CN1027179C - Method of using bari for secreting foreign proteins - Google Patents
Method of using bari for secreting foreign proteins Download PDFInfo
- Publication number
- CN1027179C CN1027179C CN86107554A CN86107554A CN1027179C CN 1027179 C CN1027179 C CN 1027179C CN 86107554 A CN86107554 A CN 86107554A CN 86107554 A CN86107554 A CN 86107554A CN 1027179 C CN1027179 C CN 1027179C
- Authority
- CN
- China
- Prior art keywords
- bar1
- gene
- plasmid
- fragment
- promotor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/62—Insulins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/58—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from fungi
- C12N9/60—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from fungi from yeast
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/50—Fusion polypeptide containing protease site
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
- C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Mycology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Endocrinology (AREA)
- Diabetes (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
A method for producing a foreign protein in a host organism whereby the protein is processed through the secretory pathway of the host. Production and processing is achieved by transforming the host organism with a vector comprising at least the signal peptide coding region of the yeast S. cerevisiae BAR1 gene fused to a foreign structural gene. DNA constructs and transformants are also provided containing a region of the BAR1 gene encoding the signal peptide and a KEX2 processing site, and a foreign structural gene. In particular, proinsulin is expressed and secreted from Schizosaccharomyces pombe and Saccharomyces cerevisiae.
Description
The application is that the serial number of submitting on October 25th, 1985 is the follow-up application of 791,305 applications.
The present invention relates to new dna structure, this structure contains the structure gene that signal peptide part and at least one and host cell with described gene transformation have nothing to do of translating of cereuisiae fermentum (Saccharomyces Cerevisae) BAR1 gene at least.Remove to transform host living beings with such structure and can cause expressing a kind of elementary expression product, this product comprises by the structural protein that are fused to the heterogenous gene coding on the BAR1 signal peptide, and the result can make this albumen by the Secretory Pathway processing of host cell and from the secretory host cell to the substratum or in the periplasmic space.
Various protokaryons and eukaryotic microorganisms have been used as can not be by the host of the spontaneous xenogenesis polypeptide of host by the production of DNA recombinant technology.People have special interest to the various fungies in the eukaryote, comprise saccharomyces cerevisiae, pear wine yeast (Schizosaccharomyces Pombe), Eurotium (Aspergillus) and arteries and veins born of the same parents bacterium (Neurospora).Especially many work have been done to belonging to blastogenesis zymic saccharomyces cerevisiae.With a suitable dna structure such as plasmid transformed yeast cell, can make its expression be included in heterogenous gene in this plasmid.Yet, the major limitation of this technology is that under many occasions, host cell can not be secreted into this protein product in the medium, so must broken these cells, and under the situation that does not make its sex change or inactivation from the cellular constituent of various pollutions the desirable protein of purifying.So hope can guide these transformant secretions can simplify the xenogenesis product of product purification step.In addition, wish that some protein enter into the Secretory Pathway of host cell so that carry out suitable post-treatment, promptly form disulfide linkage.
The known beer yeast is secreted the protein of some natural generations, still, about the knowledge of this process be very limited by comparing known to bacterium and the mammalian cell secretory protein.As if the yeast protein that great majority are secreted out all be the enzyme that remains on periplasmic space, but saccharase and acid phosphorus esterase also may with cell wall-bound.The known protein that is secreted in the substratum by saccharomyces cerevisiae comprises splice information element (α-factor and a factor), lethal toxin and the protein that causes Barrieri activity (hereinafter to be referred as " Barrier ").Pass the secretion that cell walls enters in the medium and be also referred to as " output ".The mating type α cell of saccharomyces cerevisiae produces the α-factor that is secreted in the substratum, and a cell produces two kinds of secrete polypeptides, the a-factor and the Barrier factor.The gene of α-factor has carried out clone, sequencing and analysis (seeing Kurjan and Herskowitz, Cell30: 933-943,1982).Signal peptide (a kind of be considered to the short peptide sequence that cell guiding is secreted a kind of attachment protein matter), homing sequence (Leader Sequence) (comprising a polypeptide precursor that downcuts from sophisticated α-factor) and translate gene order (comprising promotor and regulatory region) from α-factor non-and can be used for guiding the secretion that yeast, produces foreign protein (people such as Brake, ProcNatlAcadSciUSA81:4642-4646,1984).As if the expression of α-factor is regulated by MAT α 1 gene product, and α-factor precursor is processed into sophisticated protein needs for two steps at least, and thinks to be under the control of STE13 and KEX2 gene.
Compare with α-factor, the Barrier factor is seemingly glycosylated based on it and concanavalin A bonded ability.The Barrier factor is to be produced by a cell, and it is expressed seemingly under the control of MAT α-2 gene.Except possible signal peptide cutting, do not show the processing of Barrier factor precursor so far, and think that the expression of STE13 and the KEX2 gene and the Barrier factor is irrelevant.
Owing between the expression of the α-factor and Barrier factor control and processing above-mentioned difference is arranged, people can't determine in advance that in these yeast genes that is more suitable for guiding and secrete a specific foreign protein.Because these two kinds of protein are seemingly processed by different Secretory Pathways, so wish to utilize the feature of Barrier factor excretory system.
Therefore, an object of the present invention is the dna structure that will provide such, it contains the BAR1 gene fragment of coded signal peptide at least, also comprise an external structure gene, it can produce a kind of foreign protein after expressing in the microorganism host, this foreign protein is processed by the Secretory Pathway of host cell.
Another object of the present invention provides in a kind of microorganism host expresses heterogeneic method, produces one by this genes encoding and foreign protein or its part of being processed by the Secretory Pathway of this host cell.
Another object of the present invention provides a production method from a kind of microorganism host secretion foreign protein.
Further aim of the present invention provides a method that produces foreign protein by the DNA recombinant technology.
Another object of the present invention provides a protein that has the aminoacid sequence of proinsulin human and Regular Insulin by the production of DNA recombinant technology.
These purposes and some other purpose will be become obviously by following description to specific embodiments and claim.
The present invention relates to dna structure and the method for utilizing them, these structures include the signal coding sequence of cereuisiae fermentum BAR1 gene at least, the structure gene that at least one is different with host living beings, and in the host living beings of the fusion rotein that contains BAR1 signal peptide and this foreign protein, control expression promoter.
In the accompanying drawings:
Fig. 1 represent elementary translational product the BAR1 gene nucleotide sequence and by its deutero-aminoacid sequence.Add black line under MAT α 2 combining sites and mark, the signal peptide cutting part of inferring represents that with an arrow possible glycosylation position marks with an asterisk;
Fig. 2 is the synoptic diagram of plasmid pZV9;
Fig. 3 has represented the structure of plasmid p254;
Fig. 4 has represented the structure of plasmid pZV30, pZV31, pZV32 and pZV33;
Fig. 5 A and 5B have represented the structure of plasmid pZV50;
Fig. 6 has represented the structure of plasmid m115;
Fig. 7 has represented the structure of plasmid pZV49;
Fig. 8 has represented to contain the structure of the plasmid pZV134 of TPI1 promotor;
Fig. 9 has represented the subclone of MF α 1 a gene part;
Figure 10 has represented the structure of plasmid pZV75;
Figure 11 has represented to contain the structure of the plasmid of TPI1 promotor and BAR1-MF α 1 fusion sequence;
Figure 12 has represented the structure of plasmid pSW22;
Figure 13 has represented to have the plasmid construction of BAR1-MF α 1 fusion sequence;
Figure 14 has represented the structure of pZV100;
Figure 15 has represented the structure of plasmid pZV102;
Figure 16 has represented the structure of plasmid pSW96;
Figure 17 has represented the structure of plasmid pSW97;
Figure 18 has represented the structure of plasmid pSW98 and pSW99, and △ is illustrated in the sudden change at codon 25 places.
Term " dna structure " comprises plasmid with referring to any dna molecular here, and it passes through human intervention in some way by modified, so that the sequence of the nucleotide sequence in this molecule and natural generation is different. Term " dna structure " also comprises the clone of the dna molecular of such modified. Term " expression vector " and " expression plasmid " are defined as so a kind of dna structure, and it comprises that transcription initiation position and at least one are coded in the structural gene of the desired protein of expressing in the host living beings. Expression vector also comprises promoter and terminator codon like this fragment and the origin of replication of some expression of control desired protein in host living beings usually. Expression vector of the present invention also comprises a selected marker usually, for example has gene or a nutrition mark of antibiotic resistance.
Term " dna structure " also will be thought and comprises the expression vector part of integrating with host chromosome.
Term " plasmid " has its common meaning, i.e. a dna structure that is generally the energy self-replicating of closed loop.
Term " signal peptide " refers to the part in the elementary translational product, and it can import this product in the secretory pathway of the cell that produces it. In this course, signal peptide is cut from the remainder of this nascent polypeptide by a signal peptidase usually. The feature of signal peptide is to have a hydrophobic amino acid core, and appears at the aminoterminal of this nascent polypeptide translational product, normally about 17 to 25 amino acid of length. The position that signal peptide cuts is by Von Heinje(Eur.J.Biochem.133:17,1983) did to describe in detail. Term " signal peptide " can also refer to the funtion part of naturally occurring signal peptide when using here.
The invention provides the guiding transformant by the method for secretory pathway guiding foreign protei, the method is to finish by comprising with yeast BAR1 gene or having at least the heterogeneic dna structure conversion host that the part of BAR1 signal peptide coding is connected. The protein of processing can be secreted in periplasmic space or the culture medium like this. The BAR1 gene code of yeast has the factor of Barrier activity, and it is considered to a kind of glycosylated protein by a emiocytosis of saccharomyces cerevisiae. The G1 that the Barrier factor of this secretion can make maqting type a cell overcome and be caused by α-factor suppresses. This Barrier factor may be a kind of protease (seeing Manney, J.Bacteriol., 155:291-301,1983). Transcribing by α-factor of BAR1 gene promoted. In α or a/ α cell, can't detect the Barrier factor or similarly active, and the BAR1 gene is not transcribed in the cell of these types.
Fig. 1 has provided the sequence around 2750 base-pairs of BAR1 gene, and this figure has also represented the amino acid sequence of the elementary translational product of deriving thus together. The ATG rotaring intertranslating start position of BAR1 is on 681 of about 2.75 kilobase fragments shown in Figure 1, (Nasmyth and Tatchell, Cell, 19:753-764,1980) that this fragment is a fragment subcloning will obtaining from the Yeast genome library. The translating an of opening read the ATG codon of code from+1 and begun, and extends 1761 base-pairs along 3 ' direction. As if initial 24 amino acid sequences of the elementary translational product of BAR1 similar with mammiferous signal peptide sequence to known yeast. Like this, the alanine on the 24th can be used as a cleavage site, as at yeast invertase and acid phosphorus esterase. Cutting also can occur in after the 23rd amino acid. In elementary translational product, have at least nine possible glycosylation positions that are connected with asparagine to exist, but the degree of glycosylation of the Barrier factor of this oozy maturation is not clear. The promoter of BAR1 gene and regulatory region are arranged in apart from the zone of rotaring intertranslating start password 5 ' about 680 base-pairs of end. Found the function of complete promoter and the reaction that the α-factor stimulates has been positioned near the ATG of non-about 680 base-pairs of translating the district of 5 ' end.
There is the password of a cleavage site junction that dna structure of the present invention is preferably in the Barrier factor and foreign protei. Desirable this site is the KEX2 cleavage site, it is can be by the amino acid sequence of the identification of KEX2 gene outcome and the cutting of saccharomyces cerevisiae people such as (, Cell37:1075-1080,1984) Julius. The KEX2 site is to as feature take the basic amino acid as lysine and arginine. The sequence in KEX2 site is Lys-Arg or Arg-Arg preferably. The elementary translational product of this BAR1 includes two such basic amino acids pair in its structural area: at the Arg-Arg on the 177-178 position and the Lys-Lys on the 404-405 position. As previously described, the KEX2 gene does not relate to the processing of the protein precursor of this Barrier factor, and this shows these potential Processing positions owing to conformation or the glycosylation of protein are blocked, and further shows The bright this Barrier factor usually can be by processing albumen such as the used approach processing of α-factor that is different from KEX2. Yet, the applicant finds, comprise into a KEX2 Processing position in a part (containing its signal peptide part) by comprising the elementary translational product of BAR1 gene and the fusion of desired protein, at this fusion of KEX2 site cutting, will cause the secretion of desired protein. Also find to comprise by reduction the signal peptidase cutting efficiency of the fusion Barrier factor of KEX2 cleavage site, can improve the output level of desirable proteins. The KEX2 cleavage site can be provided by BAR1 sequence or required gene, perhaps can be by adding connexon or importing by site-specific mutagenesis.
So according to the present invention, a part that comprises the BAR1 gene of ATG initiation codon and signal coding sequence can be connected with required heterogenous gene, and is transformed in a kind of eukaryotic host cell.Resultant fusion gene will comprise processing site, preferably a KEX2 cleavage site at BAR1 and external sequence junction.Such structure also can comprise from the regulatory region and the promotor of BAR1 gene 5 ' end non-coding region, perhaps can comprise regulatory region and/or promotor from other gene.Except promotor from the BAR1 gene, other utilizable promotor comprises from the gene of the ethanol dehydrogenase I of cereuisiae fermentum or alcoholdehydrogenase, those genes of cereuisiae fermentum glycolytic pathway, as the TPI1 promotor, and the corresponding gene that obtains by other bacterial classification, comprise fusion yeast pear wine yeast (Russell and Hall, J.Biol.Chem., 258:143-149,1983; Russell, Nature, 301:167-169,1983).The ethanol dehydrogenase I gene of cereuisiae fermentum was described (Methods in Enzymology, 101:192-201,1983) in detail by Ammerer.Oneself is described (J.Biol.Chem., 258:2674-2682,1983) by people such as Russell the alcoholdehydrogenase gene.The glycolysis-gene of cereuisiae fermentum is by the Kawasaki(Ph D dissertation, University of Washington, 1979), people (J.Biol.Chem. such as Hitzeman, 225:12073-12080,1980), Kawasaki and Fraenkel(Biochem.Biophys.Res.Comm.108:1107-1112,1982) and Alber and Kawasaki(J.Biol.Appl.Genet.1:419-434,1982) made description.
The encoding sequence of BAR1 gene signal peptide is modified preferably in the embodiment at one, to reduce the efficient of the Barrier factor in the fusion rotein that its signal peptidase cutting contains the KEX2 cleavage site.This can be by making those potential cleavage sites, and particularly these positions of (Barrier factor protein matter sequence) amino acid 23-24 junction or amino acid 24-25 junction are carried out site-specific mutagenesis and realized.
The method that is used to form dna structure of the present invention only relates to conventional technology.The most handy single promotor control of BAR1 structure gene or its part and the structure gene that will be expressed, the connection of dna fragmentation had a large amount of the description, and was within the ordinary skill ability in related technology fully.Treat any substantially protein DNA of dna encoding sequence of marking protein, particularly resemble Interferon, rabbit, Regular Insulin, proinsulin, α-1-antitrypsin, somatomedin and organize the profibr(in)olysin activation factor that like this some have the protein of commercial significance.
Behind the dna structure of preparing the structure gene that contains BAR1 gene or its part and will express, this structure can be transformed in the host living beings under conversion condition.The technology that transforms prokaryotic cell prokaryocyte and eukaryotic cell (comprising mammalian cell) is known in the literature.
Host cell is a bacterial strain of blastogenesis yeast saccharomyces cerevisiae preferably, but, also other fungi be can utilize, fusion yeast pear wine yeast and filamentous fungus nidulus shape aspergillus tubigensis (Aspergillus nidulans) and arteries and veins born of the same parents bacterium (Neuroprora spp) comprised.
Below, as an example rather than as the restriction, provide some examples.Unless otherwise indicated, all be the molecular biology method of employing standard from start to finish.Restriction enzyme is obtained by Bathesda research laboratory, New England's biology laboratory and Beehringer-Mannheim Biochemics Inc., and according to the explanation of manufacturers, generally uses with pancreatic ribonuclease (10 mcg/ml).T
4Dna ligase is obtained by Bethesda research laboratory or Boehrmger-Mannheim company, and uses according to explanation.M13 and pUC host strain and carrier obtain from the Bethesda research laboratory.M13 presses Messing(Methods in Enzymology, 101:20-77,1983) method described clones.Archaeal dna polymerase I (Klenow fragment) is pressed the method for people (Molecular Cloning:ALaboratory Manual, Cold Spring Harbor Laboratory, 1982) descriptions such as Maniatis and is used.Intestinal bacteria (E.Coli) culture transforms by people's such as Bolirar method (Gene, 2:95-113,1977).The saccharomyces cerevisiae culture transforms according to the method (Nature275:104-108,1978) by Mackay improved (Methods in Enzymology 101:325,1983) Baggs.The pear wine yeast is pressed Russell(Nature 301:167-169,1981) described method transforms, plain α-the factor of splice information is passed through by improved (the J.Cell Biol.96:1592-1600 of people such as Manney, 1983) people's such as Duntze method (Eur.J.Biochem.35:357-365,1973) preparation or buy from sigma chemical company, oligonucleotide is gone up synthetic at one " 308A of applying biological system type DNA synthesizer ", and carries out purifying by polyacrylamide gel electrophoresis on denaturant gel.
Method
The mensuration of Barrier factor active
Being used to detect method that the Barrier factor of transformed yeast cells produces depends on the Barrier factor and reverses the cytostatic ability of responsive type a that contacts with α-factor.Test strain is a kind of because not producing the Barrier activity to the unusual responsive bacterial strain of α-factor, as bacterial strain RC629(MATa bar1).Utilization is layered on the lawn of this bacterial strain preparation in the soft agar on the agar plate.α-the factor (Manney uses 0.05-0.1 unit when measuring, and ibid) of q.s is added on this top layer to suppress the growth of these cells.Then, will screen the transformant point of the Barrier factor on this lawn.Around this point, reversed the growth-inhibiting effect of α-factor immediately by the transformant excretory Barrier factor, thereby made these sensitive cells regeneration.Can be observed the normally level and smooth edge of these regenerative cells round the transformant lawn, this annular exists and shows that the plasmid that transforms in the bacterial strain has guided the expression and the secretion of the Barrier factor.
IRI and IRC detection method
The commercialization complete sets of instrument that utilization obtains from the Nuo Wa industrial of Denmark Bagsvaerd carries out IRI and IRC detects.Detect with anti-pork insulin of cavy and the anti-people C-peptide antibody of cavy.
IRI measures
50 microlitres are at the NaFAM(0.04M phosphate buffered saline buffer, and pH7.4 contains bovine serum albumin(BSA)) in sample
50 microlitre antibody (mother liquor dilutes with 1:30)
In 4 ℃ of following 16-24 hours
50 microlitre 125I-Regular Insulin (with dilution in 1: 100)
Following 2 hours in 4 ℃
1% the streptococcus aureus of 50 microlitres in NaFAM
Following 45 minutes in 0 ℃
Use 1%BSA/TNEN
*Washed twice
Count precipitation centrifugal back
These different steps can be carried out on microtiter plate easily, then precipitation are transferred in the scintillation vial.
IRC measures
The sample of 50 microlitres in NaFAM
50 microlitre antibody (mother liquor was with dilution in 1: 50)
In 4 ℃ of following 16-24 hours
50 microlitre 125I-C peptides (mother liquor was with dilution in 1: 30)
In 4 ℃ of following 2-4 hours
1% the streptococcus aureus of 50 microlitres in NaFAM
Following 45 minutes in 0 ℃
Use 1%BSA/TNEN
*Washed twice
Count precipitation centrifugal back
*TNEN is 20mM Tris pH8.0
100mN NaCl
1mM EDTA
0.5% NP-40
The mensuration of α-factor active
The method that is used to detect the α-factor output of transformed yeast cells has utilized α-factor to suppress the ability of responsive type a cell growth.Comprising one in the BAR1 gene of test strain (as cereuisiae fermentum RC629 bacterial strain (MATabarl)) prevents to produce the Barrier activity and makes the cell sudden change responsive especially to α-factor.Form a lawn of this test strain in the soft agar on synthetic substratum (for example the lacking leucic substratum) flat board of the yeast selectivity of standard.With the transformant point of α to be screened-factor output to this lawn, and 30 ℃ of insulations down.Can cause that by transformant excretory α-factor the lawn growth that is close to this periphery of bacterial colonies is suppressed.This growth inhibiting halo in the test cell lawn shows that this bacterium colony is being exported active alpha-factor.Relatively the size of halo makes us can estimate relative populations by the α-factor of each transformant output.
Example 1 utilizes BAR1 gene expression of insulin in cereuisiae fermentum former
Utilize people such as shuttle vectors YEp13(Broach, Gene8:121-133,1979) make up the recombinant plasmid storehouse (Nasmyth and Tatchell, Cell19:753-764,1980) that comprises whole yeast genes groups.Among the YEp13 that will degrade by the cerevisiae dna fragment insertion Bam HI that part Sau3A degraded produces.(MATa leu2-3 Leu2-112bar 1-gal2: deposit numbers ATCC20679), selection leucine prototroph transformant is also cultivated under the α-factor concentration that suppresses a bar1 cell to remove to transform cereuisiae fermentum XP635-10C bacterial strain with this plasmid storehouse.From the bacterium colony that produces, filter out the bacterial strain that to secrete the Barrier factor again.Find two bacterium colonies, they promptly have the ability that leucine independence has the secretion Barrier factor again, and these bacterium colonies carry the plasmid that is called pBAR2 and pBAR3.
To be used for transformed into escherichia coli RRI bacterial strain (deposit numbers ATCC3 1343) from the plasmid DNA that these two transformants are separated.Selection has the transformant of resistance to penbritin.Purification plasmid pBAR2 and pBAR3 from the intestinal bacteria transformant, and with the restriction enzyme enzyme liberating and on agarose or acrylamide gel electrophoresis differentiate.Plasmid pBAR2 shows the skewer section that comprises about 9.2 kilobase.The intestinal bacteria RRI that transforms with plasmid pBAR2 has been deposited at ATCC, and deposit numbers is 39410.
Subclone shows that pBAR3 plasmid skewer section contains the part of pBAR2 skewer section, but locatees with opposite direction in this carrier.Further the secretion of the Barrier factor is cloned and screened, the BAR1 gene order that works is positioned in the zone of about 2.75 kilobase.This fragment has comprised encoding sequence, non-transcription sequence of translating, promotor, regulatory region, has transcribed and move the chromosome sequence that ends district and both sides.
With restriction enzyme Hind III and Xho I dissimilation plasmid pBAR2, by the fragment of about 3 kilobase of agarose gel electrophoresis purification.This fragment skewer is advanced among the plasmid pUC13 that degrades with Hind III and Sal I.Obtain being called pZV9(Fig. 2) recombinant plasmid, available its transformed into escherichia coli, but but lack the selective marker of essential replication orgin and yeast vector.Plasmid pZV9 in intestinal bacteria RRI transformant has been deposited at ATCC, and deposit numbers is 53283.
During with the secretion of BAR1 gene guiding proinsulin, adopt the BAR1 gene fragment that contains 5 ' end regulatory region and a part of encoding sequence.Read sign indicating number and on the point that the fusion polypeptide that makes final generation on the BAR1 sequence can be cut, carry out BAR1 and the segmental fusion of proinsulin gene in live body in suitable translating.It all is possible cutting part that several sites are arranged in the BAR1 gene, the Arg-Arg conduct on the selection 177-178 position and the test site of proinsulin fusion.Therefore, with the Hind III-segmental form of Sal I of 1.9 kilobase, the 5 ' end of purifying out from plasmid pZV9 is regulated the BAR1 encoding sequence of sequence and about 800 base pairs.
With reference to Fig. 3, it has shown the method for people's preproinsulin cDNA being carried out subclone.BCA clone before people's the preproinsulin cDNA() P27 is to go into to carry out the DNA that has the C-tail end that reverse transcription forms by the whole RNA to the human pancreas and produce with the pBR327 of the Pst I degraded that has the G-tail end and skewer.Plasmid pBR327 was done to describe by people such as Soberon (Gene9:287-305,1980), and people's preproinsulin was reported by people such as Bell (Nature232:525-527,1979).The complete sequence of translating is cut into Nco I-Hga I fragment.Two outstanding ends are filled out with archaeal dna polymerase I (Klenow fragment), and connect synthetic EcoR I connexon (GGAATTCC) and Xba I connexon (CTCTAGAG) simultaneously.With this fragment subclone to (Vieire and Messing, Gene19:259-268,1982) and Messing among the pUC13 of EcoR I and Xba I cutting, Meth.in Enzymol.101:20-77,1980).Owing to add an EcoR I connexon and recovered Nco I site (CCATGG) on initiation codon at 5 ' end, therefore the screening both sides have the skewer section of 340 base pairs in EcoR I, Nco I and Xba I site in plasmid.Plasmid with these character is called p47, as shown in Figure 3.Proinsulin (BCA) fragment with a tack 5 ' end is given birth to people such as (, Nuc.Acids Res.9:6103-6114,1981) Lawn by the primer repair of plasmid p47 is synthetic.Then produce the fragment of one 270 base pair, with its skewer (Vieira and Messing, the same and Messing, the same) in pUC12 with the degraded of Xba I.By filling and leading up end, prepare carrier with cutting of Xba I and gel-purified with the cutting of Hind III with archaeal dna polymerase I (Klenow fragment).The result obtains containing the carrier segments of a blunt tip and an Xba I sticky end, and it is connected on the BCA fragment recited above.Because sophisticated BCA is from phenylalanine (codon TTT), these two the segmental blunt nosed junctions that are connected produce a Hind III site again.At first screening has recovered the plasmid in Hind III site, utilizes M13 sequencing primer to measure the sequence of passing through the junction then and screens plasmid.Plasmid p254 has correct sequence.
With reference to Fig. 4, with Hind III and EcoR I degraded p254 plasmid, with the purify proinsulin fragment of about 270 base pairs of gel method.These segmental two ends are filled and led up with archaeal dna polymerase I (Klenow fragment) and deoxynucleoside triphosphate.Use T
4Polynucleotide kinase and γ-32-P-ATP treatment S al I connexon sequence (GGTCGACC) is connected to it on the proinsulin fragment of passivation again.With Sal I and the degraded of BamH I, then electrophoresis on 1.5% sepharose obtains a proinsulin fragment with Sal I and BamH I sticky end.
The BAR1 fragment of this proinsulin fragment with 1.9 kilobase is connected on the pUC13 that degraded with Hind III and BamH I.This structure is used for transformed into escherichia coli K12(JM83).
Filtering out has resistance and produces the transformant of white colony penbritin.Further screen by the degraded of carrying out restriction enzyme with Hind III, BamH I and Sal I, identify one and contain the Hind III-BamH I fragment of suitable size and the plasmid (pAV27) in single Sal I site.
On this possible processing site of Arg-Arg that insulinogenic first amino acid is connected to the BAR1 gene product, the skewer of removing in BAR1-proinsulin fusions is gone into material.As the synthetic oligonucleotide of following utilization this additional substance is removed from closed hoop.With reference to Fig. 4,, and merge fragment with the purify BAR1-proinsulin of about 2.2 kilobase of gel with Hind III and BamH I dissimilation plasmid pZV27.Then, this fragment skewer is gone among the rf phage vector M13mp11 that degraded with Hind III and BamH I (Messing, Meth.in Enzymology 101:20-77,1983).Infect e. coli k12 (JM103) (Messing, the same) with this recombinant DNA.Discharge the plaque of white, and filter out rf recombinant phage with correct restriction map by two enzyme liberating of Hind III+Sal I and Sal I+BamH I.A structure that shows desired collection of illustrative plates is called mp11-ZV29.With γ-32P-ATP and T4 polynucleotide kinase to Oligonucleolide primers (sequence: 3 ' GGATCTTCTAAACACTTG5 ') mark.Then, the kinases primer of 7.5 pmols is combined with 80 nanogram(ng) M13 sequencing primers (Bethesda research laboratory).Make this mixture annealing form the mp11-ZV29 of 2 microgram sub-threads.Then, it is such to be used for oligonucleotide guiding mutagenesis (two primer method) as people such as Zoller (" senior molecule clone technology handbook, Cold Spring Harbor Laboratory, 1983), uses T
4Dna ligase and archaeal dna polymerase I (Klenow fragment) are extended second strand.Infect e. coli k12 (JM103) with the DNA that in this way produces, and screen plaque as probe people such as (, the same) Zoller with the oligomer that intensifies.The plaque that comes out with such knowledge prepares phage replication type (RF) DNA(Messing, and is the same).The degraded of the Restriction Enzyme of RF DNA identifies to have suitable Xba I restriction map (fragment of 7.5 kilobase, 0.81 kilobase and 0.65 kilobase) and lacks a Sal I restriction site two clones of (it is present in the removal zone of BAR1-proinsulin fusions).
The RF DNA that is obtained by these two clones degrades with Hind III BamH I, is purified by gel by the fusions fragment of each 1.9 kilobase that obtain.These fragments are connected on the pUC13 and YEp13 carrier that Hind III BamH I degraded (people such as Broach, Gene8:121-133,1979).With the pUC/BAR1-proinsulin hybrid plasmid transformed into escherichia coli K12(JM83 that is used for carrying out sequencing subsequently).Two in these plasmids are called pZV32 and pZV33.With YEp13 deutero-recombinant chou transformed into escherichia coli RRI(Nasmyth and Reed, Proc.Nat.Acad.Sci.USA., 77:2119-2123,1980).Two in these plasmids are called pZV30 and pZV31(Fig. 4).
The sequencing of pZV32 and pZV33 carries out according to the method (Meth.in Enzymology, 65:57,1980) of MaXam and Gilbert., the BAR1-proinsulin is merged fragment carry out sequencing to the Sau961 site that is positioned at 3 ' end (at proinsulin gene) about 140 base pairs from the Bg1 II site that is arranged in apart from the junction about 190 base pairs of 5 ' end apart from the junction.Data acknowledgement by these experiments obtain has made up the fusions between needed BAR1 and the proinsulin gene.
Transform cereuisiae fermentum XP635-10C bacterial strain with plasmid pZV30 and pZV31.In lacking leucic standard yeast synthetic medium, cultivate 1 liter of culture.After 34 hours, α-factor is added in the aliquots containig of 10 milliliters of various cultures.Add after 11 hours, by centrifugal collection culture.Detect Regular Insulin and insulin analog with cell precipitation and supernatant liquor.Twice mensuration that the supernatant liquor of the culture that transforms with plasmid pZV31 is carried out shows that 3 pmol IRI materials and 5.8 pmol IRC materials are arranged in every milliliter of substratum.IRI is Regular Insulin, proinsulin or its degradation product of correct folding.IRC is free C-peptide, the proinsulin of incorrect folding or its degraded product.
Example 2
Utilize ethanol dehydrogenase I promotor, BAR1 gene and triosephosphate isomerase terminator expression of insulin in cereuisiae fermentum is former.
Tested cereuisiae fermentum ethanol dehydrogenase I promotor (back is called ADH I promotor, and people claim that also it is an ADC I promotor), utilized it to guide external polypeptide expression in abutting connection with the BAR1 sequence.Made up the plasmid that comprises these sequences.
Plasmid pZV50(Fig. 5 B) comprises cereuisiae fermentum ADH I promotor, terminator (Alber and the Kawasak of above-mentioned BAR1-proinsulin fusion sequence and cereuisiae fermentum triosephosphate isomerase (TPI1) gene; J.Molec.Appl.Genet.1:419-434,1982).It makes up in the following manner.Referring to Fig. 5 A, with Hind III and BamH I dissimilation plasmid pAH5(Ammerer, ibid), with the ADH I promoter fragment of gel-purified 1.5 kilobase.Utilize T
4Dna ligase, with this fragment in the plasmid pBR327 that inserts from Hind III-EcoR I polymerization connexon fragment of pUC13 with EcoR I, the degraded of BamH I.The plasmid called after pAM5 that obtains makes its degraded, the ADH I promoter fragment of about 0.4 kilobase of purifying on 2% sepharose with SPh I and Xbz I.With Xba I dissimilation plasmid pZV9, use similar gel method then, purifying contains the BAR1 fragment of about 2,000 carbon backs of whole BAR1 coding region.These two fragments of ADH I promotor and BAR I sequence are connected with the YEp13 that degrades with Xba I, Sph I, to produce plasmid pZV24.With Sph I and Bgl II degraded pZV24, carry out gel-purified then, then produce the fusion sequence of the ADH I promotor-BAR1 of about 800 base pairs, it includes ATG rotaring intertranslating start password, but the password in the potential Arg-Arg processing site of not encoding.Plasmid pZV33 contains BAR-1 proinsulin fusion sequence, with Bg1 II and Xba I it is degraded, and purifying contains the fusion fragment (about 500 base pairs) of Arg-Arg codon then.
Referring to Fig. 6, from plasmid pEG1(Alber and Kawasaki; Ibid) in obtain the TPI1 terminator.With EcoR I degraded pEG1, with archaeal dna polymerase I (Klenow fragment) the plasmid end of line styleization is filled and led up, add BamH I connexon sequence (CGGATCCA) then.With degrade this fragment and connecting again of BamH I to produce plasmid p136.From p136, be purified into the TPI1 terminator of 700 base pairs with Xba I-segmental form of BamH I.This fragment is inserted among the YEp13 that degrades with Xba I, BamH I, cut with the Hind III then, fill and lead up end, and connect again to produce plasmid p270 with archaeal dna polymerase I (Klenow fragment).In p270, be purified into the TPI1 terminator, insert then among the pUC13 that degrades with Xba I, BamH I to produce plasmid m115 with Xba I-segmental form of BamH I.
Referring to Fig. 5 B, by Xba I and the degraded of Sst I, from plasmid m115, downcut the TPI1 terminator, carry out gel-purified then.With following three fragments, promptly people such as (, Gene, 26:101-106,1983) Norrander inserted in the plasmid pUC18 of degrading with Sph I and Sst I in ADHI-BAR1 fusion sequence, BAR1-proinsulin fusion sequence and TPI I terminator.With this DNA transformed into escherichia coli K12 bacterial strain (JM83), screening has amicillin resistance and produces the transformant of white colony, is accredited as to have required slotting section plasmid (pZV45).Then, with Sph I and BamH I dissimilation plasmid pZV45, with gel-purified ADH I-BAR1-proinsulin-TPI terminator sequence.This fragment is inserted among the YEp13 that degraded with Sph I and BamH I, to produce cereuisiae fermentum expression vector pZV50.
Transform cereuisiae fermentum XP635-10C bacterial strain with plasmid pZV50, cultivate the back and as described in example 1, detect.Do not find the IRI material in the substratum, the IRC material in every milliliter is less than 0.5 pmol.The cell extract of 0.1% Nonidet (Nonidet) P-40 shows, contains the IRC material of 1 pmol in every ml cells extract.
Example 3
Utilize BAR1 gene and pear wine yeast alcohol dehydrogenase promoter expression of insulin in pear wine yeast (Schizosaccharomyces Pombe) former.
The explanation of this example utilizes the partial sequence in the BAR1 gene, the secretion of the external polypeptide that guiding is expressed in the pear wine yeast host who transforms.Made up a kind of plasmid that pear wine yeast alcohol dehydrogenase (ADH) gene promoter and BAR1-proinsulin fusion sequence are combined.
From the dna fragmentation library that derives from pear wine yeast 972h bacterial strain (ATCC 24843), obtain pear wine yeast ADH promotor, it is cloned into (J.Biol.Chem.258:143-149,1983) among the YEp13 according to Russell and the described method of Hall.Sph I-segmental form of EcoR I with 0.75 kilobase from the library is purified into promoter sequence.EcoR I-Hind III polymerization connexon fragment of this fragment and pUC12 is connected with the YEp13 that degraded with Sph I and Hind III.The gained plasmid is called pEVP-11.
The structure of the yeast expressed carrier of pear wine is referring to Fig. 7, to be purified into the ADH promotor with Sph I-segmental form of Xba I among the pEVP-11.With Xba I and Bgl II dissimilation plasmid pZV33, the BAR1 fragment that comprises the ATG initiation codon of about 340 base pairs of purifying then.With Bg1 II and Sst I degraded pZV33, the insulinogenic fusion sequence of purifying BAR1-.These three fragments are combined, to produce plasmid pZV46 with the pUC 18 that degraded with Sph I, Sst I.Because pUC18 can not transform the pear wine yeast effectively, therefore must make this plasmid carry out twice pair of enzyme liberating.From Hind III+Bg1 II degraded, be purified into ADH promotor-BAR1 and merge fragment, from Bgl II+Xba I degraded, be purified into BAR1-proinsulin fusion sequence.These fragments are inserted among the YEp13 that degraded with Hind III, Xba I, thereby produced the saccharomycetic expression vector pZV49 of pear wine.
Example 4
Utilize BAR1 signal peptide output alpha factor
Tested the ability that the BAR1 signal peptide guides alpha factor to export from the yeast conversion body.Made up several kinds of plasmids, they contain coding and have the proteic fusion rotein of BAR1 of different lengths and the dna fragmentation of 1 or 4 ripe alpha factor copy.These plasmids are transformed in the a/ α diploid host strain go, the alpha factor that detects transformant by halo detection method (halo assay) generates.
Plasmid pSW94, pSW95, pSW96 and pSW97 contain the copy of 355 base pairs of cereuisiae fermentum triosephosphate isomerase (PTI1) promotor, BAR1 gene or 767 base pair fragments (114 or 251 codons that comprise BAR1 encoding sequence 5 ' end respectively) and or four alpha factor (MF α 1) encoding sequence.Table 1 has been listed their structure.
Table 1(bp: base pair)
Plasmid BAR1 fragment alpha factor
4 copies of pSW94 355bp
4 copies of pSW95 767bp
1 copy of pSW96 355bp
1 copy of pSW97 767bp
PM220(is also referred to as pM210 with plasmid) as the source of TPI1 promoter fragment.The intestinal bacteria RRI that transforms with pM220 has been deposited at ATCC, and deposit numbers is 39853.With EcoR I dissimilation plasmid pM220, separate the fragment of 0.9 kilobase contain the PTI1 promotor by agarose gel electrophoresis, fill and lead up end with archaeal dna polymerase I (Klenow fragment).On fragment, add activatory Xba I connexon, degrade with Bgl II and Xba I then.Then this is connected to through TPI1 promoter fragment of modifying in the Bgl II-Xba I carrier segments of 3.4 kilobase of pDR1107 and goes, to produce pZV118.The structure of plasmid pDR1107 is (Marsh.Erfle and Wykes, Gene32:481-485,1984) of finishing by among the Bgl II-EcoR I TPI1 promoter fragment subclone pIC7 with 900 base pairs of pM220, has so just produced plasmid pDR1101.With Hind III and Sph I dissimilation plasmid pDR1101, with the part fragment of the TPI1 promotor of separating 700 base pairs.Plasmid pDR1100 contains the Xba I-BamH I TPI1 promoter fragment of 800 base pairs of the pM220 of subclone in the pUC18, with Hind III and Sph I it is cut.The part fragment of the TPI1 promotor of 700 base pairs is connected with the pDR1100 of line styleization, thereby produces pDR1107.
Then, destroy the EcoR I site of TPI1 promotor 3 ' end among the pZV118.With Hind III and EcoR I this plasmid of degrading, separate the fragment of 0.9 kilobase and it is linked to each other with a synthetic connexon, this connexon is by making oligonucleotide ZC708(5 ' AATTGCTCGAGT3 ') and ZC709(3 ' CGAGCTCAGATC5 ') annealing makes up.Add connexon and removed the EcoR I site of TPI1 promoter fragment 3 ' end, and added the Xba I site of Xho I.Then this fragment is joined with the PUC13 that cuts with Hind III-Xba I.The plasmid called after pZV134(Fig. 8 that obtains).
Kurjan and Herskowitz described the cloning process (ibid) of the plain alpha factor of yeast combining information (MF α 1).This laboratory has been separated this gene with similarity method from the segmental yeast genes group of Sau3A part library, this library is (Nasmyth and TaTchell, Cell19:753-764,1980) that are cloned in the BamH I site of YEp13.Being separated to such plasmid in this library, it can be in the yeast diploid bacterial strain mat α 2-34 mutant that isozygotys the express alpha factor (people such as Manney; J.Cell.Biol, 96:1592,1983).Kurjan and Herskowitz find, this clone contain one with superimposed slotting section of MF α 1 gene.This plasmid is called pZA2, separates the fragment of 1.7 kilobase that contain MF α 1 after degrading with the EcoR I, is connected to then among the pUC13 of EcoR I cutting.The plasmid called after p192 that obtains carries out separating after the cracking MF α 1 fragment of 1.7 kilobase that produced with the EcoR I.Degrade with the Mbo II then.Separate the Mbo II-EcoR I fragment of 550 base pairs and link to each other with activatory Sal I connexon.The fragment that connects with Sal I cutting.The Sal I fragment of resulting 0.3 kilobase is linked to each other (Vieiva and Messing, Gene19:259-268,1982) with the pUC4 of Sal I cutting, thus the plasmid (Fig. 9) of generation called after p489.
Make up then and contain BAR1(114 codon) and the fusion gene of MF α 1 part encoding sequence.With Sph I and Bgl II dissimilation plasmid pZV24(example 2), separate the ADH I promotor-BAR1 fragment of 0.8 kilobase.With BamH I cracking plasmid p489 and separate MF α 1 fragment of 0.3 kilobase.These two fragments are linked to each other with the YEp13 of three sections ways of connecting with Sph I+BamH I cutting.The plasmid called after pZV69(Figure 11 that obtains).
Made up second fusion gene, its encoded 251 Barrier amino acid and link to each other with the part of alpha factor precursor.Plasmid pZV16 contains the pZV9(example 1 among the pUC13 that is connected the cutting of Xba I+Sal I) 767 base pair Xba I-Sal I BAR1 fragment, degrading with the Sal I makes its line styleization.The fragment that makes this 4.0 kilobase links to each other with 0.3 kilobase Sal I fragment from four alpha factor copies of coding of p489.The plasmid called after pZV71 that on correct orientation, has BAR1-MF α 1 syzygy.BAR1-MF α 1 syzygy from pZV71 is linked to each other with ADH I promotor then.With Xba I and Pst I dissimilation plasmid pZV71 and separate the fragment of 1.07 kilobase.Sph I-segmental isolated in form of Xba I with 0.42 kilobase from pZV24 goes out ADH I promotor.With three sections ways of connecting these two fragments are connected among the pUC18 of Sph I+Pst I cutting.With the plasmid pZV73 that Sph I and the degraded of BamH I obtain, separate the fragment of 1.5 kilobase that contain ceneme, and it is connected among the YEp13 of Sph I+BamH I cutting, thereby form pZV75(Figure 10).
For the convenience of operating, will merge unit with TPI1 subclone in pUC18 (Figure 11) from the BAR1-MF α 1 of pZV69 and pZV75.With EcoR I and BamH I dissimilation plasmid pZV69, separate the fragment that contains 0.55 kilobase that merges part.By degrading, from pZV118, isolate the TPI1 promoter fragment of 0.9 kilobase with Hind III and EcoR I.With BAR1-MF α 1 fragment of 0.55 kilobase, pUC19 three parts of the TPI1 promoter fragment of 0.9 kilobase and Hind III and the cutting of BamH I couple together.The plasmid called after pSW59 that obtains.With EcoR I and BamH I dissimilation plasmid pZV75, merge fragment with the BAR1-MF α 1 that separates 954 base pairs.This BAR1-MF α 1 fragment is connected with the Hind III+EcoR I TPI1 promoter fragment of 0.9 kilobase and the pUC18 of Hind III+BamH I cutting with three sections ways of connecting, thereby produces plasmid pSW60.
In the structure of expression plasmid, the source of BAR1 encoding sequence 5 ' terminal 116 base pairs is pSW22, and it makes up (Figure 12) with following method.BAR1 coding region among the pSW22 derives from pZV9.With Sal and BamH I cutting plasmid pZV9(example 1) to isolate the BAR1 fragment of 1.3 kilobase.With this fragment subclone in the pUC13 of Sal I and BamH I cutting, thereby produce the plasmid of called after pZV17.With EcoR I dissimilation plasmid pZV17 to remove 0.5 kilobase of the end in BAR1 coding region 3 ' hold.Carrier-BAR1 fragment is connected to produce the plasmid of called after pJH66 again, make plasmid pJH66 line styleization and fill and lead up end with the Klenow fragment with the EcoR I.Add BamH I activatory connexon (5 ' CCGGATCCGG3 '), before connecting again, degrade to remove superfluous connexon with the BamH I.The plasmid that obtains is pSW8, cuts to separate the fragment of amino acid whose 824 base pairs of coding BAR1252-525 with Sal I and BamH I.This BAR1 fragment is merged mutually with the fragment of C-terminal portions of coding Substance P (Munro and Pelham, EMBO J.3:3087-3093,1984).Plasmid pPM2 obtains from Munro and Pelham, and it contains the synthetic oligonucleotide sequence of the dimeric forms of Substance P among the coding M13mp8.Make plasmid pPM2 line styleization with BamH I and the degraded of Sal I, and it is linked to each other with the BAR1 fragment of 824 base pairs.With Sal I and the Sma I degraded plasmid pSW14 that obtains, to separate the BAR1-Substance P fragment of 871 base pairs.With Xba I and Sal I cutting plasmid pZV16(Figure 10) with the encoding sequence of 767 base pairs that separate BAR15 ' end.The BAR1-Substance P fragment of this fragment and 871 base pairs is linked to each other with the pUC18 that cuts with Xba I and Sma I with three sections mode of connection.The plasmid called after pSW15 that obtains.With Xba I and Sma I dissimilation plasmid pSW15 to separate the BAR1-Substance P fragment of 1.64 kilobase.Obtained ADH I promotor from pRL029, it comprises the Sph I-EcoR I fragment of 0.54 kilobase, wherein contains APH I promotor and from 116 base pairs of the BAR15 ' end coding region of pZV24 among the pUC18.With SPh I and Xba I dissimilation plasmid PRL029 to separate the ADH I promoter fragment of 0.42 kilobase.Xba I+segmental form of EcoR I with 0.7 kilobase among the pUC18 provides TPI1 terminator (Alber and Kawasaki, J.Mol.Appl.Gen.1:419-434,1982).The line style fragment that will contain the TPI1 terminator and the pUC18 of Xba I end with Klenow filling and Sph I end is with three sections ways of connecting, be connected with the ADH I promoter fragment of 0.42 kilobase and the BAR1-Substance P fragment of 1.64 kilobase, thereby produce plasmid pSW22.
Make up plasmid pSW94(Figure 13 then).From plasmid pSW22, go out the fragment of 2.3 kilobase, wherein contain BAR1-Substance P fusion sequence and TPI1 terminator with Xba I-segmental isolated in form of Sst I.To from pZV134, link to each other with BAR1-Substance P-TPI1 terminator fragment together with the pUC18 that cuts with Hind III+Sst I with three sections ways of connecting by isolated Hind III-Xba I TPI1 promoter fragment.Obtain plasmid pSW81 with Hind III and EcoR1 cracking, to isolate the fragment of 1.02 kilobase that contain TPI1 promotor and BAR15 ' end 116 base pairs.Merge fragment with BamH I cutting plasmid pSW59 with the BAR1-MF α 1 that separates 0.55 kilobase with the EcoR I.Then with three sections ways of connecting, with this fragment be connected with YEp13 from TPI1 promotor-BAR1 fragment of pSW81 with Hind III+BamH I line styleization, thereby produce plasmid pSW94.
Figure 13 has illustrated the structure of pSW95.Merge fragment with BamH I cutting plasmid pSW60 with the BAR1-MF α 1 that separates 954 base pairs with the EcoR I.Cut plasmid pSW81 to separate the TPI1 promotor-BAR1 fragment of 1.02 kilobase with Hind III and EcoR I,, it is merged fragment with BAR1-MF α 1 be connected with the YEp13 that cuts with Hind III+BamH I together then with three sections ways of connecting.The plasmid called after pSW95 that obtains.
TPI1 promotor-BAR1-MF α 1 fusion constructs that only contains an alpha factor copy derives from BAR1-MF α 1 and merges fragment (copies of four alpha factor of coding), it contains the preceding former sequence (referring to Figure 14,15 and 16) of TPI1 promotor and MF α 1, with EcoR I and Sal I dissimilation plasmid pZV16.The BAR1 fragment of isolating 651 base pairs and the special connector of activatory Hind III-EcoR I BAR1 (producing by oligonucleotide ZC566:5 ' AGC TTT AACAAACGATGGCACTGGTCACTTAG3 ' and ZC567:5 ' AATTCTAAGTGACCAGTGGCATCGTTTGTTAA3 ' annealing) are connected among the pUC13 with Hind III and the cutting of Sal I.With Hind III and the Sal I degraded plasmid pZV96 that obtains, to separate 684 base pair BAR1 fragments.Making provides the plasmid of TPI1 promotor pM220 to merge mutually with MF α 1 preceding former sequence.With Bgl II and the TPI1 promotor-MF α 1 preceding former fragment of Hind III dissimilation plasmid pM220 to separate 1.2 kilobase.By obtain 3 ' end parts sequence of BAR1 coding region with Sal I and BamH I cutting pZV9, to isolate the BAR1 fragment of 1.3 kilobase.With four sections ways of connecting, the Sa I-BamH I BAR1 fragment of former fragment and 1.3 kilobase before the Hind III-Sal I BAR1 fragment of 684 base pairs, the Bgl II-Hind III TPI1 promotor of 1.2 kilobase-MF α 1 is connected with YEp13 with BamH I line styleization.Have the promotor of required orientation and construct called after pZV100(Figure 14 of MF α 1-BAR1 fusion sequence).
For the convenience of operating, will be from pZV100 before the MF α 1 that downcuts of tack former sequence-BAR1 merge fragment, among the Pst I-segmental form subclone of BamH I pUC13 with 1.6 kilobase, obtain plasmid pZV101 with Pst I and the cracking of EcoR I, with former-BAR1 fragment before the MF α 1 that separates 270 base pairs.Merge fragment (encode four alpha factor copies) with BamH I dissimilation plasmid pZV69 with the BAR1-MF α 1 that separates 0.55 kilobase with the EcoR I.Former-BAR1 fragment before the MF α 1 of this fragment and 270 base pairs with three sections ways of connecting, is connected among the pUC13 with Pst I and the cutting of BamH I.The plasmid called after pZV102(Figure 15 that obtains).
Then, make up the ceneme (Figure 16) that comprises TPI1 promotor, a part of BAR1 and single alpha factor copy encoding sequence.With Pst I and BamH I cutting plasmid pZV102 with the MF α that separates 0.82 kilobase before former-BAR1 fragment.Will be from the Hind III-Pst I fragment of 1 kilobase of former sequence before the MF α that contains TPI1 promotor and truncation 1 of pM220, with three sections ways of connecting, be connected with the YEp13 that cuts with Hind III and BamH I with former-BAR1 fragment before the MF α 1 of isolating 0.82 kilobase from pZV102.The plasmid called after pZV105 that obtains.With the TPI1 promotor-MF α 1 preceding former fragment of Hind III cracking plasmid pZV105 to separate 1.2 kilobase.The carrier segments that contains terminal alpha factor copy with Hind III dissimilation plasmid pZV102 with separation.Carrier-MF α 1 fragment of this 2.8 kilobase is connected with former fragment before the TPI1 promotor of 1.2 kilobase-MF α 1.Plasmid called after pSW61 with correct orientation and MF α 1 single copy encoding sequence.Part degraded by the Hind III makes plasmid pSW61 line styleization.With Hind III dissimilation plasmid pZV102 to separate BAR1-MF α 1 fragment of 0.3 kilobase.This fragment is connected among the line style pSW61.Hind III site at distance MF α 1 initiation codon 3 ' end 264 base pairs has the plasmid called after pSW70 that correct orientation is inserted section.With EcoR I and BamH I cracking plasmid pSW70 to separate BAR1-MF α 1 fragment of 361 base pairs, with Hind III and EcoR I dissimilation plasmid pSW81(Figure 13) to separate the TPI1 promotor-BAR1 fragment of 1.02 kilobase.This fragment with three sections ways of connecting, is connected with YEp13 with Hind III+BamH I line styleization with BAR1-MF α 1 fragment.The plasmid pSW96 that obtains contains 356 base pairs of TPI1 promotor and BAR15 ' end encoding sequence, and they merge mutually with the copy of an alpha factor encoding sequence.
Utilize pZV75 as the segmental source of BAR1, made up second BAR1-MF α sequence, it contains 767 base pairs (Figure 17) of the BAR1 that merges mutually with the copy of MF α 1 encoding sequence.With EcoR I and BamH I dissimilation plasmid pZV75 to separate BAR1-MF α 1 fragment of 954 base pairs.Plasmid pZV101 contains former sequence before the MF α 1 that merges with BAR1, with Pst I and EcoR I cut this plasmid with the MF α 1 that separates 0.27 kilobase preceding former-the BAR1 fragment.This fragment with three sections ways of connecting, is connected with pUC13 with Pst I+BamH I line styleization with BAR1-MF α 1 fragment of 954 base pairs.Obtain plasmid pZV104 to separate BAR1-MF α 1 fragment of 0.70 kilobase with the cracking of Hind III.The pSW61 of line styleization is connected with degrading by the part of Hind III with this fragment.Hind III site at distance MF α 1 initiation codon 3 ' end 264 base pairs has the plasmid called after pSW74 that correct orientation is inserted section.Cut plasmid pSW74 to separate BAR1-MF α 1 fragment of 738 base pairs with EcoR I and BamH I.Cut plasmid pSW81 to isolate the TPI1 promotor-BAR1 fragment of 1.02 kilobase with Hind III and EcoR I.This fragment is linked to each other with the YEp13 that cuts with Hind III+BamH I with BAR1-MF α 1 fragment of 738 base pairs with three sections mode of connection.The plasmid pSW97 that obtains contains 767 base pairs of TPI1 promotor and the BAR15 ' end that merges mutually with the single copy of alpha factor encoding sequence.
Transform the a/ α amphiploid strain X P733(MATaleu2-3leu2-112bar1-1 gal2/MATa leu2-3leu2-112bar1-1gal12 of cereuisiae fermentum with plasmid pSW73, pSW94 and pSW95).Plasmid pSW73 includes the coding region of four copies of alpha factor among TPI1 promotor, MF α 1 signal peptide and preceding former sequence and the YEp13.On the lawn with the cereuisiae fermentum RC629 strain cell of transformant point in soft agar, 30 ℃ of following incubated overnight, this soft agar is layered on to be selected on the culture medium flat plate.Comparison shows that of the halo size of pSW73 and contrast, the alpha factor of pSW94 output is about as much as 15% of pSW73 output.
In the same way, detect the situation of the alpha factor of the construct output that contains the BAR1 that merges mutually with a copy of MF α 1 encoding sequence.Utilization contains the Qian Yuan district of alpha factor list copy among TPI1 promotor, MF α 1 signal peptide, the YEp13 and the plasmid pSW67 of coding region, as the contrast of plasmid pSW96 and pSW97.Comparison shows that of halo size, pSW96 excretory alpha factor is about as much as pSW67 excretory 30-40%, and pSW97 excretory alpha factor is about as much as the 10-15% of pSW67.
Example 5
The sudden change of BAR1 signal peptide cutting site
As mentioned above, found to change the signal peptide cutting site of Barrier precursor, can expect to contain the post-treatment and the output of the fusion rotein of Barrier by the promotion of KEX2 approach.The potential cleavage site is between amino acid 23 and 24 and between amino acid 24 and 25.Therefore, make the BAR1 dna encoding sequence generation sudden change of translational product originally, make it at 25 positions coding proline residue.Plasmid pSW98 and pSW99 are the plasmids based on YEp13, and they contain 355 base pairs of cereuisiae fermentum TPI1 promotor, a BAR1 gene or 767 base pair fragments, comprising the signal peptide cutting site that suddenlyd change and the copy of an alpha factor encoding sequence are arranged.
The signal peptide sudden change is to utilize phage M13 template and synthetic mutagenesis oligonucleotide (5 ' ATTACTGCTCCTACAAACGAT3 ' sequence), (the people such as Zoller who finishes by the stripped mutafacient system of routine, " senior molecule clone technology handbook, Cold Springer Harbor Laboratory, 1983).The structure of the pSW54 of phage template is to be connected and to finish with the Sph I-M13mp19 of EcoR I degraded by the Sph I-EcoR I fragment with 0.54 kilobase of pSW22.Exsomatize after the mutagenesis, by using 32P, the mutagenesis oligonucleotide and the plaque hybridization of mark filter out potential by the plaque of mutagenesis, carry out preface then and more measure to determine the generation of sudden change.Determined by the rf of the phage of mutagenesis with the degraded of Sph I and EcoR I, separated the fragment of 0.54 kilobase and be connected with the pUC18 of Sph I+EcoR I cutting with mzc634-7.The plasmid pSW66(Figure 18 that is obtained with the degraded of Hind III and Xba I), to downcut ADH I promotor, will comprise the fragment of carrier and BAR1 sequence and be connected with the Hind III of 0.9 kilo hertz of base of pZV134-Xba I TPI1 promoter fragment.This plasmid called after pSW82, it contains the TPI1 promotor and comprises 119 base pairs of the BAR15 ' end of signal peptide cutting sudden change.
Referring to Figure 18,, separate the fragment of 1.02 kilobase that produce with Hind III and EcoR I and Bgl II and EcoR I dissimilation plasmid pSW82.Hind III-EcoR I fragment of pSW82 is connected with the YEp13 that degrades with Hind III+BamH I with EcoR I-BamH I fragment of pSW74, thereby forms pSW99.EcoR I-BamH I the fragment of 0.30 kilobase of Bgl II-segmental pSW70 of EcoR I of pSW82 and the YEp13 of BamH I degraded are connected, thereby form pSW98.Plasmid pSW98 comprises the TPI1 promotor, 355 base pairs of the BAR1 sequence 5 of mutagenesis ' end and the copy of single alpha factor encoding sequence, and plasmid pSW99 contains identical ceneme, and just the fragment of the BAR1 sequence of the mutagenesis that it had is 767 base pairs.
The analysis revealed that halo detects, if use the plasmid of the copy of an alpha factor of coding, then the sudden change of cleavage site can be strengthened the output of alpha factor.The alpha factor that contains the transformant output of pSW98 approximately Duos 50% than the transformant of the wild-type contrast that contains pSW96.
Claims (13)
1, a kind ofly in transformant, produces foreign protein and guide described albumen the method for emiocytosis approach into, it is characterized in that this method comprises the following steps:
(a) transform fungal host cells with the dna structure body, this dna structure body comprises the structure gene of the part cereuisiae fermentum BAR1 gene of the polypeptide that coding mainly is made up of 24 to 405 amino acid of the N-terminal sequence coding of the BAR1 gene that originates in methionine(Met), the described foreign protein of encoding and control expression promoter in the cell of the described fusion rotein that comprises this signal peptide and foreign protein;
(b) produce under the growth conditions that described fusion rotein selects the cell described in the culturing step (a) being suitable for.
2, according to the process of claim 1 wherein that described fungi is a cereuisiae fermentum.
3, according to the process of claim 1 wherein that described fungi is the pear wine yeast.
4, according to the process of claim 1 wherein that described fungi is aspergillus tubigensis or arteries and veins born of the same parents bacterium.
5, according to the process of claim 1 wherein that described fusion rotein comprises a KEX2 processing site.
6, according to the method for claim 5, wherein said part BAR1 gene contains the mutant that reduces signal peptidase crack protein efficient.
7, according to the process of claim 1 wherein that described promotor is selected from the pear wine yeast alcohol dehydrogenase promoter of cereuisiae fermentum BAR1 promotor, cereuisiae fermentum ethanol dehydrogenase I promotor.
8, according to the process of claim 1 wherein that described promotor is the promotor of Yeast sugar glycolysis pathway gene.
9, the method for preparing DNA construct according to Claim 8, wherein said construct is selected from:
(a) prepare construct pZV30 by at least one structure gene that connects BAR1 promotor, the foreign protein that contains the part cereuisiae fermentum BAR1 gene of signal peptide and the selected host that encodes or allogenic polypeptide, make forming fusion rotein or the polypeptide that contains described signal peptide and foreign protein by the expression in the described DNA construct transformed host cells;
(b) prepare construct pZV31 by at least one structure gene that connects BAR1 promotor, the foreign protein that contains the part cereuisiae fermentum BAR1 gene of signal peptide and the selected host that encodes or allogenic polypeptide, make forming fusion rotein or the polypeptide that contains described signal peptide and foreign protein by the expression in the described DNA construct transformed host cells;
(c) prepare construct pZV49 by at least one structure gene that connects BAR1 promotor, part pear wine yeast BAR1 promotor, the foreign protein that contains the part pear wine yeast BAR1 gene of signal peptide and the selected host that encodes or allogenic polypeptide, make forming fusion rotein or the polypeptide that contains described signal peptide and foreign protein by the expression in the described DNA construct transformed host cells;
(d) prepare construct pZV50 by at least one structure gene that connects cereuisiae fermentum ADH1 promotor, the foreign protein that contains the part cereuisiae fermentum BAR1 gene of signal peptide and the selected host that encodes or allogenic polypeptide, make forming fusion rotein or the polypeptide that contains described signal peptide and foreign protein by the expression in the described DNA construct transformed host cells.
10, according to the process of claim 1 wherein that described foreign protein exports from described cell.
11, according to the process of claim 1 wherein that described albumen comprises proinsulin or Regular Insulin.
12, according to the process of claim 1 wherein described part BAR1 gene also comprise in abutting connection with 5 of rotaring intertranslating start site '-do not translate the 680 alkali bases in district to order.
13, the method for preparing DNA construct according to claim 1, wherein said method are further characterized in that the transcription termination region of cereuisiae fermentum phosphotriose isomerase gene is connected with described structure gene.
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US79130585A | 1985-10-25 | 1985-10-25 | |
US791,305 | 1985-10-25 | ||
PCT/US1986/002198 WO1987002670A1 (en) | 1985-10-25 | 1986-10-20 | Method of using bar1 for secreting foreign proteins |
USPCT/US86/02198 | 1986-10-20 |
Publications (2)
Publication Number | Publication Date |
---|---|
CN86107554A CN86107554A (en) | 1987-08-26 |
CN1027179C true CN1027179C (en) | 1994-12-28 |
Family
ID=25153298
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN86107554A Expired - Lifetime CN1027179C (en) | 1985-10-25 | 1986-10-25 | Method of using bari for secreting foreign proteins |
Country Status (13)
Country | Link |
---|---|
EP (1) | EP0243465A1 (en) |
JP (1) | JP2523562B2 (en) |
CN (1) | CN1027179C (en) |
AU (2) | AU6543286A (en) |
CA (1) | CA1316133C (en) |
CZ (1) | CZ284251B6 (en) |
DK (1) | DK320287D0 (en) |
FI (1) | FI872801A (en) |
HU (1) | HU206897B (en) |
IE (1) | IE63822B1 (en) |
SK (1) | SK776486A3 (en) |
UA (1) | UA41863C2 (en) |
WO (1) | WO1987002670A1 (en) |
Families Citing this family (53)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DK58285D0 (en) * | 1984-05-30 | 1985-02-08 | Novo Industri As | PEPTIDES AND MANUFACTURING AND USING THEREOF |
CA1314830C (en) * | 1987-10-02 | 1993-03-23 | Susan K. Welch | Bar1 secretion signal |
US5206699A (en) * | 1988-05-06 | 1993-04-27 | Gersan Establishment | Sensing a narrow frequency band of radiation and gemstones |
AU633020B2 (en) * | 1988-07-23 | 1993-01-21 | Novozymes Delta Limited | New secretory leader sequences |
WO1991013971A1 (en) * | 1990-03-13 | 1991-09-19 | Hawaii Biotechnology Group, Inc. | Neurospora expression system |
DK82893D0 (en) * | 1993-07-08 | 1993-07-08 | Novo Nordisk As | PEPTIDE |
CN101955921A (en) | 1995-03-17 | 2011-01-26 | 诺沃奇梅兹有限公司 | Novel endoglucanases |
DE69738695D1 (en) | 1996-03-01 | 2008-06-26 | Novo Nordisk As | Anti-appetite peptide, its compositions and use |
AR027509A1 (en) | 2000-01-10 | 2003-04-02 | Maxygen Aps | G-CSF CONJUGATES |
RU2278123C2 (en) | 2000-02-11 | 2006-06-20 | Максиджен Холдингз Лтд. | Molecules similar to factor vii or viia |
HUP0303251A2 (en) | 2001-02-27 | 2003-12-29 | Maxygen Aps | Interferon beta-like molecules |
CA2441580A1 (en) | 2001-03-22 | 2002-10-03 | Novo Nordisk Health Care Ag | Coagulation factor vii derivatives |
US6534059B2 (en) | 2001-06-05 | 2003-03-18 | Advanced Biotherapy, Inc. | Compositions and methods for treating hyperimmune response in the eye |
ES2376694T3 (en) | 2001-09-27 | 2012-03-16 | Novo Nordisk Health Care Ag | HUMAN COAGULATION FACTOR VII POLIPED PEPDES VII. |
ES2381110T3 (en) | 2003-09-09 | 2012-05-23 | Novo Nordisk Health Care Ag | Coagulation Factor VII Polypeptides |
RU2412199C2 (en) | 2005-04-18 | 2011-02-20 | Ново Нордиск А/С | Versions of il-21 |
EP1917363B1 (en) | 2005-08-16 | 2011-06-22 | Novo Nordisk A/S | Method for making mature insulin polypeptides |
WO2007031559A2 (en) | 2005-09-14 | 2007-03-22 | Novo Nordisk Health Care Ag | Human coagulation factor vii polypeptides |
WO2007103447A2 (en) | 2006-03-06 | 2007-09-13 | Humagene, Inc. | A method for the preparation of recombinant human thrombin |
EP2069396B1 (en) | 2006-09-08 | 2015-10-21 | Ambrx, Inc. | Modified human plasma polypeptide or fc scaffolds and their uses |
EP2069502B1 (en) | 2006-09-27 | 2014-02-26 | Novo Nordisk A/S | Method for making maturated insulin polypeptides |
EP2076533B1 (en) | 2007-05-02 | 2014-10-08 | Ambrx, Inc. | Modified interferon beta polypeptides and their uses |
ES2632504T3 (en) | 2007-11-20 | 2017-09-13 | Ambrx, Inc. | Modified insulin polypeptides and their uses |
JP5680534B2 (en) | 2008-07-23 | 2015-03-04 | イーライ リリー アンド カンパニー | Modified bovine G-CSF polypeptides and their use |
US8349325B2 (en) | 2008-12-23 | 2013-01-08 | Abbott Laboratories | Soluble FMS-like tyrosine kinase-1 (sFLT-1) antibody and related composition, kit, methods of using, and materials and method for making |
WO2010103038A1 (en) | 2009-03-11 | 2010-09-16 | Novo Nordisk A/S | Interleukin-21 variants having antagonistic binding to the il-21 receptor |
AU2010272483B2 (en) | 2009-07-17 | 2016-07-21 | Omeros Corporation | MASP isoforms as inhibitors of complement activation |
US9096843B2 (en) | 2009-12-01 | 2015-08-04 | Novo Nordisk A/S | Peptidyl α-hydroxyglycine α-amidating lyases |
CN102666578A (en) | 2009-12-21 | 2012-09-12 | Ambrx公司 | Modified porcine somatotropin polypeptides and their uses |
EA201290541A1 (en) | 2009-12-21 | 2013-05-30 | Амбркс, Инк. | MODIFIED BULL SOMATOTROPINE POLYPEPTIDES AND THEIR APPLICATION |
AU2011222883B2 (en) | 2010-03-05 | 2016-05-26 | Omeros Corporation | Chimeric inhibitor molecules of complement activation |
US20110229921A1 (en) | 2010-03-18 | 2011-09-22 | Abbott Laboratories | METHODS OF ASSAYING URINARY NEUTROPHIL GELATINASE-ASSOCIATED LIPOCALIN (uNGAL) IN THE PROGNOSIS OF CADAVERIC KIDNEY TRANSPLANT FUNCTION IN A PATIENT, INCLUDING A PATIENT DIAGNOSED WITH DELAYED GRAFT FUNCTION (DGF), A METHOD OF ASSAYING uNGAL IN THE ASSESSMENT OF RISK OF DGF IN A PATIENT DIAGNOSED WITH EARLY GRAFT FUNCTION (EGF), AND RELATED KITS |
WO2011163558A1 (en) | 2010-06-25 | 2011-12-29 | Abbott Laboratories | Materials and methods for assay of anti-hepatitis c virus (hcv) antibodies |
CA2808596C (en) | 2010-08-17 | 2020-12-15 | Ambrx, Inc. | Modified relaxin polypeptides and their uses |
AR083006A1 (en) | 2010-09-23 | 2013-01-23 | Lilly Co Eli | FORMULATIONS FOR THE STIMULATING FACTOR OF COLONIES OF GRANULOCITS (G-CSF) BOVINE AND VARIANTS OF THE SAME |
US20120115244A1 (en) | 2010-11-09 | 2012-05-10 | Abbott Laboratories | Materials and methods for immunoassay of pterins |
CN105821078A (en) | 2010-12-09 | 2016-08-03 | 巴斯德研究所 | MGMT-Based method for obtaining high yield of recombinant protein expression |
ES2648899T3 (en) | 2011-12-09 | 2018-01-08 | Institut Pasteur | Multiplex Screening Immunoassay |
US8993248B2 (en) | 2011-12-31 | 2015-03-31 | Abbott Laboratories | Truncated human vitamin D binding protein and mutation and fusion thereof and related materials and methods of use |
CN104136041B (en) | 2012-02-09 | 2021-06-29 | Var2制药有限公司 | Targeted chondroitin sulfate glycans |
US20150307865A1 (en) | 2012-10-15 | 2015-10-29 | Novo Nordisk Health Care Ag | Coagulation factor vii polypeptides |
JP2014128262A (en) * | 2012-11-27 | 2014-07-10 | Kirin Brewery Co Ltd | Screening method for yeast strains having conjugative ability |
AU2019263303A1 (en) | 2018-05-01 | 2020-12-24 | Ambrx, Inc. | A method for optimizing antibody expression |
CN112789504A (en) | 2018-07-13 | 2021-05-11 | 瓦克特诊断有限责任公司 | Isolation of fetal-derived circulating cells using the recombinant malaria protein VAR2CSA |
PL3849614T3 (en) | 2018-09-11 | 2024-04-22 | Ambrx, Inc. | Interleukin-2 polypeptide conjugates and their uses |
JP2022512746A (en) | 2018-10-19 | 2022-02-07 | アンブルックス,インコーポレイテッド | Interleukin-10 polypeptide complex, its dimer, and their use |
WO2020168017A1 (en) | 2019-02-12 | 2020-08-20 | Ambrx, Inc. | Compositions containing, methods and uses of antibody-tlr agonist conjugates |
JP2023517595A (en) | 2020-03-11 | 2023-04-26 | アンブルックス,インコーポレイテッド | Interleukin-2 polypeptide conjugates and methods of use thereof |
CA3175523A1 (en) | 2020-04-13 | 2021-10-21 | Antti Virtanen | Methods, complexes and kits for detecting or determining an amount of a .beta.-coronavirus antibody in a sample |
WO2022031804A1 (en) | 2020-08-04 | 2022-02-10 | Abbott Laboratories | Improved methods and kits for detecting sars-cov-2 protein in a sample |
US20230302150A1 (en) | 2020-08-20 | 2023-09-28 | Ambrx, Inc. | Antibody-tlr agonist conjugates, methods and uses thereof |
WO2022147147A1 (en) | 2020-12-30 | 2022-07-07 | Abbott Laboratories | Methods for determining sars-cov-2 antigen and anti-sars-cov-2 antibody in a sample |
KR20240004342A (en) | 2021-04-03 | 2024-01-11 | 암브룩스, 인코포레이티드 | Anti-HER2 antibody-drug conjugates and uses thereof |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4546082A (en) * | 1982-06-17 | 1985-10-08 | Regents Of The Univ. Of California | E. coli/Saccharomyces cerevisiae plasmid cloning vector containing the alpha-factor gene for secretion and processing of hybrid proteins |
US4613572A (en) * | 1983-08-15 | 1986-09-23 | Kansas State University Research Foundation | Yeast BAR1 gene plasmid |
DE3537176C2 (en) * | 1984-10-18 | 1994-06-09 | Zymogenetics Inc | Tissue plasminogen activator and process for its manufacture |
JPS61247384A (en) * | 1984-10-18 | 1986-11-04 | チモ−ジエネテイツクス インコ−ポレ−テツド | Development of plasminogen activating factor in yeast |
-
1986
- 1986-10-20 JP JP61505713A patent/JP2523562B2/en not_active Expired - Fee Related
- 1986-10-20 UA UA4203156A patent/UA41863C2/en unknown
- 1986-10-20 AU AU65432/86A patent/AU6543286A/en not_active Abandoned
- 1986-10-20 HU HU865248A patent/HU206897B/en not_active IP Right Cessation
- 1986-10-20 EP EP86906638A patent/EP0243465A1/en not_active Withdrawn
- 1986-10-20 WO PCT/US1986/002198 patent/WO1987002670A1/en active Application Filing
- 1986-10-23 IE IE280486A patent/IE63822B1/en not_active IP Right Cessation
- 1986-10-23 CA CA000521206A patent/CA1316133C/en not_active Expired - Fee Related
- 1986-10-25 CN CN86107554A patent/CN1027179C/en not_active Expired - Lifetime
- 1986-10-27 SK SK7764-86A patent/SK776486A3/en unknown
- 1986-10-27 CZ CS867764A patent/CZ284251B6/en not_active IP Right Cessation
-
1987
- 1987-06-23 DK DK320287A patent/DK320287D0/en not_active Application Discontinuation
- 1987-06-24 FI FI872801A patent/FI872801A/en not_active Application Discontinuation
-
1991
- 1991-04-02 AU AU74003/91A patent/AU676132B2/en not_active Ceased
Also Published As
Publication number | Publication date |
---|---|
EP0243465A1 (en) | 1987-11-04 |
SK279041B6 (en) | 1998-06-03 |
WO1987002670A1 (en) | 1987-05-07 |
AU7400391A (en) | 1991-07-18 |
DK320287A (en) | 1987-06-23 |
UA41863C2 (en) | 2001-10-15 |
JPS63501614A (en) | 1988-06-23 |
CZ284251B6 (en) | 1998-10-14 |
JP2523562B2 (en) | 1996-08-14 |
AU6543286A (en) | 1987-05-19 |
HUT43624A (en) | 1987-11-30 |
FI872801A0 (en) | 1987-06-24 |
AU676132B2 (en) | 1997-03-06 |
FI872801A (en) | 1987-06-24 |
IE862804L (en) | 1987-04-25 |
CN86107554A (en) | 1987-08-26 |
CZ776486A3 (en) | 1996-09-11 |
SK776486A3 (en) | 1998-06-03 |
CA1316133C (en) | 1993-04-13 |
DK320287D0 (en) | 1987-06-23 |
HU206897B (en) | 1993-01-28 |
IE63822B1 (en) | 1995-06-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1027179C (en) | Method of using bari for secreting foreign proteins | |
CA1340772C (en) | Expression and secretion of heterologous protiens in yeast employing truncated alpha-factor leader sequences | |
CN1069346C (en) | Expression and secretion of hereologous proteins by yarrowia lipolytica transformants | |
EP0123544A2 (en) | Process for expressing heterologous protein in yeast, expression vehicles and yeast organisms therefor | |
CN1032367A (en) | The DAN that contains directing heterologous polypeptide excretory kluyveromyces-factor leader sequence is set up thing | |
KR20070009269A (en) | Library of translational fusion partners for producing recombinant proteins and translational fusion partners screened therefrom | |
EP3874047B1 (en) | Carbon-source regulated protein production in a recombinant host cell | |
US9012367B2 (en) | Rapid screening method of translational fusion partners for producing recombinant proteins and translational fusion partners screened therefrom | |
EP0220689B1 (en) | Method of using bar1 for secreting foreign proteins | |
US7198919B1 (en) | Use of alpha factor sequences in yeast expression systems | |
AU2019218931A1 (en) | Host cell for producing a protein of interest | |
CN1302333A (en) | Process for making desired polypeptides in yeast | |
JP3732516B2 (en) | Protein production method | |
KR100626753B1 (en) | Rapid screening method of suitable translational fusion partners for producing recombinant proteins | |
KR20050076603A (en) | Translational fusion partner for producing recombinant proteins | |
EP0188555A1 (en) | Yeast cloning vehicle | |
CN1309712A (en) | Method of making proteins in transformed yeast cells | |
CN1035127A (en) | Hirudin derivatives | |
KR20050076139A (en) | Translational fusion partners for the secretory production of proteins |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CX01 | Expiry of patent term |