CA2255830A1 - Use of a novel glucosyl transferase - Google Patents

Abstract

This invention relates to methods for inducing plant defence and resistance responses as well as regulating plant developmental events in monocots and dicots by modifying a gene encoding for a glucosyl transferase (TWI1) isolated from wounded tomatoes.

Description

USE OF A NOVEL GLUCOSYL TRANSFF'RASE
This _nvention relates to a method for i:~ducing plant defence and resistance responses and regulating plant developmental events. More particularly, this invention relates to methods for inducing the production of plant defence proteins such as pathogenesis-related (PR) proteins and proteinase inhibitor (pin) proteins and to methods for regulating resistance and acquired resistance to predators, insects, bacteria, fungi and viruses in plants, through manipulating levels of the plant hormones: salicylic acid, jasmonic acid, cytokinins and ethylene, and to methods for regulating developmental events that depend on these hormones, particularly, plant growth, reproduction and senescence.
Adaptation of a plant to its environment is brought about by recognition and response to external stimuli which cause changes in cellular activity. A chain of events link the initial recognition of the stimu2us to chances in cells of the plant that ultimately lead to adaptation. These events constitute a signal transduction pathway, in which sequential molecular interactions transduce (lead) the signal from its perception through to the end-effects caused.
Plants respond to a vast range of environmental stimuli that include, for example: changes in their growing conditions (light, heat, cold, drought, water-logging etc); mechanical damage leading to injury, and challenge by pests and pathogens (herbivores, insects, fungi, bacteria, viruses etc). These stimuli lead to cellular events at the sites) of perception, but also can trigger long-range events throughout the plant, WO 97/45546 PCTlGB97101473 leading to systemic changes. Thus, Lor example, in response to wounding and to pest/pathogen challenge, there are local and systemic events induced with signal transduc~ion pathways occurring at the local site, systemic signals) communicating the local events around the plant, and signal transduction pathways occurring in distant cells that are responding to the systemic signal(s). Networking and cross-talk between infra- and inter-cellular signal transduction pathways is recognised to be an important means through which the plant integrates all of the information received from the environment.
Plant hormones play a central role in these induced responses to environmental stimuli, since they act as the intermediate molecular signals which trigger the transduction pathways leading from the external changes) in the environment to the internal end-effect(s) within the plant. For example, in a variety of plant species, jasmonic acid is known to accumulate transiently during the wound response and has been implicated in transduction events linking mechanical injury to activation ef wound-responsive genes.
Another example is during the interactions of plants with pests and pathogens, when salicylic acid is known to increase in quantity (together with its precursor, benzoic acid and its volatile form, methyl salicylate) and is considered to be a central regulator of local and systemic acquired resistance and the activation of defence-related genes associated with resistance.
Whilst salicylic acid is a positive regulator ef these induced resistance responses, there is evidence to show that the hormone is also a negative regulator of the wound response, such that if a plant is pre-treated with aspirin or salicylic acid, wound-responsive genes dependent on jasmonic acid for their expression are not induced X1,2,3,4]. This suggests there is ' 5 communication between the signalling pathways induced by mechanical injury and induced by pests/pathogens, such that they do not occur simultaneously.
Senescence is the natural process which normally leads to cell death, either in a selected population of cells such as abscission cells or in whole organs such as flowers, leaves and fruits. This process of senescence can be developmentally regulated, such as, for example, in the ripening process, wilting and fading of flowers, yellowing and abscission of leaves. Alter:~atively, senescence and cell death can be induced by trauma, such as caused by, for example, chemicals, temr~erature extreme, pest and pathogen damage, disease or mechanical wounding.
The level of an active plant hormone in plant cells and tissues at any one time is dependent on the relative rates of its synthesis and degradation, the rates of transr~ort to or from the cells/tissue, and the relative rates of ,'~ts conversion to and from inactive metabolite(s). For plant hormones, this conversion to an inactive metabolite can involve the conjugation of the free active form of the hormone to a polar molecular species, such as a sugar, amino acid or peptide. endogenous hormones made by the plant, and exogenous hormones applied to and taken up by the plant are subject to conjugation in this manner. When large quantities of exogenous hormones are applied to the plant the conjugation process has been likened to WO 97!45546 PCT/GB97/01473 detoxification since it effectively clears the active rormones from the system rapidly.
S_nce the process of conjugation is known to be retrersible in plants, at least for some hormones, it provides a flexible mechanism for regulating the pool size of active hormone in the absence of synthesis and degradation. Also, since most plant hormones are either apolar or amphiphilic, their reversible conjugation to a polar molecule provides a useful mechanism for containing the hormone on one side or other of a membrane, such as in the apoplast, or in a particular compartment of the symplast.
Whilst many different conjugates of plant hormones have been identified, a commonly found conjugate is the glucoside, formed through the transfer of glucose from a sugar nucleotide donor to the hormone via a Vii, O-glycosidic linkage. The enzymes responsible are Q~ucosyl transferases and the available evidence i::dicates that each transferase is highly specific for ~~e particular hormone it conjugates. For example, the c~~_ucosyi transferase responsible for conjugation of the p-pant hormone, indole 3-acetic acid, has been identified and shown to be specific for the auxin substrate [5]. Similarly, the glucosylation of salicylic acid has also been investigated, and an enzyme activity identified in a variety of plant species has been shown to be specific for salicylic acid and the sugar nucleotide donor, UDP glucose [6].
A~:other important hormone is ethylene which is a gas u..~.der physiological conditions that influences a wide _ange of events in plants, including the regulation of growth, cellular differentiation and developmental processes. In particular, ethylene is the key regulator of senescence, which as stated above, is a genetically controlled process cf degeneration normally leading to cell death and which occurs in specific cell-types and in whole organs such as flowers, leaves and fruits. The effects of ethylene on developmental processes are of considerable commercial importance.
The effects can occur at low concentrations, whether the gas is produced by the plant itself or applied exogenously to the plant. Ethylene is also involved in defence/stress and resistance responses, such as directing how the plant combats challenges from pests and pathogens, and during the consequences of abiotic stimuli, for example, mechanical injury and water-logging. In these defence/stress and resistance responses, ethylene has a direct effect on the activation of specific genes, as well as a role in inducing cell death associated with hypersensitive responses.
Generally, ethylene is maintained at very low levels in plant tissue, but production can be rapid and massive during the senescence process, or during stress/trauma caused by biotic and abiotic stimuli.
During the degenerative process of senescence, ethylene synthesis is regulated by positive feedback, such that one action of the ethylene produced is the up-regulation of the synthetic machinery and thus further production of more ethylene leading to an autocatalytic avalanche of increased levels of the hormone. In contrast, during stress/trauma, she "wound" or "stress"
ethylene produced is regulated by negative feedback, leading to a hormone transient. Ethylene has been shown unequivocally to be a requirement for the developmental senescence process. The role of "wound"
ethylene is less defined.
The ethylene signal transduction pathway is the most characterised of all plant hormones to date, with the identification of genes encoding a receptor, a negative regulator protein and a number of proteins implicated genetically in downstream events f7]. In contrast, very little is known of the regulation or the mechanismis) by which ethylene levels rise in response to the environmental stimuli and to pest and pathogen attack.
Since plants have evolved inducible mechanisms of defence that respond to attack by pests and pathogens, there is considerable commercial interest in identifying methods of induction which will protect and even enhance the natural resistance of the crop plant.
This is particularly relevant when the only agrochemicals available are hazardous both to the environment and the consumer. Often, during the natural course of a defence response to pest and pathogen challenge, a broad spectrum of defence-related genes and physiological events are induced in parallel and their success at conferring resistance arises from the multiplicity of their actions. Long-term efficacy of this strategy is much greater than that achieved by genetically modifying crop plants with single defence-related genes. This is because in field situations the alteration or insertion of a single defence-related gene can be overcome by pests and pathogens rapidly evolving and adapting to the single gene change. In addition, decreased crop yields and decreased product quality are features commonly encountered in resistant cultivars. Thus, there exists a strong requirement for ' new materials and processes to improve the resistance of plants under attack by pests and pathogens. This ' S would preferably be through the induction of the plant's own defence systems.
There is also considerable commercial interest in identifying the molecular "switches" which respond to non-hazardous chemicals applied to the plant, and in turn, recrulate developmental and defence responses, where and when applied. Whilst some inducible promoters have been found that are responsive to various chemicals, (e. g. PR gene promoters responsive to dichloroisonicotinic acid (DCINA) [8] which can be used to drive the expression of genes of interest), the range of applications envisaged could be increased dramatically if more promoters and more chemical inducers were identified. By way of background, DCINA
is a widely used agrochemical which induces systemic acquired resistance (SAR) and is thought to act at a point downstream of salicylic acid in the transduction pathway leading to SAR gene expression.
For plant resistance and post-harvest protection of raw material quality, the speed of the defence response mounted by the plant cells/tissues, often determines the overall success-rate. Therefore, major interest lies in identifying rapidly responding promoters and, dependent on the application, those that are either capable of driving expression in a wide range of cell-types or those that are highly specific to a particular cell-type or tissue, for example, epidermal cells or lsaves, but not stems, etc.

There is also major commercial interest in identifying ways in which senescence can either be controlled, prevented completely, the time-span of senescence regulated, or its occurrence induced only when required. Since senescence is intimately associated with ethylene, the problems of senescence are really problems of ethylene quantity and ethylene action. For example, in the post-harvest care of fruits, vegetables and flowers, cuts and bruising can stimulate ethylene production which in turn causes cell death in the traumatised tissues as well as affecting the adjacent fresh produce. This in turn leads to massive losses in the quality of these materials during transportation and storage. Traditional technologies addressing post-harvest issues have been tried for decades but suffer from problems of side-effects, toxicity, high costs and an inability to shut down completely ethylene synthesis [9] .
In the present invention, a gene TWI1, whose existence had previously been established as merely being a "wound inducible" gene but whose true function, until now, was completely unknown, is disclosed. It is now known by way of our invention that the TWI1 gene codes for a giucosyl transferase (GTase) which regulates levels of a key signalling intermediate. Through detailed analyses of the expression patterns of TWI1 in tomato, this gene is believed to function in those signalling pathways leading to developmental and defence responses controlled by ethylene. Using transgenic plants with modified levels of TWI1 expression, we demonstrate a key role for this gene in plant responses to wounding and to pathogens.

WO 97/45546 PCTIGB97/01473 _ A disclosure oz a partial sequence on an EMBL database of a wounded tomato leaf library indicated that the TWI1 cDNA might possibly encode ror a GTase. However, no indication was given as to the induction patterns of the TWI1 gene nor the possible function oz its product.
These factors were not deducible from the partial sequence disclosed, nor from the source of the mRNA
from which the cDNA was derived. This invention, therefore, provides the first-ever correlation between GTase action and the regulation of ethylene, a common intermediate in a diverse process in plants.
Accordingly, the present invention provides a method of altering the signalling pathways of a plant involving salicylic acid, ethylene and jasmonic acid. The method comprises interfering with the normal functioning of the TWI1 gene encoding a GTase _:, plants. This is particularly useful in tomato plants, however, this invention would apply with similar advantage to other dicotyiedonous or monocotyledonous plants (i.e. broad-leaved plant species as well as grasses and cereals).
This invention is applicable to any horticultural or agricultural species, including hose in which fruit-ripening and/or post-harvest storage are important considerations.
according to one aspect of this invention, there is provided a recombinant or isolated DNA molecule which encodes for a glucosyl transferase in plants. In preferred embodiments, the GTase gene (TWI1) comprises the nucleic acid~sequence or at least portions (or fragments) of the nucleic acid sequence shown in FIGS 1 and 2. Also sequences having substantial sequence homology with the TWI1 gene of :IGS 1 and 2 are also claimed .-~_ this invention. Moreover, sequences having substantial sequence homology with the amino acid sequence encoded by the TWI1 gene (FIG 3) are claimed as part c~ this invention.

The term "portions" or "fragments" as used herein should be interpreted to mean that a sufficient number of nucleic acid or amino acid residues are present for the fragment to be useful (i.e. to act as or encode a 10 GTase). Typically, at least four, five, six, up to 20 or more residues may be present in a fragment. Useful fragments include those which are the same as or similar or equivalent to those naturally produced by the TWI1 Qene or its equivalent gene and enzyme in other plants, for example, as in FIGS 4 and 5 for rice and tobacco, respectively.
As used i~ the present application, substantial sequence homology means close structural relationship between nucleotides or amino acids. For example, substantially homologous DNA sequences may be 60%
homologous, preferably 80o and most preferably around 90 to 95% homologous, or more, and substantially homologous amino acid sequences may preferably be 35%, more preferably 500, most preferably more than 50%
homologous. Homology also includes a relationship wherein one or several subsequences of nucleotides or amino acids are missing, or subsequences with additional nucleotides or amino acids are interdispersed. When high degrees of sequence identity are present there may be relatively few differences in the amino acid sequences. Thus, for example, they may be less than 20, less than 10, or even less than 5 differences in amino acid sequences.

The degree of amino acid sequence identity can be calculated, for example, using a program such as "BESTFIT" 'Smith and Waterman, Advances in Applied Mathematics, pp. 482-489 !1981)) to find the best segment ~~ similarity between any two sequences. The alignment is based on maximising the score achieved using a matrix of amino acid similarities, such as that described by Schwarz and Dayhof !Atlas of protein Sequence and Structure, Dayhof, :~I.O., pp. 353-358).
Using the TWI1 cDNA sequence as a probe to analyze expression of the GTase during a pathogen response in tomato, we observed that the gene is induced during gene-for-gene mediated resistance (R) response involving the Cf9 R gene to Cladosporium fulvum.
Similarly, using a homologous GTase gene which we isolated from tobacco as a probe (FIG 4), we also found induction during gene-for-gene mediated R response involving the N gene to tobacco mosaic virus (TMV). In this latter system, induction of the GTase gene in response to TMV was causally dependent upon the elevation of salicylic acid. These data imply a role for the TWI1 gene product in salicylic acid-mediated pathogen responses. Thus, an object of this invention is the use of TWI1 gene in stimulating or improving pathogen. related responses in plants, through induction of the GTase and thus effecting the levels of salicylic acid normally present in the plant (i.e. a wild-type plant ) .
In transgenic tobacco plants which constitutively express t:~e GTase at a high level) we found that the ~ formation of necrotic lesions and the induction of PR-gene expression in response to the bacterial elicitor, i2 harpin L10], is completely suppressed. In contrast, in plants ~n whim GTase expression is repressed, the response to harpin is enhanced. These data show that the GTase gene product impacts directly on events at the local site of challenge with consequences on the process of acquired resistance. Importantly, the implication is that in transgenic plants expressing an antisense gene to the GTase, a hypersensitive response (HR) and acquired resistance to pathogen challenge may be enhanced.
In wound response, JA and ethylene are causally required for pin gene expression. The elevation of endogenous JA is very rapid and transient and is dependent on ethylene action [Bowies, et aI, unpublished dataj. Salicylic acid applied to plants prior to wounding inhibits this elevation in JA
completely and also inhibits pin gene expression [Bowies, et a1, unpublished data]. The wound induction of the GTase is also very rapid with a parallel time-course to the elevation in JA. In plants expressing the TWI1 antisense gene, wounding does not induce pint expression. Expression of the gene encoding ethyiene-forming enzyme occurs as normal, but in contrast to wild-type plants, in the transgenic plants the down regulation no longer occurs. This provides further direct evidence for the role of the GTase gene product in the regulation of ethylene and ethylene-dependent responses.
GTase activity as it relates to ethylene has never previously been identified nor contemplated. This would not be an obvious nor routine method to follow despite existing literature on GTases. Further, the ~3 developmental pattern of expression of any GTase is developmentally-regulated. This is demonstrated by the attached examples, wherein GTase is expressed at high levels in ethylene-mediated processes such as fruit-s ripening and senescence. Moreover, since the gene was not previously available for relevant antisense experiments, the opportunity to analyze the effects of GTase down-regulation on ethylene did not exist prior to this invention.
In this invention, we utilise antisense technology to demonstrate that down-regulation of GTase leads to prolonged levels of stress ethylene. Therefore, a further aspect of this invention is the use of the aforementioned GTase or any functional homologues thereto for use in down regulating GTase in a plant of interest.
Thus, according to a further embodiment of this invention, there is provided antisense nucleic acid which includes a transcribable strand of DNA
complementary to at least part of the strand of DNA
that is naturally transcribed in a gene encoding GTase.
This involves the construction of transformation vectors possessing either the entire or partial coding sequence of the homologous GTase crene from the species to be transformed in the reverse orientation, under the transcriptional control of a constitutive promoter such as the Cauliflower Mosaic Virus 35S promoter and a transcription terminator sequence such as the Agrobacterium tumefaciens nos terminator. Also present in the vector, it is preferable, but not necessary, to include a plant selectable marker gene which enables a plant transformed with the TWI1 gene or a gene WO 97/45546 PCT/GB97101473 _ substantially homologous thereto, to be distinguished from giants not so transformed. Such markers may include, nor example, neomycin phosphotransferase II or hygromycin phosphotransferase. Typically these select,:~ve markers are for antibiotic or herbicide resistance. Vectors containing these sequences may either be broad host range binary vectors useful for Agrobacterium-mediated transformation such as those derived from pBinl9 [13], or standard E. coli vectors useful for production of high levels of plasmid for transformation mediated by particle delivery. In addition to the tomato GTase antisense construct described in the examples below, we have also produced an antisense construct using sequences from the tobacco GTase gene of FIG. 4.
To achieve over-expression of the GTase, the coding sequence or portion of the coding sequence of the tomato TWI1 cDNA, or a coding sequence encoding an active homologous GTase isolated from any other organism or a nucleic acid sequence synthetically produced by means well-known to those skilled in the art, may be placed under the control of promoters activated specifically in the tissues of interest, these being preferably ripening fruit and senescing leaves or flowers, and followed by a transcription terminator sequence.
In the present invention, through use of Northern analyses, we show for the first time that a high expression of GTase exists in senescence and in ripened fruits. The implications of this are great, namely there may be an increased "need" for the GTase in ethylene-mediated events.

WO 97/45546 PCT/GB97/01473 _ ,;
On an application point, it is easier to obtain the over-expression effects in any plant species since a heteroiogous gene will produce the same effects. For an antisense approach, the homologous gene is preferred and may be isolated for any commercially important plant or crop.
Another aspect oz this invention is the use of a promoter comprising the 5' upstream region of the TWI1 '_0 GTase gene. The promoter claimed under this invention or one similar substantially homologous? to that of FIG 2 isolated from plants other than tomato would exhibit activation characteristics including rapid activation following mechanical wounding or pathogen ~.5 attack, including activation by salicylic acid, various salicylic acid analogues thereof and the functionally-related compound, DCINA. We show that the wound induction of the TWI1 gene and the induction by the chemical elicitors is via two independent pathways.
20 Also, promoters of homologous GTase genes from other plant species exhibiting similar activation characteristics in their respective species are also claimed by way of this inver_tion.
25 Activation of the GTase at the appropriate times using promoters derived from other sources is also claimed within the scope of this invention ((e.g. at the onset of senescence; e.g. Arabidopsis SAG12 promoter [11]) or at the onset of ripening (e. g. tomato poiygalacturonase 30 promoter [12] ) ) .
The promoters in the present inventicn were isolated from clones obtained from a commercial genomic library of tomato by using TWI1 cDNA sequence as a probe.

Sequencing of such clones identified the GTase coding sequence, with the 5' upstream region to approximately kilobases of the GTase transcription start sequence considered to be the promoter. Promoters of similar or 5 substantially homologous GTase genes to the TWI1 gene of wounded tomato plants may be isolated from other genomic plant libraries or by utilising isolation techniques well-known to those skilled in the art, including, for example, the use of inverse polymerise chain reaction.
The promoter from the TWI1 gene is useful as a sequence capable of regulating the rapid accumulation of desirable gene products at sites of physical injury to a plant. Gene products considered desirable for such control include, but are not limited to: polypeptides with anti-microbial, antifungal, anti-insect etc activities, or polypeptides which have an activity which would protect the plant from further damage, for example, by altering cell wall synthesis activities.
The promoter would also be useful in driving the regulated expression of a particular gene product following application of SA or SA analogues to the plant. The TWI1 promoter of FIG 2 could similarly be used to drive the expression of other wound inducible genes substantially homologous to the TWI1 gene in plants other than tomatoes, such as in dicotyledonous and monocotyledonous plants.
It is a further aspect of this invention to provide transformed host cells comprising recombinant DNA
encoding a plant GTase in operable linkage with expression signals including promoter and termination sequences which permit expression of said DNA in the host cell. Preferably, DNA is transformed into plant cells using a disarmed Ti-plasmid vector and carried by Agrobacterium in procedures known in the art, for example as described in EP-A-0116718 and ~P-A0270822.
Alternatively, the foreign DNA could be introduced directly into plant cells using electrical discharge apparatus. This method is preferred where Agrobacterium is ineffective, for example, where the recipient plant is monocotyledonous. Any other method that provides for the stable incorporation of the DNA
within the nuclear DNA of any plant cell cf any species would be suitable. This includes species of plants which are not currently capable of genetic transformation.
i5 Another aspect of the present invention includes the production of transgenic plants (or parts of them, such as propagating material) containing DNA in accordance with the invention as described above. The constructs would include a promoter and coding sequence from, for example, ~he tomato TWI1 gene, or another promoter and coding sequence of plant GTase exhibiting an analogous activation pattern for the purpose of regulated expression of desirable gene products at sites of attack or following elicitor application. Further, transgenic plants containing the TWI1 coding secruence, other sequence encoding a homologous plant GTa~e, or fragments thereof, in sense or antisense orientation, under the control of constitutive, developmental or tissue-specific promoters for the purpose of altering the natural levels of GTase activity are also within the scope of this invention.

Transgene constructs are produced preferably using available promoters and terminator sequences from standard E. col.i cloning vectors in combination with a GTase coding sequence (such as FIGS. 1, 2, 3 or 4).
Constructs can either then be cloned into other E. coli vectors containing plant selectable marker genes, either to be used directly for particle bombardment transformation, or for Agrobacterium-mediated transformation when a binary vector will be used.
One of the objects of this invention is activation of specific enzyme activity, namely GTase. The activation of GTase by transfer of sequences encoding GTase to other species will not necessarily be species-dependent. For down-regulation strategies however, it would be a preferred method to use the homologous gene from the target species to enable an efficient antisense effect.
It is another aspect of the invention to provide a method for improving the resistance of plants to a very broad spectrum of pests and pathogens by regulating the levels of key signalling intermediates and thus increasing the natural defence responses of plants to any challenge. In particular, this invention will benefit crops growing in the field and benefit post-harvest care and protection of plant products. For instance, increased basal levels of an unconjugated intermediate in GTase antisense plants could induce a "resistant state". In ethylene-mediated senescence, this invention seeks to improve the shelf-life/vase-life of products, whether fruit, vegetables, cut flowers, leaves, pot plants etc. This invention also teaches a method of controlling the senescent process, i.e. inducing ripening at a particular time in response to a spray or chanced condition.
The following non-limiting examples are provided as an illustration of the usefulness of the above-described invention, wherein reference is made to the following figures:
FIG. 1 The cDNA sequence for the GTase encoded by the TWI1 gene, isolated from tomato.
.0 FIG. 2 The 5'upstream region for the TWI1 gene up to the start codon and including the promoter region.
FIG. 3 Amino acid (glucosyl transferase protein) sequence of the TWI1 gene.
_.~ FIG. 4 Nucleic acid sequence for a homologous GTase enzyme isolated from tobacco.
FIG. 5 Nucleic acid sequence for a homologous GTase enzyme isolated from rice.
FIG. 6 Reference gel demonstrating TWI1 20 expression during stages of tomato fruit development.
RNA extracted from tomato fruits at different developmental stages and subjected to Northern Blotting and probed with TWI1 cDNA are shown. Lane 1: immature green fruit; Lane 2: mature green fruit; Lane 3:
25 breaker stage; Lane 4: pink-ripe; and Lane : red-ripe fruit.
FIG. 7 Reference gel showing the expression of the proteinase inhibitor (pin)2 gene and ethylene-forming enzyme (ACO) in transgenic tomato lines 30 expressing a TWI1 antisense gene prevents wound-induced pin gene expression and prolongs ACO expression.
FIG. 8 Reference gel electrophoresis demonstrating the accumulation of TWI1 mRNA (GTase) during wounding and elicitor treatment in tomato plants. Each lane of gel is described in full in Example 2.
FIG. 9 Reference gel demonstrating a time-course of TWI1 mRNA accumulation by wounding and salicylic 5 acid (2 mM) treatment in tomato. Each lane is described in full in Example 3.
FIG. 10 Reference gel showing that wound-induced TWIT expression is SA-independent.
FIG. 11 Reference gel demonstrating local and 10 long range expression of TWI1 on wounding tomato plant leaves.
FIG. 12 Reference gel illustrating the effect of anti-sense suppression of ACO expression on wound induced pin-2 expression by comparing the levels of 15 transcript accumulation in wounded transformed and wild-type 21 day old tomato plants.
FIG. 13 Reference gel demonstrating wound-induced pin gene expression can be inhibited by norbornadiene.
FIG. 14 Reference gel demonstrating that aspirin 20 inhibits wound induced pint gene expression. Details of each lane are given in Example 6.
FIG. 15 Reference gels demonstrating TWI1 mRNA
accumulation in cotyledons of tomato plants injected with either intercellular fluid containing the Avr9 avirulence protein from Cladosporium fulvum (IF9) or water. Tomato plants carrying the Cf9 resistance gene (Cf9) or without the resistance gene (Cf0) were used.
FIG. 16 Tobacco TWI1 expression and salicylate accumulation in response to TMV infection in tobacco NN
plants. The reference gels show the accumulation of the tobacco TWI1 homologue mRNA in TMV-infected wild-type tobacco plants, but no accumulation in mock (water) inoculated plants, nor in plants transgenic for nahG salicylate hydroxylase gene. The time course indicates time after transfer of plants from 30°C to 24°C at which point the resistance response is initiated.
FIG. 17 Histograms indicating the levels of the free and conjugated salicylate present i:. leaves of the same plants at the time-points (hours) indicated on the x-axis. Significant SA accumulation only occurs in wild-type NN tobacco, but not NN+ NahG tobacco.
FIG. 18 Photographs showing the effects on tobacco leaves of injection of harpin (HrpN) protein into leaves of plants which are wild-type (WT) or transgenic for over-expression of the tobacco TWI1 homologue (OVER) or antisensed for the GTase (ANTI).
FIG. 19 Reference gel showing tobacco acidic chitinase (PR3A) accumulation in water- or harpin-treated tobacco leaves at either 1, 2 or 3 days after injections, and in healthy (H) leaves. The plants are either wild-type (WT) or transgenic for over-expression (OVER) or antisensed (ANTI) of the tobacco GTase gene.

The TWI1 (tomato wound-inducible) gene was first identified and analyzed as a partial cDNA from a differential screen of a tomato-wounded-leaf cDNA
library.
Using the partial cDNA as a probe in Northern analyses TWI1 mRNA was confirmed as wound-inducible, with transcripts detectable by 15 minutes after injury to the leaves. Expression of the gene corresponding to TWI1 was also found to be developmentally-regulated.
Whilst not expressed in unwounded leaves of a young tomato plant, TWI1 mRNA became abundant in older yellow leaves and was also found at high levels v_n red-ripe tomato fruit (FIG 6). The pattern of induction of TWI1 WO 97/45546 PCT/GB97/01473 _ by elicitors of other wound responsive genes was also analyzed. The TWI1 was observed to be induced by plant cell wail Fragments and salicylic acid, suggesting at the time ~:P J 0'Donnell, 1995, Doctoral Thesis from Leeds University) TWI1 belonged to the family of defence-related proteins, know as the pathogenesis-related (PR) proteins, all of which are induced by salicylic acid and some of which are also induced by mechanical injury.
When a full-length cDNA of TWI1 was obtained and sequenced, homology was found to a large family of previously identified sequences encoding glucosyl transferases. The closest homology to existing sequences was observed to be that of Mesculenta Crantz cDNAs, mecgtl, encoding a UDP-glucose glucosyl transferase (54.3%) and mecgt5 encoding a UTP-glucose glucosyl transferase (52.2%). These have been identified as transferases involved in glucosylation of secondary metabolites. High homology was also found to a glucosyl transferase of Zea mat's, involved in the glucosylation of IAA (S2.So) and to a ripening-related glucosyl transferase of tomato (ERT1B) known to glucosylate secondary metabolites.
The standard approach to identifying function is to use an antisense strategy, in which a transgene is constructed which expresses the gene of interest in antisense orientation, thereby leading to constitutively negligible levels of the gene product.
The phenotype of the plants can then be analyzed to determine the effects of knocking out the expression of the gene. Using this antisense techno,.~ogy, tomato plants were transformed with TWI1 coding sequence in WO 97/45546 PCT/GB97/01473 _ antisense orientation whose expression was constitutively driven by a Cauliflower Mosaic Virus (35S) promoter. A 480bp fragment from the 5' end of the TWI1 cDNA clone was produced by Polymerase Chain Reaction using the following primers:
5' primer - TCTTTCCTCTAGAATGCAAGGTC
incorporating a Xbal restriction site 3' primer - GTTCAGGTACCGATGACACATTC
incorporating a Kpnl restriction site When digested with Xbal and kpnl, a 461 by fragment was produced. This was sub-cloned into Xbal/Kpnl digested site of the binary vector pJRlRi, giving a construct with the TWI1 fragment in the antisense orientation.
After transformation into E.coli, the plasmid was transferred into the Agrobacteriurn strain ~BA4404, by triparental mating. Cultures were then selectively grown up of Agrobacterium containing the plasmid.This was then used to transform tomato plants via AgrobacLerium. Selection of potential transformed plants was on the basis of resistance to kanamycin.
Regenerated planes were studied by RNA analysis to investigate the effect of the TWI1 antisense transgene.
It was discovered in three independently transformed primary transformants that the response to injury had changed. The standard wound-response gene marker, proteinase inhibitor was not expressed, whereas the gene encoding ethylene-forming enzyme (ACO), normally exr~ressed transiently was not down-regulated and wound etrvlene levels were maintained at high levels (FIG 7).
The revelation that TWI1 was wound-inducible in no way implicates the gene product in a regulatory role, quite the opposite. This gene is responding to wound-induced signals. The fact the TWI1 gene shared homology to those enccding known glucosyl transferases would not implicate the gene product in a regulatory role, since many glucosyl transferases merely glucosyiate secondary metabolites such as ERT1B [14].

Accumulation of TWI1 mRNA by mechanical wounding and elicitor treatments was assessed. Results can be seen in FIG 8. Wounding was carried out by crushing the terminal leaflets of 21 day old tomato plants (Lycopersicon esculentum Mil.) cultivar Moneymaker, with a pair of tweezers. For all elicitor treatments 21 day old plants were excised at the base of the stem and incubated for 30 minutes in the various treatments, at the stated concentrations. After 30 minutes in the elicitor, the plants were transferred into water for the remainder of the incubation period. For all treatments, plants were maintained under constant light at 22°C. Leaf material was harvested at 1 hour after wounding/treatment in each case, and total RNA was then extracted. 10 ~cg of total RNA from each sample was separated by agarose gel electrophoresis in gels containing 7a formaldehyde, blotted onto Hybond-N
membrane and probed with P32 labelled TWI1 cDNA. In FIG. 8 the results are demonstrated, with the labels being: ~~) healthy leaf; 2) wounded leaf; 3) HBO; 4) jasmonic acid (100 ICM); 5) systemin (100 nM); 6) salicylic acid (2nM); 7) aspirin (2mM); 8) benzoic acid (2mM); 9) 3,4 di-OH benzoic acid (2 mM); 10) 2,6 di-OH
benzoic acid (2mM); 11) DCINA (1mM). The filter was exposed to film for 3 days. Equal loading was confirmed by re-hybridising the stripped blot with a 32P
labelled ribosomal RNA probe.

EXAMPLE 3: Time Course of Expression of TWI1 and Response to Wounding And Salicylic Acid FIG. 9 is a Northern analysis comparing the time-course 5 of induction of GTase and PRla (PR= pathogenesis-related) gene expression following application of SA to the tomato plants through the transpiration stream.
The increase in steady-state levels of the GTase transcripts is very rapid when compared to those of 10 PRla, and become detectable within 10-15 minutes of treatment. To our knowledge, this is the fasted SA-responsive gene so far identified, since the kinetics of up-regulation of SAR genes in tobacco and tomato are all known to be comparable to that of the PRla shown in 15 FIG. 9.
The time-course of TWI1 mRNA accumulation by wounding and salicylic acid (2mM) treatment is specifically demonstrated in FIG. 9, including the induction of PR1 20 by SA treatment. 21 day old tomato plants were wounded, or excised at the base of the stem and incubated with 2 mM salicylic acid, as described in Example 2. Leaf material was harvested at each time point shown, and total RNA extracted. 10 ~.g of total 25 RNA was fractionated through an agarose gel containing 7% formaldehyde, blotted onto Hybond-N membrane and probed with 'ZP labelled TWI1 cDNA, or PR1 cDNA. Time shown in FIG. 9 is in hours after wound/SA application.
the filters was exposed to film for 24 hours (TWI1 filters) or 7 days (PR1 filters) .
To assess whether SA might be a wound-induced signal which induced TWI1 expression, we also wounded leaves of transgenic tomato plants harbouring the salicylate hydroxylase gene (NahG), which presents SA
accumulation. As shown in FIG 10, the response of TWI1 to wounding in NahG tomato plants is not significantly different from the response in wild-type plants, indicating that wound induction of this gene is SA-independent.
EXAMPLE a: (Local and Systemic Wound Induction of TWI1 mRNA) FIG. 11 compares the timing of wound-induction GTase expression in the leaf that is damaged and in the systemically responding undamaged leaf of the plant.
In FIG. 11, mechanical wounding was carried out on the terminal leaflets the first leaf of 21 day old tomato plants, as described in Example 2. Leaf material was harvested from wounded leaf (local) and the unwounded leaf 2 (systemic) at the stated times, and total RNA
extracted. 10 ~g of total RNA was separated through an agarose gel containing 7a formaldehyde, blotted onto Hybond-N membrane and probed with 32P labelled TWI1 cDNA. Time given is hours after mechanical wound. The hybridised filter was exposed to film for 8 days.

The effect of antisense suppression of the ethylene -forming enzyme (ACO) expression on wound induced pin-2 expression was assessed by comparing the levels of transcrit~t accumulation in wounded transformed and wild-type plants. 21 day old tomato plants (lycopersicon esculentum Mill) cultivar Alisa Craig, expressing an ACO construct in anti-sense orientation and driven by the 35S CaMV promoter were wounded as discussed in Example 2, above. Leaf material was harvested at the indicated times, total RNA was extracted and analyzed for pin-2 gene expression by Northern blot. Control wild type plants were wounded and leaf material harvested at 8 hours for Northern analysis.
we also found that the inhibitory effect of NBD
(norbarnadiene, a competitive inhibitor of ethylene on pint) expression can be overcome by excess exogenous ethylene, which is consistent with its action as an inhibitor (FIG. 12). This strongly suggests that ethylene must be present in wound response. Results illustrating pint gene expression following these treatments are shown in FIGS 12 and 13.

Aspirin inhibition of pin-2 gene expression can be overcome by jasmonic acid and ethylene, but not by JA
or ethylene alone. Plants were pretreated in water or ASA (aspirin) for 30 minutes, in gas tight chambers, before removal of the plants and incubation in the open. ASA pretreated plants were treated with either ethylene (100 ppm), JA, JA + 5ppm of ethylene, JA + 10 ppm ethylene, JA + 50 ppm ethylene or JA + 100ppm ethylene for 30 minutes in gas tight chambers before transfer to the open. Control plants were treated with water for the experimental duration. Leaf material was harvested at 4 hours post-treatment, total RNA
extracted and northern analysis performed using the pin-2 cDNA (FIG 14).

The expression of TWI1 in response to gene-for-g'ne mediated pathogen resistance was assessed using Avr9-containing extracts to elicit a resistance response in tomato harbouring the Cf9 resistance gene. Elicitor was injected into cotyledons of Cf9 plants or control plants with no Cf9 gene (Cf0) and as a further control, Cf9 cotyledons were injected with water. At various time-points after injection, RNA was extracted and subjected to Northern blotting using the TWI1 cDNA as a probe (FIG 15). Significant induction of TWI1 expression was only detected in Cf9 plants injected with Avr9 elicitor, demonstrating a pathogen-resistance response-specific activation of the GTase.

The expression of the tobacco TWI1 homologue during a pathogen-resistance response was investigated in tobacco plants harbouring the N-resistance gene infected with tobacco mosaic virus (TMV). Wild-type tobacco, or tobacco transformed with a salicylate hydroxylase gene (NahG) which cannot accumulate salicylic acid (SA), were inoculated with TMV or mock-inoculated with water and grown for 2 days at 30°C to permit virus spread. The plants were then transferred to 24°C to initiate the resistance response and RNA, SA
and SA conjugates were extracted at various time-points. As shown in FIGS 16 and 17, GTase expression was only induced in wild-type NN tobacco infected with TMV. No GTase expression was observed in the NahG
transformants which did not significantly accumulate SA, whereas expression in wild-type plants correlated with the timing of SA production.

The tomato TWI1 cDNA sequence can be used as a heterologous probe to identify the SA GTase from a range of Solanaceous species as shown by Southern blotting. We have isolated full-length cDNA clones corresponding to the SA GTase of tobacco using the tomato TWIT sequence as a probe (FIG 4). These two genes show around 85o identity in primary sequence.
Additional GTases have been identified in DNA sequence databases of expressed sequence tags from rice (FIG 5).
EXAMPLE 10 - Production of transQenic plants Plasmid constructs containing the tobacco TWI1 GTase homologue in either sense or antisense orientation were produced using the pJRlRi vector, placing expression of the sense or antisense genes under the control of the CaMV 35S promoter and nos polyadenylation signal.
These plasmids were transferred to Agrobacterium tumefaciens strain LBA4404 by tri-parental matings.
Leaf disks from tobacco Nicotiana tabacum cv (Samsun NN) were inoculated with the transformed Agrobacterium strains and transgenic plants regenerated using standard protocols.
These plants were used in experiments using the bacterial elicitor, harpin (the HrpN gene product from Erwinia arnylovora). In wild-type tobacco plants, and plants expressing an antisense GTase gene, harpin injection into leaves caused the formation of necrotic lesions, but such lesions were not observed in plants over-expressing the GTase (sense construct) (FIG 17).
RNA was extracted from the injected leaves and the expression of PR genes assessed by Northern blotting (FIG 18). In wild-type plants, PR3a gene expression peaked at 1 day post-injection and was present at high levels throughout the time-course. In antisense plants, the peak at 1 day was maintained over the whole time course, whereas in over-expressing plants, PR3a expression was significantly suppressed.
These data suggest that a key signal which controls 5 lesion formation and PR gene expression is affected by GTase expression levels.

1. Doherty, HM, Selvendran, RR, Bowler, DJ (1988) Physiol. :'~lol. Plant Pathoi. 33; 377-384.

2. Doherty, HM, Bowler, DJ (1990) Plant Cell Environ.
13, 851-855.

3. Pena-Cortes, H, Albrecht, T, Prat, S, Weiler, EW, Willmitzer, L (1993) Planta 191; i23-128.

4. Doares, SH, Narvaez-Vasquez, J, Conconi, A, Ryan, CA
(1995) Plant Physiol. 108; 1741-1746.

5. Szerszen, JB, Szczyglowski, K, Bandurski, RS (1994) Science 265; 1699-1701.

6. Yalpani, N, Schulz, M, Davis, MP, Balke, NE (1992) Plant Physiol. 100; 457-463.

7. Ecker, JR, Davis, RW (1995) Science 268:667-675.

8. Ward, ER, Uknes, SJ, Williams, SC, Dincher, SS, Wiederhold, DL, Alexander, DC, Ahl-Goy, P, Metraux, J-P, Ryals, JA (1991) Plant Cell 3; 1085-1094.

9. Abeles, FB, Morgan, PW, Saltveit, ME Jr. "Ethylene in plant biology," Academic Press.

10. Wei, Z.M., Laby, R.J., Zumoff, C.H., Bauer, D.W., He, S.Y., Collmer,A., Beer, S.V. (1992) Science 257:
85-88.

11. Gan, S, Amasino, RM (1995) Science 270; 1986-1988.

12. Nicholass, FJ, Smith, CJS, Schuch, W, Bird CR, Grierson,D (1995) Plant Mol. Biol. 28; 423-435.
i3. Bevan, M (1984) Nucleic Acids Res. 12; 8711.
14. Picton, S, Gray, J, Barton, S, Abu Bakar, U, Lowe, A, Grierson, D (1993) Plant Mol. Biol. 23; 193-207.

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: THE UNIVERSITY OF YORK
(C) CITY: Heslington, York (E) COUNTRY: Great Britain (F) POSTAL CODE: Y01 5DD
(ii) TITLE OF INVENTION: USE OF NOVEL GLUCOSYL TRANSFERASE
(iii) NUMBER OF SEQUENCES: 7 (iv) CORRESPONDENCE ADDRESS:
John H. Woodley Sim & McBurney 330 University Avenue, 6t'' Floor Toronto, Canada M5G 1R7 (v) COMPUTER READABLE FORM:
(A) COMPUTER: IBM PC compatible (B) OPERATING SYSTEM: PC-DOS/MS-DOS
(C) SOFTWARE: PatentIn Release #1.0, Version #125 (EPO) (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 2,255,830 (B) FILING DATE: May 30, 1997 (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: GB 9611420.2 (B) FILING DATE: May 31, 1996 (viii)PATENT AGENT INFORMATION:
(A) NAME: John H. Woodley (B) REFERENCE NUMBER: JHW 6841-24 (2) INFORMATION FOR SEQ. ID. NO. 1 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1624 nucleotides (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ. ID. NO: 1:
tcattttttc ttctttcccg atgatgctca aggtcatatg atacctacac ttgacatggc 60 gaacgttgtc gcttgtcgtg gtgttaaagc cactataatc acaacacctc tcaatgaatc 120 tgttttctct aaagctattg agagaaacaa gcatttaggt attgaaattg atattcgttt 180 actaaaattc ccagctaagg agaatgattt gcctgaagat tgtgagcgtc ttgatcttgt 240 accttctgat gacaaactcc caaacttctt aaaagctgcg gctatgatga aagatgaatt 300 tgaggagctt attggagaat gtcgccctga ttgtcttgtt tctgatatgt tccttccatg 360 gactactgat agtgcagcca aatttagcat accaagaatt gtattccatg gaactagtta 420 ctttgccctt tgtgttggcg atacgatcag gcgtaataag cctttcaaga atgtgtcatc 480 ggatactgaa acttttgttg taccggattt gccacatgaa attaggctaa ctagaacaca 540 gttgtctccg tttgagcaat cggatgaaga gacgggtatg gctcccatga ttaaagctgt 600 gagggaatcg gatgcgaaga gctatggagt tatattcaat agcttttatg agcttgaatc 660 agattatgtt gaacattaca ctaaggttgt aggtagaaaa aattgggcta ttggtccgct 720 ttcgctgtgc aatagggata ttgaagataa agcggaaaga gggaggaaat catctatcga 780 tgaacacgcg tgcttgaaat ggcttgattc gaagaaatca agttccattg tttatgtttg 840 ttttggaagt acagcagatt tcactacagc acagatgcaa gaacttgcta tggggctaga 900 agcctctgga caagatttca tttgggttat cagaacaggg aatgaagatt ggctcccaga 960 aggattcgag gaaagaacaa aagaaaaagg tttaatcata agaggatggg caccccaaag 1020 tgtgattctt gatcacgaag ctattggagc ttttgttact cattgtggat ggaactcgac 1080 actggaagga atatcagcag gggtaccaat ggtgacatgg ccagtatttg cggaacagtt 1140 tttcaatgag aagttggtga ctgaggtaat gagaagtgga gctggtgttg gttctaagca 1200 atggaagaga acagctagtg aaggagtgaa aagagaagca atagcaaagg cgataaagag 1260 agtaatggcg agtgaagaaa cagagggatt cagaagcaga gcaaaagagt acaaagaaat 1320 ggcaagagaa gctattgaag aaggaggatc atcttacaat ggatgggcta ctttgataca 1380 agacataact tcatatcgtt aactagttga tgcaaaaaaa gaaaaaacat gtgtgtttct 1440 atattctgtc ttctgttttg ctgatttgat catattacgt acttcttcat gataattaat 1500 gacatcaata gaatccaaga tcaatcatct cgaaattcaa cgttaaaata tttcgacatt 1560 tgaataatac atcgacttaa aatggaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1620 aaaa 1624 (2) INFORMATION FOR SEQ. ID. NO. 2 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1040 nucleotides (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ. ID. N0: 2:
aagcttacaa gatagtgtca tgtaggccga aaaagataga aaattattaa taaattaaat 60 ttaagaggta atataacctt attataatat aaatgtgtat ctaaaatttc tgacataaat 120 ctagggaata gttatacatt attctttatt attattattg agtcgtcaaa aaatattatt 180 agaatttatg agctaataca tatttaattt tataatgtaa atatattttt ttaaaaattt 240 accgacttca atagaacccc acgaacctta tctatatccg cctcgtgacc accaccttct 300 caagtattcc gccaaaatca aatggcaatt accggttcct actgcaataa tttagcagct 360 aatgaacaaa atgcatcttg tcatcttcta gatgatttgt acttctttct gcttaataat 420 aatcgttgac cgttgattta acataaaaag acaaatgact cgaaataatg attaaaaata 480 ataaatgata aaggtactat aatactgtac taactagcat ttgtattttc gtctttgagc 540 aaagcactgt cgttaaatta acttaaataa taaaagaaaa gtttgtgttt caattgacct 600 gtgaggggag ggcatatgtc acctgtaaag ttacatctgc caagaaattc catacgctgg 660 tccccgctat tgccggtttc cttcattgac aaggccagtt atttttgaga ttgaatttat 720 ttcacctccg attattagat atttattaaa atcgatatat gtttagtcat gattttatat 780 ataaaatagt tatgatcacg aaatatttcg atcttaaact aataaaacct tgatgagttg 840 tttagggttt gtctgttaaa tcaaccacgt gagtgcttac gtgacttctt tacgtccaac 900 ttgaaataac aagttaatct cttatgcaac ttcaacgaaa gtcttcaaac aattcgacgt 960 atatataacg tgacactaat gcaattacaa ctcaaaaagt atttactcct ctttgtttca 1020 ttcaagcatt tccacaaatg 1040 (2) INFORMATION FOR SEQ. ID. N0. 3 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 470 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ. ID. NO: 3:
Met Gly Glu Leu His Phe Phe Phe Phe Pro Asp Asp Ala Gln Gly His Met Ile Pro Thr Leu Asp Met Ala Asn Val Val Ala Cys Arg Gly Val Lys Ala Thr Ile Ile Thr Thr Pro Leu Asn Glu Ser Val Phe Ser Lys Ala Ile Glu Arg Asn Lys His Leu Gly Ile Glu Ile Asp Ile Arg Leu Leu Lys Phe Pro Ala Lys Glu Asn Asp Leu Pro Glu Asp Cys Glu Arg Leu Asp Leu Val Pro Ser Asp Asp Lys Leu Pro Asn Phe Leu Lys Ala Ala Ala Met Met Lys Asp Glu Phe Glu Glu Leu Ile Gly Glu Cys Arg Pro Asp Cys Leu Val Ser Asp Met Phe Leu Pro Trp Thr Thr Asp Ser Ala Ala Lys Phe Ser Ile Pro Arg Ile Val Phe His Gly Thr Ser Tyr Phe Ala Leu Cys Val Gly Asp Thr Ile Arg Arg Asn Lys Pro Phe Lys Asn Val Ser Ser Asp Thr Glu Thr Phe Val Val Pro Asp Leu Pro His Glu Ile Arg Leu Thr Arg Thr Gln Leu Ser Pro Phe Glu Gln Ser Asp Glu Glu Thr Gly Met Ala Pro Met Ile Lys Ala Val Arg Glu Ser Asp Ala Lys Ser Tyr Gly Val Ile Phe Asn Ser Phe Tyr Glu Leu Glu Ser Asp Tyr Val Glu His Tyr Thr Lys Val Val Gly Arg Lys Asn Trp Ala Ile Gly Pro Leu Ser Leu Cys Asn Arg Asp Ile Glu Asp Lys Ala Glu Arg Gly Arg Lys Ser Ser Ile Asp Glu His Ala Cys Leu Lys Trp Leu Asp Ser Lys Lys Ser Ser Ser Ile Val Tyr Val Cys Phe Gly Ser Thr Ala Asp Phe Thr Thr Ala Gln Met Gln Glu Leu Ala Met Gly Leu Glu Ala Ser Gly Gln Asp Phe Ile Trp Val Ile Arg Thr Gly Asn Glu Asp Trp Leu Pro Glu Gly Phe Glu Glu Arg Thr Lys Glu Lys Gly Leu Ile Ile Arg Gly Trp Ala Pro Gln Ser Val Ile Leu Asp His Glu Ala Ile Gly Ala Phe Val Thr His Cys Gly Trp Asn Ser Thr Leu Glu Gly Ile Ser Ala Gly Val Pro Met Val Thr Trp Pro Val Phe Ala Glu Gln Phe Phe Asn Glu Lys Leu Val Thr Glu Val Met Arg Ser Gly Ala Gly Val Gly Ser Lys Gln Trp Lys Arg Thr Ala Ser Glu Gly Val Lys Arg Glu Ala Ile Ala Lys Ala Ile Lys Arg Val Met Ala Ser Glu Glu Thr Glu Gly Phe Arg Ser Arg Ala Lys Glu Tyr Lys Glu Met Ala Arg Glu Ala Ile Glu Glu Gly Gly Ser Ser Tyr Asn Gly Trp Ala Thr Leu Ile Gln ~

Asp Ile Thr Ser Tyr Arg (2) INFORMATION FOR SEQ. ID. NO. 4 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 644 nucleic acids (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ. ID. N0: 4:
aagaactgaa aacaaccaca cgtctttact tttctttctg ctttctgata ctaaactaca 60 tttttctttc tttcattcaa acattttcac aaatgggtca gctccatttt ttcttctttc 120 ctgtgatggc tcatggccac atgattccta cgctagacat ggccaagctc gttgcttcac 180 gtggagttaa ggccactata atcacaaccc cactcaatga atccgttttc tccaaatcta 240 ttcaaagaaa caagcatttg ggtatcgaaa tcgaaatccg tttgatcaaa ttcccagctg 300 ttgaaaatgg cttacctgaa gaatgcgagc gcctcgatct catcccttca gatgataagc 360 tcccaaactt cttcaaagct gtagctatga tgcaagaacc actagaacag cttattgaag 420 aatgtcgacc caattgtctt gtttctgata tgttccttcc ttggactact gatactgcag 480 ccaaatttaa catgccaaga atagtttttc atggcacaag cttgtttgct ctttgtgtcg 540 agaatagcat caggctaaat aagcctttca agaatgtctc ctctgattct gaaacttttg 600 ttgtaccgaa tgtgcctcac gaaataaatg accagaccca gttg 644 (2) INFORMATION FOR SEQ. ID. NO. 5 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 354 nucleic acids (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ. ID. NO: 5:
ctttcccggc cgccgaggcg cntnanccgg aggggtgcga gagggtggac cacgtcccct 60 cgccggacat ggtgccgagc ttcttcgacg ccgccatgca gttcggcgac gcagtggcgc 120 anactncngg cgcctcacgg ggccgcgccg gctgagctgc ctcatcgccg ggatatctca 180 cacgtgggcg cacgtcctgg cgcgcnactc ggcgctccgt gcttcatctt ccacggtttc 240 tgcgcgttct ccctgctctg ctgcnagtac ctgcacgcgc acaggccgca cgaggcggtc 300 tcctcgccgg acgagctctt tgacgtccct gtcctgccgn ctttcgagtt cagg 354 (2) INFORMATION FOR SEQ. ID. N0. 6 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 nucleic acids (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ. ID. NO: 6:
tctttcctct agaatgcaag gtc 23 (2) INFORMATION FOR SEQ. ID. NO. 7 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 nucleic acids (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ. ID. NO: 7:
gttcaggtac cgatgacaca ttc 23

Claims (39)

1. An isolated polypeptide which:

(a) comprises the amino acid sequence shown in Fig. 3; or (b) has one or more amino acid deletions, insertions or substitutions relative to a polypeptide as defined in (a) above, but has at least 50% amino acid sequence identity therewith; or (c) is a fragment of a polypeptide as defined in (a) or (b) above, which is at least 10 amino acids long.

2. A polypeptide as claimed in claim 1 which is a glucosyl transferase protein isolated from tomatoes.

3. An isolated plant nucleic acid comprising the sequence shown in Fig. 1 or a sequence having at least 60% homology thereto.

4. An isolated plant nucleic acid as claimed in claim 3 further comprising a promoter said promoter being 5' to the coding region of the sequence shown in Fig. 2.

5. An isolated plant nucleic acid as claimed in claim 3 or claim 4 coding for a polypeptide as claimed in claim 1(a) or claim 1(b).

6. An isolated plant nucleic acid as claimed in claim 4, wherein the promoter isoperatively linked to the nucleic acid of claim 3, which, when expressed, effects glucosyl transferase levels in tomatoes.

7. An isolated plant nucleic acid comprising a sequence shown in Fig. 4 or a sequence having at least 60% homology thereto.

8. An isolated nucleic acid as claimed in claim 7 encoding a glucosyl transferase protein in tobacco.

9. An isolated plant nucleic acid as claimed in claim 7, wherein the nucleic acid sequence is a fragment of the sequence shown in Fig. 4 and wherein said fragment is at least 20 base pairs in length.

10. The isolated plant nucleic acid as claimed in claim 9, wherein said fragmentencodes a glucosyl transferase protein in tobacco.

11. An isolated plant nucleic acid consisting of a sequence shown in Fig. 5 or asequence having at least 60% homology thereto.

12. An isolated plant nucleic acid as claimed in claim 11 encoding a glucosyl transferase protein in rice.

13. An isolated plant nucleic acid as claimed in claim 12, wherein the nucleic acid sequence is a fragment of the sequence shown in Fig. 5 and wherein said fragment is at least 360 base pairs in length.

14. An isolated plant nucleic acid as claimed in any one of claims 7 to 13 further comprising a promoter, said promoter being 5' to the coding region of Fig. 2 and is operatively linked to said nucleic acid, which, when expressed, effects glucosyltransferase levels in plants.

15. An isolated plant nucleic acid as claimed in claim 14, wherein the plants affected are monocotyledonous and dicotyledonous plants.

16. An isolated plant nucleic acid as claimed in claim 15, wherein the plants affected are tomato, rice and tobacco.

17. An isolated plant nucleic acid as claimed in any one of claims 3 to 16, wherein said nucleic acid encodes for RNA which is antisense to RNA normally found in a plant cell.

18. An isolated plant nucleic acid as claimed in claim 17, wherein said nucleic acid encodes for RNA which is antisense to RNA encoding a glucosyl transferase in tomato, rice and tobacco.

19. Antisense nucleic acid isolated from plants which includes a transcribable strand of nucleic acid complementary to at least part of a nucleic acid naturally transcribed by the nucleic acid of any one of claims 3 to 16.

20. Antisense nucleic acid as claimed in claim 19, wherein transcription is under the control of a constitutive or developmental promoter and a transcription terminator sequence.

21. Antisense nucleic acid as claimed in claim 20, wherein the constitutive promoter is Cauliflower Mosaic Virus 35S promoter and the transcription terminator sequence is nos terminator from Agrobacterium tumefaciens.

22. Antisense nucleic acid as claimed in claim 19, wherein transcription is under the control of a glucosyl transferase promoter.

23. Antisense nucleic acid as claimed in claim 22, wherein the glucosyl transferase promoter is 5' to the coding region of the sequence of Fig. 2.

24. A vector comprising a nucleic acid as claimed in any one of claims 3 to 23.

25. A vector as claimed in claim 24 further comprising one or more selectable markers.

26. A host cell transfected or transformed with a vector as claimed in claim 24 or claim 25.

27. Nucleic acid as claimed in any one of claims 3 to 26, further comprising a marker sequence enabling a plant transformed with said nucleic acid to be distinguished from a plant not so transformed.

28. Nucleic acid as claimed in claim 27, wherein the marker sequence confers antibiotic or herbicidal resistance.

29. A plant cell transfected or transformed with a nucleic acid as claimed in any one of claims 3 to 28.

30. A plant or part of a plant, or propagating material from a plant comprising a plant cell transfected or transformed a claimed in claim 29.

31. A method of regulating a signalling pathway in plants, said method comprising altering levels of a plant glucosyl transferase gene encoded by any one of the nucleic acids claimed in claims 3 to 28.

32. A method as claimed in claim 31, wherein the signalling pathway includes regulating levels of salicylic acid, salicylic acid analogues, ethylene or jasmonic acid in plants.

33. A method as claimed in claim 31 or claim 32, wherein the plants are monocotyledonous or dicotyledonous plants.

34. A method as claimed in claim 33, wherein the plants are tomato, rice and tobacco.

35. The use of a promoter as described in any one of claims 4, 14 or 23 in regulating levels of proteins naturally present at a site of physical injury or pathogen attack to a plant, said proteins being any one of salicylic acid, salicylic acid analogues, DCINA, antimicrobial agents, antifungal agents and anti-insect agents, jasmonic acid or ethylene.

36. A method of isolating a plant glucosyl transferase gene, said method comprising preparing a cDNA or genomic library from a suitable host organism andscreening said library using a hybridisation probe comprising a nucleic acid as claimed in any one of claims 3 to 16.

37. A plant glucosyl transferase isolated by the method claimed in claim 36.

38. The use of a plant glucosyl transferase isolated by the method claimed in claim 36 in regulating signalling pathways in plants.

39. The use claimed in claim 38, wherein the signalling pathway regulated is related to levels of salicylic acid, salicylic acid analogues, ethylene or jasmonic acid.