WO1997045546A1

WO1997045546A1 - Use of a novel glucosyl transferase

Info

Publication number: WO1997045546A1
Application number: PCT/GB1997/001473
Authority: WO
Inventors: Dianna Joy Bowles; Philip James O'donnell; Michael Richard Roberts; Caroline Mary Calvert
Original assignee: The University Of York
Priority date: 1996-05-31
Filing date: 1997-05-30
Publication date: 1997-12-04
Also published as: EP0914449A1; GB9611420D0; CA2255830A1; AU2970697A

Abstract

This invention relates to methods for inducing plant defence and resistance responses as well as regulating plant developmental events in monocots and dicots by modifying a gene encoding for a glucosyl transferase (TWI1) isolated from wounded tomatoes.

Description

USE OF A NOVEL GLUCOSYL TRANSFERASE

This invention relates to a method for inducing plant defence and resistance responses and regulating plant developmental events. More particularly, this invention relates to methods for inducing the production of plant defence proteins such as pathogenesis-related (PR) proteins and protemase innibitor (pin) proteins and to methods for regulating resistance and acquired resistance to predators, insects, bacteria, fungi and viruses m plants, through manipulating levels of the plant hormones: salicylic acid, jasmomc acid, cytokimns and ethylene, and to methods for regulating developmental events that depend on these normones, particularly, plant growth, reproduction and senescence.

Adaptation of a plant to its environment is brought aoout by recognition and response to external stimuli which cause changes m cellular activity. A cnain of events link the initial recognition of the stimulus to changes m cells of the plant that ultimately lead to adaptation. These events constitute a signal transduction pathway, m which sequential molecular interactions transduce (lead) the signal from its perception through to the end-effects caused. Plants respond to a vast range of environmental stimuli that include, for example: changes in their growing conditions (light, heat, cold, drought, water- logging etc) ; mechanical damage leading to injury, and cnallenge by pests and pathogens (herbivores, insects, fungi, bacteria, viruses etc) . These stimuli lead to cellular events at the sιte(s) of perception, but also can trigger long-range events throughout the plant, leading to systemic changes. Thus, for example, m response to wounding and to pest/pathogen challenge, there are local and systemic events induced with signal transduction pathways occurring at the local site, systemic signal (s) communicating the local events around the plant, and signal transduction pathways occurring in distant cells that are responding to the systemic signal (s) . Networking and cross-talk between mtra- and inter-cellular signal transduction pathways is recognised to be an important means through wnich the plant integrates all of the information received from the environment .

Plant normones play a central role m these induced responses to environmental stimuli, since they act as the intermediate molecular signals which trigger the transduction pathways leading from the external change (s) in the environment to the internal end- effect (s) within the plant. For example, in a variety of plant species, ]asraonic acid is known to accumulate transiently during the wound response and has oeen implicated m transαuction events linking mechanical injury to activation of wound-responsive genes. Another example is during the interactions of plants with pests and pathogens, when salicylic acid is known to increase in quantity (together with its precursor, benzoic acid and its volatile form, methyl salicylate) and is considered to be a central regulator of local and systemic acquired resistance and the activation of defence-related genes associated with resistance.

Whilst salicylic acid is a positive regulator cf these induced resistance responses, there is evidence to show tnat tne normone is also a negative regulator of the wound response, such that if a plant is pre-treated with aspirin or salicylic acid, wound-responsive genes dependent on jasmonic acid for their expression are not induced [1,2,3,4] . This suggests there is communication between the signalling pathways induced by mechanical injury and induced by pests/pathogens, such that they do not occur simultaneously.

Senescence is the natural process which normally leads to cell death, either in a selected population of cells such as abscission cells or in whole organs such as flowers, leaves and fruits. This process of senescence can be developmentally regulated, such as, for example, in the ripening process, wilting and fading of flowers, yellowing and abscission of leaves. Alternatively, senescence and cell death can be induced by trauma, such as caused by, for example, chemicals, temperature extreme, pest and pathogen damage, disease or mechanical wounding.

The level of an active plant hormone in plant cells and tissues at any one time is dependent on the relative rates of its synthesis and degradation, the rates of transport to or from the cells/tissue, and the relative rates of its conversion to and from inactive metabolite (s) . For plant hormones, this conversion to an inactive metabolite can involve the conjugation of the free active form of the hormone to a polar molecular species, such as a sugar, amino acid or peptide. Endogenous hormones made by the plant, and exogenous hormones applied to and taken up by the plant are subject to conjugation in this manner. When large quantities of exogenous hormones are applied to the plant tne conjugation process has been likened to detoxification since it effectively clears the active hormones from the system rapidly.

Since the process of conjugation is known to be reversible in plants, at least for some hormones, it provides a flexible mechanism for regulating the pool size of active hormone in the absence of synthesis and degradation. Also, since most plant hormones are either apolar or amphipnilic, their reversible conjugation to a polar molecule provides a useful mechanism for containing the hormone on one side or otner of a memorane, such as in the apoplast, or m a particular compartment of the symplast.

Whilst many different conjugates of plant hormones have been identified, a commonly found conjugate is the g.ucoside, formed through the transfer of glucose from a sugar nucleotide donor to the hormone via a β , 0- glycosidic linkage. The enzymes responsible are β - g_.ucosyl transferases and the available evidence indicates that each transferase is highly specific for tr.e particular hormone it conjugates. For example, the g.ucosyi transferase responsible for conjugation of the plant hormone, indole 3-acetic acid, has been identified and shown to be specific for the auxin suostrate [5] . Similarly, the glucosylation of salicylic acid has also been investigated, and an enzyme activity identified m a variety of plant species has been shown to be specific for salicylic acid and the sugar nucleotide donor, UDP glucose [6] ,

Another important normone is ethylene which is a gas under physiological conditions that influences a wide range of events m plants, including the regulation of growth, cellular differentiation and developmental processes. In particular, ethylene is the key regulator of senescence, whicn as stated above, is a genetically controlled process cf degeneration normally leading to cell death and wnich occurs in specific cell-types and in whole organs such as flowers, leaves and fruits. The effects of ethylene on developmental processes are of considerable commercial importance. The effects can occur at low concentrations, whether the gas is produced by the plant itself or applied exogenously to the plant. Ethylene is also involved m defence/stress and resistance responses, such as directing how the plant combats challenges from pests and pathogens, and during the consequences of abiotic stimuli, for example, mechanical injury and water¬ logging. In these defence/stress and resistance responses, ethylene has a direct effect on the activation of specific genes, as well as a role m inducing cell death associated with hypersensitive responses.

Generally, ethylene is maintained at very low levels m plant tissue, but production can be rapid ana massive during the senescence process, or during stress/trauma caused by biotic and abiotic stimuli.

During tne degenerative process of senescence, ethylene synthesis is regulated by positive feedback, such that one action of the ethylene produced is the up- regulation of the synthetic machinery and thus further production of more ethylene leading to an autocatalytic avalanche of increased levels of the hormone. In contrast, during stress/trauma, the "wound" or "stress" ethylene produced is regulated by negative feedback, leading to a hormone transient. Ethylene has been shown unequivocally to be a requirement for the developmental senescence process. The role of "wound" ethylene is less defined.

The ethylene signal transduction pathway is the most characterised of all plant hormones to date, with the identification of genes encoding a receptor, a negative regulator protein and a number of proteins implicated genetically in downstream events [7] . In contrast, very little is known of the regulation or the mechanismis) by wnich ethylene levels rise m response to the environmental stimuli and to pest and pathogen attack.

Since plants have evolved inducible mechanisms of defence that respond to attack by pests and pathogens, there is considerable commercial interest in identifying methods of induction which will protect and even enhance the natural resistance of the crop plant. This is particularly relevant when the only agrochemicals available are hazardous both to the environment and the consumer. Often, during the natural course of a defence response to pest and pathogen challenge, a broad spectrum of defence-related genes and physiological events are induced in parallel and their success at conferring resistance arises from the multiplicity of their actions. Long-term efficacy of this strategy is much greater than that achieved by genetically modifying crop plants with single defence- related genes. This is because in field situations the alteration or insertion of a single defence-related gene can be overcome by pests and pathogens rapidly evolving and adapting to the single gene change. In addition, decreased crop yields and decreased product quality are features commonly encountered m resistant cultivars. Thus, there exists a strong requirement for new materials and processes to improve the resistance of plants under attack by pests and pathogens . This would preferably oe through the induction of the plant's own defence systems.

There is also considerable commercial interest m identifying the molecular "switches" which respond to non-hazarαous chemicals applied to the plant, and in turn, regulate developmental and defence responses, where and when applied. Whilst some mducible promoters have been found that are responsive to various cnemicals, (e.g. PR gene promoters responsive to dichloroisonicotimc acid (DCINA) [8] which can be used to drive the expression of genes of interest) , the range of applications envisaged could be increased dramatically if more promoters and more chemical mducers were identified. By way of background, DCINA is a widely used agrochemical wnich induces systemic acquired resistance (SAR) and is thought to act at a point downstream of salicylic acid in the transduction patnway leading to SAR gene expression.

For plant resistance and post-harvest protection of raw material quality, the speed of the defence response mounted Dy the plant cells/tissues, often determines the overall success-rate. Therefore, major interest lies in identifying rapidly responding promoters and, dependent on the application, those that are either capable of driving expression m a wide range of cell- types or those that are highly specific to a particular ceil-type or tissue, for example, epidermal cells or leaves, out not stems, etc. There is also major commercial interest in identifying ways m whicn senescence can either be controlled, prevented completely, the time-span of senescence regulated, or its occurrence induced only when required. Since senescence is intimately associated with ethylene, the problems of senescence are really problems of ethylene quantity and ethylene action. For example, in the post-harvest care of fruits, vegetables and flowers, cuts and bruising can stimulate ethylene production which in turn causes cell death in the traumatised tissues as well as affecting the adjacent fresh produce. This m turn leads to massive losses in the quality of these materials during transportation and storage. Traditional technologies addressing post- harvest issues have been tried for decades but suffer from problems of side-effects, toxicity, high costs and an maoility to shut down completely ethylene synthesis [9] .

In the present invention, a gene TWIl, whose existence had previously been established as merely being a "wound mducible" gene but whose true function, until now, was completely unknown, is disclosed. It is now known Dy way of our invention that the TWIl gene codes for a giucosyl transferase (GTase) which regulates levels of a key signalling intermediate. Through detailed analyses of the expression patterns of TWIl in tomato, this gene is believed to function in those signalling pathways leading to developmental and defence responses controlled by ethylene. Using transgenic plants with modified levels of TWIl expression, we demonstrate a key role for this gene m plant responses to wounding and to pathogens. A disclosure of a partial sequence on an EMBL database of a wounded tomato leaf library indicated that the TWIl cDNA might possibly encode for a GTase. However, no indication was given as to the induction patterns o •fP the TWIl gene nor the possible function of its product. These factors were not deducible from the partial sequence disclosed, nor from the source of the mRNA from wnich the cDNA was derived. This invention, therefore, provides the first-ever correlation between GTase action and the regulation of ethylene, a common intermediate in a diverse process in plants.

Accordingly, the present invention provides a method of altering the signalling pathways of a plant involving salicylic acid, ethylene and jasmonic acid. The method comprises interfering with the normal functioning of the TWIl gene encoding a GTase m plants. This is particularly useful in tomato plants, however, this invention would apply with similar advantage to other dicotyledonous or monocotyledonous plants (i.e. broad- leaveα plant species as well as grasses and cereals) . This invention is applicaole to any horticultural or agricultural species, including those in which fruit- ripening and/or post-harvest storage are important considerations.

According to one aspect of this invention, there is provided a recombinant or isolated DNA molecule which encodes for a glucosyl transferase in plants. In preferred embodiments, the GTase gene (TWIl) comprises the nucleic acid sequence or at least portions (or fragments) of the nucleic acid sequence shown in FIGS 1 and 2. Also sequences having suostantial sequence nomology with the TWIl gene of FIGS 1 and 2 are also claimed _n this invention. Moreover, sequences having substantial sequence homology with the ammo acid sequence encoded by the TWIl gene (FIG 3) are claimed aε part cf this invention.

The term 'portions" or "fragments" as used herein should be interpreted to mean that a sufficient number of nucleic acid or ammo acid residues are present for the fragment to be useful (i.e. to act as or encode a GTase) Typically, at least four, five, six, up to 20 or more residues may be present in a fragment. Useful fragments include those which are the same as or similar or equivalent to those naturally produced by the TWIl gene or its equivalent gene and enzyme in other plants, for example, as m FIGS 4 and 5 for rice and tobacco, respectively

As used m the present application, substantial sequence homology means close structural relationship between nucleotides or ammo acids. For example, substantially homologous DNA sequences may be 60% homologous, preferably 80% and most preferably around 90 to 95% Homologous, or more, and substantially homologous ammo acid sequences may preferably be 35%, more preferably 50%, most preferably more than 50% homologous. Homology also includes a relationship wherein one or several subsequences of nucleotides or ammo aciαs are missing, or subsequences with additional nucleotides or ammo acids are mterdispersed. When high degrees of sequence identity are present there may oe relatively few differences m the ammo acid sequences. Thus, for example, they may be less than 20, less than 10, or even less than 5 differences in ammo acid sequences. The degree of ammo acid sequence identity can be calculated, for example, using a program such as "BESTFIT" Smith and Waterman, Advances in Applied Ma thema ti cs, pp. 482-489 '1981) > to find the best segment cf similarity between any two sequences. The alignment is based on maximising the score achieved using a matrix of ammo acid similarities, such as that describee by Schwarz and Dayhof 'Atlas of protein Sequence and Structure , Dayhof, M.O. , pp. 353-358) .

Using the TWIl cDNA sequence as a probe to analyze expression of the GTase during a pathogen response in tomato, we observed that the gene is induced during gene-for-gene mediated resistance (R) response involving the Cf9 R gene to Cladosporium fulvum . Similarly, using a homologous GTase gene which we isolated from tooacco as a probe iFIG 4) , we also found induction during gene-for-gene mediated R response involving the N gene to tobacco mosaic virus (TMV) . In this latter system, induction of the GTase gene in response to TMV was causally dependent upon the elevation of salicylic acid. These data imply a role for the TWIl gene product m salicylic acid-mediated pathogen responses. Thus, an object of this invention is the use of TWIl gene m stimulating or improving pathogen related responses m plants, through induction of the GTase and thus effecting the levels of salicylic acid normally present m the plant (i.e. a wild-type plant) .

In transgenic tobacco plants which constitutively express the GTase at a high level, we found that the formation of necrotic lesions and the induction of PR- gene expression in response to the bacterial elicitor, _

harpin [10] , is completely suppressed. In contrast, m plants m wnicn GTase expression is repressed, the response to harpin is enhanced. These data show that the GTase gene product impacts directly on events at the local site of challenge with consequences on the process of acquired resistance. Importantly, the implication is that in transgenic plants expressing an antisense gene to the GTase, a hypersensitive response (HR) and acquired resistance to pathogen challenge may be enhanced.

In wound response, JA and ethylene are causally required for pin gene expression. The elevation of endogenous JA is very rapid and transient and is dependent on ethylene action [Bowies, et al , unpublished dataj Salicylic acid applied to plants prior to wounding inhibits this elevation in JA completely and also inhibits pin gene expression [Bowles, et al , unpublished data] The wound induction of the GTase is also very rapid with a parallel time- course to the elevation m JA. In plants expressing the TWIl antisense gene, wounding does not induce pm2 expression. Expression of the gene encoding ethylene- forπung enzyme occurs as normal, out in contrast to wild-type plants, m the transgenic plants the down regulation no longer occurs. This provides further direct evidence for the role of the GTase gene product m the regulation of ethylene and ethylene-dependent responses.

GTase activity as it relates to ethylene has never previously been identified nor contemplated. This would not be an obvious nor routine method to follow desϋite existing literature on GTases. Further, the developmental pattern of expression of any GTase is developmentaily-regulated. This is demonstrated by the attached examples, wherein GTase is expressed at high levels m etnylene-mediated processes sucn as fruit- ripening and senescence. Moreover, since the gene was not previously available for relevant antisense experiments, the opportunity to analyze the effects of GTase down-regulation on ethylene did not exist prior to this invention.

In this invention, we utilise antisense technology to demonstrate that down-regulation of GTase leads to prolonged levels of stress ethylene. Therefore, a further aspect of this invention is the use of the aforementioned GTase or any functional homologues thereto for use m down regulating GTase m a plant of interest .

Thus, according to a further embodiment of this invention, there is provided antisense nucleic acid which includes a transcribable strand of DNA complementary to at least part of the strand of DNA that is naturally transcribed in a gene encoding GTase. This involves the construction of transformation vectors possessing either the entire or partial coding sequence of the homologous GTase gene from the species to be transformed in the reverse orientation, under the transcπptional control of a constitutive promoter such as the Cauliflower Mosaic Virus 35S promoter and a transcription terminator sequence such as the

AgroJbacteπum tmπefaciens nos terminator. Also present m the vector, it is preferable, out not necessary, to include a plant selectable marker gene which enables a plant transformed with the TWIl gene or a gene substantially homologous thereto, to be distinguished from plants not so transformed. Such markers may include, for example, neomycin phosphotransferase II or hygromycm phosphotransferase. Typically these selective markers are for antibiotic or herbicide resistance. Vectors containing these sequences may either be broad host range binary vectors useful for AgroJbacterium-mediated transformation such as those derived from pBinl9 [13] , or standard E. coli vectors useful for production of high levels of plasmid for transformation mediated by particle delivery. In addition to the tomato GTase antisense construct described in the examples below, we have also produced an antisense construct using sequences from the tobacco GTase gene of FIG. 4.

To acnieve over-expression of the GTase, the coding sequence or portion of the coding sequence of the tomato TWIl cDNA, or a coding sequence encoding an active homologous GTase isolated from any other organism or a nucleic acid sequence synthetically produced by means well-known to those skilled in the art , may be placed under the control of promoters activated specifically m the tissues of interest, these being preferably ripening fruit and senescmg leaves or flowers, and followed by a transcription terminator sequence.

In the present invention, through use of Northern analyses, we show for the first time that a high expression of GTase exists in senescence and in ripened fruits. The implications of this are great, namely there may be an increased "need" for the GTase m ethyiene-mediated events. On an application point, it is easier to oDtain the over-expression effects in any plant species since a heteroiogous gene will produce the same effects. For an antisense approach, the nomologous gene is preferred and may be isolated for any commercially important plant or crop.

Another aspect of this invention is tne use of a promoter comprising the 5' upstream region of the TWIl GTase gene. The promoter claimed under this invention or one similar (substantially homologous) to that of FIG 2 isolated from plants other than tomato would exhibit activation characteristics including rapid activation following mechanical wounding cr pathogen attack, including activation by salicylic acid, various salicylic acid analogues thereof and the functionally- related compound, DCINA. We show that the wound induction of the TWIl gene and the induction by the chemical elicitors is via two independent pathways. Also, promoters of homologous GTase genes from other plant species exhibiting similar activation characteristics m their respective species are also claimed by way of this invention.

Activation of the GTase at the appropriate times using promoters derived from other sources is also claimed within the scope of this invention ((e.g. at the onset of senescence; e.g. Arabidopsis SAG12 promoter [11]) or at the onset of ripening (e.g. tomato polygalacturonase promoter [12] ) ) .

The promoters m the present invention were isolated from clones obtained from a commercial genomic library of tomato by using TWIl cDNA sequence as a probe. Sequencing of such clones identified the GTase coding sequence, with the 5' upstream region to approximately 5 kilobases of the GTase transcription start sequence considered to pe the promoter. Promoters of similar or substantially homologous GTase genes to the TWIl gene of wounded tomato plants may be isolated from other genomic plant libraries or by utilising isolation techniques well-known to those skilled in the art, including, for example, the use of inverse polymerase chain reaction.

The promoter from the TWIl gene is useful as a sequence capable of regulating the rapid accumulation of desirable gene products at sites of physical injury to a plant. Gene products considered desirable for such control include, but are not limited to: polypeptides with anti-microbial, antifungal, anti-insect etc activities, or polypeptides which have an activity which would protect the plant from further damage, for example, by altering cell wall synthesis activities. The promoter would also be useful in driving the regulated expression of a particular gene product following application of SA or SA analogues to the plant. The TWIl promoter of FIG 2 could similarly be used to drive the expression of other wound inducible genes suostantially homologous to the TWIl gene in plants other than tomatoes, such as in dicotyledonous and monocotyledonous plants .

It is a further aspect of this invention to provide transformed host cells comprising recombinant DNA encoding a plant GTase in operable linkage with expression signals including promoter and termination sequences which permit expression of said DNA in the host cell. Preferably, DNA is transformed into plant cells using a disarmed Ti-plasmid vector and carried by Agrojbacteriiim m procedures known in the art, for example as described m EP-A-0116718 and EP-A0270822. Alternatively, the foreign DNA could be introduced directly into plant cells using electrical discharge apparatus. This method is preferred where Agrcbacterium is ineffective, for example, where the recipient plant is monocotyledonous . Any other method that provides for the stable incorporation of the DNA within the nuclear DNA of any plant cell cf any species would be suitaple. This includes species of plants which are not currently capable of genetic transformation.

Another aspect of the present invention includes the production of transgenic plants (or parts of them, such as propagating material) containing DNA m accordance with the invention as described above . The constructs would include a promoter and coding sequence from, for example, the tomato TWIl gene, or another promoter and coding sequence of plant GTase exhibiting an analogous activation pattern for the purpose of regulated expression of desirable gene products at sites of attack or following elicitor application. Further, transgenic plants containing the TWIl coding sequence, other sequence encoding a homologous plant GTase, or fragments thereof, m sense or antisense orientation, under the control of constitutive, developmental or tissue-specific promoters for the purpose of altering the natural levels of GTase activity are also within the scope of this invention. Transgene constructs are produced preferably using available promoters and terminator sequences from standard Ξ . coii cloning vectors m combination with a GTase coding sequence (such as FIGS. 1, 2, 3 or 4) . Constructs can either then be cloned into other E. coli vectors containing plant selectable marker genes, either to be used directly for particle bombardment transformation, or for AgroJbacterium-mediated transformation wnen a binary vector will be used.

One of the objects of this invention is activation of specific enzyme activity, namely GTase. The activation of GTase by transfer of sequences encoding GTase to other species will not necessarily be species- dependent. For down-regulation strategies however, it would be a preferred method to use the homologous gene from the target species to enable an efficient antisense effect.

It is another aspect of the invention to provide a method for improving the resistance of plants to a very broad spectrum of pests and pathogens by regulating the levels of key signalling intermediates and thus increasing the natural defence responses of plants to any challenge. In particular, this invention will benefit crops growing in the field and benefit post- harvest care and protection of plant products. For instance, increased basal levels of an unconjugated intermediate in GTase antisense plants could induce a "resistant state". In ethylene-mediated senescence, this invention seeks to improve the shelf-life/vase- life of products, whether fruit, vegetables, cut flowers, leaves, pot plants etc. This invention also teaches a method of controlling the senescent process, i.e. inducing ripening at a particular time in response to a spray or cnanged condition.

The following non-limiting examples are provided as an illustration of the usefulness of the above-described invention, wherein reference is made to the following figures :

FIG. 1 The cDNA sequence for the GTase encoded by the TWIl gene, isolated from tomato. FIG. 2 The 5'upstream region for tne TWIl gene up to the start codon and including the promoter region.

FIG. 3 Ammo acid (glucosyl transferase protein) sequence of the TWIl gene. FIG. 4 Nucleic acid sequence for a homologous

GTase enzyme isolated from tobacco.

FIG. 5 Nucleic acid sequence for a nomologous GTase enzyme isolated from rice.

FIG. 6 Reference gel demonstrating TWIl expression during stages of tomato fruit development. RNA extracted from tomato fruits at different developmental stages and subjected to Nortnern Blotting and probed with TWIl cDNA are shown. Lane 1: immature green fruit; Lane 2: mature green fruit; Lane 3: breaker stage; Lane 4: pmk-ripe; and Lane 5: red-ripe fruit .

FIG. 7 Reference gel showing the expression of the protemase inhibitor (pin) 2 gene and ethylene- formmg enzyme (ACO) m transgenic tomato lines expressing a TWIl antisense gene prevents wound-induced pin gene expression and prolongs ACO expression.

FIG. 8 Reference gel electrophoresis demonstrating the accumulation of TWIl mRNA (GTase) during wounding and elicitor treatment m tomato plants. Each lane of gel is described m full in Example 2.

FIG. 9 Reference gel demonstrating a time-course of TWIl mRNA accumulation by wounding and salicylic acid (2 mM) treatment m tomato. Each lane is described in full m Example 3.

FIG. 10 Reference gel showing that wound-induced TWIl expression is SA-independent .

FIG. 11 Reference gel demonstrating local and long range expression of TWIl on wounding tomato plant leaves .

FIG 12 Reference gel illustrating the effect of anti-sense suppression of ACO expression on wound induced pin-2 expression by comparing the levels of transcript accumulation in wounded transformed and wild-type 21 day eld tomato plants.

FIG. 13 Reference gel demonstrating wound-induced pin gene expression can be inhibited by norbornadiene. FIG. 14 Reference gel demonstrating that aspirin inhibits wound induced pm2 gene expression. Details of each lane are given in Example 6.

FIG. 15 Reference gels demonstrating TWIl mRNA accumulation m cotyledons of tomato plants injected with either intercellular fluid containing the Avr9 avirulence protein from Cladosporium fulvum (IF9) or water. Tomato plants carrying the Cf9 resistance gene (Cf9) or without the resistance gene (CfO) were used. FIG. 16 Tobacco TWIl expression and salicylate accumulation m response to TMV infection in tobacco NN plants. The reference gels show the accumulation of the tobacco TWIl homologue mRNA m TMV-infected wild- type tooacco plants, but no accumulation m mock (water) inoculated plants, nor in plants transgenic for nahG salicylate nydroxylase gene. The time course indicates time after transfer of plants from 30°C to 24°C at which point the resistance response is initiated.

FIG. 17 Histograms indicating the levels of the free and conjugated salicylate present in leaves of the same plants at the time-points (hours) indicated on the x-axis. Significant SA accumulation only occurs in wild-type NN tobacco, but not NN+ NahG tobacco. FIG. 18 Photographs showing the effects on tobacco leaves of injection of harpin (HrpN) protein into leaves of plants which are wild-type (WT) or transgenic for over-expression of the tobacco TWIl homologue (OVER) or antisensed for the GTase (ANTI) . FIG. 19 Reference gel showing tobacco acidic chitinase (PR3A) accumulation in water- or harpin- treated tobacco leaves at either 1, 2 or 3 days after injections, and in healthy (H) leaves. The plants are either wild-type (WT) or transgenic for over-expression (OVER) or antisensed (ANTI) of the tobacco GTase gene.

EXAMPLE 1

The TWIl (tomato wound-inducible) gene was first identified and analyzed as a partial cDNA from a differential screen of a tomato-wounded-leaf cDNA library.

Using the partial cDNA as a probe m Northern analyses TWIl mRNA was confirmed as wound-inducible, with transcripts detectable by 15 minutes after injury to the leaves. Expression of the gene corresponding to TWIl was also found to be developmentally-regulated. Whilst not expressed m unwounded leaves of a young tomato plant, TWIl mRNA became abundant in older yellow leaves and was also found at high levels m red-ripe tomato fruit (FIG 6) . The pattern of induction of TWIl __

22

by elicitors of other wound responsive genes was also analyzed The TWIl was observed to be induced by plant cell wail fragments and salicylic acid, suggesting at the time P J O'Donnell, 1995, Doctoral Thesis from Leeds University) TWIl belonged to the family of defence-related proteins, know as the pathogenesis- related 'PR) proteins, all of which are induced by salicylic acid and some of which are also induced by mechanical injury.

When a full-length cDNA of TWIl was obtained and sequencec, nomoiogy was found to a large family of previously identified sequences encoding glucosyl transferases. The closest homology to existing sequences was observed to be that of Mesculenta Crantz cDNAs, mecgtl, encoding a UDP-glucose glucosyl transferase (54.3%) and mecgt5 encoding a UTP-glucose glucosyl transferase (52.2%) . These have been identified as transferases involved in glucosylation of secondary metabolites. High homology was also found to a glucosyl transferase of Zea mays, involved m the glucosylation of IAA (52.8%) and to a ripening-related glucosyl transferase of tomato (ERT1B) known to glucosyiate secondary metabolites.

The standard approach to identifying function is to use an antisense strategy, in which a transgene is constructed which expresses the gene of interest m antisense orientation, thereby leading to constitutively negligible levels of the gene product. The phenotype of the plants can then be analyzed to determine the effects of knocking out the expression of the gene. Using this antisense technology, tomato plants were transformed with TWIl coding sequence in antisense orientation whose expression was constitutively driven by a Cauliflower Mosaic Virus (35S) promoter. A 480bp fragment from the 5' end of the TWIl cDNA clone was produced by Poiyτπerase Cham Reaction using the following primers:

5' primer - TCTTTCCTCTAGAATGCAAGGTC incorporating a Xbal restriction site 3' primer - GTTCAGGTACCGATGACACATTC incorporating a Kpnl restriction site

When digested with Xbal and kpnl, a 461 bp fragment was produced. This was sub-cloned into Xbal /Kpnl digested site of the Dinary vector pJRIRi, giving a construct with the TWIl fragment in the antisense orientation. After transformation into E. coli , the plasmid was transferred into the Agrrobacterαum strain LBA4404, by triparental mating. Cultures were then selectively grown up of Agrobacteπum containing the plasmid.This was then used to transform tomato plants via Agrobacteπum . Selection of potential transformed plants was on the basis of resistance to kanamycm. Regenerated plants were studied by RNA analysis to investigate the effect of the TWIl antisense transgene.

It was discovered in three independently transformed primary transformants that the response to injury had changed. The standard wound-response gene marker, proteinase inhibitor was not expressed, whereas the gene encoding ethylene-forming enzyme (ACO) , normally expressed transiently was not down-regulated and wound ethylene levels were maintained at high levels (FIG 7) .

The revelation that TWIl was wound-inducible m no way implicates the gene product in a regulatory role, quite the opposite. This gene is responding to wound-induced signals. The fact the TWIl gene snared homology to those encoding Known glucosyl transferases would not implicate the gene product in a regulatory role, since many glucosyl transferases merely glucosyiate secondary metabolites such as ERT1B [14] .

EXAMPLE 2

Accumulation of TWIl mRNA by mechanical wounding and elicitor treatments was assessed. Results can be seen m FIG 8. Wounding was carried out by crushing the terminal leaflets of 21 day old tomato plants ( Lycopersicon escul entum Mil.) cultivar Moneymaker, with a pair of tweezers. For all elicitor treatments 21 day old plants were excised at the base of the stem and incubated for 30 minutes in the various treatments, at the stated concentrations. After 30 minutes in the elicitor, the plants were transferred into water for the remainder of the incubation period. For all treatments, plants were maintained under constant light at 22°C. Leaf material was harvested at 1 hour after wounding/treatment m each case, and total RNA was then extracted. 10 μg of total RNA from each sample was separated by agarose gel electrophoresis m gels containing 7% formaldehyde, blotted onto Hybond-N membrane and probed with P³² labelled TWIl cDNA. In FIG. 8 the results are demonstrated, with the labels being: 1) healthy leaf; 2) wounded leaf; 3) H₂0; 4) jasmonic acid (100 μM) ; 5) systemm (100 nM) ; 6) salicylic acid (2nM) ; 7) aspirin (2mM) ; 8) benzoic acid (2mM) ; 9) 3,4 di-OH benzoic acid (2 mM) ; 10) 2,6 di-OH benzoic acid (2mM) ; 11) DCINA (ImM) . The filter was exposed to film for 3 days. Equal loading was confirmed by re-hybridismg the stripped blot with a ³²P labelled ribosomal RNA probe. EXAMPLE 3 : Time Course of Expression of TWIl and Response to Wounding And Salicylic Acid

FIG. 9 is a Northern analysis comparing the time-course of induction of GTase and PRla (PR= pathogenesis- reiated) gene expression following application of SA to the tomato plants through the transpiration stream. The increase in steady-state levels of the GTase transcripts is very rapid when compared to those of PRla, and become detectable within 10-15 minutes of treatment. To our knowledge, this is the fasted SA- responsive gene so far identified, since the kinetics of up-regulation of SAR genes in tobacco and tomato are all known to be comparable to that of the PRla shown in FIG. 9.

The time-course of TWIl mRNA accumulation by wounding and salicylic acid (2mM) treatment is specifically demonstrated in FIG. 9, including the induction of PR1 by SA treatment. 21 day old tomato plants were wounded, or excised at the base of the stem and incubated with 2 mM salicylic acid, as described in Example 2. Leaf material was harvested at each time point shown, and total RNA extracted. 10 μg of total RNA was fractionated through an agarose gel containing 7% formaldehyde, blotted onto Hybond-N membrane and probed with ³²P labelled TWIl cDNA, or PR1 cDNA. Time shown in FIG. 9 is in hours after wound/SA application, the filters was exposed to film for 24 hours (TWIl filters) or 7 days (PR1 filters) .

To assess whether SA might be a wound-induced signal which induced TWIl expression, we also wounded leaves of transgenic tomato plants harbouring the salicylate hycroxylase gene (NahG) , which presents SA accumulation. As shown in FIG 10, the response of TWIl to wounding in NahG tomato plants is not significantly different from the response m wild-type plants, indicating that wound induction of this gene is ΞA- mdependent .

EXAMPLE 4 : (Local and Systemic Wound Induction of TWIl mRNA) FIG. 11 compares the timing of wound-induction GTase expression m the leaf that is damaged and m the systemicaily responding undamaged leaf of the plant.

In FIG. 11, mechanical wounding was carried out on the terminal leaflets the first leaf of 21 day old tomato plants, as described m Example 2. Leaf material was harvested from wounded leaf ιlocal) and the unwounded leaf 2 (systemic) at the stated times, and total RNA extracted. 10 μg of total RNA was separated through an agarose gel containing 7% formaldehyde, blotted onto Hybond-N membrane and probed with ³²P labelled TWIl cDNA. Time given is hours after mechanical wound. The hybridised filter was exposed to film for 8 days.

EXAMPLE 5

The effect of antisense suppression of the ethylene - forming enzyme (ACO) expression on wound induced pin-2 expression was assessed by comparing the levels of transcript accumulation in wounded transformed and wild-type plants. 21 day old tomato plants

(lycopersicon esculentum Mill) cultivar Alisa Craig, expressing an ACO construct in anti-sense orientation and driven by the 35S CaMV promoter were wounded as discussed m Example 2, above. Leaf material was harvested at the indicated times, total RNA was extracted and analyzed for pm-2 gene expression by Northern blot. Control wild type plants were wounded and leaf material harvested at 8 hours for Northern analysis.

We also found that the inhibitory effect cf NBD (norbarnadiene, a competitive inhibitor of ethylene on pin2) expression can be overcome by excess exogenous ethylene, which is consistent with its action as an inhibitor (FIG. 12) . This strongly suggests that ethylene must be present in wound response. Results illustrating pin2 gene expression following these treatments are shown in FIGS 12 and 13.

EXAMPLE 6

Aspirin inhibition of pin-2 gene expression can be overcome by jasmonic acid and ethylene, but not by JA or ethylene alone. Plants were pretreated in water or ASA (aspirin) for 30 minutes, in gas tight chambers, before removal of the plants and incubation in the open. ASA pretreated plants were treated with either ethylene (100 ppm) , JA, JA -r 5ppm of ethylene, JA + 10 ppm ethylene, JA + 50 ppm ethylene or JA + lOOppm ethylene for 30 minutes in gas tight chambers before transfer to the open. Control plants were treated with water for the experimental duration. Leaf material was harvested at 4 hours post-treatment, total RNA extracted and northern analysis performed using the pin-2 cDNA (FIG 14) .

EXAMPLE 7

The expression of TWIl in response to gene-for-gene mediated pathogen resistance was assessed using Avr9- containing extracts to elicit a resistance response in tomato harbouring the Cf9 resistance gene. Elicitor was injected into cotyledons of Cf9 plants or control plants with no Cf9 gene (CfO) and as a further control, Cf9 cotyledons were injected with water. At various time-points after injection, RNA was extracted and subjected to Northern blotting using the TWIl cDNA as a probe (FIG 15) . Significant induction of TWIl expression was only detected in Cf9 plants injected with Avr9 elicitor, demonstrating a pathogen-resistance response-specific activation of the GTase.

EXAMPLE 8

The expression of the tobacco TWIl homologue during a pathogen-resistance response was investigated in tobacco plants harbouring the N-resistance gene infected with tobacco mosaic virus (TMV) . Wild-type tobacco, or tobacco transformed with a salicylate hydroxylase gene (NahG) which cannot accumulate salicylic acid (SA) , were inoculated with TMV or mock- inoculated with water and grown for 2 days at 30°C to permit virus spread. The plants were then transferred to 24°C to initiate the resistance response and RNA, SA and SA conjugates were extracted at various time- points. As shown in FIGS 16 and 17, GTase expression was only induced in wild-type NN tobacco infected with TMV. No GTase expression was observed in the NahG transformants which did not significantly accumulate SA, whereas expression in wild-type plants correlated with the timing of SA production.

EXAMPLE 9

The tomato TWIl cDNA sequence can be used as a heterologous probe to identify the SA GTase from a range of Solanaceous species as shown by Southern blotting. We have isolated full-length cDNA clones corresponding to the SA GTase of tobacco using tne tomato TWIl sequence as a probe (FIG 4) . These two genes show around 85% identity m primary sequence.

Additional GTases have been identified in DNA sequence databases of expressed sequence tags from rice (FIG 5) .

EXAMPLE 10 - Production of transgenic plants Plasmid constructs containing the tobacco TWIl GTase homologue in either sense or antisense orientation were produced using the pJRlRi vector, placing expression of the sense or antisense genes under the control of the CaMV 35S promoter and nos polyadenylation signal. These plasmids were transferred to Agrobacterium tumefaciens strain LBA4404 by tri-parental matmgs. Leaf disks from tobacco Nicotiana tabacum cv (Samsun NN) were inoculated with the transformed Agrobacteπum strains and transgenic plants regenerated using standard protocols.

These plants were used in experiments using the bacterial elicitor, harpin (the HrpN gene product from Erwinia amylovora) . In wild-type tobacco plants, and plants expressing an antisense GTase gene, harpin injection into leaves caused the formation of necrotic lesions, but such lesions were not observed in plants over-expressing the GTase (sense construct) (FIG 17) . RNA was extracted from the injected leaves and the expression of PR genes assessed by Northern blotting

(FIG 18) . In wild-type plants, PR3a gene expression peaked at 1 day post-injection and was present at high levels throughout the time-course. In antisense plants, the peak at 1 day was maintained over the whole time course, whereas in over-expressing plants, PR3a expression was significantly suppressed.

These data suggest that a key signal which controls lesion formation and PR gene expression is affected by GTase expression levels.

1. Doherty, HM, Selvendran, RR, Bowles, DJ (1988) Physiol . Mol . Plant Pa thol . 33; 377-384.

2. Doherty, HM, Bowles, DJ (1990) Plant Cell Environ .

13, 851-855. 3. Pena-Cortes, H, Albrecht, T, Prat, S, Weiler, EW, Willmitzer, L (1993) Planta 191; 123-128.

4. Doares, SH, Narvaez-Vasquez, J, Conconi, A, Ryan, CA (1995) Plant Physiol . 108; 1741-1746.

5. Szerszen, JB, Szczyglowski, K, Bandurski, RS (1994) Science 265; 1699-1701.

6. Yalpani, N, Schulz, M, Davis, MP, Balke, NE (1992) Plant Physiol . 100; 457-463.

7. Ecker, JR, Davis, RW (1995) Science 268:667-675.

8. Ward, ER, Uknes, SJ, Williams, SC, Dincher, SS, Wiederhold, DL, Alexander, DC, Ahl-Goy, P, Metraux, J- P, Ryals, JA (1991) Plant Cell 3; 1085-1094.

9. Abeles, FB, Morgan, PW, Saltveit, ME Jr. "Ethylene in plant biology, " Academic Press.

10. Wei, Z.M., Laby, R.J., Zumoff, C.H., Bauer, D.W., He, S.Y., Collmer,A., Beer, S.V. (1992) Science 257:

85-Θ8.

11. Gan, S, Amasino, RM (1995) Sci ence 270; 1986-1988.

12. Nichoiass, FJ, Smith, CJS, Schuch, W, Bird CR, Grierson,D (1995) Plant Mol . Biol . 28; 423-435. 13. Bevan, M (1984) Nucl eic Acids Res . 12; 8711.

14. Picton, S, Gray, J, Barton, S, Abu Bakar, U, Lowe, A, Grierson, D (1993) Plant Mol . Biol . 23; 193-207.

Claims

1. A recombinant or isolated DNA as shown or su^pstantially homologous to a nucleotide sequence of FIG 1 or a fragment thereof, wherein said DNA is a gene (TWIl) encoding a glucosyl transferase or an equivalent protein in plants.

2. DNA as claimed in claim 1 encoding for an ammo acid sequence of FIG 3.

3. A recombinant or isolated DNA as shown in FIG 4 or a fragment thereof, wherein said DNA codes for a substantial homologue of a tomato TWIl gene and is isolated from tobacco.

4. A recombinant or isolated DNA as shown in FIG 5 or a fragment thereof, wherein said DNA codes for a substantial homologue of a tomato TWIl gene and is isolated from rice.

5. DNA as claimed in claim 1, which further comprises a promoter said promoter being 5' to the coding region of the sequence shown m FIG 2.

6. DNA as claimed in any one of claims 1 to 5, wherein the promoter is operatively linked to the TWIl gene which, when expressed, effects glucosyl transferase levels in tomatoes.

7. DNA as claimed m any one of claims 1 to 6, wherein the TWIl promoter of FIG 2 is operatively linked to DNA substantially homologous to the TWIl gene which, when said DNA is expressed, effects glucosyl transferase levels or a similar protein m dicotyledonous plants.

8. DNA as claimed in any one of claims 1 to 6 , wherein the TWIl promoter of FIG 2 is operatively linked to DNA substantially homologous to the TWIl gene which, when said DNA is expressed, effects glucosyl transferase levels or a similar protein in monocotyledonous plants.

9. DNA as claimed in any one of claims 1 to 8 , wherein said DNA encodes for RNA which is antisense to RNA normally found in a plant cells.

10. DNA as claimed in claim 9, wherein the DNA encodes for RNA which is antisense to RNA encoding for glucosyl transferase in tomatoes or its equivalent in other plants .

11. Antisense nucleic acid which includes a transcribable strand of DNA complementary to at least part of DNA that is naturally transcribed by the TWIl gene coding for glucosyl transferase in tomatoes or an equivalent gene and protein in other plants.

12. Antisense nucleic acid as claimed in claim 11, wherein transcription is under the control of a constitutive promoter, such as a Cauliflower Mosaic Virus 35S promoter.

13. Antisense nucleic acid as claimed in claim 11, wherein transcription is under the control of a glucosyl transferase promoter.

14. DNA as claimed in any one of claims 1 to 13, which is in the form of a recombinant vector.

15. DNA as claimed in claim 14, wherein the vector is a cloning vector and comprises one or more selectable markers .

16. A microbial host cell transfected or transformed with a vector as claimed in claim 14 or 15.

17 DNA as claimed m any one of claims 1 to 16, which includes a marker sequence which enables a plant transformed with the DNA to be distinguished from plants not so transformed.

18. DNA as claimed in claim 17, wherein the marker sequence confers antibiotic or herbicide resistance.

19. A plant cell including DNA as claimed in any one of claims 1 to 18.

20. A plant or part of a plant, or propagating material from a plant comprising plant cells transformed as claimed m claim 19.

21. A method of altering the signalling pathways m plants by altering the levels of any one of salicylic acid, jasmonic acid or ethylene produced by said plants, said method comprising interfering with a glucosyl transferase or similar protein encoded by an isolated DNA (TWIl) as claimed in any one of claims 1 to 18 or a fragment thereof.

22. A method as claimed m claim 21, wherein the plants are any one of tobacco, rice or tomato, preferably tomatoes.

23. A method of inducing the production of plant defence proteins in plants, said method comprising regulating a glucosyl transferase protein encoded by an isolated DNA

(TWIl) as shown in or substantially homologous to a nucleotide sequence as claimed in any one of claims 1 to

18, said glucosyl transferase altering the signalling pathways of any one of salicylic acid, jasmonic acid or ethylene.

24. A method as claimed in claim 23, wherein the plant defence proteins comprise PR proteins and PIN proteins.

25. A method of regulating developmental events m plants, wherein said method comprises manipulating levels of ethylene produced by a plant , said manipulation comprising interfering with production of a glucosyl transferase gene encoded by an isolated DNA as claimed in any one of claims 1 to 18 or a fragment thereof.

26. A method as claimed in claim 25, wherein the developmental events regulated are plant growth, reproduction and senescence.

27. A method for stimulating or improving plant response to pathogens, said method comprising altering levels of salicylic acid produced by a plant in response to a pathogen, said method further comprising interfering with a glucosyl transferase gene encoded by a DNA as claimed in any one of claims 1 to 18 or a fragment thereof.