragment). A synthetic old ndn [linker-CGCAAGCTTGC] was added at position +6 of the TPI structural gene. Religation of the molecules produced pTH30. The construct was then cut with old nd■, treated with Ba131 and DNA polymerase I (Flenow fragment) as described above, and a synthetic Eco RI linker (GGAATTCC) was added at position -10. T.P.
The T promoter (900 bp) was removed using Bgl n and the EcoRI/Bgl II digested plasmid pFRT
I inserted it inside. The resulting plasmid is pTE26.

Example 4 Production of plasmids p213 and p279 Plasmid p
279 was the source of the TPI promoter, MFα1 leader sequence and TPI terminator.

To explain Figure 14, human Breproinsulin c DNA (1) reB CA) Kron, p27
G-tailed Pst I-digested pBR327,
It is produced by inserting C-tilt DNA made by reverse transcription of total RNA from human pancreas.

Plasmid pBR327 is derived from Soberon (5oberon).
) et al., Gene 9:287-305 (19
80), and the sequence of human breproinsulin is described by Beil et al., Nature.
) 232:525-527 (1979). The complete translated sequence was converted into NcoI-HgaI
Cut as fragments. stand out protru
dtng ) ends with DNA polymerase I (Flenow fragment) and synthetic Eco R1 linkers (GG
AATTCC) and Xba I linker (CTCT
AGAG) was attached at the same time.

The fragment was extracted from the vector pUc13 (Vieira et al.) cut with Eco RI and Xba I.
and Messing), Gene
19:259-268.1982, (the entirety of which is hereby incorporated by reference) for pUC8 and pUC9, but containing the polylinker sequence shown in Figure 15]. . Addition of an Eco RI linker at the 5' end creates an Nco 1 site (CCATG
G), the plasmid contains εcoRI, Nco summer and Xba I in a 340 bp insert.
Screened for the presence of sites.

A plasmid p47 was identified that has these properties.

Referring to Figure 16, the BCA fragment with the 5' end of the plant was used with the primers of plasmid p47.
Repair synthesis [Lawn et al., New Creek
Acid Research (Nuc, Ac1dsRes,)9
:6103-6114.1981).

Subsequent digestion with Xba I yielded a 270 bp fragment, which was transformed into pUc12 (Vieira et al.
and Messing), ibid., pUC
8 and pUC9, but including the polylinker sequence shown in Figure 15). The vector was cut with Htndul, the ends were planted with DNA polymerase (Flenow fragment), cut with XbaI, and prepared by gel purification.

The resulting vector fragment containing the plant end and Xba I sticky end was ligated to the above fragment derived from p47.

Plasmids were first screened for recovery of the old ndn[ site and then by sequencing across the ligation using the M13 sequencing primer. Plasmid p254 had the correct sequence.

The genetic coding for factor α (MFα1) was described by Kurjan et al.
933-943 (19B2), previously cloned and characterized by, and later confirmed [Swing (
Singh, ^) et al., Nucleic Acids Research
), Earthworks: 4049-4063.1983). YEp1
3 [NathIlyth and Tat
cell), Cell 19 Near 53-76
A plasmid expressing α-factor in the α2 mutant strain was isolated from a yeast genomic library of a partial 5au3A fragment cloned into the Ram H1 site of the 4.4.1980). Cron was the first midfielder whose characteristics were displayed.
It contained an insert that overlapped with the αl gene. To explain Fig. 17, this plasmid (pZA2) was
o It was cut with RT and a 1700 bp fragment containing the stomach α1 gene was isolated. Add this fragment further to
Digest with fl endonuclease and DNA polymerase! (Flenow Fragment) and made it into a plant. Ec
oRI linkers (GGAATTCC) were ligated to the ends.

After re-cleaving with Eco R1 and Sal“■, MFα
The purified fragment containing most or all of the transcribed region of one gene was ligated to the TPI promoter in plasmid pTE26. In the resulting plasmid 201, anal α1
The gene loses its natural regulatory region (controlled by the mating type position) and is placed under constitutive expression by the TPI promoter.

Yeast TPI terminator fragment is plasmid p
Fc;1 (Alber and Ka
Wasaki) Ibid.]. It is about 700 minutes from the penultimate amino acid codon of the TPI gene.
It includes the region below hpJll up to the Eco RI site. 18th
To explain the diagram, the Baa+ H1 site is the unique Ec of pFGl.

First, cut the plasmid at the R1 site with Eco RI,
The ends were then made into plants with DNA polymerase (Flenow fragment) and synthetic aIIIHI linkers (
CGGATCCA) and religation to generate plasmid p136.

TP■Terminator from p136 Xbal-Bam
It was extracted as an HI fragment. This fragment was digested with Xba[-Baa+ HI-digested YEp13 (Broach et al., Gene).
8:121-133.1979) to generate plasmid p213.

To explain Fig. 19, the old ndlII-Xba
1 fragment was excised from p254 and the Bgl of p201 containing the TPI promoter-pro alpha factor fusion.
II-old ndI [[ligated to fragment. This was ligated into plasmidl 213 cut at the Xba I and Bgl II sites. The resulting plasmid is p27
It is 9.

Example 5 Construction of pDR403 Plasmid pDR403 (Fig. 4) was manufactured by Wallen.
The complete coding sequence of tPA (with the above base substitutions), including the 5' end sequence of the long variant described by En) et al. (ibid), was inserted into the TPI promoter and terminator.
as well as varnish and cereviche (S.

cerevisiae) together with the pre-pro sequence of the abdominal α1 gene. This plasmid serves as a useful intermediate for the construction of many yeast expression vectors based on this expression unit. pDR403 lacks a functional replication prototype in yeast, but contains the replication prototype from the bacterial plasmid pBR322, so it can be expressed in E. coli (H, colt).
) is maintained in suitable stocks. It is t from pUCH
It was constructed by ligating the PA coding sequence with an oligonucleotide linker to a portion of plasmid pM210.

Plasmid pM210 contains yeast TPI promoter and terminator-1MFα1 prepro sequences, and human proinsulin (BCA) sequences [Be1l].
et al., Nature, 232:525~
527.1979).

That is, Example 3, as described below and in FIG.
and pTE26, p279, and p213 described in 4.

Referring to FIG. 5, pTE26 was digested with Bgl and Hco RI and the 900 bp TPI promoter fragment was purified. Plasmid p279 is Eco
Digested with RI and Xba I to anal α1 and BCA
The aoobp fragment containing the sequence was similarly purified.

Plasmid p213 was cut with old ndn[, the sticky ends were planted using DNA polymerase I (Flenow fragment), and the linear molecule was recircularized using T4 DNA ligase to generate plasmid p270. T.P.I.
Terminator-12μ and ampicillin resistance (amp
γ) A fragment of approximately 5 kb containing the sequence was inserted into the p270
Purified from baI-Bgln digest. 3
fragment, TPI promoter, MFα1/BCA
and TP I/2u/ars9r, T4DNA
Ligation using ligase generated plasmid pM210.

Regarding FIG. 4, to construct pDR403, plasmid pUCH was completely digested with Xba I,
It was partially digested with Xho ■. Xho If -Xba
The 1tPA fragment was gel purified and ligated by an oligonucleotide linker to 9M210, which had been cut with old ndnl and Xba I to remove the BCA sequence.

Linker.

S'AGCTGGCGCCA""CCGCGGTCTAGS' is the 5' end of the 9M210 fragment that is complementary to the old ndl[r sticky end, and the X of the tPA fragment.
Provides a 3' end that is complementary to the hon sticky end.

It completes the coding sequence for the long variant of tPA (Wallen et al., ibid.) by supplying codons for the amino acids Gly-Ala-Arg. Fusion of this sequence to the preproMFα1 sequence brings the tPA coding sequence in frame to the α-factor Lys-Ar
g - Glu -Ala - Glu-Ala linked to the coding sequence for the potential processing site. Lys-Arg followed by pre-pro-α factor-tPA
Cleavage of the precursor protein yields the tPA precursor with four additional amino acids at the amino terminus. Processing can also occur after one or both of the two alanine residues, yielding a tPA polypeptide with Q, one or two Glu-Ala pairs at the amino terminus.

Subsequent sequence analysis showed that the linker sequence was present in multiple link duplications. The foreign linker sequence is then removed during construction of the yeast expression vector as described below.

Example 6 Construction of pDR505 By transferring the expression units of the promoter, leader sequence, coding sequence and terminator from pDR403 to the yeast vector YEp13 (Broach et al., Gene 8:121'-133.1979). A preliminary yeast expression vector was constructed.

The expression unit was removed from pDR403 by complete Bam HT and partial Bgl II digestion. The fragment was gel purified and cloned into the Ba11H1 site of YEp13. The resulting plasmids were screened for insert orientation. The plasmid with the orientation shown in Figure 6 was designated pDR505.

S. cerevisiae strain E8-11C (M'ATcXLeu 2-3.112
Crossbreeding E2-7B (ATCC20689
) XGKloo (ATCC 20669) hubroid segment) was transformed with pDR505 and grown at 30°C in synthetic medium lacking leucine.

Samples were taken occasionally starting at 9.5 hours (initial log) and up to 48 hours after culturing the transformants. (Cells are 17-1
It entered the initial stationary phase in 9 hours. ) The cell pellet was extracted, and the culture supernatant was subjected to Western method (Western blo
t) Analysis [Towbin et al., Processing of National Academy of Sciences (Proc, Natl., Acad, Sci.)
USA Yu, 4350.1979 and Barnett (Bu
(Anal, Biochem), 112:19
5-203.1981) for Amicon (Am1con
) Concentrated 100 times by ultrafiltration. tPA polypeptide was not detectable in cell pellet extracts or initial supernatant samples, but could be detected in 24-48 hour (somewhat longer than 24 hour) supernatant samples by Western analysis. Some bands at approximately 63,000 daltons could indicate differences in polypeptide processing or glycosylation. pDR505 and YEp
13 Concentrated supernatants from 24-hour samples of control cultures were also
! It was assayed by the LISA method (see Example 13). Compared to the native melanoma tPA standard, the pDR505 sample contained at least 1 ng tPA per ml unconcentrated supernatant. Since assays for native tPA are suppressed by yeast supernatant components, values for the true amount of tPA may be underestimated.

In addition to constructing pDR403, the expression unit containing the 3' region of the TPI promoter, HPα1 sequence, and tPA coding sequence was transformed into Sph I to remove foreign linker sequences.
pUc removed from pDR505 as an Xba I fragment and cleaved with sph I and Xba I
19 (Norrander et al., Gene 26: 101-1
06, 1983). The excess linker was then cut with agin, and the plasmid was recircularized with T4 DNA ligase. The correct construct is pDR1
Known as 206.

Example 7 Construction of a plasmid for intracellular expression of tPA tPA in S. cerevisiae
A plasmid was constructed for intracellular expression. This plasmid is known as pDRIO05 and is used in S. cerevisiae (S. cerevisiae) T P
1 promoter and terminator-1Met-Gl
Contains the coding sequence for y-Ala-Arg-5er-tPA and part of vector yEp 13. Its construction is shown in FIGS. 7 and 8.

Referring to FIG. 7, to construct pDR1005, pDR403 was cleaved with Bgl If and Xba I, and the tPA fragment (approximately 1.6 kb)
% agarose gel. The band was cut from the gel and diluted with TE buffer (10mM Tris pH 7).
, 4,5mM EDTA) for 6-8 hours, and then the DNA was precipitated with 2 volumes of ethanol. The 5' end of the coding sequence was repaired with the oligonucleotide linker "CATGGGCC, CCA3'"CCGCGGTCTAG". The tPA fragment and linker were added to the vector p cut with Neo I and Xba I.
It was joined to MT204. [Vector pMT204 is
Using T4 DNA ligase, plasmid pADHpol
(Russell and Hal
l), Journal of Biological Chemistry (J, formerly o1. Chem,) 258: 143
~149.1983) from Sbh T-Eco
RI Schizosac
charomycespombe) ADH promoter fragment; Yf! p13 Sph I,
A large fragment of heavy digestion in Xba [contains ampicillin resistance, LEU2, and partial 2μ sequences]; plasmid p153 (designation "Yeast, S. cerevisiae-" submitted on November 1, 1983);

system for the expression and secretion of insulin (Sys
tem for Expression and 5e
cretion ofinsulin in theY
547,748, hereby incorporated by reference] Eco RI-Xba
It was constructed by joining the pre-proinsulin fragments. Therefore, Nco of pMT204
I-Xba I fragment is varnish, cylinder (S
, pombe) ADH promoter and YEp
13 sequences (see Figure 7).The resulting construct is pDR
606 and shown in FIG.

tPA coding sequence and Varnish, cereviche (S, c
Referring to FIG. 8, plasmids pDR606 and p153 were digested with Nco I and Xba T and the digest was digested with 0.0. Electrophoresis was performed on a 7% agarose gel. A 1.6 kb fragment was purified from pDR606 digest. p153 digest to yEp 13 and the large Nco 1-Xba I':;' fragment containing the TPI promoter sequence and the Xba I- containing the TPI terminator.
The Xba I fragment was purified.

The three fragments were then ligated using 74 DNA ligase. The resulting hybrid DNA was used to incubate Escherichia coli (E.
, coli) strain LM1035 (strain HB101 (AT
A highly transforming derivative of CC33694) was transformed. Transformation was performed by Maniatis et al. [Molecular Cloning
:Laboratory Manual, Cold Spring Harbor
・Laboratory (Cold Spring Harbor
Laboratory), 1982). Twelve transformed colonies were screened for the presence of the desired plasmid construct. Approximately 7 to the 3' side of upstream Xba I in the Tamaminator
00bp or approximately 100 to the 5' side of the downstream XbaI site
Based on the presence of a Bam H1 site located at 0 bp.

Double restriction enzyme digestion with Bam HI therefore
Screen for the presence and orientation of the I terminator fragment. Correct construct of Nco I
+Bam HI digest yields a fragment of 2300 bp), while the incorrect construct yields a fragment of 2600 bp).
resulting in fragments of Bam'HI +Eco R
The I digest yields a 1300 bp fragment if the orientation is correct and a 1600 bp fragment for the incorrect orientation.

Colonies are YEp 13, TPI promoter and t
It was shown to contain the PA sequence but lacked the TPI terminator. The plasmid obtained from one such colony was designated pDRlool. Then plasmid pD
R1001 was linearized using Xba I. The TPr terminator sequence was cleaved from p153 using XbaE, the fragment was gel purified and ligated into linear pDR1001. The ligated DNA was incubated with Escherichia coli (E, calf).
) & used for transformation of LM1035. Desired Xb
Colonies containing plasmids with al fragments were found. The plasmid was purified and designated pDR1005 (Figure 8). TPI plasmid pDR1005
Screening was performed as above to verify terminator orientation. Eco R1+Ba of pDR1005
Heavy digest with m HI and Nco I + Bam H yielded 1300 bp and 2300 bp fragments, respectively, confirming that the desired plasmid had been constructed.

Varnish, S. cerevisiae strain E2-7 B (MATa leu 2 his
4P target engineering; ATCC20689) was transformed with plasmids pDR606, pDR1005 and YEp13 vectors. Cells were grown in synthetic medium lacking leucine and samples were taken during culture growth of each transformant. These materials were extracted and analyzed using the Western method. No proteins recognized by anti-tPA antibodies were detected in the pDR606 extract. pDR
Samples from 1005 extracts had detectable cytoplasmic tPA polypeptide, which reached a maximum in post-log phase (5X10'
~1×10 cells/ml). In the extract from pDR1005, the tPA molecule was clearly cleaved and two bands with Mr=27-2B,000 Daltons were detected based on the Western method.

Example 8 Construction of pDR12'07 and pDR1°208 Plasmid pDR505 has the amino acid sequence Lys-Arg-G
lu-Ala-Glu-Ala-Gly-8la-Ar
Contains a fusion of a MFα1 leader sequence and a tPA coating sequence constructed to generate a primary translation product with g-3er-tPA. In vivo cleavage of such a precursor after a Lys-Arg pair by cathebusin B-like protease yields a tPA molecule with four extra amino acids at the amino terminus. Varnish, cereviche (S, c
erevisiae) further partial processing by the S T E 13 gene product results in either Glu-A
It is expected that post-la cleavage will occur, thereby yielding a mixed population of products. However, the presence of multiple copies of the linker sequence in pDR505 suggests that the sequence Gly-Ala-Ar
g-5er-Gly-Ala-Arg-5er-tPA
yields a primary translation product containing.

To generate secreted tPA with an amino terminus corresponding to the two reported forms of the molecule (Wal fen et al., ibid.), MFI! 1-tPA junction region was further modified to delete the Glu-Ala-Glu-Ala sequence and create M
Lys-Arg of Fα1 was directly attached to the amino terminus of tPA (G
ly or 5et). Referring to Figure 9, plasmid pDR505 was transformed into sph I and
2, which is cleaved with ba I and contains MFα1 and tPA sequences.
．． A 2kb fragment was purified. This fragment was linearized with M13s+p with sphI and XbaI.
It was joined to 19. The resulting hybrid molecule, known as m19-ZV52, was used to infect Escherichia coli (E, colt).
transfected with K12 (JM103),
The single stranded form of the phage was purified [Igessing, Met.

Etchmology (Meth, in Enzys)
101:20-77.1983), this 1
The double-stranded DNA was then injected with two oligonucleotide primers (
ZC126: (3')AACCTATTTTCT
CCTCGGTCTAGA (5') or Z
C127: (3') AACCTATTTTCTA
GAATCCTTCZC (5'), and one of M
No. 13 Universal Generic Single Brimer was allowed to form a hybrid. The resulting heteroduplex was treated with Schiller (Zol)
Oligonucleotide-directed site-directed mutagenesis (O1igonuε1eotide
-directed 5ite-specific+
utagenosiis) (two-brimer method) with DNA polymerase I (Frenow fragment) and T4 DNA ligase. The double-stranded product was isolated from Escherichia coli (E. coli) K.
12 (JM103), and the resulting plaques were rescreened by hybridization with labeled oligonucleotide primers. Positive clones were plaque purified and sequenced [Meshing (M
essing), ibid.]. The replicative form for each of the two phages [DNA was purified and cleaved with Sph I and Xba I to yield a 2.2 kb Sph I-
The I fragment was purified. The tPA fragment was then ligated with sph I and Xb using T4 DNA ligase.
a Plasmid pUc1 linearized by cleavage with I
9 (Norlander) et al., Gene 26: 1
01-l 06.1983). ZC126
The construct generated using the oligonucleotide was pDR12
07, and that generated using the ZC127 oligonucleotide is known as pDR120B (9th
figure).

Next, sequencing across the MFcrl-LPA junction is performed using a looping-out method.
It was shown that the foreign copy of the linker present in R505 was removed. Similarly, Glu-Ala-Glu-Al
a (in pDR120? and pDR1208) and t
The codon for Glu-Ala-Arg at the amino terminus of PA (for pDR1208 only) was deleted.

Since pUc19 is a bacterial plasmid, pDR120
7 and pDR1208 are varnish, cerevisiae (S,
cerevisiae). Modified MFα1
- To generate a yeast plasmid with a tPA fusion,
Plasmids pDR1207 and pDR1208 are first digested with sph I and Xba I. The fragment containing the 3' end of the TPI promoter, the MFα1 leader and the tPA coating sequence was gel purified and ligated into pDR1107 described in Example 9, which was first s
Cut with ph I and Xba 1, pDR1207
and pDR13 derived from pDR1208, respectively.
07 and pDR1308. These intermediates are then used to construct yeast expression vectors.

Example 9 Construction of pDR1107 Plasmid pDR11Q7 (Figure 10) contains the 5' portion of the TPI promoter, TPI terminator-1 and plasmid pUc18 (Norrander).
et al., ibid]. Therefore, it is a bacterial plasmid and is a suitable strain of Escherichia coli (E. coli), such as strain JM83 (Messing), Recombinant DNA Technical Bulletin (Recomb).
inant DNA Technical Bullet
tjn), NIH Publication No. 79-99.2,
N! L2.43-48.1979).

To explain Fig. 10, 80 obp'rp I
The terminator fragment was added to the Xba of pDR403.
Purified from I+Bam HI digest. This fragment was ligated with Xba I using T4 DNA ligase.
and ligated into pUc18 linearized with Bag HI. This construct was cultured in Escherichia coli (E. coli) K12 (J
M83) was used for transformation. The plasmid was isolated from the resulting white colony and 800 bp Xba 1-Ban
+ Screened for the presence of HI insert. Choose one plasmid with this insert and p
It was called DRlloo.

TPI promoter 900bp from pDR403
It was purified as a Bgl U-Eco RI fragment. This fragment was combined with Bgl II and Eco
Plasmid pIC7 (pUC8 cut with R1)
(constructed by cutting with d■ and EcoRI and inserting the polylinker sequence shown in FIG. 11).

The construct was cultured in Escherichia coli (E, colt) K12 (JM8
3) was used for the transformation, and the plasmid was isolated from the resulting white colony. 90 obp Bgl■-Eco
The plasmid with the RI insert was designated pDRllol.

To construct plasmid pDR1107, pDRll
ol to pDR as follows:
It was joined to lloo. Plasmid pDR1101 is Sp
Digested with h r and old nd m to create a 700 bp molecule P
The I promoter fragment was purified. plasmid p
Cut with DR1100GSph■ and old nd m,
The promoter fragment from pDRIIOI was ligated to the linearized plasmid using T4 DNA ligase. Escherichia coli (E. coli) K using ligation mixture
12 (JM83) was transformed. The plasmid isolated from the white colony was transformed into the former ndm-Bas+HI insert.

- (approximately 1.6 kb). One such plasmid was designated pDR1107.

Example 10 Site-specific conversion of tPAcD in tPA coating sequence
Mutations in the NA sequence are essentially Schiller (Zoller)
) et al. (ibid.) by in vitro mutagenesis using the two-primer method. A single (positive) strand DNA template was prepared from mp19 ZV52. Two oligonucleotide primers were then annealed to the template. The first primers were complementary to the region around the mutation site except for a single base mismatch. The second primer was complementary to a sequence 40 base pairs away from the 5' end of the mutation site. Typically the annealing reaction is performed at 55°C for 1
It was carried out for 0 minutes and cooled to room temperature for 5 minutes.

DNA polymerase (Flenow Fragment) and T4 DNA ligase were then added and the primers were incubated at 14°C.
It was extended for 4 to 8 hours. The mixture was then used to infect E. coli (
E, colt) JM83 was transformed and cells were plated and grown overnight. To identify positive plaques, DNA was collected as described [Schiller (Zo 1
(1er) et al., ibid.) and the filters were prehybridized for 1 hour at 37°C and then hybridized with the appropriate zzp-labeled mutant primer for 1 hour at 37°C. Room temperature, 50℃
, and if necessary at 60° C., with autoradiography between washes. Plaques identified as positive dips by hybridization at elevated temperatures were collected and DNA was prepared from them. The presence of the desired sequence was verified by sequencing using the dideoxy method.

The first (mutant) primer that corrects the mutation at position 605 is 217-”GTTGTGGTTCCCCAGGCCCAG3′
Met. The second (sequencing) primer was the 17-mer "CTT^^AGACGTAGCACC".

The positive strand of mp19-ZV52 was used as a template.

Two strategies were used to correct the position 404 mutation. 1st
The strategy used the positive strand of a phage clone with a modified position 605 mutation as a template. The second option is no modification 1
111) The positive strand of 19-ZV52 was used as a template. In both cases, the mutant primer is 187-”
CTGGCACACGAAATCTGA” and the sequencing primer is 18-mer “GGCCCTG”.
It was GTATCTATTTC” '.

The position 1069 mutation was corrected using the positive strand with the corrected position 605 mutation as a template. The mutation primer is “GTTGCTTGGCAAAGATGGCA3′ and the sequencing primer is “GCCCCCG”
It was CACAGGAACCG3'.

Example 11 Preparation of expression vectors in which the base sequence encoding tPA was modified The tPA sequence with one or more bases modified was inserted into several yeast expression vectors by the following method. . M13 clone R with various modifications
F was cleaved with the appropriate enzyme and the tPA cleavage was purified. These fragments were inserted into bacterial vectors pDR1206, pDR1207 and pDR1208, which had been previously digested with Bgl n and Xba I to remove the mutated tPA sequence.

Plasmid pDR1216, which has a corrected mutation at position 605, was prepared from pDR1206 by replacing the mutated sequence with the corrected Bgl II-Xba I fragment. Plasmids pDR1217 and pDR121B were similarly prepared from plasmids 1207 and pDR1208, respectively.

Plasmids pDR1226, pDR1227 and pD
R1228 was generated by replacing its mutated sequence with a Bgl U-Xba I fragment with a modification at position 404, resulting in pDR1206, pDR1207, and pD, respectively.
Prepared from R120B.

Plasmids pDR1246, pDR1247 and pD
R1248 was created by inserting the Bgl U-Xba 1 fragment containing modifications at positions 605 and 404 into a linear plasmid, pDR1206 and pDR1, respectively.
207 and pDR12,08.

Plasmids pDR1256, pDR1257 and pD
R1258 contains numbers 605 and 1069 in the linear plasmid.
pDR1206 and pDR12, respectively, by inserting a Bgl U -Xba I fragment with a modification in the sequence.
07 and pDR1208.

Plasmids pDR1276, pDR1277 and pD
R1278 has numbers 605 and 106 in the linear plasmid.
Nar I-XbaI fragment with a modification at position 9 and its clone Bgl II with a modification at position 404
- pD by inserting the Nar I fragment
R1206, pDR120? and pDR1208. These three plasmids are expected to encode tPA having the amino acid sequence reported by Penn1ca et al. (same journal) and Allen et al. (same journal).

The tPA cDNA sequence in pDR1276 was subcloned into M13mp18 and M13mp19 as a Sph I-Xba I fragment for sequencing both strands. Sequencing using the guideeoxy method revealed that this cDNA had a new base substitution at position 870.873.876.879 and a double base deletion at position 723.724, 404.605 and 106.
It was shown that the base substitution at number 9 was corrected.

Sequencing of several intermediate subclones in the preparation of the expression vector showed that they were identical to those of the large brother DNA fragments that could be used in assembling the correct tp^ sequence. Bam of M13mpH
Xhol of plasmid pUcW inserted into the HI site.
M containing the I-XhoTI t P A fragment
l 3T21 is 723-724 and 870-879
did not contain any error in the position of 404.60
It had base substitutions at positions 5 and 1069. Plasmid pDR1276 contained corrected base substitutions at positions 404.605 and 1069.

A yeast expression vector with the correct sequence as shown in FIG. 12 was prepared as follows.

The RF of Ml 3T21 was digested with Xho II and sph I, and the 5'tPA fragment was purified. Plasmid pDR1276 was digested with Sca I and Xba I,
The 3'tPA fragment was purified. Also, plasmid p
DR1276 was digested with Bgl II and Xba I,
A fragment containing the puc18 sequence was purified. These three fragments were ligated to create plasmid pDR1286. This has only the original mutations in numbers 404 and 605.

Furthermore, pDR1286 was completely digested with Xba I, and Ta
A 1145 base pair tPA fragment was obtained by partial digestion with qI. p this fragment
446 base pairs of BglII-Taq from DR1276
I fragment and Bgl■-X from pDR1276
ba I vector fragment and plasmid p
DR1296 was obtained.

In order to restore the 5' region of the TPI promoter and TPI terminator to the expression unit in pDR1296,
The vector was digested with sph I and Xba I,
A fragment containing the TPI promoter, MFα1 and tPA sequences was purified. This fragment is Sph
pDR1107 digested with r and Xba I. The resulting plasmid was named pDR1396.

Furthermore, pDR1396 with Bao+ HI and Hind m
digested the TPT promoter, MFα1, tPA and T
The final yeast pod expression vector was prepared by purifying the fragment containing the expression unit with the PI terminator.

This fragment was further divided into Baa HI and Hind m
and inserted into YEpl3. The resulting plasmid is known as pDR1496.

5phl-XbaIt of pDR1496
Subcloning and sequencing the PA sequence into M13mp18 and M13mp19 confirmed that all mutations were corrected.

Plasmid pDR1497 has a Gly-Ala-
It was prepared to encode post-secreted tPA with the sequence Arg-3er-. The sequence of tPA is Lys-Arg
MF at the codon corresponding to the processing site of
It was combined with the α1 sequence.

pDR1217 was transformed into Bg to prepare pDR1497.
The vector fragment was purified by gel. The sequence encoding tPA was removed from pDR1296 and the two fragments were ligated together. The resulting preparation (pDRl 297) was E,c
was used to transform Oli L M 1035.

Plasmid DNA isolated from one transformant was sph
The fragment containing the LPA-encoding region was purified. This fragment is s
It was refined with RF of M13mp19 cut with ph I and Xba I, and sequence analysis confirmed that the sequence of the binding part of α-factor and tPA and the sequence encoding tPA were as desired. .

The final yeast expression vector pDR1497 was prepared as follows. 3′ region of TPI promoter and NF
pDR1 with α1 sequence and tPA-encoding sequence
The Sph I-Xbar fragment of 297 was sp
It was inserted into pDR1107 which had been previously cut with hI and XbaI. This preparation, known as pDR1397, was further cut with old ndll[ and Bam H1, and the fragment containing the expression unit was purified by gel. This fragment was then inserted into YEp 13 previously cut with H'1ndll[ and Bam+HI. The resultant product is pDR1497. Plasmid pDR14
98 encoded a shorter molecule fused to a codon corresponding to the Lys'Arg cleavage signal of α-factor (
Ser-tPA), which has a modified tPA sequence. This preparation method only requires that the origin of the original vector fragment be pDR1208, and the above-mentioned pDR1
It is similar to that shown in the preparation scheme for 497.

Plasmid pDR1499 is a plasmid that is linked directly to the TIP promoter to encode intracellular production of tPA.
It contains a base sequence encoding et-Gly-^1a-Arg-5er-tPA. It was prepared in the following manner. Plasmid pDR1005 was cut with sph I and Xba I, and the 3' side of the TPI promoter and t
The fragment containing the PA-encoding sequence was purified by gel. Furthermore, this fragment is sph I and
It was ligated to pUc19 linearized with baI. pDR
This plasmid, known as Bgl II
and Xba I, and the vector fragment was purified. tPA with modified base at position 605
The encoding sequence was purified from the RF of the appropriate M13 clone as described in Example 10. This Bgl U
The -Xba I fragment was ligated to the vector fragment of pDR1209 to create pDR1219.

Furthermore, plasmid pDR1499 is pDR1219
By using vector fragments derived from
It was prepared in the same manner as pDR1497 and pDR1498.

For expression in yeast, the plasmid described above was transformed into a suitable yeast host strain, and the transformants were prepared in Example 1.
The cells were cultured as described in 2. A preferred yeast host is strain E8-11c.

The table below shows the expected sequences of the major translation products encoded by the expression vectors described above.

Vector pDR1496MFα1-Lys-Arg-Glu-A
la-Glu-Ala-Gly-Ala-Arg-Se
r-tPApDR1497' MFα1-1. ys
-^rg-Gly-Ala-Arg-3er-tPAp
DR1498MFαl-Lys-Arg-3er-tP
ApDR1499Met-Gly-Ala-Arg-S
Expression of tPA using er-tPA S. cerevisiae TP
I promoter, MFofl leader sequence, Gly-
The expression vector pDR1496 containing the sequence encoding Ala-Arg-Ser-t PA and the TPf terminator in YEpl 3 was transformed into the E8-100 strain of S. cerevisiae. Cells were grown to arrest and then plated in fresh 1 eu medium. The medium was stirred at 250 rpa+ and incubated at 30°C. A similar culture of E8-11c strain transformed with YEp 13 was carried out as a control.

At 18.20.22 and 24 hours after inoculation, 100 ml of the medium was taken out and bacteria were collected by centrifugation.

The washed pellet-shaped bacterial cells were disrupted with a glass piece in phosphate-buffered saline. The biological activity of tPA was then measured by fibrin degradation method.

The fibrin degradation test is based on the method of Hinder et al. (J. Biol, Chew, 254:
199 B.

1979). Bovine fibrinogen solution 10ml
(3,0mg/mj!; 0.036M sodium acetate pH 8, 4,0,036M sodium barbiturate, 0.145M sodium chloride, 10-'M calcium chloride, 0.02% sodium azide) at 40°C in the same manner. To this solution was added 10 μl of plasminogen and 10 μl of calf thrombin (500 U/m
l) was added. The mixture was poured onto a Gelbond agarose support membrane (Marine Colloids) and cooled. A well was cut in the agarose, and 10tt of the test sample was placed in the well.
1 and 10 μl of phosphate buffered saline containing 0.1% bovine serum albumin were added. The results were compared to a standard curve created using purified tPA. A bright ring around the well indicates the presence of biologically active plasminogen activator.

The results of a representative series of experiments are summarized in Table A.

S. cerevisi transformed with pDR1496, pDR1497, pDR1498 and pDR1499.
The aeE8-11c strain is American type culture.
Stored in Corexilan. The receipt number is 2 each.
0728.20729 and 20731.

So-11-N Plasmid Yutaka-1 plate @! ? , (μg/jriYE
p13 18hr's -”
20hrs −//
22 hrs-”
24hrs-pDR149618h
rs 13.2” 20hrs
27.0〃22hrs 18.0〃24hrs 17.21
Protein concentrations are given per milliliter of medium.

A similarly prepared medium of E8-11c transformed with pDR1496 was tested by the Eliza method. (Example 13). The results are summarized below.

1 8 hrs 52.8
1 66.020 hrs 1
04.0 264.022 hrs
1 20.0 280.
024 hrs 80.0
296.4*Tambek concentrations are given per 11 medium.

S. ceresivia transformed with pDR149B
The eE8-11c strain was grown in 11 eu medium supplemented with 2% glucose both with and without 0.1 M potassium hydrogen phthalate at pH 5.5. The extracts from the arresting phase medium were tested by Elisa method and fibrin degradation method. The results are summarized below.

E8-11c/pDR1498 extract in PBS
Precipitated with 0% saturated ammonium sulfate, resuspended in PBS, and dialyzed against PBS.

The final concentration of protein is 100■/mA! I sang. PBS or endoglycosidase H (0.1 μg) was added to 50 μl of the post-dialysis extract and incubated for 1 hour at room temperature before being subjected to the fibrinolytic activity test. As shown below, endoglycosidase treatment in vitro resulted in an approximately 2- to 6-fold increase in the biological activity of yeast-produced tPA.

5.0 170 3801.0
25 1100, 25
7 300.05
1.7 11th enzyme-linked immunosorbent assay (ELISA) for tPA microtiter plate (1 mmulon 2, Dynat
ech) wells were coated with affinity-purified rabbit anti-tPA antibody. 0 for coating
．． A solution prepared by diluting the antibody 400 times with 1 M sodium carbonate was used. Leave the plate at 4°C overnight and add buffer B (
0.05% Tween 20, 0.05% in PBS
(containing sodium azide) three times. 20
0 μl Buffer A (0.05% Tveen in PBS)
20. 0.05% sodium azide, 1% BSA
) was added to each well, and the plates were incubated at 35° C. for 2 hr to reduce non-specific binding. Additionally, the plate was washed three times with buffer B.

The test sample was prepared by diluting the test substance with buffer A. Place 200 μl of sample into each well and incubate the plate at room temperature for 1 h.
r incubated. Each, Elle.

Aspirated with an aspirator and washed three times with buffer B and once with distilled water. Affinity-purified rabbit anti-t conjugated with alkaline phosphatase in buffer A.
PA antibody solution 200μ! (Typically the bound antibody is
(1:00 dilution) was added to each well and the plate was incubated for 30 minutes at room temperature. The antibody solution was then removed and the plates washed with buffer B and distilled water as described above. 200 μm of enzyme substrate (60 μm of paranitrophenyl phosphate reagent [Sigma] dissolved in 59 ml of a solution of jetanolamine 96 m 12 / 1, magnesium chloride 56 Akebono / 1 pH 9,8)
was added and the plate was incubated for 30 minutes at 37°C. The plates were read with a Titertek "MultiScan" detector. The results showed that the concentration of na prepared in buffer A was 5 to 1100 n/ml.
Comparison was made with a standard curve by tivetPA.

Example 14 Site-directed mutagenesis of plasminogen activator Plasminogen activator obtained from tissue has four endogenous glycylation sites (amino (Bioche)
m, 23; 370 13707, 1 984
), three of these sites (Asn-117, -
184, -448) is glycosylated in tPA obtained from Bones melanoma cells. The remaining parts (As
n'-218) is not glycosylated in Bowest PA.

The plasminogen activator produced in yeast appears to be extensively glycosylated (by Western plot analysis). This highly glycosylated state may impair the suitability of the product for human therapeutic purposes. This is because the human body may recognize it as a foreign protein. Thus, a method for producing modified tPA in transformed yeast is provided. The modified protein has less glycosylation than tPA produced by wild-type yeast, yet retains biological activity. The modified plasminogen activator also has reduced activity in terms of antigenicity with respect to humans. Glycosylation can be prevented by substituting the ^sn residue at the glycosylation site with another amino acid.

In particular, it is desirable to change Asn residues to Gin residues.

Furthermore, modifications at other parts of the sequence may be introduced to prevent glycosylation of yeast-produced proteins.

proline residues can inhibit glycosylation in yeast (Marshall, Biochem,
Soc.

Symp.-Prec. 0:17-26.1974), and other substitutions at this position have also been made. Additionally, the third amino acid of certain glycosylation sites can also be changed. t
Altering the DNA sequence encoding PA can be done by site-directed mutagenesis. This method is basically based on the 1983 Co1d Spring
Zoller and Smlth in the Advanced Technology Manual on Molecular Cloning, published by Harbor Lab. Nucleotide exchanges may result in modification of one or more glycosylation sites. Furthermore, the mutated sequences can be successfully combined by restriction endonuclease digestion of the vector containing the mutation and ligation between the generated fragments to create the desired combination, or by a single mutagenesis step. Multiple changes can also be introduced.

In particular, it may be advantageous if additional nucleotide substitutions are made such that the codon corresponding to the original glycosylation site is changed to the desired yeast codon.

B, Experimental The cloned tPA cDNA was subcloned as two fragments for site-directed mutagenesis.

Approximately 1 μg of plasmid pDR1296 was incubated in BgllI buffer (BRL) to obtain the 5′ region of the tPA sequence.
Digested with 1 unit of Bgl I for 2 hours at 37°C. An additional 1 unit of EcoRI was added and the resulting DNA fragments were separated on a 1% agarose gel after incubation for 10 and 20 minutes. And 1.
The 086 base pair BglII digested and HcoR1 partially digested fragment was transferred to an NA-45DEAE membrane (Sc
Electrolytic elution was carried out into Hleicher & 5channel) according to the instructions.

3' side DNA is 0.05M1-lith, pH 7,4,6
It was prepared by complete digestion with χbal and EcoRI in a buffer of mM magnesium chloride and 0.05 M sodium chloride. The fragment was fractionated on a 1% agarose gel and the 1.532 base pair Eco RI-Xba I fragment was eluted as described above. The fragment was extracted and purified with chloroform and phenol, and precipitated with ethanol.

The purified Bgl II-EcoRI fragment was M
The fragment obtained by digesting 13mp8 (replicated RF) with BamHI and EcoRI and T4D for 5 hours at room temperature.
The ligation was carried out by treatment with NA ligase. Eco
The RI-Xbal fragment was extracted from MB in a similar manner.
13mp 19 (RF) Eco RI and Xb
a Combined with the I-digested fragment.

The recombinant phage clone was a lytic bacterium E. coliJM.
infected with IOI. Phage DNA was purified from the plaques and sequenced by dideoxy method using ZC87 as a primer to confirm whether it had the correct cDNA sequence. “Site-directed mutagenesis was performed on single-stranded M13 templates using mutagenic primers ZC294, ZC295 and ZC2.
97 (see Table 3) as Asn-117 and -18, respectively.
4 and -448 to make modifications. The use of these primers was designed to modify the endogenous glycosylation sites such that conversion of Asn codons to Gln codons and codon exchanges of other glycosylation sites desirable for yeast occur.

The primers were also compared to the template sequence to ensure that they did not have secondary regions of homology that would give rise to unrelated mutations. Glycosylation sites at Asn-117 and -184 were converted using the M13mp8 recombinant containing the Bgl U-EcoR1 insert as a template. Asn-4
The 48 site is Ec as a template.

Transformation was performed using the M13mp19 recombinant containing the R1-XbaI insert. The M13 universal primer ZC87 was used as the second primer for all mutagenesis.

20 pmole of phosphorylated mutagenic primer and 2
0 pmole of secondary brimer in 10μ2 of 20mM Tris, pH 7,5, 10mM Magnesium Chloride, 50mM
l in a buffer containing M sodium chloride, 1mM DTT.
The mixture was mixed with pmole single-stranded template and incubated at 65°C for 10 minutes. It was then left at room temperature for 5 minutes and further stored in water. 20mM of each dNTP, 2.5 units of Klenow polymerase, and 3.5 units of DNA ligase, pH 7.5.
, 10mM magnesium chloride, ], OmM DTT buffer was added to the annealed DNA and incubated at 15°C.
and incubated for 3 hours. Thereafter, the DNA was used to infect recipient bacteria E. coli JMIOI. Its E, co
li was plated on YT agar medium and incubated at 37°C.

Plaques were pre-prepared with 6x SSC and 10x Denha
rdt's mild 11i solution for 1 hour at 4°C, which is the Tm of the mutagenic primer.
was hybridized with a 32p-labeled mutagenic primer. Filters were exposed to X-ray film overnight.

The subsequent washing operation was carried out at a temperature 5°C higher because of the need to identify mutated plaques.The following mutated phage clones were identified.

Bgl with a mutation at the R2, Asn-117 site
Bgl with a mutation at the site of M13mp8 R10, Asn-184 containing a fragment digested with II and partially [EcoRI].
M13mρ8 containing a fragment partially digested with Eco RT with a mutation at the R24, Asn -448 site.
M containing fragments digested with RI and Xba I
By replacing the tPA-encoding sequence in 13mp19 pDR1298, tP with 1, 2, and 3 mutations was generated.
The DNA sequence of A was prepared. The following plasmid was prepared.

(1) pDR1601; has a mutation at the Asn-117 site, (2) pDR1602; has a mutation at the Asr+-184 site, (31pDR1603; has a mutation at the Asn-448 site, (41pDR16(14; Asn- Plasmid pDR1601 with all three mutations was initially clone #2 (RF ) containing the Asn-117 mutation, old nd ■ and partially digested E
The coRI fragment was purified and prepared by inserting this fragment into pUc12 digested with old ndnI and HcoRI. Furthermore, the plasmid was digested with Xba, and E
1086 partially digested with coRI and containing the sequence of tPA
The base pair fragment was purified. This fragment was derived from pDR1296 (containing the 3' tPA sequence).
32 base pair EcoRI-χbaI fragment and pD
R1298 (pUolB, TPI promoter, MFα
Plasmid pDR1601 was prepared by ligating the large χbal-BgllI fragment derived from 1) in a ligated form.

Plasmid pDR1602 was cloned #1 in a similar manner.
Mutated 5' tPA fragment from 0(RF) (
Hindll [and partially digested EcoRI].

Plasmid pDR1603 contains the 3′ mutant tPA fragment (Eco RI of clone #24 (RF)
Xbal digest) was purified, and this fragment and pDR
(7) Xba I-Bgl If digested fragment from pDR129B and BglII and partially digested t! It was prepared by ligating three fragments of the 5' tPA fragment digested with coRI.

Plasmid pDR1604 is clone #24 (RF)
EcoRI-Xba I fragment of pDR12
By replacing the corresponding fragment of 96,
It was prepared in the same manner as pDR1601.

Plasmid pDR1605 is clone #24 (RF)
The EcoRI-Xba I fragment of pDR12
p by replacing with the corresponding fragment of 96
It was prepared in the same manner as for DR1602.

Plasmid pDR1606 is the Xba of pDR1298.
I-Bgl II fragment and the Bgl II-Taq I fragment from pDR1601 (Asn
-117 site) and partially digested Taq I and Xba I fragments derived from pDR1605.

All pDR1600 series plasmids are sph
The tPA sequence was purified and cloned into M13mp18 for sequence verification.

Plasmids with the desired sequences were selected for use in preparing yeast expression vectors.

pDRL701-1706 is obtained by digesting the pDR1600 series plasmid with sph I and Xba 1 and
Purify the A fragments and combine them with Sph r and Xba
Each was created from pDR1601-pDR1606 by ligation to pDR1107 digested with I. The pDR1700 series plasmid was digested with BamHI and ll1ndl[[, and each tPA expression unit was
Plasmid pDR1801-1806 was created by inserting into YBp13 digested with amHI and old ndI.

Plasmid pDR1801, 1802, 1803, 18
04 was used to transform S. cerevisiae E 8-11c strain. The transformed cells are 2
25 Orpm containing 1 eu medium containing % glucose
The cells were cultured at 30°C in shaking flasks. Samples were sampled at regular time intervals during culture and tested for tPA polypeptide by ELISA and biological activity by fibrin digestion. The data obtained were compared with that of purified tPA standards. The results shown below are for each of the three single mutants (pDR
1801, 1802, 1803) indicate increased biological activity.

pDR1498286464 pOR1B01 30 80 40B
pDR18023040,6404 pDR18033064,8720 pDR18042688132 Example 15: Use of P)105 signal peptide to secrete tPA Yeast gene PH05 (Art Sho a et al. h Rainbow Ac1
dsRes, 11.1657-1672.1983) encodes a secreted protein acid phosphatase. Synthetic protein N encoding the signal peptide of PH05
The A fragment was ligated with DNA encoding tPA expressed in yeast.

Oligonucleotides ZC231,232,233,234 for the purpose of preparing sequences encoding signal peptides
(see Table 3) was synthesized and phosphorylated. These were annealed in duplicate to create fragments with the 5' end of the -terminal strand (ZC23°1+ZC232 and ZC
233+ZC234), that fragment is! ! coR
It was ligated with equimolar amounts of pUc13 cut with I and BawHI.

The combined mixture II! , coH strain JM83, and the resulting bright blue plaques were selected and sequenced. Select the plasmid with the correct insert9
It was named MPH05.

The PH05 sequence was combined with the TPI promoter and the tPA encoding sequence in the following manner (Figure 20).
. Plasmid pDR1296 with old nd ■ and Bgl IF
The plasmid containing the TPI promoter and TFα1 sequences was purified and cloned into pIC7 digested with HindI and BglI. This clone was further restricted with EcoRI and Bgl ff and MFα1
The bripro sequence was removed.

Plasmid pMPHO5 I! coRI and Xho II
The signal sequence of PH05 was purified. The signal sequence was ligated to the pDR1296 fragment. The resulting plasmid (named pMTPIPH05) was digested with sph I and Bgl II, and TPI
A fragment containing the promoter and PH05 sequences was purified. Furthermore, tPA cDNA (pDR12
Bgl If-Xba derived from 96! fragment) and pUclB digested with sph I and Xba I were ligated together to generate a plasmid named pDR1294 (Figure 20).

To prepare a yeast expression vector containing the TPI promoter-PH05-tPA expression unit, plasmid pDR1294 was digested with Sphr and Xba■, and T
The PI-PH05-tPA fragment was purified and pDR
Plasmid pDR1 by inserting into 1107
I made 394. Furthermore, its expression unit is BamH[
and old ndI [ and purified by gel. This fragment was inserted into YEp 13 by the method described in Example 11, creating plasmid 1) DR1494.

S. cerevisiae E 8-11 C strain is pDR
1494. The strain was cultured to arrest in a medium containing 6% glucose and 0.1 M potassium hydrogen phthalate, pH 5.5. tPA is EL I
Tested by SA method and fibrin degradation method. The respective expression levels were 52.8 μg/l and 14.4 μg/l.
It was l.

pDR1494 was modified with GIy-Al at the 5' end of the tPA sequence.
The change was made by induction of site-directed mutagenesis to delete the codon encoding a-Arg. pDR1394
Digested with ph I and Xba I to produce approximately 1.9 Kb of TP.
M13mp18 fragment of I-PH05-tPA
subcloned to. - The terminal strand of DNA was prepared and oligonucleotide ZC403 (“GCCAAT GCCT
CT TACCAA”).

The second strand is elongated and the mixture is
The cells were infected with M107 strain. Plaques were screened by hybridizing with labeled oligonucleotide ZC403. DNA was purified from labeled clones and sequenced to confirm the presence of the desired 5' tPA sequence. tPA subjected to changes
The fragment was removed from the M13 vector by digesting RF with old ndI[I and BamHI, and the fragment containing the tPA expression unit was inserted into YEp13 to create plasmid pZV84.

S, cerevisiae E 8-11 C is pZV8
The strain was transformed with 6% glucose and o
, IM potassium hydrogen phthalate, pH 5,5.
The cells were cultured in eu medium for 28 hours at 30°C. ELrS
The expression levels determined by method A and fibrin degradation test were 96 μg/1 and 64 μg/1, respectively.

Example 16: Use of the 5UC2 signal peptide for the expression of tPA The yeast 5UC2 gene encodes two types of inbatases, one of which is a glycosylated secretion synthesized as a precursor with a signal peptide. It is a protein. In order to use the signal peptide of 5UC2 for secretion of tPA, a part of the sequence encoding 5UC2 was converted into tP
Gene fusion was performed by linking with the sequence encoding A.

Using synthetic oligonucleotides, the intervening DNA was removed so that the first codon of the tPA sequence was immediately adjacent to the cleavage site of the signal peptide of 5UC2.

The 5UC2 gene was stored as an EcoRI fragment on plasmid pBR58 (Carlson & Bottst
efn, Cell Engineering: 145-154.1982). The fragment is processed by DNA polymerase (K
lenow fragment), and Ba
conjugated with mHI linker. And even more BamHI
and partially digested with NcoI. This fragment containing the 5UC2 promoter and the 5'-encoding region was extracted from pU, which had been previously cut with BamHI and XbaI.
Nco 1-Xba derived from pDR1299 in c12
It was ligated together with the ItPA fragment.

This plasmid, named pHK1002 (Fig. 21), was digested with BamHI and XbaI, resulting in 5UC2-
The tPA fragment was purified. This fragment was placed into pDR
1100-derived Xba I-BamHITPI terminator fragment. This ligation mixture was used to transform the E. coli RRI strain, and the plasmid from this Amp.Tet'' transformant was
．． The 1 kb BatmHE-BamHI expression unit was screened for the presence and orientation. pHK1
One plasmid named 102 was selected and Bam
The 5UC2tPA fragment was purified after digestion with HI and Xba I.

This fragment was inserted into M13mp18(RF) to generate an in vitro looped out template for making the correct 5UC2 signal peptide and tPA fusion. The template was sequenced to confirm whether it correctly contained all of the 5UC2 coding region and the 5UC2-tPA binding site.

An in vitro loop-out on the M13 template was created to remove the foreign encoding sequence between the 5UC2 and tPA sequences and to ensure correct fusion of the Guy-tPA and Ser-t P,A sites. . oligonucleotide ZC
238 and ZC239 (Table 3) were used to create the loopout. 5UC2-tPA fragment
M13RFD as n+H[-Xba I fragment
YEp 13 isolated from NA and cut with BamHl was terminated with a TPI terminator (XbaI of pDRlloo).
-BamHI fragment). Plasmids pHK1202 and pHK1205 are 5UC2-Guy inserted into the Ba+mH1 site in opposite orientations.
tPA unit, plasmid pHKL3
02 and pHK1002 SertPA units.

The TPI promoter replaced the 5uC2 promoter in the preparation described above. Plasmids containing such fusions were digested with old ndI[r and XbaI and their 5UC
The 2-tPA fragment was purified. This fragment was then inserted into the Nco I-old ndl adapter (sequence: (
CATGCTTTTGCAG'A'A'A' A
'C' GTT (and Neo I from pDR1399
-Xba I vector fragment (containing TPI promoter and terminator sequences).

The resulting intermediate was digested with Sphr and Xba I, and the TPI promoter-tPA fragment was purified and subcloned into M13mp8. Sequencing was then performed to confirm the sequence of the bonded portion. The expression unit from the intermediate was digested with BaaHI and Bg
It was removed by partial digestion with lII and subcloned into YEp13. The resulting yeast vector was transferred to pHK1212 (Gly-Ala-Arg-5
er-tPA) and pHK1
312 (having the expression unit of Set-tPA).

The TPI promoter is Ec for various preparations.

The original T
It has a sequence that is significantly different from the sequence of the PI promoter or the common sequence commonly found in strong ist promoters. Therefore, the promoter sequences derived from I) HK, GA) 312 are oligonucleotides ZC375 and ZC3, respectively.
76 (Table 3) was used to generate in vitro mutations to the native or consensus sequence. This mutation was verified by sequencing, and the altered promoter sequence was identified as Ep 1
A junction was added to the remaining part of the expression unit in 3. pHK1
These plasmids, designated 322 and pHK1322, contain the native TPT sequence and the d promoter sequence, respectively.

Plasmid pHK1212, pHK1312, HK13
22 and pHK1,322 are S.

revisiae E 8-11 C strain.

The strain was grown in 1 eu medium containing 2% glucose. The expression level of the bacterial strain extract was measured by the ELrSA method and the tubulin degradation method, and the results are summarized below.

pHK 1212 20 hours
18.4 0pHK 1312 20
hours 32 54pHK 1
322 20 hours 38
40pHK 1332 20 hours
32.8 38 Example 17; Intragenic t
Use of the pre-pro sequence of PA Mature tPA is synthesized within the cell and contains a leader peptide that is removed during the secretion process. It is made from the li1 translation product. A yeast expression vector containing the tPA signal sequence along with the mature protein coding sequence was prepared.

There are cleavage sites for BamHI and NcoI adjacent to the 5' side of the first codon (ATG) of the signal sequence. , and BglII (5au3 A, Xho
There is a cleavage site for lI). The natural leader sequence does not have a convenient restriction site near its center, but CGACCA (
By changing amino acids 20 and 19 (encoding Gly-Ala) to GGCGCC, Has
m and Nar I restriction sites can be introduced.

Applied Biosystems Model 38
The following oligomers were synthesized using an 0-A synthesizer.

ZC131: ” GGA TCCATG GAT G
CA ATG AAG AGAGGG CTCTGCT
GT GTG''ZC132: ' ``TGG CGC
CACACA GCA GCA GCA CACAGC
AGAG3' ZC133: ” GGCGCCGTCTTCGTT
TCG CCCAGCCAG GAA ATCCA
TG"ZC134: "AGA TCT G
GCTCCTCT TCT GAA TCGGG
CATG GAT TTCCT 3' We want to anneal oligomers ZC131 and ZC132 so that the 12 bases overlap in Section 1).

Furthermore, oligomers Zc133 and ZC134 were annealed so that 12 bases overlapped (Section 2).

Trim the oligomers into Pol I buffer (BRL)65
The mixture was kept warm at ℃ for 5 minutes. Then, it was slowly returned to room temperature and left for 4 hours for annealing. 10 units of DNA Elimerase were added and the mixture was reacted for 2 hours at room temperature. The reaction solution was heated at 100OV using an 8% acrylamide urea-denatured sea fencing gel to fractionate the products by size.
Electrophoresis was performed for 0.5 to 2 hours. Fragments of the correct size (completed polymerase reaction) were cut out of the gel and extracted.

After annealing, section 1 is labeled with Bag HI and NarI.
pU cut with Ba1lIHI and NarI
Cloned into C8 (Vieira and MessingS
Genes19i259-268.1982 and Me
ssing.

Methods in Enzy++ology
I G 1 ; 20-77.1983), section 2 was annealed and then cut with Nar 1 and BglI[,
Cloned into pUc8 cut with an+ HI and Nar I. Colonies were screened with appropriately labeled oligonucleotides. The sequences of positive plasmids were analyzed by colony hybridization to verify whether the correct sequences were cloned.

Section 1 was purified by cutting the appropriate pUC clone with BaIIHI and Nar I, and section 2 was purified using Nar I.
It was purified from the digests of I and Xho f[. The two fragments were ligated at the Nar I cleavage site and cloned into pUC8 which was cut with BamHI.

The prepro sequence was removed from the pUC vector as an Ncol-5an3A fragment and pDR1296
Bgl'II-Xba I tPA cDNA derived from
A fragment and Sph I from pDR1296
-Nco I TPI promoter fragment. The resulting fragment was divided into sph I and Xba I
and the preparation was inserted into pUC8 cut with pDR12.
It was named 95.

Yeast expression vector pDR1495 to pDR129
5 in a manner similar to that described for pDR1494 in Example 15. This plasmid is S, cerev
isiae strain E8-11c, and the strain was grown in 1 eu medium containing 2% glucose. 16
After some time, the cell extracts were subjected to tPA testing by ELISA and fibrin degradation methods. The expression levels were 4.0 μg/l and 5.2 μgel, respectively.

Example 181 Expression Vector Containing a BAR1-tPA Fusion The sequence encoding tPA was ligated to the BAR1 gene of S. cerevisiae. This preparation encodes the primary translation product, which contains the signal peptide that generates the proper disulfide bonds and directs to the secretory pathway.

The yeast BAPI gene encodes a secreted polypeptide known as barrier. This polypeptide, which is believed to be glycosylated, allows mating cells to overcome GE capture induced by α-factor. The first 20 to 24 amino acid sequences of the BAR1 primary translation product appear to be similar to known yeast and mammalian signal peptide sequences. Several cleavage sites potentially exist within the primary translation product.

The tPA-encoding sequence was inserted into the BARL amino acid 177-
178 (potential processing site) or convenient glII cleavage site (11414 on BAR)
NA1 as if fused to Arg-Arg sequence of amino acid)! i planned to produce the product.

The BAR1 gene was isolated from a plasmid pool containing the entire yeast gene cloned into the YEpl 3 vector (Nasmyth & Touch
e11SCell 9; 753-764.1980).

The plasmid bouquet was transformed into S. cerevisiae xP635-10 strain (MATa leu 2-3 1
eu 2-112 bar 1-2 gal 2; A
TCC #20679) and selected those with leucine prototrophy, and further screened for those capable of secreting barrier activity (as opposed to inhibition by α-factor). Two colonies were found to have these properties, from which plasmids were isolated and named pBAR2 and pBAR3.

Plasmid DNA isolated from these two transformants
was transformed into the RRI strain of E. coli (ATCC
#31343). Transformants were selected for ampicillin resistance. Plasmids pBAR2 and pBAR3 were Lco
li transformant and characterized by restriction enzyme digestion and agarose or acrylamide gel electrophoresis. Plasmid pBAR2 was found to contain an approximately 9.2 kb insert. The RRI strain of E. coli transformed with plasmid pBAR2 is stored at the 8TCC under accession number 39410. Subcloning revealed that pBAR3 contained part of the insert of pBAR2 but had the opposite orientation in the vector, and further subcloning and screening by barrier secretion revealed that a functional BAR1 gene sequence was present in a region of approximately 2.75 kb. I found out that I can. This fragment includes protein coding sequences, untranslated transcribed sequences, promoters, control regions, transcription terminators, and blanking chromosomal sequences.

Plasmid pBAR2 restriction endonuclease old nd
The fragment was digested with Xho I and Xho I, and the approximately 3 kb fragment was purified by agarose gel electrophoresis. This fragment was inserted into plasmid pIJc13 digested with old ndl[I and SalI. The resulting recombinant plasmid was named pZV9 and was used in E. coli form.

Although it could be used for transformation, it lacked the replication origin and selection marker necessary for yeast vectors.

To use the BAPI sequence to express tPA, we first linked the BARI gene to the yeast ADH1 promoter (Figure 22).
Amerer's Meth, in Enzyn+
ology.

101.192-201.1983) to the old ndu [and B
Digested with amHI and isolated a fragment of approximately 1.4 kb. It is t! derived from pUc12! coRI-Htn
dII [with polylinker, EcoRI and Baa+
It was inserted into pBR322 digested with HI to create plasmid pAM5. pAM5 with sph I and Xba I
The approximately 450 bp ADHI promoter fragment was isolated. Plasmid pZV9 was cut with Xba I and an approximately 2 kb BAR1 fragment was purified.

Those two fragments were previously separated into Sph r and Xba.
It combined with YEp 13, which had been linearized with I.

For expression of the BAR1 sequence from the ADHI promoter, a plasmid with the fragment in the correct orientation is pZ
It was named V24 (Figure 22).

Furthermore, a plasmid having a BAR1 sequence linked to a sequence encoding Set-tPA at the BglII site of BAR1 was prepared (Figure 23). pDR1107 and pDR1
296 was transformed into E.coliG-48(dam-). After purification of the plasmid, it was digested with Xba I and BamHI in Xba I buffer. pDR1107
The 600 bp TPI terminator fragment derived from pDR1296 and the 4.3 kb (tPA+vector) fragment derived from pDR1296 were purified by gel, and the two fragments were combined by reacting overnight at room temperature, and E, col
It was used for transformation into tRRl. Plasmid DNA was purified from the transformant, and the DNA was digested with Xba 1 and Bam II in an Xba I buffer to confirm that there were no errors. One of the clones was pJH33.
It was named.

Plasmid pJH33 was incubated with Bgl II in Uni-buffer.
Digested with phI. In addition, a 5.1 kb fragment containing the tPA-TPI terminator and the vector was purified by gel. pZV24 was added to Uni-buffer (0.05M
) Squirrel pH 7, 4, 0,006M magnesium chloride, 0
．． 05M sodium chloride) cut with t7sphl and Bgl n, containing the ADHI promoter and BARI region.
The 00bρ fragment was purified by gel. 5.1
Bgl I-sph I fragment of 80 kb and
0'bp (DpZV24-derived ADH1 promoter-B
A ligation reaction was performed with the AR1 fragment overnight at room temperature, and the ligation reaction product was transformed into E. coli RRl. Plasmid DNA was screened by digestion with Sph I + Bgl II and Sph I + BamHI. One correct plasmid is selected and p
It was named JH35.

BARI position 1025 (114th amino acid)
A yeast plasmid pJH39 containing the LPA sequence fused to the BAR1 sequence was prepared. This fusion is
A primary translation product containing a portion of the barrier polypeptide bound to 5et-tPA is generated by regenerating the rg residue at the 5' site of Set of tPA. pJH39
pJH35 and YEp in Uni-buffer to prepare
13 was cut with sph I and Bam HI. YEp
13 fragment and a 3 kb insert from pJH35 (
ADHI promoter, BAR1-t PA binding sequence and TPI terminator) was purified by gel and binding reaction was performed overnight. The generated plasmid is pJl
(It was named 39 (Figure 23).

Gly-Ala-Arg-Ser at the potential processing site at Arg Arg of BARI
- A second expression vector was prepared with the BARI sequence combined with the tPA sequence (see Figures 24 and 25).
.

pDR1219 was cut with Nco I, the fragment was blunted with DNA polymerase I (Kleno-fragment) and dNTPs, and ligated with a phosphorylated 5al I linker. The binding reaction product is in Xb buffer,
Digestion was performed by incubating overnight with 5ail and Xba I. A 1.6 kb fragment was gel purified using an NA45 membrane. Also, pUC13 is
Cut with 5alI and XbaI in buffer for NA4
Purified by gel using 5 membrane. 2.7k
The binding of the pUc13 fragment of b and the 1.6 kb tPA fragment was carried out overnight at room temperature, and
It was transformed into M83. A 2mβ scale rapid plasmid preparation was performed for each transformant. These were digested with Xba I and 5al I in Xbar buffer and confirmed to be correct clones. One correct plasmid was selected and named pJH6.

BARI and tPA sequences were combined. pZV9 old n
It was cut with old ndlI and 5alI in dllr buffer.

The 1.75 kb BAR1 fragment was then purified by gel using an NA45 membrane.

pJH6 in Uni-buffer (0.05M), pH 7.4,
0,006M magnesium chloride, 0.05M sodium chloride), was cleaved with old ndII [and Sal I, and NA4
Purification was performed by gel using a 5 membrane. 1.75k
b BAR1 fragment and 4.3 kb t PA+p
Coupling of the Uc13 fragment was carried out overnight at room temperature, E.
E.coli JM83 was transformed. After the plasmid DNA was purified, it was cut with Bglff in Uni buffer to confirm that it was a correct clone. One clone was selected and named pJH18. Bgl
pJ) (400 bp generated from 18
The fragment was purified by gel using NA45 membrane. pIc19H was cleaved with Bgln in Uni-buffer, ligation with the 400 bp BAR1-t PA fragment was performed overnight at room temperature, and the E. coli J M 8
3 was transformed.

'1ml plasmid purification from transformants was performed. The DNA was mixed with HinaTII and Ba in the supernatant solution.
5a was cut with IIIHI and also with BamHI in the same buffer.
Verification of the correct clone and orientation of the insert was determined by cutting with il. One correct clone was selected and named pJH20.

The sequences of BARl and Gly-Ala-Arg-5er-tPA were precisely combined. pJH20 was cut with old ndlll and Bam HI in Uni-buffer, and the 400bp BA
The R1-t PA fragment was gel purified using an NA45 membrane. M 1.3 mρ18 was cleaved with old nd[[ and Ram H1 in Uni-buffer, and NA
Purified by gel using a 45 membrane. This vector fragment and 4oobp BAR1-t PA
The fragment ligation reaction was carried out overnight at room temperature. This ligation reaction was transformed into E. colt JM 101.

REDNA was prepared from the plaques and digested with Bgl in Uni-buffer for verification of correct clones. One clone was selected and named mp19-JH23 (Figure 24). Template D from mp19-JH23
NA was prepared and sequenced. Loop-out mutagenesis was performed in mp19-JH23 using oligonucleotides ZC354 and ZC87 (Table 3) as primers. RF was prepared from a likely correct plaque and cut with Bgl II to confirm its authenticity.

Plaques that appear to be correct are sequenced and clones with the desired BARl-t PA binding sequence are extracted.
It was named 19-JH42.

As shown in Figure 25, the BARI-tPA fusion preparation was inserted into a pUC-type plasmid for subsequent manipulation. Phage mpl9-JH42 and plasmid pIc19H (containing the polylinker sequence shown in Figure 11 inserted into the Eco RI site of pUc9)
was cut with Bgln, and the linearized plasmid and approximately 200 bp BAR1-tPA fragment were purified by gel. To prevent the linearized plasmid from recombining, it is treated with phosphatase from calf intestine, and BA
conjugated with Rl-tPA fusion fragment. The resulting plasmid was named pJH46. A yeast vector was prepared containing the BARI sequence fused to the cty-^1a-Arg-Ser-tPA sequence at the Arg-Arg codon. It was made in the following way. Plasmid pJH46 was cut with BgllI in Uni buffer and the approximately 200 bp BARI-tPA fusion fragment was gel purified. Plasmid pJH35 was linearized with Bglm, gel purified, and treated with calf intestinal phosphatase. The ligation reaction of the two fragments was carried out overnight, and the clones were screened by restriction ester nuclease digestion. The plasmid showing the desired pattern was named pJH51. Plasmid pJH51 and YE
p13 was digested with sph I and BamHI in Uni-buffer. YEp13 vector fragment and 3.1 kb
The ADHl-BARl-tPA-TP I terminator fragment was gel purified and an overnight ligation reaction was performed to create the expression vector pJH52 (Figure 25).

A third BARl-t PA expression vector was prepared (Figure 26), which binds BAR1 to the Set form of tPA at the potential processing site of ^rg-Arg.
I am coding an array.

Plasmid pJH6 was combined with Xba I and Bg in Uni-buffer.
ln and the approximately 2.7 kb vector-tPA fragment was purified by gel. pDR1296 DNA was purified from an E. coli G-48 (dam-) transformant, and mixed with Xbar and Bgl in a buffer for Xbar.
Cut at n. 1.6 kb tPA fragment to NA
Purified by gel using 45 paper.

2.7 kb vector-tPA fragment and 1.6
The conjugation reaction of the kb tPA fragment was carried out overnight at room temperature and transformed into E. coli RRI. The generated plasmid was named pJH32.

mpl9-JH23 and pJH32 in Uni-buffer, B
Cut with am HI and Sal I. mpl9-JH2
6.5 kb BAR1-t PA-mpl 9 derived from 3
Fragment and 1.6 kb pJH32-derived tPA
The fragment was gel purified. The binding reaction of these two fragments was carried out overnight at room temperature, and the binding reaction product was E,
The cells were transformed into E.coli JM1()1. R
F was prepared and cut with 5ail and BamHI in Uni-buffer to confirm and verify the correctness of the clone.

One of the clones was selected and named mpl9-JH3B. This clone was sequenced to once again confirm its authenticity. In order to obtain the desired combination of BARl and tPA sequences.

Oligonucleotide ZC36 as mutagenic primer
5 and ZC151 as the second primer (Table 3)
A loop-out mutation was induced on mpl9-JH38 using . RF DNA was prepared from potentially correct clones and screened by digestion with Nar I and χba I+8g1IT in Htnd ■ buffer. One correct clone was mpl9-,
It was named JH43.

Template DNA was prepared from mpl9-JH43, and loop-out was confirmed by sequence analysis. Phage 1Ip19
- JH43 and plasmid pUc13 in Uni-buffer “
It was cut with Xbar and 1lirrrdllll. The plasmid and the 1.8 kb fusion fragment were purified by the method described above, and the two were ligated to prepare pJH47.

BARI Arg-Arg codon site (1212)
The yeast plasmid containing the BARI sequence combined with the 5et-tPA sequence was named pJH49.

It was done in the following way. 1.8kb BA
The R1-t PA fusion fragment was isolated from pJH47 by gel electrophoresis using NA45 paper.
+ Purified from BgI n digest. 800bp 5p
hl -BgllI (ADHl promoter-BAR
l) The fragment was isolated from pZVj4 in a similar manner. These fragments and Sph derived from pJH35
Three fragments of the vector-TP I terminator fragment purified from the T-Xba I double digest were ligated. The generated plasmid is pJH48
It was named. Furthermore, in Uni-buffer, plasmid pJH4
8 was cut with sph I and BamHI. 3.4 kb (ADHI promoter-BAR1-t PA-TP
I terminator) fragment was purified by gel,
It was conjugated to YEp13 digested with Sphr and Ba+wHI. The expression vector produced is pJH49 (Figure 26).

Yeast expression vectors pJH39, pJH49 and pJH52 are S. cerevisiae H8-11
It was used for transformation into C strain. The strain contains 0.1M potassium hydrogen phthalate pH 5.5 and 6% glucose-L
The extracts were grown in en medium and tested by ELISA and fibrin degradation methods. The results obtained are shown below.

H8-11C/pJH3926 hours 20
．． 8 22.4E8-LIC/pJl (4926
hours 4.9 9.488-11
C/pJH5226 hours 4.0
11. Q distribution i distribution order GA20 190-259 Z29 211-378 Z88 362-527 Z89 518-687 TC48-6823-990 z91 1136-1289 C, 348-7REV 1202-1018Z92
1136-1289 RI-HINDIII 1279-1489Z93
1479-1648 LAC1805-1630 16 sequence was derived from the Xho II digest of ptrcw.
PA! 23 The internal tPAEcoRI fragment is EcoRI.

3. Eco RT-HindnI fragment (
EcoRI +14, the direction of the primer is written in the 5'-3' direction.
M 1 3Xho II-Xho
II' TCTTACCAAGTGXh
o II-Xho II' TGC
AGCGAGCCAAAGGXholowXho II'
ACGTGGAGCACAGCGXho I
I-Xho II' CCAICAC
T CAAAGCCCEco R1-Eco RI”
M L 3Xho
II-Xho II' CCCTCC
TGCTCCACCEco R1-IEco RI”
M 13Xho
II-Xho II' GGGGGC
ATACT CATCEco R1-Old nd III'
M 13Xho II-Xh
o II' TATTCGGAGCG
GCTGXho II-Xho II'
M13mp
Obtained from a preparation made by inserting into II.

Subcloned into co-digested M13mpH.

subcloned into M13mpH digested with 1ndnI).

:There is. What is M13?Bethesda Re5earc
h Lab, for M13.

ζko (ri l + I C5 (J? (j ω Q
−← ro υ ku ← ←(昭←ω(ko←ζri(ri(C(ri←←−ri(ζko←← ← ω
← ← ← ← Q +,! I l-I
t-3 lo υ ←ku←c5(＜ωkumouth←kuωkumouth← ←Q(ko((輻ζko(ri(ko←←ζko←kukuguchi8ω〈
<<<
ro ← ku c+)t+! 50←ω Roroku←
ω←←Qku(riω←←ζko←(riυω(showωωζko-C
←(ri-aki<(riυ←l+)-ri(#-1(!-t-g
Toro (J < u←←−←CJ 4 CJ←υ−1~ri size ψ■ Mouth of moaning and crying L! 3's Nori's ■mouth■ of C sea lion ~ ~ ~ ~ ~ 6 ~ to nononouuuuOQuωuuQuu口NNNNNNNNNNNN bad NNN

[Brief explanation of drawings]

Figure 1 shows the production of plasmid pucw, Figure 2 shows the production of plasmid pUCH, and Figure 3 shows the tPACDN cloned into pUCH.
FIG. 2 is a diagram showing the nucleotide sequence determined for A and the amino acid sequence derived from the nucleotide sequence. Deviations from published sequence data (Pennica et al. and Wallen et al.) are *
and the sequence of the oligonucleotide used in the sequencing procedure is indicated. Figure 4 shows the construction of plasmid pDR403, Figure 5 shows the construction of plasmid pM210, and Figure 6 shows the construction of plasmid pD.
The structure of R505 is shown in Figure 7, the construction of plasmid pDR606 is shown in Figure 8, and the construction of plasmid pDR1005 is shown in Figure 8.
Figure 9 shows plasmids pDR1207 and pDR120.
Figure 10 shows the construction of plasmid pDR1107, and Figure 11 shows the construction of plasmid pDR1107.
The figure shows parts of plasmids plc7 and plc19H, and Figures 12a and 12b show parts of plasmid pDR149.
Figure 13 shows the construction of plasmid pTE26, Figure 14 shows the construction of plasmid p47, and Figure 15 shows the construction of plasmid pU.
Figure 16 shows the production of plasmid p254, Figure 17 shows the production of plasmid p201, and Figure 18 shows the multiple cloning site sequences of c12 and pUC13.
Figure 19 shows the production of plasmid p279, Figure 20 shows the construction of plasmid pDR1294, and Figure 2 shows the production of plasmid pDR1294.
Figure 1 is an expression that includes 5UL2 reader arrays. Figure 22 shows the construction of the plasmid pZV24, Figure 23 shows the construction of the expression vector pJH39, Figure 24 shows the construction of the recombinant phage mp19-JH23, and Figure 25 shows the construction of the expression vector pJH52. FIG. 26 shows the construction of expression vector pJH49. Jokichi of the drawing (Contents 1, no details) 0 conflict -1Φko- to Yodo! iI 6 Shiba <' Te Shiba C5 0■ o<o <h Cri>○-F'l (J Ayan QQ 0-Q Pe
1Q mountain Tokiri 00ON u
b CJ-1-Nori-L) 61 1”'
l-bu (!Ic!l ri5 be. , -1 lonely music E °“ °'<N<tot-th hr-t Q絢 υΦ いUψ Qφmo≧ Umigo ;≦piece ?shio (JOCJl , l G> υfalse u
s−+ ＜＞ aP@＜ψCJ false
-h o+, 00 to p c
喰υα Q---CJF-1jiΦ Poor scold U. 6. 0 days QQ 0φ roυ−<I
＜″ Poor, 5′ Reprimand Q0 0 knee〇大 QQ -ω Kushu E
-IJ: a- S82 ≦5 Toyama. U C5ko Φko cs<)s L) Puku-go S self r 1 ctp Φd Φri 0 絢 to<:l+l0a
t 8 adventure 3 sea lion −ψ 0φ □w 8 every ro 8 C! l> cph behashi hani tpo ) IcJ ) ICJ (J-Φri Ql yesterday am OΦ トΦ Q-〇〇- <tn L)+J 1-IE-1
p-rJ<mouth QC: Φtyt CJOh
. Keiyari foot/word CJI-+ CJI'1(J
ll14CJlk O-QQ Watch Uchu, CJ 148μ Milo confirmation 3 Asihama υ(: am <u o ceramic (J(
11C Rinote: < 84 ka ψ Bek CJk ll'lυQ' Leg piece 8 Ran QJ:
Nobeshu <E-ILL'IC! l<Qbe −0CJI11
'<o Peert OCJΦcp>
υ−C+ll−Φ−≦ ha u+>0< Φ−−1+l
ri l+1lJI ri 輛
Rikusu Ri1suN RiNυQ, (J14 0E-I's Riichi Omiko <sound. Q+ ell KaB.
Total. Q80 ω (j14 (JJ: ゞto1 1浣 be. E-IE-1<E-1 to E+1 mountain ~ I+1 Lee Lee INl, J Ri
-N RiyuFIG, -II pDR1296 YEp13pool ↓ SucoR+- ↓Flenow 1+ 80 ffi HE Lin j- 1 piece l! O≦ FIG, -19 FIG, -21 pDR+219 ↓ ↓ Violent

Claims (23)

[Claims] (1) growing a culture of yeast transformed with a DNA construct, said construct comprising a yeast gene promoter and a DNA sequence encoding a tissue plasminogen activator; A method for producing yeast tissue plasminogen activator, wherein expression of a DNA sequence is under the control of said promoter. (2) The method according to claim (1), wherein the promoter is selected from the group consisting of a triosephosphate isomerase promoter and an alcohol dehydrogenase I promoter. (3) The construct is plasmid pDR505, pDR100
5, pDR1496, pDR1497, pDR1498
and pDR1499, the method according to claim (2). (4) The method of claim (1), wherein the construct further comprises a leader sequence located between the promoter and the DNA sequence. (5) Leader sequence is ¥MF¥α1, ¥PH05¥, ¥
Claim No. (
4) Method described in section 4). (6) The method according to claim (4), wherein the leader sequence is derived from the pre-pro region of the human tPA gene. (7) The method according to claim (1), wherein the culture is grown in a medium maintained at a pH of 5.0 to 6.0. (8) Medium is 0.1M potassium hydrogen phthalate pH 5.5
and 0.1 M sodium succinate pH 5.5.
The method described in section. (9) The method further comprises: isolating tissue plasminogen activator from the culture; and treating the isolated tissue plasminogen activator to remove carbohydrates. The method described in (1). (10) The method of claim (9), wherein said treatment step comprises culturing said isolated tissue plasminogen activator in the presence of endoglycosidase H. (11) A product produced by the method described in claim (1). (12) A substantially pure polypeptide according to claim (11). (13) Amino acid positions 117, 184, 218 and 4
48. The polypeptide according to claim 12, comprising a glutamine residue at a position selected from the group consisting of 48. (14) A DNA construct comprising a yeast gene promoter and a gene for a tissue plasminogen activator located in yeast such that the plasminogen activator gene is under the control of said promoter. (15) The DNA construct according to claim (14), wherein the promoter is selected from the group consisting of a triosephosphate isomerase promoter and an alcohol dehydrogenase I promoter. (16) Plasmid pDR505, pDR1005, p
The DNA construct according to claim 14, comprising a DNA sequence of a plasmid selected from the group consisting of DR1496, pDR1497, pDR1498 and pDR1499. (17) Claim No. 1 further includes a leader sequence located between the promoter and the gene.
4) DNA construct described in section 4). (18) Leader sequence is ¥MF¥α1, ¥PH05¥,
The DNA construct according to claim (17), which is derived from a yeast gene selected from the group consisting of \SUC2\ and \BAR1\ genes. (19) D according to claim (17), wherein the leader sequence is derived from the pre-pro region of the human tPA gene.
NA construct. (20) The DNA construct according to claim (14), which comprises a glycosylation site coding sequence in which the tissue plasminogen activator gene is mutated. (21) The coding sequence is Gln-X-(^S^e^
r_T_h_r), and the Gln codons are present in codons 117, 184, and 21 in the plasminogen activator gene.
8 and 448, the DNA construct according to claim 20. (22) A transformed strain of yeast comprising the DNA construct according to claim (14). (23) Saccharomyces cerevisiae
omycescerevisiae) according to claim (22).