RU2799538C1 - Preimplantation genetic testing method for blepharophimosis, ptosis and epicanthus reversal syndrome type 1,2 - Google Patents

Abstract

FIELD: diagnostics.

SUBSTANCE: invention relates to a method for diagnosing the monogenic disease blepharophimosis, ptosis and epicanthus reversal syndrome, type 1, 2 under conditions of preimplantation genetic testing (PGT). The method involves detection of the inheritance of the pathogenic variant NC_000003.11:g.138665511_138665512del(NM_023067.4:c.53_54del, p.Prol8fs) in the FOXL2 gene and includes a double detection system — direct and indirect. Direct detection is carried out using amplification primers, and indirect detection is carried out using primers for the analysis of the inheritance of molecular genetic markers of the STR type linked to the pathogenic variant selected from SEQ ID NO 1-39. Primers directed to those STRs whose alleles are different on the chromosomes of the parent-carrier of the mutation are used. Diagnosis is carried out in two stages of semi-nested PCR: at the first stage, multiplex PCR is performed with external primers, at the second stage, individual PCR of each fragment is performed with internal primers for STR.

EFFECT: method has high specificity and efficiency, and is also universal in relation to biosamples of various types.

1 cl, 2 tbl, 1 ex

Description

The invention relates to preimplantation genetic testing of monogenic diseases. Currently, there are more than 350 million people in the world suffering from a rare disease (according to the RARE Project). The total number of such diseases, according to the estimates of the European Organization for Rare Diseases (EURORDIS), varies from 5 to 7 thousand. At the same time, about 80% of rare diseases have a genetic cause. The known genetic basis of the disease makes it possible to predict with high accuracy not only the health of an already born child, but also to assess the risk of having such a child by analyzing the genotypes of the parents, as well as to conduct genetic diagnostics at the earliest stages. Preimplantation genetic testing (PGT) of a monogenic disease is becoming a powerful tool for the prevention of such diseases.

The present invention relates to a method for preimplantation genetic testing for blepharophimosis, ptosis and epicanthus reversal syndrome type 1,2. Blepharophimosis, ptosis, and epicanthus reversal syndrome type 1,2 is a hereditary pathology of the eyelid and palpebral fissure, transmitted in an autosomal dominant mode of inheritance. Blepharophimosis, ptosis, and epicanthus reversal syndrome type 1,2 occur at a rate of 1 in 50,000 population. This disease leads to a violation of the formation of the eyelid from 2 sides. Characterized by drooping of the eyelid (ptosis), narrowing of the palpebral fissure, inversion of the epicanthus, anomalies of the lacrimal duct, amblyopia. These changes in women may also be accompanied by premature ovarian failure. With an autosomal dominant type of inheritance of the disease, the probability of having a child with this disease in the family is 50%.

Blepharophimosis, ptosis, and epicanthus reversal syndrome type 1,2 can be caused by pathogenic genetic variants in the FOXL2 gene [Crisponi L, et al. Nat Genet. Feb 2001; 27(2): 159-66], located on chromosome 3. This gene encodes the Forkhead box protein L2 protein, which regulates transcription processes. Its normal functioning is necessary for the normal formation of the gonads, eggs, and eyelids.

PGT for blepharophimosis, ptosis, and epicanthus reversal syndrome type 1,2 is performed for families with a confirmed molecular genetic nature of the disease. It is important to note that the substantiation of the pathogenicity and causation of genetic variants occurs before the PGT of a monogenic disease and is not included either in the goals and objectives of the PGT of a monogenic disease, or in the complex of measures for conducting PGT of a monogenic disease. Pathogenicity is assessed according to the international standard - according to the criteria described in 2015 by the American College of Medical Genetics and Genomics-Association for Molecular Pathology (ACMG-AMP) in the search for the molecular genetic cause of the disease. PGT is recommended for families at high risk of having a child with a severe (incurable) hereditary disease with an established pathogenic variant that causes this risk. PGT allows you to choose from all embryos obtained by IVF (in vitro fertilization) embryos without a pathogenic variant and, therefore, without the risk of developing a disease.

The main problem in the genetic diagnosis of embryos is the small initial amount of biomaterial, since the biopsy contains from one to three cells. In this case, to improve the efficiency and accuracy of the analysis, it is important both to completely exclude the possibility of contamination and to neutralize the possible effect of uneven and/or incomplete amplification, as well as degradation of the biomaterial. This requires the development of a test system with special characteristics. At the same time, the test system is being developed taking into account the possibility of using different types of biomaterial - total deoxyribonucleic acid (DNA) isolated from different tissues, the product of Whole Genome Amplification (WGA), as well as single cells. The combination of versatility with respect to the biomaterial with stepwise amplification of target fragments makes it possible to analyze several pathogenic variants for a single sample, including on single cells, and also to identify the situation of incomplete amplification, contamination, or degradation of the sample. Another feature of PGT is the lack of information about the biological characteristics of the embryo: unlike an adult, an embryo can have any chromosomal abnormalities that complicate the task of assessing the status of an embryo for a specific genetic variant. Therefore, a test system for PGT of a monogenic disease should make it possible to identify such cases and evaluate their impact on the reliability of the diagnostic result.

Description of a close technical solution was not found in public sources.

The PGT method presented by us for blepharophimosis, ptosis, and epicanthus reversal syndrome type 1,2 solves the problem of developing a more accurate method, preimplantation genetic testing of this monogenic disease without the use of expensive devices and reagents, which could be used on various types of biomaterial: DNA isolated from different tissues, whole genome amplification product (WGA), single cells.

The technical result was the creation of a test system for diagnosing a pathogenic variant (the nucleotide number in the reference sequence of genomic DNA is indicated by the prefix NC, the nucleotide number in the reference sequence of the coding transcript is indicated by the prefix NM): NC_000003.11:g.138665511_138665512del , p.Pro18fs) in the FOXL2 gene, which was previously found in the literature [E. DeBaere et al. Human Molecular Genetics, Volume 10, Issue 15, 15 July 2001, Pages 1591-1600] with a dual detection system - direct and indirect. Such a system is necessary when working with a small amount of biomaterial, since unstable amplification can lead to loss of information or reduced accuracy of the analysis. Direct diagnosis involves the analysis of the direct presence-absence of a pathogenic variant. In this case, for the genetic variant NC_000003.11:g.138665511_138665512del (NM_023067.4:c.53_54del, p.Pro18fs) of the deletion type (absence of several nucleotides, English Deletion, del), primers were selected that allow detection of the mutation by the difference fragment lengths using capillary electrophoresis. Indirect diagnosis consists in the analysis of the inheritance of molecular genetic markers linked to a mutation, i.e. inherited with it. To do this, at a distance of no more than 3 mB (which corresponds to 3% crossover on average) from the FOXL2 gene in each direction, polymorphic loci called STR (short tandem repeat - short tandem repeat) were selected with a heterozygosity of at least 0.70 to ensure maximum informativity of indirect diagnostics. STRs are repeats of 2 or more nucleotides located one after another (for example, an adenine-cytosine (AC) pair repeated several times in a row: ACACACACA) and are present in large numbers in the human genome. The number of repeats in each of them may vary from individual to individual, and may also be different in the same person on 2 homologous chromosomes. Heterozygosity above 0.70 means that there is a high probability that in the same person the number of nucleotide repeats in this STR on one chromosome will differ from the number of repeats in the same STR on the homologous chromosome, in other words, the alleles of this marker in this person will differ in length. When amplifying a fragment containing such a marker, amplicons of two different lengths will be obtained. By analyzing the number of repeats in several markers surrounding the pathogenic variant and examining how they are inherited in the tested family, linkage between the alleles of the markers and the pathogenic variant can be established. The diagnostic value of studying the number of repeats in these markers in embryos is that by which allele of each of the markers was inherited by the embryo, it can be judged whether the embryo inherited the FOXL2 gene carrying the pathogenic variant, or whether it inherited the FOXL2 gene from another , a homologous chromosome that does not contain a pathogenic variant. For each of these loci, primers were selected for amplification by the type of nested or semi-nested PCR in 2 rounds, which makes it possible to increase the accuracy and efficiency of amplification. The test system included 13 STR loci for the FOXL2 gene: D3S137.38, D3S137.4, D3S1576, D3S137.8, D3S138.04, D3S138.6, D3S138.66, D3S138.68, D3S138.8, D3S1206, D3S13 8 .9, D3S138.99, D3S1764. Primers for amplification are located on chromosome 3 in the region of coordinates 137387104-139188577 (according to hg19). The sequences of primers for amplification are indicated in the claims in the list of SEQ ID NO 1-39. It is important to note that during the selection of primers, a number of special requirements were observed: the length of the product with external primers for the first round of PCR should not exceed 500 bp. (for production from fragments obtained by whole genome amplification), product length from internal primers for the second round of PCR from 120 to 350 bp, high specificity of external primers, annealing temperature does not differ by more than 1°C.

Preparatory stage of the PGT

At the preparatory stage, the test system is being developed: selection of amplification conditions that are optimal for primers to work, analysis of the efficiency and specificity of PCR amplification in both rounds, assessment of the universality of the test system for biosamples of various types (DNA, WGA product, single cells). When testing the test system, stock dilutions of primers were prepared with a concentration of 100 mM, and working dilutions of primer combinations (a combination of primer pairs for rounds 1 and 2 of PCR) with a concentration of 10 mM of each primer in solution. Since various types of matrices can be used as part of the diagnostics of clinical material, two biopsies of single cells were used in the development of the test system, which were in a special lysis buffer (1 × PCR Buffer, 0.1% Tween-20, 0.1% Triton X-100, 1 µg Proteinase K), two samples of the products of whole genome amplification of embryonic biopsies (WGA), as well as total DNA of family members isolated from blood, for compiling a pedigree and identifying the linkage of a pathogenic variant with alleles of polymorphic markers.

In nested and semi-nested PCR, amplification is carried out in two steps. At the first stage, multiplex PCR is performed with all external primers for all loci included in the test system to enrich the sample with all target fragments. At the second stage, individual amplification of each fragment with internal primers is carried out.

Semi-nested PCR

For the first stage, external highly specific primers were selected to amplify fragments from 300 to 500 bp. For the second stage, primers were selected to amplify fragments no longer than 350 base pairs, and labels were introduced for detection by fragment analysis. The sequences of primers for amplification are indicated in the claims in the list of SEQ ID NO 1-39. The PCR mixture for the first round of amplification contained 1xPCR buffer with Mg2+ (Evrogen, Russia), 0.1 mM of each deoxynucleotide, 0.15 μΜ of each primer, 2.5 U/μΙ HsTaq DNA polymerase (Evrogen, Russia), 6% dimethyl sulfoxide (DMSO), and 1 µl total DNA or 2.5 µl WGA or 5 µl lysis buffer with sample as template. The first stage of amplification was carried out according to the following protocol: the stage of denaturation at 94°C for 2 minutes, 30 cycles with a decrease in the annealing temperature of the primers from 62 to 45°C in each, the stage of completion of all templates at 72°C for 10 minutes. Next, the products of the 1st stage were placed into individual tubes with one pair of primers per specific locus.

The PCR mixture for the second stage included 1xPCR buffer with Mg2+ (Evrogen, Russia), 0.5xRediLoad™ loading buffer (Thermo Fisher Scientific, USA), 0.2 mM of each deoxynucleotide, 0.2 μΜ of each primer, 1 U/μI HsTaq DNA polymerase (Evrogen , Russia), 6% dimethyl sulfoxide (DMSO) and 1 μΙ PCR product of the first stage of amplification as a template. The second stage of amplification was carried out according to the following protocol: denaturation stage at 95°C for 2 minutes, 35 cycles: denaturation at 95°C for 30 seconds, primer annealing at 57°C for 30 seconds, template synthesis at 72°C for 1 minute, completion of all templates 72°C 5 minutes. Evaluation of the efficiency and specificity of amplification was performed using electrophoresis in 2% agarose gel. The result of electrophoresis in agarose gel allows you to determine the required degree of dilution of the amplification products for application to fragment analysis (amplification products of DNA of family members).

Fragment analysis of amplification products was performed using capillary electrophoresis on a 3130x1 Genetic Analyzer (Applied Biosystems, USA). Based on the results of the fragment analysis, a pedigree is compiled and informative polymorphic STR loci for each family are noted, which will later be used in clinical diagnostics. Loci are divided into non-informative (the carrier of the pathogenic variant is homozygous for this locus), semi-informative (alleles for this marker are the same on some and parental chromosomes), informative (alleles of this marker are different on all chromosomes of the parents, which makes it possible to distinguish each of them when analyzing the genotype of the embryo ). Detection of the pathogenic variant NC_000003.11: g.138665511_138665512del (NM_023067.4:c.53_54del, p.Pro18fs) was carried out using amplification primers:

External primers:

Direct: 5'-CACCTTGATGAAGCACTCG-3',

Reverse: 5'-TGTCATGATGGCCAGCTAC-3'

Internal primers:

Forward: 5'-(FAM)ACTTCGCGATGATGTACTGG -3' paired with external reverse.

Example 1

Patients A

Family A turned to the Center for Genetic and Medical Research, in which a child with blepharophimosis, ptosis and epicanthus reversal syndrome was born with a heterozygous carrier of the pathogenic variant NC_000003.11:g.138665511_138665512del(NM_023067.4:c.53_54del, p.Pro18fs) in the FOXL2 gene . The couple was recommended to undergo PGT for blepharophimosis, ptosis and epicanthus reversal syndrome type 1,2 as part of IVF to select embryos that did not inherit the disease.

Family haplotyping

At the first stage, biomaterial (peripheral blood) of family members was obtained to detect the pathogenic variant and identify linkage groups of alleles of polymorphic markers. Amplification of DNA fragments containing polymorphic markers was carried out using the primers listed in the claims in the list of SEQ ID NO 1-39. 13 STR loci were analyzed. Of these, 9 turned out to be informative on the father. Thus, embryo samples were tested only for informative markers. Alleles of polymorphic markers that match in a child and a parent with blepharophimosis, ptosis and epicanthus reversal syndrome with pre-established carriage of the pathogenic variant NC_000003.11:g.138665511_138665512del(NM_023067.4:c.53_54del, p.Pro18fs) in the FOXL2 gene, recognized linked with the pathogenic variant and with each other. Alleles of polymorphic markers that do not match in such relatives are considered linked to each other and to the normal allele of the FOXL2 gene. Linkage groups are also established for relatives who are not carriers of the pathogenic variant. Alleles of polymorphic markers that match in a healthy mother and a child with a disease are recognized as linked to each other and to the normal FOXL2 gene. Alleles of polymorphic markers of a healthy mother that do not match with the child are also recognized as linked to each other and to the normal FOXL2 gene. Indirect diagnostics makes it possible to draw a conclusion about the inheritance of a normal or mutant allele of a gene even if the allele is lost or the reaction fails during amplification of DNA fragments for direct diagnostics.

As a result of haplotyping and determination of linkage groups for family A from the example, the results presented in Table 1 were obtained. The alleles indicated on the same line are located on the same chromosome, that is, they represent the linkage group. Thus, for each member of the family, there are 2 linkage groups corresponding to each of the two third chromosomes. N in the table denotes the wild-type allele, mut is the mutant allele. Numerals indicate the lengths of amplicons in base pairs; their lengths depend on the number of repeats in the STR marker. Pathogenic variant NC_000003.11:g.138665511_138665512del(NM_023067.4:c.53_54del, p.Pro18fs) in the FOXL2 gene is shortly denoted in the table - FOXL2 c.53delCA.

Table 1. Results of haplotyping of family A. Alleles for which linkage could not be established as part of the development of the test system are shown in parentheses.

As a result of haplotyping, it was concluded that the following alleles of STR markers were linked in the patient's partner with the pathogenic variant: D3S137.38 - 206, D3S137.4 - 263, D3S1576 - 296, D3S137.8 - 281, D3S138.04 - 146, D3S138.6 - 242, D3S138.8 - 259 D3S138.9 - 197.

Preimplantation genetic testing

In the IVF cycle, 7 embryos were obtained, a biopsy was performed on the 5th day of development (in the IVF clinic), the biopsy in WGA buffer (1xPBS (Invitrogen, USA), 1% polyvinylpyrrolidone (PVP) (Fertipro, Belgium)) was sent to the Genetico ". To control contamination at different stages of working with a sample, the laboratory developed a system of controls: control of contamination of the biopsy buffer, control of contamination during transportation (one test tube with buffer is not opened by the embryologist), control of contamination of each sample (sample of the medium from the last wash drop of biopsy material). All these controls, together with the samples, go through the stage of whole genome amplification, after which the smallest amount of DNA contaminating the controls will be noticeable. Genome-wide amplification was performed using the commercial SurePlex kit (Illumina, USA).

The product of genome-wide amplification, as well as the DNA of all family members, was amplified at stage 1 in multiplex PCR with primers for the detection of the pathogenic variant and primers for polymorphic markers informative for the A family in accordance with the protocol for the test system developed as part of the preparatory stage. At stage 2, amplification was performed for each marker separately in accordance with the developed protocol for the test system. In this way, the linkage groups inherited by each embryo were established. The results obtained are presented in table 2.

Table 2. Results of PGT-M for family A. ADO - allele dropout. FA - amplification failed

According to the results of direct and indirect diagnostics, 5 embryos (embryo 2, 4-7) did not inherit the disease, in 2 embryos (embryo 1 and 3) a haplotype corresponding to the inherited disease was detected. With the consent of the parents, preimplantation genetic screening for chromosomal abnormalities was performed for embryos that did not inherit the disease. Based on the results of all tests carried out, embryo 4 was recommended for transfer. The remaining embryos were not recommended due to various chromosomal abnormalities.

Claims (2)

Method for preimplantation genetic testing of blepharophimosis, ptosis and epicanthus reversal syndrome type 1, 2, involving the detection of the inheritance of the pathogenic variant NC_000003.11:g. double detection system - direct and indirect, where direct detection is carried out using primers for amplification, and indirect detection is carried out using primers for the analysis of the inheritance of molecular genetic markers of the STR type linked to the pathogenic variant, selected from SEQ ID NO 1-39, while using primers directed to those STRs whose alleles are different on the chromosomes of the parent-carrier of the mutation , where the outer primers are designated as Fout (forward primer) and Rout (reverse primer), and the internal primers are designated as Fin (forward primer) and Rin (reverse primer), while the diagnosis is carried out in two stages of semi-nested PCR: at the first stage, multiplex PCR with external primers, at the second stage, individual PCR of each fragment is carried out with internal primers for STR and for the pathogenic variant.