SK16998A3 - Chemically-inducible plant gene expression cassette - Google Patents

Abstract

A chemically-inducible plant gene expression cassette comprising a first promoter operatively linked to a regulator sequence which is derived from the alcR gene and encodes a regulator protein, and an inducible promoter operatively linked to a target gene which encodes a protein which is damaging to insects or whose expression induces a metabolic pathway which produces a metabolite which is damaging to insects, the inducible promoter being activated by the regulator protein in the presence of an effective exogenous inducer whereby application of the inducer causes expression of the target gene.

Description

Technical field

The present invention relates to recombinant DNA molecules and plants comprising these molecules. In particular, it relates to promoter sequences and their use for expression of genes related to the insecticidal activity of plants.

BACKGROUND OF THE INVENTION

Advances in plant biotechnology have led to the creation of transgenic plants that are protected against insect larvae attack.

Many organisms produce proteins that are harmful to insects. One of them is Bacillus thuringiensis, producing a crystalline 6-endotoxin protein which, when ingested, kills insect larvae but is not toxic to mammals. It is therefore very useful as an insecticide in agriculture. Many strains of B. thuringiensis are active against insect pests and genes encoding insect endotoxins have been characterized. B. thuringiensis δ-endotoxins include those toxins that are specifically insecticidal to Lepidoptera-like larvae (for example, Cryl-type proteins) or Coleoptera-like beetles (e.g., CrylII-type proteins) or double specificity proteins to both Lepidoptera and Coleoptera larvae (e.g., CryV). Chimeric proteins containing at least a portion of B. thuringiensis 5-endotoxin have been designed to alter some properties of endotoxin to some extent, e.g. killing rate. Transgenic plants expressing insect endotoxins are also known.

Another way to kill insect pests is to stimulate plant metabolism to produce insecticidal metabolites.

The present invention provides a gene system wherein genes encoding active insecticidal proteins, such as δ-endotoxins from B. thuringiensis, are expressed in an inducible manner, depending on the use of a specific chemical; or alternatively, a metabolic pathway is induced that leads to the production of insect damaging metabolites. This approach brings a number of advantages, examples of which are given in the following paragraph:

1. The constitutive expression of insect resistance genes (e.g. B. thuringiensis δ-endotoxins) in plants results in a significant increase in selection pressure favoring resistant insect species. Possibility of expression control, i. j. inducible expression of insect resistance genes reduces the risk of developing resistant pests. For example, expression of insecticidal genes can be induced only at the point in the growth period when protection is required. In addition, controllable insect tolerance can be utilized as part of an integrated plant protection system in which treatment with an insecticidal gene expression-inducing chemical is alternated with standard insecticidal pesticide treatment.

2. There is a risk that overexpression from a strong constitutive promoter may adversely affect plant development and may lead to germination or flowering disorders or yield reduction. Inducible expression reduces the risk of deleterious effects since the transgene is only expressed for a short period outside of sensitive developmental stages.

3. The chemical inducer acting as an expression switch can be added to a mixture with a standard insecticidal composition, which then has a dual effect, intrinsic chemical and gene, thus destroying the pests in two independent ways.

An inducible gene regulatory system (gene switch) has been developed, based on the alcR regulatory protein from Aspergillus nidulans, which activates the expression of genes from the alck promoter in the presence of certain alcohols and ketones. This system has been described in our international patent application no.

WO 93/21334, which is incorporated herein by reference.

The alcA / alcR gene activation system from Aspergillus nidulans is well characterized. The metabolic pathway for the conversion of ethanol into A. nidulans is responsible for the decomposition of alcohols and aldehydes. The products of three genes have been shown to be involved in this pathway. The alcA and alcR genes lie close together in VII. binding group and aldA falls into VIII. Binding group (Pateman J. H. et al., 1984, Proc. Soc. Lond. B217: 243-264; Sealy-Lewis H. N. and Lockington R. A., 1984, Curr. Genet. 8: 253-259). The alcA gene encodes ADHI in A. nidulans and aldA encodes AldDH, the second enzyme responsible for the metabolic utilization of alcohol. The expression of both alcA and aldA is induced by ethanol and a number of other inducing agents (Creaser E. H. et al., 1984, Biochem. J. 255: 449-454) via the transcriptional activator alcR. The alcR gene and co-inducer are responsible for the expression of alcA and aldA, since a number of mutations and deletions in the alcR gene lead to pleiotropic decrease in ADHI and AldDH activity (Felenbok B. et al., 1988, Gene 73: 385-396, Pateman et al. , 1984, Sealy-Lewis HM and Lockington RA, 1984). The ALCR protein activates expression from alcA by binding the sequence to three specific sites of the alcA promoter (Kulmberg P. et al., 1992, J. Biol. Chem. 267: 21146-21153).

The alcR gene was cloned (Lockington L. A. et al., 1985, Gene 33: 137-149) and sequenced (Felenbok B. et al., 1988). The expression of the alcR gene is inducible, self-regulated, and subject to glucose repression mediated by the CREA repressor (Bailey C. and Arst HN, 1975, Eur. J. Biochem. 51: 573-577; Lockington RA et al., 1987, Mol. Microbiol. 1: 275-281; Dowzer CEA and Kelly JM, 1989, Curr. Genet. 15: 457-459; Dowzer CEA and Kelly JM, 1991, Mol. Cell Biol. 11: 5701-5709). The regulatory protein contains 6 cysteine molecules near its N-terminus arranged in a two-core zinc-containing cluster (Kulmberg P. et al., 1991, FEBS Letts. 280: 11-16). This cluster is similar to the highly conserved DNA domains for transcription factors in pocket fungal fungi. GAL4 and LAC9 transcription factors contain such binucleate complexes with a clover leaf structure containing 2 Zn (II) atoms (Pan T. and Coleman

J. E., 1990, Biochemistry 29: 3023-3029; Halvorsen Y.D.D. et al., 1990, J. Biol. Chem. 265: 13283-13289). The structure of ALCR is similar to this type except that it contains an asymmetric loop of 16 amino acid residues between the Cys-3 and Cys-4 molecules. ALCR itself positively activates self-expression by binding to two specific sites of its promoter region (Kulmberg P. et al., 1992, Mol. Cell Biol. 12: 1932-1939).

The regulation of all three alcR, alck, and aldk genes, forming the ethanol utilization pathway, is transcriptional (Lockington et al., 1987, Gwyne D. et al., 1987, Gene 51: 205-216; Pickett et al., 1987 , Gene 51: 217-226).

There are two other alcohol dehydrogenases in A. nidulans. ADHII occurs in the mycelium when the fungus is grown on a non-inducing medium and subjected to ethanol repression. ADHII is encoded by the alcB gene and is also controlled by alcR (Sealy-Lewis and Lockington, 1984). The third alcohol dehydrogenase was also cloned by complementation with S. cerevisiae adh-strain. The alcC gene belongs to binding group VII, but is not linked to either alcA or alcR.

In summary, A. nidulans expresses the alcohol dehydrogenase I (ADHI) enzyme encoded by the alcA gene only when it grows in the presence of various alcohols and ketones. Induction is transmitted by a regulatory protein (regulator) encoded by the alcR gene and constitutively expressed. When an inducer (i.e., alcohol or ketone) is present, the regulatory protein activates expression of the alcA gene. In the presence of an inducer, the regulatory protein also stimulates its own expression. That is, under inducing conditions (i.e., when an alcohol or ketone is present), a large amount of the enzyme ADHI is formed. Conversely, the alcA gene and hence its ADHI product are not expressed in the absence of an inducer. The expression of alcA and enzyme production is repressed in the presence of glucose.

Thus, the alcA gene promoter is an inducible promoter activated by the alcR regulatory protein in the presence of an inducer (ie, a protein / alcohol alcR and alck combination (including respective and sequenced) (Lockington RA 137-149, Felenbok B. et al., 1988 et al., 1987, Gene 51: 205-216.

or propellant / ketone). The promoter genes) were cloned et al., 1985, Gene 33:, Gene 73: 385-396; Gwynne

Alcohol dehydrogenase (adh) genes have been studied in certain plant species. In maize and other cereals, their expression is triggered by anaerobic conditions. The promoter region of the maize adh gene contains a 300 bp regulatory element that is necessary for expression under anaerobic conditions. However, no equivalent of the alcR regulatory protein was found in any plant. Thus, the alcR / alck type gene regulatory system is not known in plants. Constitutive expression of the alcR gene in plant cells does not result in activation of endogenous adh.

SUMMARY OF THE INVENTION

The invention provides a chemically inducible gene expression cassette comprising a first promoter operably linked to a regulatory sequence derived from an alcR gene that encodes a regulatory protein and an inducible promoter operably linked to a target gene encoding an insect harmful protein or its expression induces metabolic pathways leading to insect damaging metabolites, wherein the inducible promoter is activated by a regulatory protein in the presence of a potent exogenous inducer whose application triggers expression of the target gene.

If the target gene encodes an insect damaging protein, it is preferred that the protein is orally active. An example of such orally active insecticidal proteins are B. thuringiensis 6-endotoxins and therefore the target gene encodes at least a portion of B. thuringiensis α-endotoxin.

T

We have found that the alcR / alck gene switch is particularly suitable for the expression of genes that encode 6-endotoxins from B. thuringiensis for at least the following reasons: Sys6 alcR / alch gene switch topics have been developed to achieve a high level of gene expression. In addition, expression of the regulatory protein alcR is preferably initiated from a strong constitutive promoter such as polyubichitin. Thus, a high level of transgene expression can be achieved compared to expression from a strong constitutive promoter such as the 35 CaMV promoter.

Fig. 1 shows the time course of expression of a marker gene (CAT) after administration of an inducing chemical (inducer). This study shows a sudden increase in CAT expression (2 hours) after foliar application of the inducer. Initial early kinetics of induction is due to constitutive expression of the regulatory protein, therefore no delay (lag phase) is evident while transcription factor synthesis takes place. In addition, a simple two-component system was chosen that does not depend on the entire complex signal transduction system.

The specificity of the alcR / alck system was tested with a range of solvents common in agronomic practice. The hydroponic culture assay of young plants showed that ethanol, butan-2-ol and cyclohexanone caused a high level of induced reporter gene expression (Fig. 2). Conversely, when various alcohols and ketones (listed in Table 1), common to agronomic practice, were applied to foliar spray, only ethanol resulted in a high level of induced gene activity of the reporter gene (Figure 3). This is significant because there is no illegitimate induction. transgene by accidentally encountering solvents in various agrochemical formulations. Ethanol is not a common part of agrochemical formulations and so properly organized ethanol spraying can be considered a specific inducer of the alcR / alcA gene switch under field conditions.

TABLE 1

1. Isobutylmethyketone 13. acetonylacetone 2. Fenchon 14. JF5969 (cyclohexanone) 3. 2-Heptanone 15. N-Methylpyrrolidone 4. Di-isobutyl ketone 16. polyethylene glycol 5. 5-Methylhexanone 17. propylene glycol 6. 5-Methylpentane-2,4-diol 18. Acetophenone 7. Ethylmethylketone 19. JF4400 (methylcyclohexanone) 8. 2-Pentanone 20. Propan-2-ol 9. glycerol 21. Butan-2-ol 10. τ-butyrolactone 22. acetone 11. diacetone alcohol 23. ethanol 12. tetrahydrofurfuryl alcohol 24. distilled water

None of the variety of biotic and abiotic stresses, such as pathogen infection, heat, cold, drought, injury and flooding, induce alcR / alcA gene switch function. In addition, a number of other non-solvent chemicals such as salicylic acid, ethylene, abscisic acid, auxin, gibberellic acid, and various other agrochemicals did not induce the alcR / alck system.

The present invention is not limited to any particular endotoxin, and chimeric endotoxins may also be employed.

The first promoter is either constitutive or tissue specific, or can be developmentally programmed or even inducible. The regulatory sequence, i.e. the alcR gene, is obtained from Aspergillus nidulans and encodes the alcR regulatory protein.

The inducible promoter is preferably an alck gene promoter obtained from Aspergillus nidulans, or is a chimeric promoter derived from the alck promoter regulatory sequences and the central promoter region of a gene promoter that is active in a plant cell (including any plant gene promoter). The alck promoter or derived chimeric promotor is activated by the alcR regulatory protein upon application of an alcohol or ketone inducer.

The inducible promoter can also be derived from the aldk, alcB, or alcC promoter gene obtained from Aspergillus nidulans.

The inducer is any active chemical (e.g., alcohol or ketone). Suitable chemicals for use with the alcR / alck gene expression cassette are those disclosed by Creaser et al. (1984, Biochem. J. 255: 449-454) such as butan-2-one (ethylmethylketone), cyclohexanone, acetone, butan-2-ol, 3-oxobutyric acid, propa-2-ol and ethanol.

The gene expression cassette responds to the application of an exogenous chemical inducer and thereby allows external activation of expression of the target gene regulated by the cassette. The expression cassette is strongly regulated and is suitable for general plant use.

The two portions of the expression cassette form part of one and the same recombinant DNA molecule or form two separate recombinant DNA molecules. The first part comprises a cDNA of a regulatory gene or a gene sequence subcloned into an expression vector in which their expression is under the control of an operative plant promoter. The second part comprises at least a portion of an inducible promoter that directs expression of a target gene lying downstream of the promoter. A regulatory protein that is the product of a regulatory gene in the first portion; cassette, in the presence of a suitable inducer, activates expression of the target gene by stimulating the inducible promoter in the second portion of the gene cassette.

In practical use, a recombinant DNA molecule or recombinant DNA molecules comprising an expression cassette of the invention is introduced into a plant by transformation.

Any method suitable for the selected plant or plant cell may be used for transformation, including infection with Agrobacterium tumefacienns that carries recombinant

Ti plasmids, electroporation, microinjection of cells or protoplasts, transformation by microprojectiles or transformation of the pollen bladder. Successfully transformed cells regenerate whole plants in which genome is permanently inserted new nuclear material. Thus, it is possible to transform both monocotyledonous and dicotyledonous plants.

Examples of plants that can be genetically modified are field crops, cereals, fruits and vegetables such as rape, sunflower, tobacco, sugar beets, cotton, soybean, corn, wheat, barley, rice, sorghum, tomatoes, mango, peach, apple tree , pear, strawberry, banana, melon, potatoes, carrots, lettuce, cabbage and onion.

The invention further provides a plant cell comprising a recombinant DNA molecule with a gene expression cassette according to the invention. This gene expression cassette is introduced by transformation and permanently incorporated in the plant genome. The invention also provides a plant tissue or whole plant comprising such transformed cells as well as plants or seeds derived therefrom.

The invention further provides a method of controlling gene expression in a plant, comprising transforming a plant cell with a recombinant DNA molecule that represents a gene expression chemically inducible cassette comprising a first promoter operably linked to a regulatory sequence derived from an alcR gene that encodes a regulatory protein and inducible promoter operably linked a target gene encoding a B. thuringiensis δ-endotoxin, wherein the inducible promoter is activated by a regulatory protein in the presence of an effective exogenous inducer, the application of which causes expression of the target gene.

Various preferred features and embodiments of the present invention are described in the following Examples and Figures, although embodiments of the invention are not limited to these examples.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 shows the time course of induction after application

7.5% ethanol in the segregating population of AR10.

Fig. 2 shows the activity of the CAT reporter gene in the homozygous line AR10-30 after soaking the roots in various chemicals.

Fig. 3 shows the activity of the CAT reporter gene in the homozygous line AR10-30 after soaking roots in various chemicals.

Fig. 4 shows the generation of a recombinant DNA molecule containing the 35S regulatory element.

Fig. 5 shows the generation of a recombinant DNA molecule containing a reporter gene.

Fig. 6 depicts the generation of a controllable (comprising a switch) DNA insect resistant vector.

Fig. 7 shows the optimized Cryla (c) gene sequence.

Fig. 8 depicts restriction sites in the optimized Cryla (c) gene sequence.

Fig. 9 shows the sequence of an optimized CryV gene.

Fig. 10 depicts a 5129 bp DNA vector containing a CryV gene.

Fig. 11 shows the sequence of the vector pMJB1.

Fig. 12 is a representation of a map of pJRI 1 vector.

DETAILED DESCRIPTION OF THE INVENTION

Example 1

Generation of recombinant alcR regulator molecule

The alcR genomic DNA sequence has been published to allow isolation of the alcR cDNA sample.

The alcR cDNA was cloned into the expression vector pJR1 (pUC). pJR1 contains cauliflower mosaic virus (CaMV) 35S promoter. This promoter is a constitutive plant promoter and continuously expresses a regulatory protein. The nose polyadenylation signal is used in the expression vector.

Fig. 4 depicts the generation of a regulatory recombinant molecule with a 35S element by ligation of alcR cDNA to pJR1. Partial digestion of the alcR cDNA clone with BamHI was followed by agarose gel electrophoresis and excision and purification of the 2.6 Kb fragment. The fragment was then ligated (inserted) into a vector pJR1 that had been digested with BamHI and treated with phosphatase to prevent recirculation. The alcR gene was then positioned in this 35S-alcR ^M recombinant molecule to be under the control of the 35S CaMV promoter and the nos 3 'polyadenylation signal.

Example 2

Generation of a recombinant alcR regulator molecule containing a chimeric promoter

Plasmid pCaMVCN contains the bacterial chloramphenicol transferase (CAT) reporter gene between the 35S promoter and the transcription terminator (recombinant 'LiSS-CAT' molecule).

The alcA promoter was subcloned into the pCaMVCN vector to generate a recombinant alcA-CAT molecule. The fusion of the alcA promoter moiety and the 35S promoter moiety created a chimeric promoter that allows control of gene expression.

Fig. 5 shows the generation of a recombinant reporter gene molecule. The alcA promoter and the 35S promoter have identical TATA sequences that were used to join the two promoters together using the recombinant polymerase chain reaction (PCR) method: 246 bp region from the alcA promoter and the 5 'end of the CAT gene from pCaMVCN (containing the -70 central portion) The 35S promoter regions were separately amplified and then pooled using PCR. The recombinant fragment was then digested with BamHI and HindIII. The vector pCaMVCN was partially digested with BamHI and HindIII and then subjected to electrophoresis so that the correct fragment could be isolated and ligated with the recombinant fragment.

The ligation mixtures were transformed into E. coli and plated on rich agar broths. Plasmid DNA was isolated by miniprep from the resulting colonies, and recombinant clones were resuspended by size by electrophoresis and restriction mapping. Ligation junction regions were sequenced to check if the correct recombinants were captured.

Example 3

Recombinant gene

We created the following recombinant genes - DNA molecules, which are summarized in Figure 6:

Vector 1 contains an amplified 35M CaMV promoter fused to the tobacco mosaic virus (TMV) omega translational enhancer sequence, the Cry 1A (c) gene from Bacillus thuringiensis, and the nopaline synthetase terminator (nose).

Vector 2 is identical to vector 1 except that the Cry 1 A (c) gene from Bacillus thuringiensis is replaced by the Cry V gene from Bacillus thuringiensis.

Vector 3 contains the alcR regulatory protein gene from Aspergillus nidulans driven by the 35S CaMV promoter, the alcA promoter region, the TMV enhancer, Cry 1A (c), and the nos terminator.

Vector 4 is identical to vector 3 except that the Cry 1 A (c) vector is replaced by the Cry V gene.

The Cry 1A (c) gene is an optimized Lepidoptera-specific synthetic sequence encoding an endotoxin from Bacillus thuringiensis and is shown in Figures 7 and 8. The sequence was obtained from Pamela Green, Michigan State University.

described in WO 90/13651.

The Cry V gene is a new endotoxin from Bacilluss thuringiensis entomocidal to the larvae of the Coleoptera and Lepidoptera series and is our International Patent Lecture No. 6,199,549. The Cry V gene is a modified synthetic sequence optimized for genetic coding in plants from which the RNA instability regions have been removed. It is shown in Figures 9 and 10.

Example 4

Vector preparation

Vector 1 - constitutive Cry 1 A (c)

Oligonucleotide primers for PCR were designed to amplify the omega TMV sequence in pMJB1 (see Figure 9) with the addition of a SalI restriction site flanking the XhoI site (see consensus oligonucleotide) and with a NcoI site and addition of the SalI and BglII sites to the reverse oligonucleotide.

Consistent oligonucleotide (SEQ ID NO: 1) SalI

5 'CTACTCGAGTCGACTATTTTTACAACAATTACCÄAC 3 ’

XhoI

Reverse oligonucleotide (SEQ ID NO: 2)

5 'CTAGGTACC GTCGAC GGATCCGTAAGATCTGGTGTAATTGTAAATAGTAATTG 3'

Kpnl Sali BamHI BglII

PCR was performed on the consensus and reverse oligonucleotide primers using pMJB1 plasmid DNA as a template. The resulting PCR product was cloned into the pTAg vector (LigATor kit, R&D system), then released by digestion with Asp 718 XhoI and cloned into the XhoI / Asp 718 digested plasmid pMJB1 (FIG. 10) to give plasmid pMJB3. Plasmid pMJB1 is based on pIBT 211 containing the CaMV35S promoter with a duplicated enhancer linked to a tobacco mosaic virus translational enhancer sequence replacing the 5 'untranslated tobacco spot virus leader sequence and terminated by a poly (A) nopaline synthetase signal.

The synthetic Cry IA (c) gene was excised as a BglII-BamHI fragment and cloned into pMJB3. Using HindIII and EcoRI, a fragment containing the amplified 35 CaMV promoter, omega TMV sequence, Cry 1 A (c), and nos terminator was isolated. The resulting fragment was ligated into EcoRI / HindIII digested plasmid pJRI (Fig. 12) to create a Bin 19 based plant transformation vector.

Vector 2 - constitutive Cry V pMJB3 was digested with HindIII and a linker inserted

HindIII-EcoRI-HindIII. The resulting vector was then digested with BamHI and the BamHI fragment containing the Cry V gene inserted therein. The Cry V gene was oriented using a combination of restriction digestion and sequencing. The EcoRI fragment from the resulting vector containing the enhanced 35 CaMV promoter, the omega TMV sequence, the Cry V gene, and the nos terminator was transferred to JRIRiMCS, a Bin 19-based vector containing a multiple cloning site from pUC18.

Vector 3 - inducible Cry 1A (c) pMJB3 containing the Cry 1A (c) gene was digested with SalI, releasing the fragment containing the omega TMV sequence fused to the Cry 1A (c) gene. The resulting fragment was cloned into SalI-digested AUC and oriented by restriction digestion. Using HindIII, the fragment containing the alcA promoter fused to the omega TMV sequence, the Cry 1 A (c) gene, and the nos terminator was excised, and transferred to HindIII cut with p35SalcRalcAcat, a Bin 19 based vector containing the 35CaMV promoter fused to the alcR cDNA report. alcAcat cassette removed by HindIII digestion.

Vector 4 - Inducible Cry V pMJB3 containing the Cry V gene was digested with SalI, releasing a fragment containing the omega TMV sequence fused to the Cry V gene. The resulting fragment was cloned into SalI-digested CAT A and oriented by restriction digestion and sequence analysis. Two fragments containing the Cry V alcA promoter and the nos terminator were released by digestion with HindIII. Triple ligation of the two HindIII fragments was performed by inserting the alcA CryV nos cassette into HindIII-digested p35αcRalcAcat and removing the alccat cassette. Correct assembly of the cassette was confirmed by restriction digestion, Southern blotting, and sequence analysis.

Example 5

Transforming plants

Transformation of leaves with Agrobacterium tumefaciens

The transformation was performed according to the procedure he published

Bevan 1984. Tobacco plants (Nicotiana tabacum cv. Samsum), 3-4 weeks old, grown sterile on MS medium, the leaves were cut off and the leaves were placed for 20 minutes in tumefaciens (strain LBA 4404) used for transformation. Margins cut into pieces. Leaf pieces of suspension of Agrobacterium cells transformed with plasmid pJRIRI with insert. The leaf pieces were then plated on NBM medium (i.e. MS medium supplemented with 6-benzylaminopurine (6-BAP) at 1 mg / L and naphthaleneacetic acid (NAA) at 0.1 mg / L). After two days, the explants were transferred to NBM culture flasks with the addition of antibiotics carbenicillin (500 mg / l) and kanamycin (100 mg / l). After 5 weeks, 1 shoot from each leaf disc was transferred to NBM medium with carbenicillin (200 mg / L) and kanamycin (100 mg / L). After a further 2 to 3 weeks, the complete regenerated plants (root branch) were transferred to fresh medium and, if necessary, the shoot was divided into 2 parts which were placed in separate containers. One shoot was then maintained as a stable tissue culture and the other was regenerated into a plant that had been transplanted to the soil and grown in the greenhouse after rooting.

By this transformation procedure, 4 vectors were introduced into tobacco plants and regenerated primary transformants (i.e. 1st generation of transformed plant) resistant to kanamycin. 53 primary transformants with a recombinant DNA molecule carrying a constitutive Cry 1 A (c), 54 transformants carrying a constitutive Cry V, 73 transformants with inducible Cry 1 A (c) and 62 carrying inducible Cry V were thus obtained.

Example 6

Leaf DNA extraction for PCR reactions

Leaf samples were taken from plants 3-4 weeks old that grew under sterile conditions. 5 mm diameter leaf discs were crushed for 30 seconds in 200 μΐ extraction buffer (0.5% sodium dodecyl sulfate (SDS), 250 mM NaCl, 100 mM Tris-HCl (tris (hydroxymethyl) aminomethane hydrochloride), pH 8). The samples were centrifuged for 5 minutes at 13000 rpm, and then 150 μΐ of isopropanol was added to the same volume of the top layer.

The samples were kept on ice for 10 minutes, centrifuged at 13000 rpm for 10 minutes and allowed to dry. They were then resuspended in 100 μΐ of deionized water. 2.5 μΐ was used for PCR performed under the conditions described by Jepson et al., Plant Molecular Biology Report 9 (2): 131-138, 1991.

Primary transgenic plants were tested by PCR to identify plants that contained the full length transgene:

Constitutive Cry 1 A (c)

Extracts from these plants were run 2 PCR reactions using the following primer pairs:

TMV1 5 'CTA CTC GAG TCG ACT ATT TTT ACA ACA ATT ACC AAC (SEQ ID NO: 3)

CRY1A2R 5 'CGA TGT TGA AGG GCC TGC GGT A (SEQ ID NO: 4)

PCR conditions were: 35 cycles, 95 'C 1.2 min, 62' C

1.8 min and 72 ’C 2.5 min and a final string extension of 6 min at 72’ C.

CRY1A1 5 'GCA CCT CAT GGA

CAT CCT.GAA CA (SEQ ID NO: 5)

NOS 5 'CAT CGC AAG ACC GGC AAC AG (SEQ ID NO: 6)

PCR conditions were: 35 cycles, 95 'C 0.8 min, 62' C

1.8 min and 72 ’C 2.5 min and a final string extension of 6 min at 72’ C.

The nine primary transformants that provided the PCR products for both sets of primers, together with the two PCR negative lines, were planted in 7.5 inch (19 cm) pots and placed in a greenhouse.

Constitutive Cry V

Two PCR reactions were performed on these extracts using the following primer pairs:

TMV1 (see above)

CRYV1R 5 'GCT GTA GAT GGT CAC CTG CTC CA (SEQ ID NO: 7)

PCR conditions were: 35 cycles, 94 C 0.8 min, 64 C

1.8 min and 72 C 2.8 min and chain extension for 6 min at 72 C. CRYV1 5 'TGT ACA CCG ACG CCA TTG GCA (SEQ ID NO: 8)

NOS (see above)

PCR conditions were: 35 cycles, 94 C 0.8 min, 58 C

1.8 min and 72 C 2, 0 min and chain extension for 6 min at 72 C.

Twenty-four primary transformants provided PCR products for both sets of primers, which were then planted together with seven PCR negative lines in soil in pots of size

7.5 inches (19 cm) and placed in a greenhouse.

Inducible Cry 1 A (c)

Three PCR reactions were performed on these extracts using the following primer pairs:

ALCR1 5 'GCG GTA GCG CTT TCA ACA GGC T (SEQ ID NO: 9)

NOS as above

PCR conditions were: 35 cycles, 94 C 1.8 min, 60 C 1.0 min and 72 C 1.5 min, and chain extension for 6 min at 72 C.

Primer pairs TMV1 / CRY1A2R, CRY1A1 / NOS were used as above.

Forty-five plants that provided PCR products for all primer sets, together with two PCR negative lines, were planted in soil in 6-inch (15.2 cm) pots in a greenhouse.

Inducible Cry V

Sixty-two primary transformants were produced, but no PCR analysis has been performed to date.

Example 7

Western blot analysis

120 mg of 3-4 week old plant tissue, which grew under sterile conditions, was crushed at 4 ° C in 0.06 g of polyvinylpolypyrrolidone (PVPP) to absorb phenol compounds and in 0.5 ml extraction buffer (1 M Tris) -HCl, 0.5 M EDTA (sodium ethylenediaminetetraacetic acid), 5 mM DTT (dithiothreitol), pH 7.8). Then 200 ml of extraction buffer was added. Samples were mixed and then centrifuged for 15 minutes at 4 ° C. The supernatant was discarded and protein concentration was determined by the Bradford assay using Bovine Serum Albumin (BSA) as standard. Samples were stored at -70 ’C until use.

25 mg protein samples with 33% (v / v) Laemmli color (97.5% Laemmli buffer (62.5 mM Tris-HCl, 10% (w / v)) sucrose, 2% (w / v) SDS, pH 6.8), 1.5% pyronine and 1% β-mercaptoethanol) were applied to a 17.7% (30: 0.174 acrylamide: bisacrylamide) SDS-PAGE gel (sodium dodecyl sulfate polyacrylamide gel electrophoresis) after 2 minutes of boiling.

The translation products were electrophoretically separated in the following buffer (14.4% (w / v) glycine, 1% (w / v) SDS, 3% (w / v) Tris-Baze). They were then transferred to a nitrocellulose filter (Hybont-CO, Amersham) by electrophoresis (Biorat unit) in the following transfer buffer (14.4% (w / v) glycine, 3% (w / v) Tris-Baze, 0.2% (w / v) SDS, 20% (v / v) methanol) at 40 mV overnight.

Whether the same amount of protein was applied was checked by decolorizing the nitrocellulose filter just after the transfer was complete in 0.05% CPTS (tetrasulfonic acid Cu-phthalocyanine 4-sodium salt) and 12 mM HCl. The filters were then stained with 2 to 3 rinses in 12 mM HCl and excess dye was removed with 0.5 M NaHCO _{3 solution} for 5 to 10 minutes, followed by rinsing in deionized water. The filters were blocked for 1 hour in TBS-Tween (2.42% (w / v) Tris-HCl, 8% (w / v) NaCl, 5% excess antiserum (w / v) BSA).

Tween 20 (polyoxyethylene sorbitan monolaurate), pH 7.6) containing 5% (w / v) BSA. They were then washed for 20 minutes in a TBS-Tween solution supplemented with 2% (w / v) BSA. Indirect immunodetection was performed with Cry 1 A (c) or Cry V antiserum at 1: 2000 dilution as the first antibody and with rabbit anti-rabbit antiserum at 1: 1000 dilution as the second horseradish peroxidase (HRP) conjugated antibody. Any elution was eluted with TBS-Tween supplemented with 2% ECL detection (enhanced chemiluminescence) was performed using the protocols described by Amersham. Any background was removed by further washing the membranes in the solution above. ECL detection was then performed.

The determination of the expression level of the B. thuringiensis gene was performed on an LKB 2222-020 Ultroscan XL laser densitometer (Pharmacia). A helium-neon laser beam (633 nm wavelength) viewed a 2.4 mm wide band in the center of the band corresponding to the translation products on the car radio.

Each peak was characterized by its area, calculated by the internal software of the instrument from the curve of absorbance versus beam position.

Example 8

Northern blot analysis

Total RNA was fractionated on a 1.2% agarose gel containing 2.2 M formaldehyde. After electrophoresis, RNA was transferred to a Hybont-N membrane (Amersham) by capillary transfer in 20x SSPE. RNA was fixed to membranes by a combination of UV irradiation (Strataling, Stratagene) and fusion for 20 minutes at 80 ° C. cDNA probes excised from pBluescript SK 'by digestion with EcoRI were labeled with the ³² PdCTP isotope using random primers as described by Feinberg and Vogelstein. Prehybridizations were performed in 5x SSPE, 0.1% SDS, 0.1% Marvel (milk powder), 100 mg / ml denatured salmon sperm DNA for four hours at 65 ° C. Hybridizations were performed in the same buffer containing the labeled probe at 65 ° C for 12-24 hours.

The filters were washed at 65 ° C in 3x SSC, 0.1% SDS for 30 minutes and once in 0.5x SSC, 0.1% SDS for 30 minutes before autoradiography at -80 ° C.

Experiments with insect pests

The efficacy of the present invention can be conveniently tested by monitoring how insect larvae eat leaves of transgenic plants containing the recombinant molecules of the present invention, both in the presence and absence of the inducer (control).

Example 9

Primary observation

The primary observation was by harvesting the leaves from the plants and cutting the leaves into 1 cm ² pieces. Individual samples were placed separately on 0.75% agar and each leaf piece was infected with approximately 10 sterilized Heliothis virescens eggs. The leaf discs were covered and incubated at 25 ° C and 70% relative humidity for 5 days prior to recording the larval feeding effect. Leaf damage was assigned a scale ranging from 0 to 2, graduated to 0.5. Stage 2 indicates zero leaf damage (ie complete protection from insect eating is provided) and level 0 means that the leaf disc has been completely destroyed by the larvae.

Leaves from all tissue cultures of the primary transformants of constitutive Cry1A (c) and wild-type tobacco were harvested and tested with Heliothis virescens larvae as described above. The results are shown in Tab. 2:

TA.BUEKÄ 2

Relative ;: | PCR-Z- A B C D E 35SCrvIA (c) 1 | 1 1 1 1 2 2 2 2 1 1 1 1 1.5 1 1.5 · » J 0 0 0 1 o 1 0 D 1 1.5 1 1.5 o 1 1.5 5 PCR + I 0 1.5 o 1 1.5 1 0 6 | 1.5 0 i 1 1.5 1.5 7 PCR + | 1.5 1.5 1.5 1 1.5 1.5 WITH 2 1.5 1 2 '2 9 PCR + 2 2 1.5 2 2 10 1.5 2 1 1 1.5 11 0 1.5 0 0 0 12 0 0 0 0 1 13 2 2 0 0 1 14 1.5 1 0 0 1 o 15 2 1 2 0 0 16 PCR + 2 2 2 2 I 1.5 ' 17 2 0 0 1 2 18 0 0 0 1.5 2 19 PCR + 1.5 1.5 1.5 0 1.5 20 PCR + 1.5 1.5 2 1.5 1.5 21 1 0 0 0 0 22 0.5 0 0 2 2 23 1 0 1 0 0.5 1 0.5 24 1.5 1.5 1 0 1 o 0 25 2 1 2 1 1 1 2 26 1 0 0 1 i 1 27 0 1 1-5 1 o 1 1.5 t o 28 | PCR. + 1 1.5 1 1-5 1.5 | 1.5 1 1.5 29 0 0 1 1 1.5

Samples: PCR +/- A B C D E 30 1 about 0 1.5 0 31 PCR + 1 0 1.5 o 1 1.5 32 2 1 1.5 0 1.5 n 2 2 2 2 1 2 34 1 0 0 1.5 2 35 0 2 0 1 1.5 36 2 0 2 2 0 37 2 1 1.5 1 1.5 38 PCR + 1.5 1.5 1.5 1.5 2 39 1.5 0 0 0 1 40 1 1 0 0 0 41 0 0 1 1 0 42 2 1.5 1.5 1.5 2 43 1.5 1.5 1.5 1.5 2 44 2 1.5 1.5 1.5 1 2 45 2 1 2 1 0 0 46 0 2 1 o 2 1 47 2 2 2 0 0. div. type of tobacco 1 2 2 2 0

In typical biological experiments, wild type tobacco predominantly gives an average score of less than 0.5.

Example 10

Primary observation - repetition

Eleven of the constitutive. C ry 1 A (c) greenhouse plants and wild-type tobacco were retested. This was to prove that the constitutive Cry 1 A (c) plants that grew in soil under greenhouse conditions for three weeks after tissue culture also showed reduced leaf damage by the Seliothis virascens larvae.

TABLE 3

sample and b C D e 35SCrvIA (c) 6 0.5 0.5 2 2 2 M / 2 1 2 2 2 9 0.5 0.5 2 1 0.5 16 2 2 2 2 19 2 2 1.5 2 1.5 20 1.5 1 0 0.5 2 28 0.5 1.5 2 2 2 31 0 0 about 0 1.5 -í * » 2 • 2 2 2 7 38 1 0 1 2 1 42 1 1 1 1 1 div. type of tobacco 0 0 0 0 1.5

Example 11

The primary observation of the primary crystals in cry

In the manner described above, leaves were naturally transformed with constitutive Cry V and wild-type tobacco. The damage caused to the cut-off sheets is recorded in Table 4 below.

TABLE 4

sample 1 PCR +/- and b 1 C D 3SSCrvV 1 1 + 0 0 0 0 2 0 0 0 0 3 1 1.5 0 1 0 4 + 0 0 0 0 5 0 0 0 0 6 0 0 0 0 7 + 0 0 0 0 8 0 0 0 0 9 + 0 0 0 0 10 + 0 0 0 1 o 11 + 0 0 0 0 12 0.5 1 1 0.5 13 + 0 1 0 0 0 14 +. 0 0 0 0 15 + 0 0 0 0 16 0 0 1 o 0 17 0 0 0 0 18 0 0 1 o t 0 19 1 0 1 o 0 1 0 I 20 0 0 0 0

Sample 1 PCR +/- a b C D 21 1 0 0 | 0 | 0 22 + 0 0 0 0 23 + 0 0 t 0 0 0 24 +. 0 | 0 0 | 0 25 + 0 0 0 0 26 + 0 0 0 0 27 o | about 0 0 28 1 0 1.5 1 29 + | 0 | 0 0 1 0 30 0 0 | 0 | 0 31 + 0.5 0.5 | 0.5 0 32 + 0 0 0 | 0 33 0 0 0 0 34 0 1.5 0 0 35 0 0 0 0 35 0 0 0 0 37 0 0 0 1.5 38 0 0 0 0 0 39 0 0 0 0 40 1 o 0 0 0 41 + 0 0.5 0 1.5 42 | 0 0 0 0 43 0 0 0 0 44 0 0 0 0 45 + 1 0 0 0 0 46 + 0 0 0 0 47 0 0 0 0 88 + 0 0 0 0 49 0.5 0.5 0 0 50 0 0 0 0 51 1 0 | 0 | 1 52 1 0.5 0.5 0.5 div. type of tobacco 0 0 0 1.5

Example 12

Secondary observation

In order to verify the data obtained from the primary observation, a secondary observation of leaf damage was performed on larger pieces of leaf from transgenic lines using larvae at the third larval stage.

Tobacco leaves were cut from the plant and kept on ice for up to one hour. 40 mm diameter discs were cut from the leaves and placed, epidermis down, on 3% agar in 50 mm plastic trays. Heliothis winter larvae kept on LSU for five days at 25 ° C were weighed and used to infect leaf discs, one per disc at the third larval stage. After infection, the dishes were capped and stored at 25 ° C under diffused light. After three days, the mortality, the developmental stage and how many percent of the leaf disc were consumed by the larvae were evaluated. Larvae were also weighed after three days.

TABLE 5

% DRIVE DAMAGE 1 SAMPLE A 1 B 1 c 1 D E 1 F I G 1 H 1 I 1 J 1 div. type of tobacco 20 15 1 70 1 20 1 30 80 30 I 80 1 o 95 | 35SCrvlAc) 7 <5 1 <5 1 <5 <5 1 <5 1 <5 <5 1 <5 1 <5 <5 1 16 <5 1 <5 1 <5 <5 1 10 1 10 <5 1 <5 1 <5 <5 | 19 <5 | 10 1 10 15 1 10 5 10 1 <5 1 <5 20 20 <5 1 <5 1 <5 <5 1 <5 1 <5 <5 1 <5 1 <5 <5 1 28 <5 1 <5 1 <5 <5 1 <5 1 <5 <5 1 <5 1 <5 <5 1 29 20 <5 1 <5 30 1 25 1 25 30 1 25 1 25 i 25

larval DEVELOPMENT STAGE 1 div. type of tobacco 4 3 5 1 3 | 3 1 5 1 4 1 5 1 3 1 5 1 35SCrvlAic) 7 | 3 3 1 J 1 3 1 3 1 «·» J 1 3 1 J 1 3 i 3 1 16 □ 3 1 3 1 3 | 3 1 J 1 3 1 3 1 3 1 3 1 19! J 3 1 J I 3 1 3 1 0 1 3 1 3 1 3 1 4 1 20 3 3 1 3 1 3 | 3 1 n J 1 3 1 J 1 3 1 3 1 28 J 3 1 J 1 3 | 3 1 J 1 3 i J 1 3 1 3 1 29 4 3 3 1 5 4 1 4 1 4 4 l · j I 3 1 1 MORTALITY div. type of tobacco L 1 L . L 1 L | L 1 L 1 L L 1 D L 35SCrvlA (c) 7 L 1 D D 1 L | D 1 D 1 D D 1 D D 16 D 1 D D t D | L 1 L 1 L L 1 D L 19 D 1 L L 1 L I L 1 L 1 L D 1 L 1 L 20 D 1 D D 1 D I D 1 D 1 L 1 L 1 D 1 L 28 D 1 L D | D | D 1 D 1 D 1 L 1 L 1 D 29 L 1 L 1 D 1 L 1 L 1 L 1 L 1 L 1 L 1 L

I Π

Example 13

Inducible insecticidal activity

Forty-five inducible Cry 1 A (c) PCR positive lines, two PCR negative lines and wild type 6 inch (15.2 cm) potted tobacco were immersed in the roots in 100 mL of 5% ethanol. 28 hours later, small pieces of leaves were collected in 4 replicates and infected with Heliothis virescens eggs. The results are shown in Table 6. Of the 45 lines growing in the presence of ethanol, 66% showed full resistance in the primary observation with Heliothis virescens. To prove that the plants were indeed inducible and did not express the resistance gene constitutively, leaves from 7 high-score lines were infected 8 days later and infected with Heliothis virescens eggs. Previous data from reporter gene tracking driven by the 35SalcRalcA switch promoter showed that CAT protein activity levels peaked at 24-48 hours and were descending at 48 hours (Fig. 1). Other data (not shown) showed that 9 days after induction, CAT protein was not detected at all.

Table 7 shows that without ethanol spraying, the mortality level was comparable to that observed in the wild-type control.

TABLE 6

Heliothis virescens on ALC Cryl A (c) primary transgenic greenhouse plants roots in 5% ethanol, 28 hours before the test 1 | 1 1 Identity j PCR +/- 1 3. I b 1 c 1 ♦ and ALCCrvIA (c) 1 | + i i 1 2 2 2 2 1 + 2 2 1 2 1 < » J + 1 0 o 1 o 1 1.5 4 1 + i 2 2 2 1 2 5 1 1 T 0.5 0.5 0.5 | 1 6) - 2 1 0.5 0 7 + 1 0 I 2 1.5 2 8 + 2 2 2 2 9 + 2 2 2 2 10 + 2 2 2 2 11 + 2 2 2 2 12 + 2 2 2 2 13 2 2 2 1 2 14 + 2 2 1 2 2 15 + 2 2 1 2 1 2 16 2 2 2 2 17 + 2 2 2 2 18 + 2 2 1 2 19 + 2 2 2 2 20 + 2 2 2 ) 2

21 + 0 0 0 1 22 + 0.5 2 0.5 2 23 + 2 2 2 1 2 24 2 1 2 7 2 25 + 2 2 2 2 26 + 2 2 2 2 27 + 1 2 2 2 28 + 0.5 2 2 2 29 + 2 2 2 7 30 + 2 2 7 2 31 + 2 2 1 2 32 + 2 2 2 2 33 + 1 2 2 7 34 + 2 2 2 2 35 + 1 7 2 2 36 + 2 2 2 1 37 + 0 0.5 0 1 38 - 0.5 0.5 0.5. 0.5 39 + 2 2 2 2 40 + 2 2 2 2 41 + 2 2 2 7 42 -U 2 2 2 2 43 + 2 2 2 2 44 + i 2 2 2 2 45 + 2 2 2 0.5 46 + 2 2 2 2 47 -L 1 2 2 2 div. type of tobacco 0 0.5 0 0.5

>

<

heehaw

H

ABOUT

CQ <

Eh

• they from < > J *. w \> from and R ° from Ό - 0.5 0.5 0.5 - 0.5 0.5 0.5 about and 0.5 I - 0.5 0.5 about 0.5 0.5 0.5 about 0.5 - n and ABOUT 04 0.5 about about - Cu 0.5 1.5 H-L 0.5 0.5 0.5 0.5 about about T + & at ph + + + + + + + idculihi r- 32 39 about T ΟΊ 'T 44 ? 1 INDUCED Ό 04 04 n 04 04 04 04 0.5 ABOUT 04 04 04 04 04 04 04 about _ω 04 04 04 M 04 04 04 m ABOUT honor 04 04 04 04 04 04 04 about PCR +/- + + + + + + + J3 θ'- | 32 39 ABOUT 'T m 'T ^ r à

Several lines were selected for secondary observation to verify the effect of induction on insect feeding, along with the constitutive Cry 1 A (c) line 10 and wild type tobacco as controls. 10 leaf pieces were taken from the primary transformants of each line 12 days after being induced by soaking roots in 100 ml of 5% ethanol and placed on 3% agar in 50 mm lid plates and incubated overnight at 25 ° C and 60% humidity. . Cry 1 A (c) protein expression was expected to be low or undetectable after 12 days. The plant roots were then soaked in 100 ml of 5% ethanol. 22 hours later, the leaves were cut and 10 pieces of 40 mm leaf were removed and placed on 3% agar in 50 mm lid plates. 5 non-inducible leaf discs and 5 ethanol-inducible leaf discs were infected with Heliothis zea larvae in the third stage and 5 discs of each type were infected with Heliothis virescens larvae raised as described above. Table 8 shows that the wild-type control shows a high percentage of leaf discs consumed in the presence or absence of ethanol, while the 35S control samples show good control of insect damage in both chemical regimens. Transgenic lines containing the recombinant Ale 1A (c) molecule show poor control of insect damage unless treated with ethanol. Table 8 shows that ethanol induction provides a measure of insect damage control with 35S Cry 1 A (c) control.

TABLE 8

whose .sla 1 to S = H. zea numbers 6 to 10 = Ξ. vix; 55CSS3 line % poško- % poško- lation lation div. uninduced type} 45 div. type induced 1 55  2 0 55 J 25 j 95 4 30 4 50 5 45 5 25 1 6 95 6 25 7 5 7 55 8 50 8 30 Q ✓ 20 9 20 10 15 10 25 35S / 10 not induced 1 10 35S / 10 induced by 1 <5 2 <5 2 <5 n J 15 n J 3 4 10 4 5 5 <5 5 5 6 0 6 <5 7 <5 7 10 8 <5 8 <5 Q ✓ <5 9 0 10 <5 1C 5

66 not induced 1 15 66 induced by l | <5 2 10 2i <5 ** J 0 3 | <5 4 50 4 (<5 50 51 10 1 1 6 ίο 1 6 | 0 ** / 10 71 <5 8 | 15 1 8 <5 9 o 1 91 <5 10 10 10 | <5

Industrial-usability

The present invention provides a gene system wherein genes encoding active insecticidal proteins, such as e.g.

B. thuringiensis 6-endotoxins are expressed in an inducible manner dependent on the use of a specific chemical. Thus, a protein with an insecticidal effect is only expressed in the plant after the exogenous application of the chemical inducer. Another possibility is in a similar way to induce a metabolic pathway that leads to the production of insect damaging metabolites.

The use of the plant gene expression cassette of the invention for plant transformation will reduce damage to the transformed plants by insect pests of the Lepidoptera and Coleoptera order.

The use of the plant gene expression cassette of the invention will improve the efficiency of the integrated plant protection system.

Examples of plants that can be genetically modified according to the invention are field crops, cereals, fruits and vegetables such as rape, sunflower, tobacco, sugar beet, cotton, soybean, corn, wheat, barley, rice, sorghum, tomatoes, mango, peach , apple, pear, strawberry, banana, melon, potatoes, carrots, lettuce, cabbage and onion.

LIST OF SEQUENCES (1) GENERAL INFORMATION (i) APPLICANT:

(A) NAME: ZENECA LIMITID (B) STREET: 15 Stanhope Gate (C) CITY: London (E) STATE: UK (F) POST CODE: W1Y6LN (ii) NAME OF THE INVENTION: CHEMICALLY INDUCABLE

(Iii) NUMBER OF SEQUENCES: 9 (iv :) COMPUTER READABLE FORM:

(A) MEDIA TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: PatentIN Release # 1.0, # 1.30 (EPO) (vi) PRIORITY APPLICATION:

(A) APPLICATION NUMBER: GB 9516241.8 (B) filing date: 08-AUG-1995 (2) INFORMATION ON SEQ ID NO. 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) FIBER TYPE: single (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 1:

CATCTCGAGT CGACTATTTT TACAACAATT ÄCCAAC

PLANT

Version (2) INFORMATION ON SEQ ID NO. 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 53 base pairs (B) TYPE: nucleic acid (C) FIBER TYPE: single (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 2:

CTÄGGTACCG TCGÄCGGATC CGTAAGATCT GGTGTAATTG TAAATAGTAA TTG 53 (2) INFORMATION ON SEQ ID NO. 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 3:

CATCTCGAGT CGACTATTTT TACAACAATT ACCAAC 36 (2) INFORMATION ON SEQ ID NO. 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) FIBER TYPE: single (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 4:

CGATGTTGAA GGGCCTGCGG TA 22 (2) INFORMATION ON SEQ ID NO. 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 5:

GCACCTCATG GACATCCTGA ACA 23 (2) INFORMATION ON SEQ ID NO. 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) FIBER TYPE: single (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 6:

CATCGCAAGA CCGGCAACAG 20 (2) INFORMATION ON SEQ ID NO. 7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (xi) SEQUENCE DESCRIPTION: K SEQ ID NO. 7:

GCTGTAGATG GTCACCTGCT CCA 23 (2) INFORMATION ON SEQ ID NO. 8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) FIBER TYPE: simple (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (Xi) SEQUENCE DESCRIPTION: SEQ ID NO. 8

TGTACACCGA CGCCATTGGC A (2) INFORMATION ON SEQ ID NO. 9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) FIBER TYPE: single (D) TOPOLOGY: linear (ii) MOLECULA TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 9:

Claims (12)

PATENT CLAIMS A chemically inducible plant gene expression cassette comprising a first promoter operably linked to a regulatory sequence derived from an alcR gene and encoding a regulatory protein, and an inducible promoter operably linked to a target gene encoding an insect harmful protein or whose expression induces a metabolic pathway producing an insect-damaging metabolite, wherein the inducible promoter is activated by a regulatory protein in the presence of an effective exogenous inducer, so that application of such an inducer causes expression of the target gene. The chemically inducible plant gene expression cassette according to claim 1, wherein the target gene encodes an orally active insecticidal protein. The chemically inducible plant gene expression cassette of claim 2, wherein the orally active insecticidal protein is at least a portion of a B. thuringiensis 6-endotoxin. The plant gene expression cassette according to any one of claims 1 to 3, wherein the inducible promoter is derived from the alcA gene promoter. The plant gene expression cassette according to any one of claims 1 to 4, wherein the inducible promoter is a chimeric promoter. A plant cell comprising the plant gene expression cassette according to any one of the preceding claims 1 to 5. The plant cell of claim 6, wherein the plant gene expression cassette is stably inserted into the plant genome. A plant tissue comprising a plant cell according to any one of claims 6 and 7. A plant comprising a plant cell according to any one of claims 6 and 7. A plant derived from a plant according to claim 9. A plant-derived seed according to any one of claims 9 and 10. An insect control method comprising transforming a plant cell with a plant gene expression cassette according to any one of claims 1 to 5.