EP0188555A1

EP0188555A1 - Yeast cloning vehicle

Info

Publication number: EP0188555A1
Application number: EP85903625A
Authority: EP
Inventors: Anton K. Beck; Gregory P. Thill; Edward G. 4 Longfellow Place Bernstine; Jeffrey F. Lemontt
Original assignee: Integrated Genetics Inc
Current assignee: Integrated Genetics Inc
Priority date: 1984-07-09
Filing date: 1985-07-09
Publication date: 1986-07-30
Also published as: JPS61502655A; DK103886A; EP0188555A4; DK103886D0; WO1986000637A1

Abstract

Véhicule de clonage avec une séquence de régulation de transcription de levure et une séquence de signal de levure placée dans un cadre de lecture et une direction de transcription corrects par rapport à une séquence d'ADN exogène codant pour une protéine désirée. Dans un aspect particulier, les séquences de transcription et de signal sont essentiellement identiques à celles du gène PH05 naturel et la séquence de signal code pour un peptide de signal possédant les mêmes trois acides aminés terminaux carboxy que le peptide de signal PH05. Le véhicule est utilisé pour transformer une levure hôte sécrétant la protéine désirée. Il peut être préparé par la ligature de l'ADN exogène à un fragment d'ADN comportant un site de clivage d'endonucléase de restriction qui a été inséré à l'extrémité 3' de la séquence de signal, sans paires de bases étrangères entre eux; alternativement, lorsque G peut être la paire de base terminale 5' de l'ADN exogène, le véhicule peut être préparé par la ligature de l'ADN exogène, moins la base à son extrémité 5' à un fragment d'ADN où une seule base G a été placée entre l'extrémité 3' de la séquence de signal et la séquence d'ADN exogène.Cloning vehicle with a yeast transcription regulatory sequence and a yeast signal sequence placed in a correct reading frame and transcription direction relative to an exogenous DNA sequence encoding a desired protein. In a particular aspect, the transcription and signal sequences are essentially identical to those of the natural PH05 gene and the signal sequence codes for a signal peptide having the same three carboxy terminal amino acids as the signal peptide PH05. The vehicle is used to transform a host yeast secreting the desired protein. It can be prepared by ligation of exogenous DNA to a DNA fragment having a restriction endonuclease cleavage site which has been inserted at the 3 'end of the signal sequence, without foreign base pairs between them; alternatively, when G can be the 5 'terminal base pair of exogenous DNA, the vehicle can be prepared by ligation of exogenous DNA, minus the base at its 5' end to a DNA fragment where only one base G was placed between the 3 'end of the signal sequence and the exogenous DNA sequence.

Description

YEAST CLONING VEHICLE

Background of the Invention This invention relates to cloning vehicles for production of proteins. (The term "proteins" is used in this application to include peptides of indefinite size.)

There has been increasing interest in the use of eukaryotic cells, such as yeasts, as hosts for the expression of genes or complementary DNA (cDNA) coding sequences for specific proteins. Typically, proteins exported from eukaryotic cells are processed in a secretory pathway that involves synthesis of a precursor protein (containing an amino-terminal "signal" peptide region), translocation across endoplasmic reticulum membranes, followed by specific signal peptide cleavage and further processing including carbohydrate additions (glycosylation), and finally secretion of the mature product out of the cell. The yeast Saccharomyces cerevisiae is known to have such a secretory pathway [see Schekman and Novick, "The secretory process and yeast cell-surface assembly", in The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression. Strathern et al. (Eds.), Cold Spring Harbor Laboratory. 1982]. Moreover, unlike an analogous secretory pathway that exists in some prokaryotic species, the yeast secretion mechanism provides components capable of glycosylating proteins. Hitzeman et al. (1983) Science 219:620-625 report expression and secretion in yeast of human interferon based on a coding region containing the interferon signal sequence. The mature secreted protein reported by Hitzeman et al. revealed inaccurate cleavage of the signal peptide. Hinnen et al., at an International Congress of Microbiology (Boston, Massachusetts 1982) reported the fusion of a DNA fragment from the PH05 gene of the yeast Saccharomyces cerevisiae (containing the promoter and 80% of the 5' end of the PH05 signal sequence) to a cDNA fragment coding for the mature protein sequence and a portion of the 3' end of the signal sequence of human alpha interferon. PH05 codes for the major repressible (by phosphate) acid phosphatase, a secreted enzyme in this yeast. This construction lacks the DNA coding sequence for the last 3 amino acids of the PH05 signal peptide and instead the last three amino acids of the hybrid signal are those coded for by the human cDNA sequence—i.e., the amino acids of the pre-interferon signal information. The plasmid constructed by Hinnen et al. was used to transform cells of Saccharomyces cerevisiae. The transformants were reported to express interferon activity under phosphate regulation. Localization of the interferon activity (intracellular versus extracellular) was not discussed. Summary of the Invention

In a first aspect, the invention features generally a cloning vehicle that is used to transform a microorganism for expression and secretion of a protein. The cloning vehicle includes, in order of transcription: a yeast transcription control DNA sequence, a DNA sequence coding for a yeast signal peptide and an exogenous DNA sequence coding for a desired protein.

In a second aspect, the invention features a DNA fragment which includes: a signal sequence substantially identical to a yeast PH05 transcription control sequence; a sequence coding for a signal peptide substantially identical to a complete PH05 signal peptide, and having the same three carboxy-terminal amino acids as a PH05 signal peptide; and a restriction endonuclease site adjacent to the carboxy terminal end of the signal sequence.

In a third aspect, the invention features a method of making the above-described plasmid by providing naturally occurring PH05 transcription control and signal sequences, and modifying them by creating a restriction endonuclease cleavage site at the 3' end of the signal sequence without changing the identity of the three carboxy-terminal amino acids encoded by the DNA signal sequence.

The cloning vehicle containing the exogenous DNA sequence can be used to transform a yeast host, the transformed host is cultured, and secretion of the desired protein is obtained.

The term "yeast transcription control DNA sequence" means a DNA sequence naturally occurring in yeast which is effective to initiate transcription of DNA. The term "yeast signal DNA sequence" means a DNA sequence which codes for a signal peptide sequence that naturally occurs in yeast. "Exogenous DNA" refers to DNA which is not naturally found associated with the yeast transcription control DNA sequence and the yeast signal DNA sequence of the vehicle of the invention. In preferred embodiments, the transcription control DNA sequence is identical to the transcription control DNA sequence of a naturally occurring yeast gene, and the yeast signal DNA sequence codes for a peptide identical to a signal peptide produced by that gene. The yeast gene is the PH05 gene, which codes for the major repressible acid phosphatase enzyme. PH05 is contained within an 8-kilobase (kb) EcoRI region of the genomic DNA of chromosome 2 in Saccharomyces cerevisiae. Both the transcription control sequence and the adjacent signal DNA sequence of this gene are contained within a smaller 600-base pair (bp) BamHI-Kpnl portion of this region. The exogenous DNA can be yeast DNA coding for nonsecreted (or secreted) yeast proteins; however, preferably, the exogenous DNA sequence corresponds to a sequence coding for a nonyeast protein. The above described cloning vehicle enables expression of exogenous DNA in yeast, so that the protein product is secreted by the yeast into the surrounding medium. Moreover, the protein is recovered in its mature form after processing (i.e., removal of the yeast signal sequence). Control over the placement and spacing of the signal sequence, as described below, will enable the desired exogenous protein to be expressed and processed by the host organism, such that cleavage of the signal sequence will occur at the correct site and the mature form of the protein will be secreted.

The information necessary to effect the correct processing of the mature protein is contained in the yeast signal DNA sequence, and is not dependent on the nature of the DNA sequence coding for the exogenous protein. The above described cloning vector is useful for expression and secretion of DNA sequences coding for any secretory and nonsecretory exogenous proteins. Description of the Preferred Embodiment

Drawings

Figure 1 is a diagram representing plasmid 99NMlu-alpha. Figure 2 is a diagram representing plasmid 99N. Figure 3 is a diagram representing plasmid 99NMlu.

Figure 4 is a diagram representing plasmid 99N-alpha. Figure 5 is a partial restriction map of a DNA fragment cloned into pBR322, including the coding sequence for the first 30 nucleotides of mature alpha HCG.

Cloning Vehicle Structure The components of the cloning vector or vehicle are illustrated by plasmid 99NMlu-alpha, depicted in Fig. 1, and, alternatively, by p99N-alpha in Fig. 4. The plasmid includes a yeast transcription control sequence which comprises a functional promoter region and a transcription initiation site.

The functional yeast promoter region should include sufficient sequences upstream from other plasmid components to permit initiation of transcription, for example, a complete naturally occurring yeast promoter. (Naturally occurring yeast transcription control DNA sequences containing certain deletions at the 3' end are also functional promoters.) The 5' to 3' DNA sequence from the BamHI site (-553) to the nucleotide preceding the ATG triplet (defined as +1, +2, +3), represents a functional PH05 promoter region with sufficient upstream sequences to permit initiaton of transcription. Certain deletions of the 3' end of the PH05 transcription control region are also functional promoters.

Fused in phase with the transcription control sequence is a sequence which is transcribed and translated into the signal peptide of a yeast secretory protein. p99NMlu-alpha codes for a signal peptide (identical to the PH05 signal peptide), having the following amino acid sequence: Met-Phe-Lys-Ser-Val-ValTyr-Ser-Ile-Leu-Ala-Ala-Ser-Leu-Ala-Asn-Ala. The DNA sequence coding for the signal peptide on p99NMlu-alpha is: ATGTTTAAATCTGTTGTTTATTCAATTTTAGCCGCTTCTTTGGCCAACGCG, The above yeast DNA sequences are positioned in phase with the DNA sequences coding for the desired exogenous protein. "Exogenous protein" means a protein that, in naturally occurring systems, is not produced under control of the yeast promoter of the vehicle, and is not produced with the yeast signal peptide of the vehicle. This term includes yeast proteins, but preferably the exogenous DNA sequence codes for the mature form of a nonyeast protein. Changes can be made in naturally occurring signal DNA sequences to facilitate fusion of the signal sequence to the sequence coding for the mature protein, but one should avoid changes which are reflected in the amino acid sequence of the resulting signal peptide. The 3' end of the signal DNA sequence is ligated to the 5' end of the exogenous DNA sequence such that there are no extraneous nucleotides between the sequences. In this way, the nascent protein will contain a signal peptide directly adjacent to the desired mature protein and the protein that is secreted should not contain extraneous amino acids.

Other components of the preferred cloning vehicle include DNA replication origins and DNA fragments conferring phenotypic bases for plasmid selection. The detailed features which are present in p99NMlu-alpha are illustrated by the following description of its precursor, plasmid p99N, and of the method of making p99NMlu-alpha from p99N. Cloning Vehicle Construction and Precursors

The above-described cloning vehicle can be constructed by engineering a vector containing a yeast transcription control sequence and a yeast signal sequence which has been modified to provide a multipurpose cloning site. Plasmid 99NMlu (Fig. 3) is such a vector containing a cloning site Mlul. The restriction site should be positioned at or near the end of the yeast signal DNA sequence, so that any exogenous DNA sequence coding for a desired secretory or nonsecretory protein, which has been engineered by restriction digest or by the use of synthetic linkers, is then inserted into the Mlul site of plasmid 99NMlu, and expression and secretion of the desired protein or peptide is achieved. Depending on where the restriction site is positioned and what sequences are required, the linker used may be engineered to maintain the intact naturally occurring signal DNA sequence, but the redundancy of the genetic code provides some flexibility as to the engineering steps performed. Similarly, engineering and nucleotide additions may be required at the 5' end of the exogenous DNA sequence to insure an inphase fusion to the signal sequence. An example of the structure and construction of such linkers is outlined below for p99NMlu-alpha.

What follows is a specific description of p99N and its construction, followed by a description of the construction of p99NMlu from p99N by inserting the restriction site Mlul. Exogenous DNA is then spliced into p99NMlu to create p99NMlu-alρha. Routine recombinant DNA procedures that may be used in this construction are described in Maniatis et al. Molecular Cloning: A Laboratory Manual, Coldspring Harbor Laboratory, Cold Spring Harbor, 1982. Plasmid 99N. Plasmid 99N includes the following DNA segments

(counter-clockwise from the EcoRI site):

1. The functional TRPl gene from yeast contained within a 1.45 kb EcoRI genomic DNA fragment from chromosome 4. described in Kingsman et al. (1979) Gene 7 , 141-152 and in Tschumper and Carbon (1980) Gene 10. 157-166. This fragment contains a 103 bp functional TRPl promoter region, a 672 bp coding sequence, and a 678 bp 3' untranslated region, which functions not only as a transcription termination sequence but also as a weak DNA replication origin (or replicon) called the arsl sequence; plasmid YRp7 has been described by Tschumper and Carbon (1980) and consists of this 1.45 kb EcoRI fragment inserted into pBR322 at the EcoRI Site in an orientation such that TRPl and the gene for ampicillin resistance are transcribed in the same direction.

2. The pBR322 sequence, EcoRI-NruI, 3389 bp, carrying the gene for ampicillin resistance in E. coli. as well as a DNA replication origin that functions in E. coli:

3. The 1.45 kb HincI I fragment from the B form of the 2 micron circle, a naturally occurring plasmid endogenous to most strains of Saccharomyces cerevisiae. described in Broach. The Molecular Biology of the Yeast Saccaromyces: Life Cycle and Inheritance. Cold Spring Harbor Laboratory, Cold Spring Harbor. 1981. The HincI I fragment contains a "strong" origin of DNA replication, (i.e., "stronger" than arsl because it confers a higher plasmid copy number in yeast) and confers a much lower rate of plasmid loss per mitotic cell division. This is also partly due to the presence of endogenous 2-micron plasmids carried in most strains of yeast. The orientation of the vector fragment in plasmid 99N is not important for this function;

4. The pBR322 597 bp sequence from NruI-BamHI;

5. The 0.6 kb BamHI-Kpnl segment of the 8 kb EcoRI-PH05 fragment. This fragment contains the intact

PH05 promoter plus all of the DNA sequence necessary to encode the 17 amino acid signal peptide (including the initial methionine); and

6. The Kpnl-EcoRI fragment is used as a spacer region. The source and length of this fragment is not important for its use in plasmid 99N or its derivatives. In plasmid 99N, the spacer region consists of PH05 structural sequences.

Plasmid 99N is constructed as follows. Plasmid YRp7 is partially digested with EcoRI such that only one of the two EcoRI sites is cleaved. Most of the product of this digestion consists of 5.8 kb linearized YRp7 molecules. Approximately half of these linear molecules are cleaved at one EcoRI site while the other half are cleaved at the other EcoRI site. This mixture of linear molecules is separated from uncleaved circular molecules and from shorter linear molecules, arising by occasional cleavage of both EcoRI sites, by gel electrophoresis as described in Maniatis et al. (1982), followed by elution from the gel. The 5' protruding EcoRI ends are then filled in with dNTP's using DNA polymerase I (Klenow enzyme). (Alternatively, the 5' EcoRI protruding ends can first be removed with a single-strand-specific 5' to 3' exonuclease.) The flush-ended molecules thus generated are rejoined (circularized) with DNA ligase, which results in the loss of one of the EcoRI recognition sequences. The plasmid of interest, YRp7', which retains the EcoRI site adjacent to the TRP1 promoter, is identified by restriction mapping. Next, the 1.45 kb HincII fragment from the yeast 2 micron plasmid is ligated into the Nrul site of YRp7'. The plasmid that is generated, YRp7'N, is digested with both EcoRI and BamHI. The large fragment. 6.87 kb, which is isolated from the gel, is the vector fragment.

The PH05 gene of Saccharomyces cerevisiae codes for the major phosphate-repressible acid phosphatase enzyme (APase). corresponding to the peptide called p60. and is contained within an 8 kb EcoRI genomic DNA fragment from chromosome 2 described in Bostian et al. (1980) PNAS 77. 4504-4508 and in Kramer and Andersen (1980) PNAS 77, 6541-6545. The PH05 fragment is prepared by digesting a plasmid carrying the 8 kb EcoRI PH05 region (e.g. pAP20, as described in Anderson. Thill and Kramer, Molec. Cell Biol. 3:562-569. 1983), with BamHI and Kpnl and isolating the 0.6 kb BamHI-Kpnl fragment from a gel. The 5' to 3' DNA sequence from the BamHI site (-553) to the nucleotide preceeding the ATG triplet represents a functional PH05 promoter region with sufficient upstream sequences to permit initiation of transcription.

The composition of the Kpnl-EcoRI spacer fragment is arbitrary. In plasmid 99N, the spacer fragment consists of PH05 structural sequences beginning at the Kpnl site (at +94bp) and terminating at the Pstl site (at +1500 bp) to which had been added an EcoRI linker sequence. The fragment is combined with the PH05 fragment and the vector fragment into a circular plasmid with DNA ligase. This product is used to transform E. coli to ampicillin resistance. From this pool of transformants plasmid 99N is identified and plasmid DNA is prepared. Plasmid 99N has been deposited with the NRRL and bears accession number 15790.

Plasmid 99N can be used to construct a cloning vehicle (for example p99Nalpha) for an exogenous DNA sequence beginning with a G as the first base pair using the technique described below in the section "Plasmid 99N-alpha". Alternatively, the insertion of a Mlul site in p99N would allow expression of exogenous DNA without regard to the identity of the initial base pair. Plasmid 99NMlu.

In order to place the Mlul site within the 3' end of the PH05 signal sequence of 99N, the following engineering steps are required. First, the PH05 promoter and signal sequence containing 1.95kb

BamHI-EcoRI fragment of 99N is inserted into pBR322 to generate plasmid pBRPho. Then, the Ball site in the pBR portion of pBRPho is eliminated by removing the Aval-PvuII f ragment to generate pAPP. pAPP now has only one Ball site which is located close to the 3' end of the DNA sequence encoding the PH05 signal.

The next step involves the replacement of the Kpnl site located next to the Ball site with an Mlul site. In order to accomplish this replacement pAPP is digested with Kpnl and the 3' overhang is removed using T4 DNA polymerase. Synthetic Mlul linkers (ACGCGT) are ligated on followed by digestion with Mlul and ligation to close the vector. Bacterial transformants are checked for the presence of a Mlul site; such a plasmid, pAPPM. is isolated. pAPPM is digested with Mlul and synthetic

7-mers (5'TGGCCAA3') and 11-mers ( 5'CGCGTTGGCCA3') that contain a Ball site and Mlul overhang are ligated on. Several of these linkers can be ligated in-between the two Mlul overhangs which leads to the following structure: (PH05 Signal-Bal... Mlu-Bal........Bal-Mlu).

These structures are digested with Ball and the vector is closed by ligation. This removes all the unnecessary linkers and moves the Mlul site next to the Ball site in the PH05 signal, thus giving the desired configuration, which is verified by DNA sequencing (pPhoM).

Construction of 99NMlu from plasmids 99N and pPhoM then is accomplished as follows: The 1.95kb BamHI-EcoRI fragment of pPhoM is isolated and ligated into 99N which has been cut with both BamHI and EcoRI and treated with bacterial acid phosphatase. Bacterial transformants are screened for plasmids having an Mlul site. Such a plasmid, 99NMlu, described in Figure 3. is isolated and can be used for fusions of the PH05 signal to foreign proteins. Plasmid 99NMlu has been deposited with the NRRL and bears accession number B 15792.

Thus, when 99NM1U is digested with Mlul. a 4-base overhang is created which ends exactly at the site encoding the carboxyl terminal of the signal sequence. This Mlul overhang can be modified so that either the site is filled in with dNTP's using the large fragment of DNA polymerase I (Klenow enzyme) which results in a blunt ended complete PH05 signal sequence or alternatively, the overhang is digested with nuclease SI which leads to a blunt ended PH05 signal sequence of which the. last 4 nucleotides are missing. This region of 99NMlu can also be cut with FnuDII (recognition sequence CGCG) which yields a blunt ended PH05 signal of which the last 2 nucleotides are missing.

These modifications allow fusion of the PH05 signal in frame to any coding region that is engineered by restriction digest or use of synthetic linkers:

Plasmid 99NMlu alpha.

The following example describes the proposed synthesis and secretion of the alpha subunit of human chorionic gonadotropin (alpha hCG) in Saccharomyces cerevisiae directed by the promoter, translation initiation site and signal sequence of PH05. Both alpha hCG and yeast acid phosphatase are secretory proteins derived from pre-proteins containing a signal peptide at their amino terminal end. The first 50 nucleotides of the coding sequence of the mature alpha hCG contain no recognition sequences for any known restriction enzymes. A fusion of the mature portion of alpha hCG to any signal sequence would thus require the extensive use of very long synthetic DNA linkers. This can be circumvented by creation of a restriction site downstream from the start of the mature coding sequence at positions that contain all but one or two nucleotides of a restriction enzyme recognition site. Relatively short and inexpensive synthetic DNA fragments can then be inserted between the newly created restriction site and the Mlul site of 99NMlu.

In a preferred method, the DNA fragment coding for the mature form of alpha hCG can be engineered so that a correct in-phase fusion to the PH05 signal in plasmid 99NMlu can be achieved.

An alpha hCG clone coding for the complete pre-alpha hCG molecule had been cloned between the BamHI and EcoRI sites of pBR322. A partial restriction map of this insert and the sequence of the first 30 nucleotides of the coding sequence for the mature alpha hCG are shown in Fig. 5. The codon for the first amino acid of the mature alpha hCG starts at the eighty-fifth base as indicated by the arrow. Replacement of the G at position 94 with a C would create a Pstl site (CTGCAG) which then could be used to insert synthetic DNA linkers. Exonuclease Bal31 can be used to resect this fragment from the BamHI site under conditions in which about 90 bp will be digested. To these digested fragments, EcoRI linkers which contain a C at their 3' end can be ligated. Only molecules in which the resection had ended exactly at the sequence 5'TGCAG3' will - after addition of a C - contain a Pstl site at postion 94. Thus, the above mentioned ligation mixture can be cut with Pstl and fragments of about 250bp length which contain a Pstl site at each end can be selected by cloning into the Pstl site of pBR322. Plasmids containing such a fragment can be digested with Pstl and synthetic 10-mers (5'CATCAGGAGC3') and 18-mers

(5'CGCGGCTCCTGATGTGCA3') are ligated on. These linkers contain a Mlul overhang and the missing alpha hCG coding sequence ending with a Pstl overhang. This ligation mixture can then be digested with Mlul and the fragment can be cloned into the Mlul site of pPhoM. The 3' fragment of the alpha hCG coding region can be inserted into this plasmid as a Xbal-EcoRI fragment and the entire BamHI-EcoRI fragment containing the PH05 promoter and the PH05 signal fused to the mature alpha hCG coding region can be inserted into p99NMlu to yield p99NMlualpha which then can be used to transform yeast. Plasmid 99N-alpha.

In an alternative method, plasmid 99N was used as a vector for constructing a hybrid gene in which the PH05 signal sequence was fused to the DNA sequence coding for the mature form of alpha hCG to yield plasmid 99N-alpha, illustrated in Fig. 4. The specific construction of the hybrid gene was possible because the PH05 signal sequence was manipulated to contain only the first 51 nucleotides, coding for the entire 17 amino acid signal peptide, plus an additional guanine (G) residue. This was achieved by first digesting the PH05 DNA with Kpnl enzyme to generate a 3' protruding strand. Then, flush ended molecules were obtained by the 3'-5' exonucleolytic activity of T4 DNA polymerase. The coding region of the mature alpha hCG was manipulated in a similar way as described above for making p99NMlu-alpha. Addition of a GA to the mature coding region creates a new restriction site Sad with the recognition sequence GAGCTC. This has been achieved by Iigating alpha-hCG fragments which had been resected with Bal31 from the BamHI site to fragments that contained a filled in Sall site and therefore a GA at their ends. The newly created Sad site contains within it an Alul site (AGCT). Cutting with Alul yields fragments which have the first G of the first amino acid of the mature alpha-hCG missing. The fusion of those fragments to the modified signal peptide in 99N resulted in the construction of plasmid 99N-alpha which contains an intact PH05 promoter, translation initiation site and complete signal sequence fused in phase to the sequence coding for mature alpha hCG. Plasmid 99N-alpha has been deposited with the

NRRL and bears accession number B 15791. Protein Synthesis

The cloning vehicle is used to transform a host yeast organism using standard techniques such as described by Beggs, Nature 275:104-109 (1978).

The transformed yeast organism is cultured in a standard culture medium using standard techniques such as those summarized by Botstein and Davis "Principles and Practice of Recombinant DNA Research with Yeast", in The Molecular Biology of the Yeast Saccharomyces:

Metabolism and Gene Expression, pp. 607-636, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. The secreted mature polypeptide is recovered from the surrounding medium. Plasmid 99N-alpha was used to transform a strain of Saccharomyces cerevisiae carrying a mutant trpl gene (causing tryptophan auxotrophy) to the Trp+ phenotype (tryptophan prototrophy). Plasmid 99N-alpha carries an expressible yeast trpl gene allowing the transformed yeast to grow in the absence of tryptophan (Trp prototrophy). Suitable methods for the transformation of yeast by plasmid DNA are described for example by Beggs, 1978. One or more Trp transformants were isolated by single-colony isolation on synthetic growth medium lacking tryptophan. This S -TRP and is described in Table 1.

The transformed strain was incubated in a low-phosphate synthetic liquid growth medium that lacks tryptophan and contains 30 mg/l KH₂PO₄ and 1.5 g/1 KCl. This medium is called LP (SC--TRP) and is described in Table 1. Cells retaining the expression of plasmid 99N-alpha grow in this medium and begin to synthesize alpha hCG when the intracellular level of inorganic phosphate begins to decrease. After two days of incubation at 30 degrees C, virtually all (greater than 90%) of the antigenically active alpha hCG was found in the culture medium. Typical levels were 0.2 mg/1 or greater, as determined by radioimmunoassay.

Since most or all of the alpha hCG was secreted into the culture medium, the yeast cells were at first removed from the harvested cell suspension by any of several convenient means such as centrifugation, filtration, etc. Then, the cell-free fermentation broth was subjected to appropriate protein purification procedures designed to isolate pure alpha hCG.

As described previously, plasmid 99NMlu can be used to attach the PH05 signal sequence to any foreign gene or cDNA and can be introduced to any strain of Saccharomyces cerevisiae. The transformed yeast can then be used to produce the desired foreign protein using techniques such as those described above for production of alpha hCG using yeast transformed with p99N alpha. The system provides an increased yield of the foreign protein which is secreted into the extra cellular fluid.

Each of the plasmid deposits referred to in this application has been made under conditions which: (a) provide for access to the culture during pendency of the patent application to one determined by the Commissioner of the U.S. Patent and Tredemark Office to be entitled thereto under 37 CFR 1.14 and 35 U.S.C. 122; and (b) ensure that all restrictions on the availability to the public of the culture so deposited will be irrevocably removed upon the granting of the patent.

Other Embodiments Other embodiments are within the following claims. To achieve adequate signal cleavage site recognition in the expressed polypeptide. the three terminal amino acids should be identical to the naturally occurring yeast signal sequence amino acids. While it is desirable to produce an intact, unmodified signal peptide, one-skilled in the art may be able to use the claimed invention while making a few such changes. Similarly, one may include a few extraneous amino acids at the N-terminal end of the desired polypeptide and tolerate some slight (3-6 base pairs) movement of the restriction enzyme site with respect to the end of the signal DNA sequence. What is claimed is:

Claims

1. A cloning vehicle capable of effecting the expression of an exogenous DNA sequence in a yeast host, said cloning vehicle comprising, in phase and in order of transcription: a yeast transcription-control sequence, a yeast signal sequence which codes for a yeast signal peptide, and an exogenous DNA sequence which comprises a DNA sequence coding for a desired protein.

2. The cloning vehicle of claim 1 wherein said yeast signal sequence and said exogenous DNA sequence code for a protein comprising an intact yeast signal peptide abutting the desired protein with no extraneous amino acids therebetween.

3. The cloning vehicle of claim 1 wherein said yeast transcription control sequence is substantially identical to the naturally occurring transcription-control sequence of a phosphaterepressible yeast acid phosphatase gene.

4. The cloning vehicle of claim 3 wherein said yeast transcription control DNA sequence is substantially identical to the transcription control sequence of a yeast PH05 gene.

5. The cloning vehicle of claim 4 wherein said yeast transcription control sequence is substantially identical to a fragment contained within a 0.6 kb BamHI-Kpnl fragment of the 8kb EcoRI PH05 genomic DNA fragment from. chromosome 2 of Saccharomyces cerevisiae.

6. The cloning vehicle of claim 1 wherein said yeast signal sequence codes for a peptide that is substantially identical to the signal peptide expressed by a naturally occurring phosphate-repressible yeast acid phosphatase gene.

7. The cloning vehicle of claim 6 wherein said yeast signal DNA sequence codes for a signal peptide identical to a complete signal peptide expressed by a PH05 genomic fragment.

8. The cloning vehicle of claim 1 wherein the three amino acids at the carboxy-terminus of the signal peptide are Ala-Asn-Ala.

9. The cloning vehicle of claim 8 wherein said yeast signal sequence codes for the following signal peptide: Met-Phe-Lys-Ser-Val-Val-Tyr-Ser-Ile-LeuAla-Ala-Ser-Leu-Ala-Asn-Ala.

10. The cloning vehicle of claim 9 wherein the yeast signal sequence (including the ATG translation start codon) is either

ATGTTTAAATCTGTTGTTTATTCAATTTTAGCCGCTTCTTTGGCCAATGCA; Or ATGTTTAAATCTGTTGTTTATTCAATTTTAGCCGCTTCTTTGGCCAACGCG

11. The cloning, vehicle of claim 1 wherein said exogenous DNA sequence codes for a nonsecretory protein or peptide.

12. The cloning vehicle of claim 1 wherein said exogenous DNA sequence codes for a secretory protein or peptide.

13. The cloning vehicle of claim 1 wherein said exogenous DNA sequence codes for a mammalian protein or peptide.

14. A DNA fragment comprising a transcription-control sequence substantially identical to a naturally occurring yeast PH05 transcription control sequence, a signal sequence which codes for a signal peptide substantially identical to a yeast signal peptide expressed by a naturally occurring yeast PH05 genomic DNA, the three carboxy-terminal amino acids of said signal peptide coded by said signal sequence being identical to the three carboxy-terminal amino acids expressed by said naturally occurring PH05 genomic DNA. and a restriction endonuclease cleavage site at the 3' end of said signal sequence, with no extraneous base pairs between said 3' end and said cleavage site, whereby exogenous DNA coding for a desired protein can be spliced onto said signal sequence while maintaining the proper reading frame for said exogenous DNA and without introducing any extraneous base pairs between the 3' end of said signal sequence and the 5' end of said exogneous DNA.

15. The DNA fragment of claim 14 wherein said yeast signal DNA sequence, codes for the following peptide: Met-Phe-Lys-Ser-Val-Val-Tyr-Ser-Ile-Leu-AlaAla-Ser-Leu-Ala-Asn-Ala.

16. The DNA fragment of claim 14 wherein said yeast signal DNA sequence is comprises: ATGTTTAAATCTGTTGTTTATTCAATTTTAGCCGCTTCTTTGGCCAACGCG.

17. The DNA fragment of claim 14 wherein said restriction endonuclease site is Mlul.

18. The DNA fragment of claim 14 wherein said fragment is contained in cloning vehicle p99NMlu (NRRL No. B 15792) or p99N (NRRL No. 15790).

19. A DNA fragment comprising a transcription control sequence substantially identical to a naturally occurring yeast PH05 transcription control sequence; a signal sequence which codes for the following signal peptide: Met-Phe-Lys-Ser-Val-Val-Tyr-Ser-Ile-LeuAla-Ala-Ser-Leu-Ala-Asn-Ala; a G nucleotide abutting the 3' end of said signal sequence; whereby exogenous DNA, which codes for a desired protein when a G base is joined to its 5' end. can be spliced to said 3' end of said DNA fragment while maintaining the proper reading frame for said exogenous DNA to produce DNA coding for a peptide comprising said signal peptide abutting said desired protein with no extraneous amino acids therebetween.

20. The fragment of claim 19 wherein said signal sequence (including said extra G nuleotide) is: ATGTTTAAATCTGTTGTTTATTCAATTTTAGCCGCTTCTTTGGCCAATGCAG.

21. A method of making the cloning vehicle of claim 14 comprising providing a plasmid comprising said transcription control sequence and a signal sequence identical to a naturally occurring signal sequence. modifyid naturally occurring yeast signal sequence at its d to create a restriction endonuclease cle site, said modified signal sequencecomprisi its 3' end nine base pairs coding for the three ca-terminal amino acids corresponding to the three ca-terminal amino acids coded by said naturally occur east signal sequence.

22. Ad of synthesizing a peptide which comprises a des pePtide and a peptide signal sequence withirast host, and secreting said desired peptide throug membrane of ttιe yeast host, said method comprisi ding a cloning vehicle capable of effecting the fsion of an exogenous DNA sequence in a yeast host; cloning vehicle comprising in order of transcripts yeast transcription control DNA sequence, a yeignal DNA sequence, which codes for a signal peptide three carboxy-terminal amino acids are identicale three carboxy-terminal amino acids of a naturallyring yeast signal peptide, and an exogenous DNA nce which comprises a DNA sequence coding for saired protein, said transcription control sequenid yeast signal sequence, and said exogenous DNA nce being positioned in phase with respect to eaor; orming the yeast host with said cloning vehicl then ing the transformed yeast host to secrete the se protein or peptide.

23. thod of claim 22 wherein said selected proteglycosylated.