JPS62285786A - Hybrid promoter and production of foreign protein using same - Google Patents

Abstract

PURPOSE:To produce a foreign protein with a yeast, by integrating an SV40 virus-originated enhancer into a yeast promoter and utilizing the obtained hybrid promoter. CONSTITUTION:A miniaturized yeast promoter free from UAS region is prepared by depleting a region above a restriction enzyme site Bs+EII positioned about 70 bp about TATA box of pH05 promoter or by depleting a region above a restriction enzyme site XmmI positioned about 20 bp above TATA box of GAP-DH promoter. The obtained yeast promoter is linked with an SV40 virus enhancer with T4 ligase to construct a hybrid promoter. HBsAg or Pre S- HBsAg is produced by using said promoter, a pBR322 derivative as a basic vector and a yeast Saccharomyces cerevisiae as a host.

Description

Detailed Description of the Invention 3. Detailed Description of the Invention (Field of Industrial Application) The present invention relates to a hybrid promoter and a method for producing a heterologous protein by yeast using the promoter, and more specifically, to an enhancer derived from the SV40 virus. The present invention relates to a hybrid promoter that is incorporated into a yeast promoter, and a method for producing a heterologous protein in yeast using the hybrid promoter.

[Prior art]

Many attempts have been made to make yeast produce foreign proteins using genetic engineering techniques. In these examples, the transcription side of the target gene? P from yeast as III'pM region
HO5”, GAP-DH2ゝ, PGK”.

Promoter regions such as a-1';' a c t or' are used.Generally, in yeast, RNA
Does the promoter region where polymerase ■ acts exist from the translation start point to the region containing the transcription start point and TATA box and 5' upstream of this region, and functions in cis to promote transcription? ■Area (UAS: up
stream activation 5ite) 2
UAS has been shown to promote the transcription of specific genes under the action of factors that function in trans between bacterial cells6).

In addition, UAS moves from the translation start site to the transcription start site and TATA.
This UA works independently of the region containing the box.
7' can be released from the original control system by replacing S with the UAS of another gene.

It has been revealed that enhancers exist in the transcriptional control regions of animal cells and animal virus genes as regions that function in cis and exhibit transcriptional promoting effects (S).

The enhancer of the SV40 virus has been shown to function in African green monkey kidney cells, CO3 cells, and He1a cells.

Although it is not clear whether this SV40 enhancer functions in yeast, it has been shown that a region of homology exists in the yeast Ty element12+.

Conventionally, yeast-derived promoter regions have been used to produce foreign proteins in yeast. This may be due to the risk that undesirable phenomena such as some sort of control or recombination may occur due to the host yeast.

References (expressed in the original language for the convenience of those skilled in the art) 1) include:
Murray et al., EMBOJ, 3(
3), 645-650°+84 2) G, A, Bitter & K, M, Egan,
Gene, 32+263-274. '84 3) C, Y., Chen et al., Nucl.
Ac1d Res, 12(23).

8951-8970. '84 4) A, J, Brake eL al,, Proc.
, Natl, Acad, Sci.

Needle, 4642-4646. '845) L, Gu
arente, Ce1l, 36.799-,
'846) E, Giniger et al, C
e11. ao, 767-774+'857)
L, Guarente et al, +P
'roc, Natl, 8cad, Sci,.

Yuzuru, 7410-, '82 L, Guarente et al,, Cel+,
36+ 503-, '84, 5truhl,
Proc, Natl, Acad, Sci, 81
+7865-, '84 8) G, Khoury &t P, Gruss,
Ce1l, 33.313-314°+83 9) D, H, I (amer & P, Leder,
Nature, 281 + 3510) trump
hr + es et al, + Ce1l, , qo,
173. '8211) J, Banerji et.
al,, Ce1l, 27. 299. '811
2) B. Errede et al.
Proc, Nam1. Acad, Sci.

82, 5423-5427. '85 [Problems to be Solved by the Invention] In order to develop a system for efficiently producing large quantities of foreign gene products using yeast promoters, we first assembled an enhancer other than yeast into a yeast promoter. As a result of constructing a hybrid promoter containing a hybrid promoter and examining the expression of a foreign gene in yeast, it was found that (1) the amount of foreign protein produced was increased compared to when the original promoter was used, and (2) the present invention was completed.

[Means for solving problems]

The present invention relates to a yeast promoter, preferably a hybrid promoter constructed by replacing the UAS region having a transcription promoting effect with an enhancer region of the SV40 virus, and the hybrid promoter,
and D encoding a heterologous fluorescent substance bound downstream of
This is a method for producing a heterologous protein, which is characterized by transforming yeast using an NA sequence.

Removal of the UAS II region from the yeast promoter.

Restriction enzyme with unique recognition site or Ba13
Using an exonuclease such as 1, it is carried out from several 10 heses 5' upstream of the TATA box.

The PHO5 promoter described in Reference Example 1 is the promoter region of the gene (PHO5) encoding yeast-inhibitory acid phosphatase, and its promoter activity is suppressed when inorganic phosphate is present in the medium, and promoted with lack of inorganic phosphate. It is known that Therefore, P.H.
When using the O5 promoter, it is necessary to use a phosphate-free medium or to use a host yeast that has a mutation in the PHO5 control system and in which the PHO5 promoter can function constitutively. The UAS region was removed from the PHO5 promoter by removing the region upstream from the restriction enzyme BstEII recognition site located approximately 70 b upstream 5' of TATAbox.

Figure 1 shows the base sequence of the miniaturized PHO5 promoter.

Furthermore, the GAP-DH promoter in Example 2 is the promoter region of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAP-DH), which constitutes the yeast glycolytic system, and its promoter activity is It functions constitutively between. The UAS region was removed from the GAP-DH promoter by removing the region upstream from the restriction enzyme Xmm1LT2 recognition site located approximately 20 b upstream 5' of TATAbox. Figure 2 shows a miniaturized GAP
-The base sequence of the DH promoter is shown.

The transcription control region of the SV40 virus is known, and the plasmids carrying it are also known and can be purchased from commercial sources (eg, Pharmacia, etc.). S.V.
As the SV40 enhancer region, a region containing the 72b repeat structure, which is an early enhancer, can be used, and this can be extracted from a plasmid carrying the SV40 transcriptional control region using an appropriate known restriction enzyme.

FIG. 3 schematically shows the SV40 transcription control region.

The regulatory enzyme recognition sites are also shown.

A hybrid promoter can be constructed by ligating this enhancer region to the aforementioned miniaturized yeast promoter from which the yeast UAS-containing region has been removed by DNA ligase treatment.

By inserting the gene encoding the protein of interest downstream of the hybrid promoter thus constructed, a recombinant plasmid was obtained, and yeast was transformed and expressed to efficiently produce the protein of interest. I can do it.

PH of yeast promoter used in Examples of the present invention
O5 promoter, couminator and GAP-D
The H promoter and terminator are isolated by the methods shown in Reference Examples 1 and 4.

In addition, in one embodiment of the present invention, the product of the hybrid promoter is hepatitis B virus surface antigen (HBsAg).
and p consisting of 55 amino acids at the N-terminus of HBSAg.
PreS-HBsAg with an attached reS region was used.

It is hypothesized that the mechanism by which HB virus invades hepatocytes is via polyalbumin receptors on HBV, polyalbumin, and polyalbumin receptors on hepatocytes. The polyalbumin receptor is included in the PreSpi region of the HB virus, and therefore, HBsAg that has the PreSl region (PreS-HBsAg) is expected to have higher antibody production ability for humans than HBsAg that does not have this region, and in vitro. There are reports that it is actually high (Neurath, A, R, et al.
al,, 5science 224+ 392-395
, 1984).

HBsAgii! The DNA sequences of the gene and the PreS-HBsAg gene are all known, and the plasmids carrying them are also known. The inventors have discovered that HBsAg
The gene and PreS-HBsAg gene are also old og
It was prepared from PreS (Fig. 4.6) obtained from En. The restriction enzyme map of the PreS-HBsAg gene is
Shown in Figure 0. The subtype of HBsAg used in the present invention is adyw type.

The vector used in the present invention is a vector that contains a yeast gene and an E. coli gene, and carries a hybrid promoter consisting of an SV40 enhancer region and a miniaturized yeast promoter.

The vector carries genes that serve as markers for transformed E. coli and transformed yeast, for example.

Ampicillin resistance gene, 2-isopropyl malate
Suitably carries a dehydrogenase gene, etc.

The yeast to be transformed includes a mutant strain 1 having a mutation complemented by a selection marker gene carried by the inserted plasmid, such as Saccharomyces cerevisiae, which is a leucine auxotrophic mutant strain.
cerevisiae) A H22(a,
h±soil4. Mutual △ and 2. It is also possible to use a wild strain as a host by using a drug resistance gene such as transposon 903 as a marker. The obtained transformed strain is cultured in a known medium suitable for the host. Examples of the medium include YNB liquid medium [
0.7°% Yeast NitrogenBase (
Difco), 2% glucose] is preferably used. Culture is usually carried out at 15 to 32°C for 20 to 50 hours,
Aeration and stirring can be performed if necessary. After culturing, the bacterial cells are collected by a known method such as centrifugation, suspended in a suitable buffer solution, for example, treated with ultrasonic waves, and then the supernatant is collected by centrifugation. The target HBsAg and PreS-HBsAg are produced in this supernatant, and the target substance can be purified, for example, by an immobilized column using a monoclonal antibody or affinity chromatography using a hydrophobic group.

It should be noted that many techniques used in the present invention 1 reactions and analytical methods are well known in the art. Unless otherwise noted, all enzymes were obtained from commercial sources such as Takara Shuzo; New England, Biolapse (NEB) (New En
grand Biolabs (NEB) ), ?
Sachusetts, USA; Amersha
m) + United Kingdom and Bethesda Research Laboratories (Bethesda Research Laboratories)
tories (BRL)), Merriland 1 UK;
It can be obtained from Boehringer Mannheim Yamanouchi.

Buffers and reaction conditions for enzyme reactions were used according to the manufacturer's recommendations for each enzyme unless otherwise specified.

Methods for transforming E. coli using phages, transforming E. coli using plasmids, plaque hybridization, electrophoresis, and DNA recovery from gels are described in "
"Molecular Cloning" Cold Spring Harbor Laboratory ("Shame-1")
g J Co1d Spring Harbor L
Laboratory (1982).

Yeast transformation method is "Method in Yeast Genetics" Cold Spring Harbor Laboratory
(rMeLhod in yeast Ganetic
sJ ) (Cold Spring Harbor L
Laboratory (1981).

〔Effect of the invention〕

The thus obtained hybrid promoter consisting of the SV40 enhancer region and the miniaturized yeast promoter enables efficient production of a foreign protein gene operably connected to the downstream thereof, compared to the case where the native yeast promoter is used. This resulted in an increase in production. Furthermore, in the case of a hybrid promoter using the PHO5 promoter, which originally functions repressively, as a miniaturized yeast promoter, it functioned constitutively within the yeast cells because the region that promotes transcription of PHO5 was removed. In addition, among the promoter regions, the region derived from yeast is 1/
Because it was able to be downsized to 3 to 115.

It is thought that the frequency of recombination with the chromosome by the host yeast will decrease, and it is expected that the expression of foreign genes will become more stable.

[Reference example/Example]

Reference examples will be described below to explain the present invention in detail, but the present invention is not limited thereto.

Reference example 1. Cloning of yeast PHO5 gene and P) (05 promoter) in Saccharomyces cerevisiae (Saccharo II
Icescerevisiae), Cryer (C
Yeast chromosomes were extracted according to the method of D. ryer et al.
,R.

Cryer et al., Method in C
e1l Biology (Acade-mic Pr
ess)), vol, XU, 39.1975
).

Next, based on the report of Meyhack et al.
The HO5 gene was cloned [Bee, Maher]
7 Rira (B, Meyhack et al,), EM
BOJ, 1.675°1982). That is, the obtained yeast chromosome was treated with a restriction enzyme Dando mH! Digested, 0.8%
After agarose gel electrophoresis, DN around 5.1 kb
The recovered DNA was inserted into the Bam81 site within the polylinker sequence of pUc9, and E, co
li 118101 was transformed. Colony hybridization was performed on the obtained transformants using a synthetic polynucleotide as a probe. Colony hybridization method is Molecular Clo
ning (supra). As a result, plasmid (pUcPh
o) was prepared, and the inserted fragment was recovered by mHI digestion.

pJDB20? It was then recloned into the amH1 site.

Using this, Satucharomyces cerevisiae AH22 (
S. Cerevisiae AH22) was transformed.

PHO5 activity (inhibitory acid phosphatase activity) was confirmed by the method of Toe et al. [Toe et al.

Journal Bacteriology (Toh-e, Aet
al, J, Bacteriol, ) 113.727.
(1973) - Plasmid pUCPho, which was positive for inhibitory acid phosphatase activity, was transfected with amHI-
After digestion, 1% agarose electrophoresis was performed, and 3.9k
The b fragment was recovered.

This was integrated into the Doku H1 and oRV sites of pBR322 to obtain plasmid pA·P 5 (8 kbp).

Reference example 2. Construction of HBsAg expression plasmid using PHO5 promoter (Fig. 4) After pAP5 was digested with Doku Hr--Dan11, it was subjected to 4% polyacrylamide gel electrophoresis (hereinafter referred to as PAGE).
A PHO5 promoter fragment (0,6'2 kb) containing the ATG codon of PHO5 was obtained. This was inserted into the amHI-ΣT1 site within the polylinker sequence of pUC9 to obtain pUP26.

In addition, pAP5 was digested with 3AI, the ends were repaired with DNA polymerase I (Klino) (manufactured by Boehringer Mannheim), and then Pstl was digested with 4% P.
A PHO5 terminator fragment (0.37 kb) was obtained by AGE (polyacrylamide gel electrophoresis).

DNA polymerase I after 5alt digestion of p[JP26
(Klino), and then the PHO5 terminator fragment was inserted into the 1±1 digested product to obtain pUP26t. pUP26t with BamHI-H
The product was digested with iUdl[r and a 0.99 kb fragment containing the PHO5 promoter and terminator was recovered by 4% PAGE. This 0.99kb fragment was converted into pJDB207Ba
Once mHI was integrated into the du+1 site, pcL203
I got 1.

Plasmid pPreS containing the PreS-HBsAg gene obtained from Biogen was completely digested using restriction enzymes xbat (Takara Shuzo) and BanU (NEB), and HBs was purified by 1.5% agarose gel electrophoresis.
1. Contains sAg gene. A DNA fragment consisting of 1 kb was obtained. After partially digesting pGL2031 with the restriction enzyme AhaI (manufactured by Takara Shuzo), it was subjected to 0.8% agarose gel electrophoresis, and pGL2031 cut at one site was recovered. This pGL2031 fragment contains the previous 1.1k
After repairing the ends of the HBsAg gene fragment consisting of b using DNA polymerase I (Clino), the integrated p
GL2062 was created.

Reference example 3 - Creation of pGP3Hr pGP3Hr was created by the procedure shown in FIG.

After completely digesting pGL2062 with the restriction enzyme Hindfl [(manufactured by Takara Shuzo), we further digested it with the restriction enzyme Saβ! (
(Takara Shuzo) and 2.45 kb containing the PHO5 promoter, HBsAg gene and PHO5 terminator was determined by 1% agarose gel electrophoresis.
A 6°3 kb fragment corresponding to the fragment and part of the vector was obtained. Connect both ends of the 2.45kb fragment with all four dNTPs.
DNA polymerase in the presence! (Klino) (manufactured by Boehringer Mannheim) to restore blunt ends, and then a psa11 linker (manufactured by Takara Shuzo) was connected using T4 ligase (manufactured by Takara Shuzo). Add this restriction enzyme BstEI
After complete digestion with I (manufactured by NEB) and repairing both ends as before, the pH1ndIII linker (manufactured by Takara Shuzo) was digested with T
4 ligase. This was completely digested with HindIII and Sal■ and subjected to 0.8% agarose gel electrophoresis. As a result, the region upstream from the BstE■ recognition site was removed, resulting in a smaller PHO5 promoter with a new Hind■ cohesive end at the 5' end, and a 1.73 kb cohesive end with a 5alI cohesive end 3' downstream of the PHO5 terminator. A fragment was obtained. This 1.73k
The b fragment and the previous 6.3 Kb vector fragment were ligated using T4 ligase to obtain pGP3Hr.

Reference example 4. Yeast GAP-DH gene and GAP-DH
Cloning of Promoter A DNA having the yeast GAP-D II gene sequence was prepared from yeast chromosomal DNA as follows.

Yeast Saccharomyces cerevisiae (Saccharo-
m ces Cerevisiae) GRF 18p
From ho80 (z, leu+shikus, met, sukehihin), C.R. Cryer (C0R0Cr
yer) et al. “Method in Cell Biology J
(rMethod in Ce1l Bio-1og
Chromosome D according to the method of Vol. 18, Section 3, p. 39, Academic Press, New York (1975).
NA was prepared. This chromosomal DNA is digested with restriction enzyme Hin.
Lambda phage charon28 (b1007.
154, NIN5) DNA. T4 for connection
Ligation was performed by reacting overnight at 16° C. using DNA ligase (manufactured by Takara Shuzo Co., Ltd., same hereinafter) according to the recommended method. The same method was used for DNA ligation described below. After puff caging the ligated DNA using an in vitro puff caging kit (manufactured by Amersham), E. coli strain LE392 (F-, hsd
R514 (ri+-mm-).

Earth and E44. Earth and F58. Both earth and Yl.

l1 each other 2, 11 each other T22. From Koumi 1. E1R55
，! 2) and obtained 40,000 plaques.

The pancaging method was performed according to the method recommended by Amersham, and the infection with E. coli was carried out using Molecular
Cloning (described above).

Screening was performed by fixing these 40,000 plaques on a nitrocellulose filter and hybridizing them with synthetic NA labeled with 32p (plaque hybridization method). Plaque hybridization method is MolecuLar Clo
ntng (described above). As a result, two phages that were strongly hybridized and had identical restriction enzyme mappings were obtained.

By completely digesting this phage DNA with HindI[I, a 2.1 kb yeast chromosome-derived DNA fragment was prepared.

This 2. IKb HindI
ligated using E. coli strain 88101 (Danji).

hsds20 (rs-, ms-), recA13
゜Soil L knee 14, 1 kiln A2. N Midan Yl, ■ Ee K
2. Ll upper L 20 (Sm'), 51L-5゜work ±1-1. Uni and E44. Suni) was transformed.

Performed recloning. The E. coli plasmid transformation method was performed according to Molecular Cloning (described above). The plasmid obtained by recloning was named pGAP301 FIG. 6(A).

Reference example 5. Construction of PreS-HBsAg expression vector GAP for expressing PreS-HBsAg in yeast
- Plasmid vector pGG using DH promoter
503 was constructed as shown in FIGS. 6(A) and (B). This will be explained below according to FIG.

G, by completely digesting pGAP301 DNA using TaqI (manufactured by NEB) and separating it by electrophoresis.
AP-D) GAP- of 652 bp from -676 to -25 when the base of the translation start point of the I gene is +1
A DNA fragment was prepared from the DH promoter region.

DNA polymerase this DNA fragment! (Clinaw)
(Poi'l) (manufactured by Bates Ngermannheim) and all four types of dNTPs (deoxyNTPs)
The sticky ends were changed to blunt ends. This DN
The A fragment was ligated to pUC9 completely digested using Smar (manufactured by Takara Shuzo Co., Ltd.) using T4 DNA ligase in the direction shown in the figure. The plasmid obtained by transforming E. coli HBIOI with this DNA was named pGG2.

Next, pGAP301 was added to 5aiN (manufactured by Takara Shuzo Co., Ltd.).

A 140 bp DNA fragment containing the terminator sequence of the GAP-DH gene was prepared by complete digestion using H4ndl [[ (manufactured by Takara Shuzo Co., Ltd.) and separation by electrophoresis. In addition, pGG2 DNA was digested using 5aJl (manufactured by Takara Shuzo Co., Ltd.) and ) (indl[I), and a 3.4 Kbp DNA fragment was prepared by electrophoresis.
The DNA fragment and the 140 bp DNA fragment were ligated using T4 DNA ligase (manufactured by Takara Shuzo Co., Ltd.), and the resulting plasmid was named pGG3.

The adgw type PreS-HBsAg gene has its DNA
From the sequence, there are four single translation start codons (ATG) (
Figure 10). The polyalbumin receptor region is HBsA
The third AT of the PreS gene is connected to the N-terminus of g.
G (3rdATG'). Therefore, pPreS was combined with the restriction enzyme Mstl [(manufactured by NEB) and B
3rdPreS-HBsA was completely digested using an1I (manufactured by NEB) and subjected to 1% agarose gel electrophoresis.
A DNA fragment of 1.4 Kb containing the g gene was obtained.

A DNA fragment obtained by completely digesting pGG3 DNA with 5affl (manufactured by Takara Shuzo Co., Ltd.) and a 1.4 Kb fragment containing HBsAg were ligated using 74DNAIJ gauze (manufactured by Takara Shuzo Co., Ltd.), and the resulting plasmid was transformed into pGG40 (Fig. 6 (B)). It was named.

In order to express the HBsAg gene in yeast, it is desirable that HBsAg be present on DNA that self-replicates in yeast, but pGG40 cannot self-replicate in yeast. Therefore, E. coli/yeast shuttle vector 1) JDB21
9 (J.D. Besogus, Neich+ -(J,
D, Beggs+ Nature)+275,
I O4, 1978) DNA was completely digested with )(indl[r to prepare a 3.2 Kbp DNA fragment. pcG
40 was completely digested using Hindl[I, and 3.2K
bpDNA fragments and T4 DNA ligase are used to ligate the
pGG503 was created.

Reference example 6. Creation of pGG7Br (Figure 7) pGG503
After complete digestion with restriction enzyme Xmn I (manufactured by NEB), pBglU linker (manufactured by Takara Shuzo) was connected using T4 ligase. After this was completely digested with 1indll, the ends were repaired with DNA polymerase 1 (Clino), and then further digested with restriction enzyme Bgg [(Takara Shuzo Co., Ltd.)].
It was completely digested. This was also subjected to 1% agarose gel electrophoresis, and as a result, the region upstream from the XmnI recognition site was removed.

A miniaturized CAP-DH promoter with a new Bgln cohesive end at its 5' end and 3rdPreS-H
A 1.95 Kb DNA fragment consisting of the BsAg gene and GAP-DH terminator was obtained.

pJDB207) (completely digested with indllr, D
After repairing the ends with NA polymerase (Klino), Bg! was added using T4 ligase. ! Connected the U linker. Saj this! Completely digested with I.

The ends were repaired using DNA polymerase I (Klino) and then completely digested with BgfI. This was subjected to 0.8% agarose gel electrophoresis to obtain a vector fragment consisting of 6.3 Kb. This 6.3 Kb vector fragment and the above 1.
The 95 Kb fragment was ligated with T4 ligase to obtain pGG73Br.

Example 1゜ Plasmid pL purchased from Pharmacia.

was completely digested with restriction enzymes) (indllI and Xhol (manufactured by Takara Shuzo) and digested with 4% PAC;
I got a piece of it. This was further treated with restriction enzyme Ne.

■ (manufactured by Boehringer Mannheim) for complete digestion.

A 239bp fragment containing the SV40 early enhancer was obtained.
End repair was performed with DNA polymerase I (Klino).

pGP3Hr) (completely digested with ndlll, then end-repaired with DNA polymerase I (Klino) to create a 239 bp fragment containing this and the SV40 early enhancer.
The fragments were ligated using T4 ligase. As a result, the SV40 early enhancer was inserted in the early direction relative to the transcription direction of the HBsAg gene.
3HrSV and pGP inserted in the 1ate direction
3HrSVt was obtained (Fig. 8).

Next, pGL2062, 1) GP3Hr, pGP3HrS
The yeast Saccharomyces cerevisiae (Saccharomyces cerevisiae)
m cescerevisiae) AH22(a,
h±s4. 2°C A') was transformed.

Additionally, using pGL2062, S. cerevi
siaeGRF18 pho80 (α, his,
leu.

trp, met, pho80) were transformed.

The obtained transformants were plated on a minimal medium plate containing no leucine (0.7% Yeast
Nitrogen Ba5e) (Difco),
2% dextrose, 1.5% agar).

Each purified strain was incubated at 30℃2 in the above minimal medium (excluding agar).
80ml of the same minimum medium as preculture after shaking culture for 1 day.
1 was inoculated at 1% and cultured at 30°C for 2 days. Bacteria were collected by centrifugation, washed once with physiological saline, and then washed with buffer (50mM Tris-
llcl pH 7,5, 1mM EDTA, 1mM
The temperature was adjusted to PMSF). This buffer solution was treated for 9 minutes at level 10 under water cooling using an ultrasonic generator uR-200p manufactured by Tomy Seiko Co., Ltd., and then treated at 0'c, 13,0OOx.
g HB of the supernatant obtained after centrifugation for 10 minutes. 9 A
g activity was measured using Antihebcell@ (manufactured by Midori Juji Co., Ltd.).

Table 1゜pGP3Hr” 3pG
P3HrSV, ” >10
pGP3HrsVt >t.

Example 2゜Similarly to Example 1, pLI was added to Hindllr and Xh.
or by complete digestion and 4% PAGE.

A 354 bp fragment containing the SV40 early enhancer was obtained. This was subjected to end repair using DNA polymerase I (Klino).

After completely digesting pGG73Br with BglIl, the DNA
The ends were repaired using polymerase I (Klino), and this and a 354 bp fragment containing the SV40 early enhancer were ligated using T4 ligase. As a result, the SV40 initial enhancer was 3rdPreS-HBsA.
pGG73BrSV inserted in the early direction with respect to the direction of transcription of the g gene, and pGG73BrSV inserted in the 1ate direction were obtained (FIG. 9).

Next, pGG503. pGG73Br, pGG7313
The yeast Saccharomyces cerevisiae (Saccharomyces cerevisiae) was grown using rS Ve and PGG73BrSVt.
cescerevisiae AH22 (a, h±
s4. leu 2゜Dochitate 1) was transformed. The obtained transformants were plated on minimal medium without leucine (
0.7% yeast night diene base (Yeast
NiLrogen Ba5e) (Dirco),
2% dextrose, 1.5% agar).

Each purified strain was incubated at 30℃2 in the above minimal medium (excluding agar).
80ml of the same minimum medium as preculture after shaking culture for 1 day.
1 was inoculated at 1% and cultured at 30°C for 2 days. Bacteria were collected by centrifugation, washed once with physiological saline, and then washed with buffer solution (50mM Tris
-Hcl pH7,5, 1mM EDTA, 1mM P
MSF). This buffer solution was cooled with water using an ultrasonic generator UR-200p manufactured by Tomy Seiko Co., Ltd.
After treatment at 0°C for 9 minutes, 13. OOOXg1
The HBsAg activity of the supernatant obtained by centrifugation for 0 minutes was measured using Anti-Hepcell@ (manufactured by Midori Juji Co., Ltd.). In addition, polyalbumin receptor activity was measured using the RPHA reagent in which sheep red blood cells were sensitized with polyalbumin.

Plasmid HBsAg activity Polyalbuminle (2
') Scepter activity (2'') pGG503 7 6pGG
73Br 3 2pGG73
BrsV, 98pGG73
Brsν, 9 8

[Brief explanation of the drawing]

Figure 1 shows the miniaturized PHO5 promoter, Figure 2 shows the miniaturized GAP-DH promoter, and Figure 3 shows I) a schematic diagram of the SV40 Hatsuho transcription control region carried by L+, restriction enzyme recognition sites, and Figure 4 is. Construction of HBsAg expression plasmid using the PHO5 promoter of Reference Example 2, Figure 5 shows pGP3H of Reference Example 3.
Figure 6 (A) and (B) are PreS of Reference Example 5.
- Creation of HBsAg expression vector, Figure 7 shows creation of pcG73Br of Reference Example 6, Figure 8 shows pG73Br of Example 1.
Creation of P3HrSV or pGP3HrSVL, Figure 9 shows pGG73BrSV or pGG73B of Example 2.
FIG. 1O shows the restriction enzyme map of the PreS-HBsAg gene carried in pPreS. Explanation of symbols B: GAP-DH promoter representative patent attorney (8107) Kiyotaka Sasaki (and 2 others) Figure 1 GTCACCTTACTTGGCA to GGCATATA
CCCATTTGGTATAAGCGCTGATGTT
TTGCTAAGTCGAGGTTAGTATGGCzuAGCAAATTCGAGATTACCA Procedural Amendment 118W61D°1OMonth 15th

Claims (8)

[Claims] (1) A hybrid promoter in which an enhancer derived from the SV40 virus is incorporated into a yeast promoter. (2) Yeast promoter is yeast glyceraldehyde-3
- phosphate dehydrogenase (GAP-DH) promoter or yeast repressible acid phosphatase (PHO5
) The hybrid promoter according to claim (1), which is a promoter. (3) The hybrid promoter according to claim (2), wherein the GAP-DH promoter or the PHO5 promoter is miniaturized. (4) A method for producing a heterologous protein, which comprises transforming yeast using at least a hybrid promoter in which an enhancer derived from the SV40 virus is incorporated into the yeast promoter, and a DNA sequence encoding the heterologous protein linked downstream thereof. . (5) Yeast promoter is yeast glyceraldehyde-3
- phosphate dehydrogenase (GAP-DH) promoter or yeast repressible acid phosphatase (PHO5
) A method for producing a heterologous protein according to claim (4), which is a promoter. (6) The method for producing a heterologous protein according to claim (5), wherein the GAP-DH promoter or PHO5 promoter is miniaturized. (7) Hepatitis B virus surface antigen (HBs) is a heterologous protein.
Ag) or HBsAg containing the PreS region (PreS-
HBsAg), the method for producing a heterologous protein according to claim (4). (8) The method for producing a heterologous protein according to claim (7), wherein the PreS region consists of at least 55 amino acids starting from the third ATG site of the region.