EP0846179A2

EP0846179A2 - Dna constructs

Info

Publication number: EP0846179A2
Application number: EP96925889A
Authority: EP
Inventors: Ian Jepson; Jacqueline Ann Mary Paine
Original assignee: Zeneca Ltd
Current assignee: Syngenta Ltd
Priority date: 1995-08-08
Filing date: 1996-07-29
Publication date: 1998-06-10
Also published as: CZ36998A3; GB9516241D0; BR9609873A; MX9801008A; CN1199425A; JPH11510694A; AR002914A1; WO1997006268A3; AU704172B2; AP863A; WO1997006268A2; HUP9900057A3; NZ313724A; AP9801194A0; AU6625296A; SK16998A3; TR199800177T1; PL324880A1; HUP9900057A2; IL123172A0

Abstract

A chemically-inducible plant gene expression cassette comprising a first promoter operatively linked to a regulator sequence which is derived from the alcR gene and encodes a regulator protein, and an inducible promoter operatively linked to a target gene which encodes a protein which is damaging to insects or whose expression induces a metabolic pathway which produces a metabolite which is damaging to insects, the inducible promoter being activated by the regulator protein in the presence of an effective exogenous inducer whereby application of the inducer causes expression of the target gene.

Description

DNA CONSTRUCTS

The present invention relates to DNA constructs and plants incorporating them. In particular, it relates to promoter sequences and their use in the expression of genes which confer insecticidal activity on plants.

Advances in plant biotechnology have resulted in the generation of transgenic plants which are protected against feeding insect larvae.

Many organisms produce proteins which are harmful to insects and among these is the organism Bacillus thuringiensis which produces a crystal-associated protein δ endotoxin which kills insect larvae upon ingestion. It is not, however, toxic to mammals. It is thus very useful as an agricultural insecticide. Many strains of B. thuringiensis are active against insect pests, and the genes encoding for the insect endotoxins have been characterised. The B. thuringiensis δ endotoxins include those specifically insecticidal to Lepidopteran larvae (such as the Cryl type proteins), those specifically insecticidal to Coleopteran larvae (such as the Crylll type proteins) and those with dual specificity for Lepidoptera and Coleoptera (such as CryV). Chimeric proteins comprising at least part of a B. thuringiensis endotoxin have also been proposed with the aim of improving the properties ofthe endotoxin in some way, for example improved speed of kill. Transgenic plants expressing genes which encode for the insecticidal endotoxins are also known. Other ways of damaging insects include stimulating plant metabolic pathways which produce metabolites which are insecticidal.

We propose a system where genes encoding active insecticidal proteins such as B. thuringiensis endotoxins would be expressed in an inducible manner dependent upon application of a specific activating chemical. Alternatively, the induction of pathways which produce metabolites damaging to insects could be acheived. This approach has a number of benefits, including the following:

1. Constitutive expression in plants of insect resistance genes such as B. thuringiensis endotoxins, will lead to a significant increase in the selection pressure for resistant insect species. The inducible regulation of insect resistance genes will reduce the risk of development of resistant pests. For example, insecticidal gene expression can be induced only at the point in the growing season where protection is required. In addition, switchable insect tolerance can be used as a part of an integrated pest management system, in which chemical treatments to induce insecticidal gene expression can be alternated with standard insecticidal pesticide treatments.

2. There is a risk that overexpression, from strong constitutive promoters, could lead to detrimental effects on plant development resulting in aberrant germination flowering or yield penalties. Inducible expression would reduce the risk of detrimental effects as the transgene could be expressed for a short period avoiding sensitive points in development.

3. The switch chemical could be added to standard insecticide formulations to give both a chemical and gene effect, thus killing insects by two independent mechanisms. We have developed an inducible gene regulation system (gene switch) based on the alcR regulatory protein from Aspergillus nidulans which activates genes expression from the ale A promoter in the presence of certain alcohols and ketones. This system is described in our International Patent Publication No. WO93/21334 which is incorporated herein by reference. The alcA/alcR gene activation system from the fungus Aspergillus nidulans is also well characterised. The ethanol utilisation pathway in A. nidulans is responsible for the degradation of alcohols and aldehydes. Three genes have been shown to be involved in the ethanol utilisation pathway. Genes ale A and /cR have been shown to lie close together on linkage group VII and aldA maps to linkage group VIII (Pateman JH et al, 1984, Proc. Soc. Lond., B217:243-264; Sealy-Lewis HM and Lockington RA, 1984, Curr. Genet. 8:253- 259). Gene alcA encodes ADHI in A. nidulans and aldA encodes AldDH, the second enzyme responsible for ethanol utilisation. The expression of both ale A and aldA are induced by ethanol and a number of other inducers (Creaser EH et al, 1984, Biochemical J., 255:449- 454) via the transcription activator alcR. The alcR gene and a co-inducer are responsible for the expression of ale A and aldA since a number of mutations and deletions in alcR result in the pleiotropic loss of ADHI and aldDH (Felenbok B et al, 1988, Gene, 73:385-396; Pateman et al, 1984; Sealy-Lewis & Lockington, 1984). The ALCR protein activates expression from ale A by binding to three specific sites in the ale A promoter (Kulmberg P et al, 1992, J. Biol. Chem, 267:21146-21153).

The alcR gene was cloned (Lockington RA et al, 1985, Gene, 33:137-149) and sequenced (Felenbok et al, 1988). The expression ofthe alcR gene is inducible, autoregulated and subject to glucose repression mediated by the CREA repressor (Bailey C and Arst HN, 1975, Eur. J. Biochem. 51:573-577; Lockington RA et al, 1987, ?/. Microbiology, 1 :275- 281; Dowzer CΕA and Kelly JM, 1989, Curr. Genet. 15:457-459; Dowzer CΕA and Kelly JM, 1991, Mol. Cell. Biol. 11 :5701-5709). The ALCR regulatory protein contains 6 cysteines near its N terminus co-ordinated in a zinc binuclear cluster (Kulmberg P et al, 1991, FEBS Letts. , 280: 1 1-16). This cluster is related to highly conserved DNA binding domains found in transcription factors of other ascomycetes. Transcription factors GAL4 and LAC9 have been shown to have binuclear complexes which have a cloverleaf type structure containing two Zn(II) atoms (Pan T and Coleman JΕ, 1990, Biochemistry, 29:3023-3029; Halvorsen YDC et al, 1990, J. Biol. Chem, 265:13283-13289). The structure of ALCR is similar to this type except for the presence of an asymmetrical loop of 16 residues between Cys-3 and Cys-4. ALCR positively activates expression of itself by binding to two specific sites in its promoter region (Kulmberg P et al, 1992, Mol. Cell. Biol , 12:1932-1939).

The regulation of the three genes, alcR, ale A and aldA, involved in the ethanol utilisation pathway is at the level of transcription (Lockington et al, 1987; Gwynne D et al, 1987, Gene, 51 :205-216; Pickett et al, 1987, Gene, 51 :217-226).

There are two other alcohol dehydrogenases present in A. nidulans. ADHII is present in mycelia grown in non-induced media and is repressible by the presence of ethanol. ADHII is encoded by alcB and is also under the control of alcR (Sealy-Lewis & Lockington, 1984). A third alcohol dehydrogenase has also been cloned by complementation with a adh- strain of S cerevisiae. This gene alcC, maps to linkage group VII but is unlinked to ale A and alcR.

The gene, alcC, encodes ADHIII and utilises ethanol extremely weakly (McKnight GL et al, 1985, EMBO J. , 4:2094-2099). ADHIII has been shown to be involved in the survival of A. nidulans during periods of anaerobic stress. The expression of alcC is not repressed by the presence of glucose, suggesting that it may not be under the control of alcR (Roland LJ and Stromer JN, 1986, Mol. Cell. Biol. 6:3368-3372).

In summary, A. nidulans expresses the enzyme alcohol dehydrogenase I (ADHI) encoded by the gene ale A only when it is grown in the presence of various alcohols and ketones. The induction is relayed through a regulator protein encoded by the alcR gene and constitutively expressed. In the presence of inducer (alcohol or ketone), the regulator protein activates the expression ofthe ale A gene. The regulator protein also stimulates expression of itself in the presence of inducer. This means that high levels of the ADHI enzyme are produced under inducing conditions (i.e. when alcohol or ketone are present). Conversely, the ale A gene and its product, ADHI, are not expressed in the absence of inducer. Expression of ale A and production ofthe enzyme is also repressed in the presence of glucose. Thus the ale A gene promoter is an inducible promoter, activated by the alcR regulator protein in the presence of inducer (i.e. by the protein/alcohol or protein/ketone combination). The alcR and alcA genes (including the respective promoters) have been cloned and sequenced (Lockington RA et al, 1985, Gene, 33:137-149; Felenbok B et al, 1988, Gene, 73:385-396; Gwynne t β/, 1987, Gene, 51:205-216).

Alcohol dehydrogenase (adh) genes have been investigated in certain plant species. In maize and other cereals they are switched on by anaerobic conditions. The promoter region of adh genes from maize contains a 300 bp regulatory element necessary for expression under anaerobic conditions. However, no equivalent to the alcR regulator protein has been found in any plant. Hence the alcRlalcA type of gene regulator system is not known in plants. Constitutive expression of alcR in plant cells does not result in the activation of endogenous adh activity.

According to a first aspect of the invention, there is provided a chemically-inducible plant gene expression cassette comprising a first promoter operatively linked to a regulator sequence which is derived from the alcR gene and encodes a regulator protein, and an inducible promoter operatively linked to a target gene which encodes a protein which is damaging to insects or whose expression induces a metabolic pathway which produces a metabolite which is damaging to insects, the inducible promoter being activated by the regulator protein in the presence of an effective exogenous inducer whereby application ofthe inducer causes expression ofthe target gene.

When the target gene encodes an insect-damaging protein, it is advantageous for that protein to be orally active. Examples of orally active insecticidal proteins are B. thuringiensis δ endotoxins and therefore, the target gene may encode at least part of a B. thuringiensis δ endotoxin.

We have found that the alcA/alcR switch is particularly suited to drive genes which encode for B. thuringiensis endotoxins for at least the following reasons. The alcA/alcR switch has been developed to drive high levels of gene expression. In addition, the regulatory protein alcR is preferably driven from a strong constitutive promoter such as polyubiquitin. High levels of induced transgene expression, comparable to that from a strong constitutive promoter, such as 35 CaMV, can be achieved.

Figure 1 reveals a time course of marker gene expression (CAT) following application of inducing chemical. This study shows a rapid increase (2 hours) of CAT expression following foliar application of inducing chemical. The immediate early kinetics of induction are brought about be expressing the regulatory protein in constitutive manner, therefore no time lag is encountered while synthesis of transcription factors takes place. In addition we have chosen a simple two component system which does not rely on a complex signal transduction system. We have tested the specificity of alcA/alcR system with a range of solvents used in agronomic practice. A hydroponic seedling system revealed that ethanol, butan-2-ol and cyclohexanone all gave high levels of induced reporter gene expression (Figure 2). In contrast when various alcohols and ketones listed in Table 1 and used in agronomic practice were applied as a foliar spray only ethanol gave high levels of induced reporter gene activity (Figure 3). This is of significance since illegitimate induction of transgenes will not be encountered by chance exposure to formulation solvents. Ethanol is not a common component of agrochemical formulations and therefore with appropriate spray management be considered as a specific inducer ofthe alcA/alcR gene switch in a field situation.

Table 1

1. Isobutyl methyl ketone 13. acetonyl acetone

2. Fenchone 14. JF5969 (cyclohexanone)

3. 2-heptanone 15. N-methyl pyrrolidone

4. Di-isobutyl ketone 16. polyethylene glycol

5. 5-methyl-2-hexanone 17. propylene glycol

6. 5 -methylpentan-2, 4-diol 18. acetophenone

7. ethyl methyl ketone 19. JF4400 (methylcyclohexanone)

8. 2-pentanone 20. propan-2-ol

9. glycerol 21. butan-2-ol

10. γ-butyrolactone 22. acetone

11. diacetone alcohol 23. ethanol

12. tetrahydrofurfuryl alcohol 24. dH₂O A range of biotic and abiotic stresses for example pathogen infection, heat, cold, drought, wounding, flooding have all failed to induce the alcA/alcR switch. In addition a range of non-solvent chemical treatments for example salicylic acid, ethylene, absisic acid, auxin, gibberelic acid, various agrochemicals, all failed to induce the alcJ lalcR system. The present invention is not limited to any particular endotoxin, and is also applicable to chimeric endotoxins.

The first promoter may be constitutive, or tissue-specific, developmentally- programmed or even inducible. The regulator sequence, the alcR gene, is obtainable from Aspergillus nidulans, and encodes the alcR regulator protein. The inducible promoter is preferably the ale A gene promoter obtainable from

.Aspergillus nidulans or a "chimeric" promoter derived from the regulatory sequences of the ale A promoter and the core promoter region from a gene promoter which operates in plant cells (including any plant gene promoter). The alcA promoter or a related "chimeric" promoter is activated by the alcR regulator protein when an alcohol or ketone inducer is applied.

The inducible promoter may also be derived from the aldA gene promoter, the alcB gene promoter or the alcC gene promoter obtainable from .Aspergillus nidulans.

The inducer may be any effective chemical (such as an alcohol or ketone). Suitable chemicals for use with an /cA/ /cR-derived cassette include those listed by Creaser et al (1984, Biochem J, 225, 449-454) such as butan-2-one (ethyl methyl ketone), cylcohexanone, acetone, butan-2-ol, 3-oxobutyric acid, propan-2-ol, ethanol.

The gene expression cassette is responsive to an applied exogenous chemical inducer enabling external activation of expression of the target gene regulated by the cassette. The expression cassette is highly regulated and suitable for general use in plants. The two parts ofthe expression cassette may be on the same construct or on separate constructs. The first part comprises the regulator cDNA or gene sequence subcloned into an expression vector with a plant-operative promoter driving its expression. The second part comprises at least part of an inducible promoter which controls expression of a downstream target gene. In the presence of a suitable inducer, the regulator protein produced by the first part ofthe cassette will activate the expression of the target gene by stimulating the inducible promoter in the second part -of the cassette. In practice the construct or constructs comprising the expression cassette of the invention will be inserted into a plant by transformation. Expression of target genes in the construct, being under control of the chemically switchable promoter of the invention, may then be activated by the application of a chemical inducer to the plant. Any transformation method suitable for the target plant or plant cells may be employed, including infection by Agrobacterium tumefaciens containing recombinant Ti plasmids, electroporation, microinjection of cells and protoplasts, microprojectile transformation and pollen tube transformation. The transformed cells may then in suitable cases be regenerated into whole plants in which the new nuclear material is stably incorporated into the genome. Both transformed monocot and dicot plants may be obtained in this way.

Examples of genetically modified plants which may be produced include field crops, cereals, fruit and vegetables such as: canola, sunflower, tobacco, sugarbeet, cotton, soya, maize, wheat, barley, rice, sorghum, tomatoes, mangoes, peaches, apples, pears, strawberries, bananas, melons, potatoes, carrot, lettuce, cabbage, onion.

The invention further provides a plant cell containing a gene expression cassette according to the invention. The gene expression cassette may be stably incorporated in the plant's genome by transformation. The invention also provides a plant tissue or a plant comprising such cells, and plants or seeds derived therefrom. The invention further provides a method for controlling plant gene expression comprising transforming a plant cell with a chemically-inducible plant gene expression cassette which has a first promoter operatively linked to a regulator sequence which is derived from the alcR gene and encodes a regulator protein, and an inducible promoter operatively linked to a target gene which encodes for a B. thuringiensis δ endotoxin, the inducible promoter being activated by the regulator protein in the presence of an effective exogenous inducer whereby application ofthe inducer causes expression ofthe target gene.

Various preferred features and embodiments of the present invention will now be described by way ofthe following non-limiting examples and the drawings in which:

Figure 1 is a plot showing the time course of induction of AR10 segregating population with 7.5% ethanol; Figure 2 is a plot showing CAT activity in AR 10-30 homozygous line on root drenching with various chemicals;

Figure 3 is a plot showing CAT activity in AR 10-30 homozygous line on root drenching with various chemicals; Figure 4 shows the production of a 35S regulator construct;

Figure 5 shows the production of a reporter construct;

Figure 6 illustrates switchable insect resistance vectors;

Figure 7 illustrates the sequence ofthe optimised Cryla(c) gene;

Figure 8 shows the restriction sites in the optimised Cryla(c) gene; Figure 9 illustrates the sequence ofthe Cry V gene;

Figure 10 shows the vector 5129 bps containing the CryV gene;

Figure 11 illustrates the sequence ofthe vector pMJBl; and

Figure 12 is a map of vector pJRIi.

EXAMPLE 1 Production Of The alcR Regulator Construct.

The alcR genomic DNA sequence has been published, enabling isolation of a sample of aJcR cDNA.

The alcR cDNA was cloned into the expression vector, pJRl(pUC). pJRl contains the Cauliflower Mosaic Virus 35S promoter . This promoter is a constitutive plant promoter and will continually express the regulator protein. The nos polyadenylation signal is used in the expression vector.

Figure 4 illustrates the production ofthe 35S regulator construct by ligation ofalcR cDNA into pJRl . Partial restriction ofthe alcR cDNA clone with BamHI was followed by electrophoresis in an agarose gel and the excision and purification of a 2.6 Kb fragment. The fragment was then ligated into the pJRl vector which had been restricted with BamHI and phosphatased to prevent recircularisation. The alcR gene was thus placed under control of the CaMV 35S promoter and the nos 3' polyadenylation signal in this "35S-alcR" construct.

EXAMPLE 2

Production Of The alcA-CAT Reporter Construct Containing The Chimeric Promoter. The plasmid pCaMVCN contains the bacterial chloramphenicol transferase (CAT) reporter gene between the 35S promoter and the nos transcription terminator (the "35S-CAT" construct). The alcA promoter was subcloned into the vector pCaMVCN to produce an "alcA-CAT" construct. Fusion of part ofthe alcA promoter and part ofthe 35S promoter created a chimeric promoter which allows expression of genes under its control.

Figure 5 illustrates the production ofthe reporter construct. The alcA promoter and the 35S promoter have identical TATA boxes which were used to link the two promoters together using a recombinant PCR technique: a 246 bp region from the alcA promoter and the 5' end ofthe CAT gene from pCaMVCN (containing part ofthe -70 core region ofthe 35S promoter) were separately amplified and then spliced together using PCR. The recombinant fragment was then restriction digested with BamHI and Hindlll. The pCaMVCN vector was partially digested with BamHI and HindlH, then electrophoresed so that the correct fragment could be isolated and ligated to the recombinant fragment.

The ligation mixtures were transformed into E coli and plated onto rich agar media. Plasmid DNA was isolated by miniprep from the resultant colonies and recombinant clones were recovered by size electrophoresis and restriction mapping. The ligation junctions were sequenced to check that the correct recombinants had been recovered.

EXAMPLE 3 Gene Constructs

We have generated the following constructs summarised in Figure 6: Vector 1 contains the enhanced 35S CaMV promoter fused to the tobacco mosaic virus omega sequence translational enhancer (TMV) Bacillus thuringiensis Cry I A (c) gene and nopoline synthase (nos) terminator.

Vector 2 is identical to vector 1 with the exception that the B. thuringiensis Cry I A (c) gene is replaced with the B. thuringiensis CryV gene. Vector 3 contains the ale R regulatory protein gene from Aspergillus nidulans driven from the 35S CaMV promoter, ale A promoter region, TMV enhancer Cry I A (c) and nos terminator.

Vector 4 is identical to vector 3 with the exception ofthe Cry I A(c) gene is replaced with the

CryV gene. The Cry I A (c) gene is an optimised Lepidotera specific synthetic sequence encoding a Bacillus thuringiensis endotoxin and is illustrated in Figures 7 and 8. The sequence was obtained from Pamela Green's laboratory, Michigan State University. The Cry V gene is a novel Bacillus thuringiensis endotoxin entomocidal to Coleopteran and Lepidopteran larvae, and is described in our International Patent Publication No

WO90/13651. The Cry V gene is a modified synthetic sequence, optimised for plant code usage and has had RNA instability regions removed. It is illustrated in Figures 9 and 10.

EXAMPLE 4 Vector Preparation

Vector 1 - Constitutive Cry 1 A (c)

PCR primers were designed to amplify the TMV omega sequence in pMJB 1 (see Figure 9) with the addition of a Sal I site adjacent to the Xhol site (see forward oligonucleotide) and destroying the Ncol site and adding a Sal I and Bgl II sites in the reverse oligonucleotide.

Forward oligonucleotide ι SEO ID NO 1) Sai l

5 ' CTACTCGAGTCGACTATTTTTACAACAATTACCAAC 3 * Xhol

Reverse Oligonucleotide fSEO ID NO 2)

5'CTAGGTACC GTCGAC GGATCCGTAAGATCTGGTGTAATTGTAAATAGTAATTG 3^! Kpnl Sail BamHI BglII

A PCR was performed with the forward and reverse primers using pMJBI plasmid

DNA on a template. The resultant PCR product was cloned into the pTAg vector (LigATor kit, R&D systems); this was then released with Asp 718 and Xho I digestion and cloned into Xho I/Asp 718 digested pMJBI (Figure 10), to form pMJB3. pMJBI is based on pIBT 211 containing the CaMV35 promoter with duplicated enhancer linked to the tobacco mosaic virus translational enhancer sequence replacing the tobacco etch virus 5' non-translated leader, and terminated with the nopaline synthase poly (A) signal (nos). The Cry IA(c) synthetic gene was excised as a Bgl II Bam H I fragment and cloned into pMJB3. A fragment containing the enhanced 35 CaMV promoter TMV omega sequence, Cryl A (c) and the nos terminator was isolated using Hind III and EcoR I. The resultant fragment was ligated into EcoRI/Hind III cut pJRIi (Figure 12) to generate a Bin 19 based plant transformation vector. Vector 2 - Constitutive Cry V pMJB3 was cut with Hind III and a Hind III - EcoRI - Hind III linker was inserted. The resultant vector was then cut with Bam HI and a fragment containing the CryV gene as a Bam HI fragment was inserted. The Cry V gene was orientated using a combination of restriction digestion and sequencing. An EcoRI fragment from the resultant vector, containing the enhanced 35 CaMV promoter, TMV omega sequence, CryV gene and nos terminator, was transferred to JRIRiMCS, a Bin 19 based vector containing the pUC18 multiple cloning site. Vector 3 - Inducible Cry 1 A (c) pMJB3 containing the Cry lA(c) gene was cut with Sal I, liberating a fragment containing the TMV omega sequence fused to the Cry 1 A(c) gene. The resultant fragment was cloned into Sal I cut pale A CAT and orientated by restriction digest. A fragment containing the alcA promoter fused to the TMV omega sequence, Cry 1 A(c) gene and nos terminator was excised using Hindlll, and transferred to Hindlll digested p35SalcRalcAcat, a Bin 19 based vector containing the 35 CaMV promoter fused to alcR cDNA, with the alcAcat reporter cassette removed on Hindlll digestion. Vector 4 - Inducible Cry V pMJB3 containing the Cry V gene was cut with Sal I, liberating a fragment containing the TMV omega sequence fused to the Cry V gene. The resultant fragment was cloned into Sal I palcACAT. and orientated by restriction digest and sequence analysis. Two fragments containing the ale A promoter Cry V gene and nos terminator were released by digestion with Hind III. A three way ligation ofthe two Hind III fragments was performed to insert the ale A Cry V nos cassette into p35alcRalcAcat digested with Hindlll to remove the alccat cassette. Correct assembly ofthe cassette was confirmed by restriction digest, southern blotting and sequence analysis. EXAMPLE 5

Plant transformation

Leaf transformation by Agrobacterium .

The transformation was performed according to the method described by Bevan 1984. 3-4 weeks old sterile culture of tobacco (Nicotiana tabacum cv Samsum), grown on MS, were used for the transformation. The edges ofthe leaves were cut off and the leaves cut into pieces. Then they were put into the transformed Agrobacterium cells, containing the pJRIRI plasmid with the insert, suspension (strain LBA 4404) for 20 minutes. The pieces were put on plates containing NBM medium (MS medium supplemented with lmg/1 6- benzylamino purine (6-BAP), OJmg/1 naphtalene acetic acid (NAA). After 2 days, explants were transferred to culture pots containing the NBM medium supplemented with carbenicillin (500 mg/l) and kanamycin (100 mg/l). Five weeks later, 1 shoot per leaf disc was transferred on NBM medium supplemented with carbenicillin (200 mg/l) and kanamycin (100 mg/l). After 2-3 weeks, shoots with roots were transferred to fresh medium. If required, 2 cuttings from each shoot were transferred to separate pots. One will be kept as a tissue culture stock, the other one will be transferred to soil for growth in the glasshouse after rooting.

Using this transformation method, the four vectors were introduced into tobacco and kanamycin-resistant primary transformants generated. There were 53 primary transformants generated for constitutive Cryl A(c), 54 for constitutive CryV, 73 for inducible CrylA(c) and 62 for inducible CryV.

EXAMPLE 6

Leaf DNA extraction for PCR reactions.

Leaf samples were taken from 3-4 weeks old plants grown in sterile conditions. Leaf discs of about 5 mm in diameter were ground for 30 seconds in 200 ul of extraction buffer (0.5% sodium dodecyl sulfate (SDS), 250 mM NaCl, 100 mM Tris HCl (tris(hydroxymethyl) aminomethane hydrochloride), pH 8). The samples were centrifuged for 5 minutes at 13,000 rpm and afterwards 150 ul of isopropanol was added to the same volume ofthe top layer.

The samples were left on ice for 10 minutes, centrifuged for 10 minutes at 13,000 rpm and left to dry. Then they were resuspended in 100 ul of deionised water. 2.5 ul was used for the PCR reaction at the conditions described by Jepson et al , Plant Molecular Biology Report 9(2), 131-138 (1991).

The primary transgenics generated were tested by PCR analysis to identify plants which contained the full length transgene: Constitutive CrylA(c

Two PCR reactions were carried out for these extracts using the following primer pairs:

TMV1 5'CTA CTC GAG TCG ACT ATT TTT ACA ACA ATT ACC AAC (SEQ ID NO 3) CRY1A2R 5'CGA TGT TGA AGG GCC TGC GGT A (SEQ ID NO 4)

The PCR conditions were 35 cycles of 95 °C 1.2mins, 62 °C 1.8 mins, 72 °C 2.5 mins and extension of 6 mins at 72 °C.

CRY1A1 5' GCA CCT CAT GGA CAT CCT GAA CA ( SEQ ID NO 5 )

NOS 5' CAT CGC AAG ACC GGC AAC AG (SEQ ID NO 6) The PCR conditions were 35 cycles of 95 °C 0.8 mins, 61 °C 1.8 mins, 72 °C 2.5 mins and extension of 6 mins at 72 °C.

Nine primary transformants gave PCR products for both primer sets; these and two PCR negative lines were planted into soil in 7.5" pots in the glasshouse.

Constitutive Cry V

Two PCR reactions were carried out for these extracts using the following primer pairs: TMV1 (see above)

CryVIR 5' GCT GTA GAT GGT CAC CTG CTC CA ( SEQ ID NO 7 )

The PCR conditions were 35 cycles of 94 °C 0.8 mins, 64 °C 1.8 mins, 72 °C 2.5 mins and extension of 6 mins at 72 °C.

CRYV1 5' TGT ACA CCG ACG CCA TTG GCA (SEQ ID NO 8 )

NOS (see above)

The PCR conditions were 35 cycles of 94 °C 0.8 mins, 58 °C 1.8 mins, 72 °C 2.0 mins and extension of 6 mins at 72 °C. 24 primary transformants gave PCR products for both primer sets; these and seven PCR negative lines were planted into soil in 7.5" pots in the glasshouse. Inducible CrylACc)

Three PCR reactions were carried out for these extracts using the following primer pairs:

ALCR1 5'GCG GTA AGG CTT TCA ACA GGC T (SEQ ID NO 9)

NOS as above The PCR conditions were 35 cycles of 94 °C 1.0 mins, 60 °C 1.0 mins, 72 °C 1.5 mins and extension of 6 mins at 72 °C.

The primer pairs TMV1/CRY1 A2R, CRY1 Al/ NOS were used as above. Forty-five plants gave PCR products for all primer sets; these and two PCR negative lines were planted into soil in 6" pots in the glasshouse Inducible CrvV

Sixty-two primary transformants have been generated but no PCR analysis carried out at present.

EXAMPLE 7 Western blot analysis.

120 mg of leaf from 3-4 weeks old plants grown in sterile conditions were ground at 4°C in 0.06 g of polyvinylpoly-pyrolidone (PVPP) to adsorb phenolic compounds and in 0.5 ml of extraction buffer (1 M Tris HCl, 0.5 M EDTA (ethylenediamine-tetraacetate), 5 mM DTT (dithiothreiol), pH 7.8). Then 200 ml more of extraction buffer were added. The samples were mixed and then centrifuged for 15 minutes at 4°C. The supernatant was removed, the concentration of protein estimated by Bradford assay using the bovine serum albumin (BSA) as standard. The samples were kept at -70°C until required.

Samples of 25 mg of protein with 33% v/v Laemmli dye (97.5% Laemmli buffer (62.5 mM Tris HCl, 10% w/v sucrose, 2% w/v SDS, pH 6.8), 1.5% pyronin y and 1% b- mercaptoethanol) were loaded on a SDS-PAGE (sodium dodecyl sulphate-polyacrylamide gel electrophoresis) gel (17.7% 30:0.174 acrylamide:bisacrylamide), after 2 minutes boiling. Translation products were separated electro-phoretically in the following buffer (14.4% w/v glycine, 1% w/v SDS, 3% w/v Tris Base). Then they were transferred onto nitro¬ cellulose (Hybond-CO, Amersham) using an electroblotting procedure (Biorad unit) in the following blotting buffer (14.4% w/v glycine, 3% w/v Tris Base, 0.2% w/v SDS, 20% v/v methanol) at 40 mV overnight. Equal loadings of proteins were checked by staining the freshly blotted nitrocellulose in 0.05% CPTS (copper phtalocyanine tetrasulfonic acid, tetrasodium salt) and 12 mM HCl. Then the blots were destained by 2-3 rinses in 12 mM HCl solution and the excess of dye removed by 0.5 M NaHCO₃ solution for 5-10 minutes followed by rinses in deionised water. Filters were blocked for 1 hour with TBS-Tween (2.42% w/v Tris HCl, 8% w/v Nacl, 5% Tween 20 (polyxyethylene sorbitan monolaureate), pH 7.6) containing 5% w/v BSA. Then they were washed for 20 minutes in TBS-Tween supplemented with 2% w/v BSA. Indirect immunodetections were performed with a 1:2000 dilution of a Cry I A (c) or Cry V antiserum as first antibody and with a 1 : 1000 dilution of a rabbit anti-rabbit antiserum as second antibody, associated with the horseradish peroxidase (HRP). Any excess of antiserum was washed with TBS-Tween supplemented with 2% w/v BSA. ECL (enhanced chemiluminescence) detection was performed using the protocols described by Amersham. Any background was eliminated by additional washes ofthe membranes in the solution mentioned above. The latter one were then subjected to ECL detection. An estimation ofthe level of expression ofthe B. thuringiensis gene was performed on the LKB 2222-020 Ultroscan XL laser densitometer (Pharmacia). A helium-neon laser beam (wavelength 633 nm) was scanning on the autoradiograph a band of 2.4 mm width in the middle ofthe band corresponding to the translation products. Each peak was characterized by its area, determined by the inner software from the curve of absorbance function ofthe beam position.

EXAMPLE 8 Northern blot analysis

Total RNA was fractionated on a 1.2% agarose gel containing 2.2.M formaldehyde. After electrophoresis, the RNA was transferred onto Hybond-N membrane (Amersham) by capillary blotting in 20X SSPE. RNA was fixed to membranes using a combination UV strata linking (Stratagene) and baking for 20 minutes at 80°C. cDNA probes excised from pBluescript SK^" by digestion with EcoRI, were labelled with a ³²PdCTP using a random priming protocol, described by Feinberg and Vogelstein. Prehybridisations were performed in 5X SSPΕ, 0.1% SDS, 0.1% Marvel (dried milk powder), 100 mg/ml denatured salmon sperm DNA for 4h at 65°C. Hybridizations were achieved in the same buffer containing labelled probe at 65°C for 12-24h. Filters were washed at 65°C in 3 x SSC 0J%SDS for 30 mins, and once at 0.5 x SSC 0.1% SDS for 30 mins prior to autoradiography at -80°C.

Insect Feeding trials

The effectiveness ofthe present invention can be conveniently tested by feeding leaves of transgenic plants containing the constructs ofthe present invention to insect larvae, both in the presence and absence, as control, ofthe inducer.

EXAMPLE 9 Primary Screen

A primary screen was performed by removing leaves from the plants and cutting a number of 1 cm² leaf pieces. Replicas were placed separately on 0.75% agar and each infested with approximately 10 sterilized Heliothis virescens eggs. The leaf discs were covered and incubated at 25°C, 70% RH for 5 days before scoring the effects of larval feeding. Leaf damage was assigned a score ranging from 0 to 2 in 0.5 increments; 2 denoting no leaf damage (full insect feeding protection) and 0 implying the leaf disc was fully eaten. Leaves from all the constitutive Cryl A(c) tissue culture primary transformants and wild type tobacco were removed and tested for effect on Heliothis virescens as described above. The results are shown in Table 2 below: TABLE 2

Replicas: PCR+/- A B C D E

35SCrylA(c) 1 1 1 2 2 2

2 1 1 1.5 1 1.5

3 0 0 0 0 0

4 1.5 1 1.5 0 1.5

5 PCR + 0 1.5 0 1.5 0

6 1.5 0 1 1.5 1.5

7 PCR + 1.5 1.5 1.5 1.5 1.5

8 2 1.5 1 2 2

9 PCR + 2 2 1.5 2 2

10 1.5 2 1 1 1.5

11 0 1.5 0 0 0

12 0 0 0 0 1

13 2 2 0 0 1

14 1.5 1 0 0 0

15 2 1 2 0 0

16 PCR + 2 2 2 2 1.5 Replicas: PCR+/- A B C D E

17 2 0 0 1 2

18 0 0 0 1.5 2

19 PCR + 1.5 1.5 1.5 0 1.5

20 PCR + 1.5 1.5 2 1.5 1.5

21 1 0 0 0 0

22 0.5 0 0 2 2

23 0 1 0 0.5 0.5

24 1.5 1.5 0 0 0

25 2 2 1 1 2

26 1 0 0 1 1

27 0 1.5 0 1.5 0

28 PCR + 1.5 1.5 1.5 1.5 1.5

29 0 0 1 1 1.5

30 1 0 0 1.5 0

31 PCR + 1 0 1.5 0 1.5

32 2 1 1.5 0 1.5

33 2 2 2 2 2

34 1 0 0 1.5 2

35 0 2 0 1 1.5

36 2 0 2 2 0

37 2 1 1.5 1 1.5

38 PCR + 1.5 1.5 1.5 1.5 2

39 1.5 0 0 0 1

40 1 1 0 0 0

41 0 0 1 1 0

42 2 1.5 1.5 1.5 2

43 1.5 1.5 1.5 1.5 2

44 2 1.5 1.5 1.5 2

45 2 2 1 0 0

46 0 2 0 2 1

47 2 2 2 0 0 wt tobacco 1 2 2 2 0

In typical bioassay experiments wild type (wt) tobacco mainly gave an average score of less than 0.5.

EXAMPLE 10 Primary Screen - Retest

Eleven ofthe glasshouse grown constitutive CrylA(c) plants and wild type tobacco were retested. This was to demonstrate that constitutive Cryl A(c) plants that had been growing in soil in glasshouse conditions for three weeks after tissue culture were also showing reduced leaf damage from Heliothis virescens.

TABLE 3

Identity a b c d e 5SCrylA(c) 6 0.5 0.5 2 2 2

7 2 1 2 2 2

9 0.5 0.5 2 1 0.5

16 2 2 2 2 2

19 2 2 1.5 2 1.5

20 1.5 1 0 0.5 2

28 0.5 1.5 2 2 2

31 0 0 0 0 1.5

33 2 2 2 2 2

38 1 0 1 2 1

42 1 1 1 1 1 wt tobacco 0 0 0 0 1.5

EXAMPLE 11

Primary Screen with CryV Primary Transformants

Leaves from the constitutive CryV primary transformants and wild type tobacco were tested by the method described above. The damage sustained by excised leaf pieces is recorded below in Table 4.

TABLE 4

Identity PCR+/- a b c d

35SCryV 1 + 0 0 0 0

2 0 0 0 0

3 1.5 0 1 0

4 + 0 0 0 0

5 0 0 0 0

6 0 0 0 0

7 + 0 0 0 0

8 + 0 0 0 0

9 + 0 0 0 0

10 + 0 0 0 0

11 + 0 0 0 0

12 0.5 1 1 0.5

13 + 0 0 0 0

14 + 0 0 0 0

15 + 0 0 0 0 Identity PCR+/- a b c d

16 0 0 0 0

17 0 0 0 0

18 0 0 0 0

19 0 0 0 0

20 0 0 0 0

21 0 0 0 0

22 + 0 0 0 0

23 + 0 0 0 0

24 + 0 0 0 0

25 + 0 0 0 0

26 + 0 0 0 0

27 0 0 0 0

28 1 0 1.5 1

29 + 0 0 0 0

30 0 0 0 0

31 + 0.5 0.5 0.5 0

32 + 0 0 0 0

33 0 0 0 0

34 0 1.5 0 0

35 0 0 0 0

36 0 0 0 0

37 0 0 0 1.5

38 0 0 0 0

39 0 0 0 0

40 0 0 0 0

41 + 0 0.5 0 1.5

42 0 0 0 0

43 0 0 0 0

44 0 0 0 0

45 + 0 0 0 0

46 + 0 0 0 0

47 0 0 0 0

88 + 0 0 0 0

49 0.5 0.5 0 0

50 0 0 0 0

51 1 0 0 1

52 1 0.5 0.5 0.5 wt tobacco 0 0 0 1.5 EXAMPLE 12 Secondary Screen

To verify the data obtained from the primary screen, a secondary assay was performed on transgenic lines on larger leaf pieces using third instar larvae.

Tobacco leaves were cut from the plant and stored on ice for up to one hour. 40mm diameter leaf discs were cut and placed, cuticle side down, on 3% agar in 50mm plastic pots. Third instar Heliothis zea reared on LSU artificial diet for five days at 25°C were weighed and infested onto each leaf disc, one per disc. After infestation lids were placed on the pots and they were stored at 25°C under diffuse light. Treatments were assessed after 3 days for mortality, developmental stage and % leaf disc eaten. Larvae were weighed at infestation and after 3 days.

TABLE 5

EXAMPLE 13

Inducible insecticidal activity

Forty -five inducible Cryl A(c) PCR positive lines, two PCR negative lines and wt tobacco in 6" pots were root drenched with lOOmls of 5% ethanol. 28 hours later 4 replica small leaf pieces were removed and infested with Heliothis virescens eggs. The results are shown below (Table 6). Ofthe 45 lines grown in the presence of ethanol, 66% showed full resistance on the primary screen test to Heliothis virescens. To demonstrate that the plants were inducible and not constitutive expressors leaves were removed 8 days later from 7 of the high scoring lines and infested with Heliothis virescens eggs. Previous data from a reporter gene driven by the 35SalcRalcA switch promoter showed that CAT protein levels peaked at 24/48 hours and was on the decline after 48 hours (Figure 1). Other data (not shown) demonstrated that no CAT protein was detected 9 days after induction.

Table 7 demonstrates that in the absence of ethanol irrigation mortality levels were found to be comparable to that seen with a wild type control.

TABLE 6

Heliothis virescens on ALC Cryl A(c) glasshouse primary transgenics.

5% ethanol root drench, ~28hours before assay set up.

identity PCR+/- a b c d

ALCCrylA(c) 1 + 1 2 2 2

2 + 2 2 2 2

3 + 0 0 0 1.5

4 + 2 2 2 2

5 + 0.5 0.5 0.5 1

6 - 2 1 0.5 0

7 + 0 2 1.5 2

8 + 2 2 2 2

9 + 2 2 2 2

10 + 2 2 2 2

11 + 2 2 2 2

12 + 2 2 2 2

13 + 2 2 2 2

14 + 2 2 2 2

15 + 2 2 2 2

16 + 2 2 2 2

17 + 2 2 2 18 + 2 2 2 2

19 + 2 2 2 2

20 + 2 2 2 2

21 + 0 0 0 1

22 + 0.5 2 0.5 2

23 + 2 2 2 2

24 + 2 2 2 2

25 + 2 2 2 2

26 + 2 2 2 2

27 + 1 2 2 2

28 + 0.5 2 2 2

29 + 2 2 2 2

30 + 2 2 2 2

31 + 2 2 1 2

32 + 2 2 2 2

33 + 1 2 2 2

34 + 2 2 2 2

35 + 1 2 2 2

36 + 2 2 2 1

37 + 0 0.5 0 1

38 - 0.5 0.5 0.5 0.5

39 + 2 2 2 2

40 + 2 2 2 2

41 + 2 2 2 2

42 + 2 2 2 2

43 + 2 2 2 2

44 + 2 2 2 2

45 + 2 2 2 0.5

46 + 2 2 2 2

47 + 1 2 2 2 wt tobacco 0 0.5 0 0.5

TABLE 7

INDUC1 ED NO INDUCTION identity PCR+/- a b c d identity PCR+/- a b c d

17 + 2 2 2 2 17 + 0.5 0.5 0.5 1

32 + 2 2 2 2 32 + 1.5 1 1 0.5

39 + 2 2 2 2 39 + 2 2 0.5 0.5

40 + 2 2 2 2 40 + 0.5 0.5 0.5 0.5

41 + 2 2 2 2 41 + 0.5 2 0 1

43 + 2 2 2 2 43 + 0.5 0.5 0.5 0.5

44 + 2 2 2 2 44 + 0.5 0 0.5 0.5 t tobacco 0 0.5 0 0.5 wt tobacco 0 0 0.5 0.5

- wt tobacco 0 1 0 0 Several lines were chosen for a secondary screen to test the effect of induction on insect feeding, along with the constitutive Cryl A(c) line 10 and wt tobacco as controls. 10 leaf pieces for each line were removed from primary transformants 12 days after they had been induced by root drenching with lOOmls of 5% ethanol and placed on 3% agar in 50 mm pots with lids and incubated overnight at 25°C and 60% humidity. Expression of CrylA(c) protein was expected to be low or undetectable after 12 days.. The plants were then root drenched with lOOmls of 5% ethanol. 22 hours later leaves were excised and ten 40mm leaf pieces were removed and placed on 3% agar in 50mm pots with lids. Five uninduced and 5 ethanol induced leaf discs were infested with 3rd instar Heliothis zea and 5 of each infested with Heliothis virescens reared as described above. Table 8 demonstrates that wild type controls in the presence or absence of ethanol show a high percentage leaf disc eaten, while the 35S controls show good insect control under both chemical regimes. Transgenic lines containing the Ale Cry IA(c) construct showed poor insect control in the absence of ethanol treatment. Table 8 shows induction with ethanol gives insect control comparable to that seen in the 35S Cry I A (c) control.

TABLE 8

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: ZENECA LIMITED

(B) STREET: 15 Stanhope Gate

(C) CITY: London (E) COUNTRY: UK

(F) POSTAL CODE (ZIP) : W1Y 6LN

(ii) TITLE OF INVENTION: DNA CONSTRUCTS (iii) NUMBER OF SEQUENCES: 9

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentin Release #1.0, Version #1.30 (EPO)

(vi) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: GB 9516241.8 (B) FILING DATE: 08-AUG-1995

(2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

CATCTCGAGT CGACTATTTT TACAACAATT ACCAAC 36 (2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 53 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: CTAGGTACCG TCGACGGATC CGTAAGATCT GGTGTAATTG TAAATAGTAA TTG 53

(2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: CTACTCGAGT CGACTATTTT TACAACAATT ACCAAC 36

(2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: CGATGTTGAA GGGCCTGCGG TA 22

(2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: GCACCTCATG GACATCCTGA ACA 23 (2) INFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

( i) SEQUENCE DESCRIPTION: SEQ ID NO: 6: CATCGCAAGA CCGGCAACAG 20

(2) INFORMATION FOR SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: GCTGTAGATG GTCACCTGCT CCA 23

(2) INFORMATION FOR SEQ ID NO: 8:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: TGTACACCGA CGCCATTGGC A 21

(2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: GCGGTAAGGC TTTCAACAGG CT 22

Claims

1. A chemically-inducible plant gene expression cassette comprising a first promoter operatively linked to a regulator sequence which is derived from the alcR gene and encodes a regulator protein, and an inducible promoter operatively linked to a target gene which encodes a protein which is damaging to insects or whose expression induces a metabolic pathway which produces a metabolite which is damaging to insects, the inducible promoter being activated by the regulator protein in the presence of an effective exogenous inducer whereby application ofthe inducer causes expression ofthe target gene.

2. A chemically inducible plant gene expression cassette as claimed in claim 1, wherein the target gene encodes an orally active insecticidal protein.

3. A chemically inducible plant gene expression cassette as claimed in claim 2, wherein the orally active insecticidal protein is at least part of a Bacillus thuringiensis δ endotoxin.

4. A plant gene expression cassette according to any one of claims 1 to 3, wherein the inducible promoter is derived from the ale A gene promoter.

5. A plant gene expression cassette according to any one of claims 1 to 4, wherein the inducible promoter is a chimeric promoter.

6. A plant cell containing a plant gene expression cassette according to any preceding claim.

7. A plant cell according to claim 6, wherein the plant gene expression cassette is stably incorporated in the plant's genome.

8. A plant tissue comprising a plant cell according to either of claims 6 and 7.

9. A plant comprising a plant cell according to either of claims 6 and 7.

10. A plant derived from a plant according to claim 9.

11. A seed derived from a plant according to either of claims 9 and 10.

12. A method of controlling insects comprising transforming a plant cell with the plant gene expression cassette of any one of claims 1 to 5.