RU2771582C1 - Komagataella phaffi yeast transformant - citrobacter gillenii phytase producer - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: disclosed is a transformant of yeast Komagataella phaffii, which produces Citrobacter gillenii phytase. Said transformant contains the nucleotide sequence of the gene given in the sequence listing under the number SEQ ID NO: 1, coding phytase C. gillenii, or its forms, determined by degeneracy of genetic code.EFFECT: invention provides wider range of recombinant microorganisms producing phytase.1 cl, 3 dwg, 1 tbl, 3 ex

Description

SUBSTANCE: invention relates to microbiology and biotechnology and concerns production of Komagataella phaffii (Pichia pastoris) yeast strains capable of producing phytase enzyme.

Phosphorus is an essential chemical element necessary for the growth and development of animals. Most animal feeds, such as cereals and legumes, contain phosphorus mainly in the form of phytate (myo-inositol hexakisphosphate) [Advanced Food Research, 1982, 28, 1-92.]. Monogastric animals are not able to absorb phytate phosphorus due to the lack of the necessary enzyme in the digestive tract [Can. J. Anim. Sci., 2013, 93, 9-21].

The presence of phytate in the compound feed also prevents the effective absorption of calcium, magnesium, zinc, iron and other minerals and leads to the binding of feed proteins into complexes inaccessible for digestion [Current Topics In Nutraceutical Research, 2008, 6(3), 131-144.] .

Phytases (myo-inositol hexakisphosphate phosphohydrolase) hydrolyze phytate with elimination of phosphate groups. These enzymes are successfully used as a feed additive, significantly increasing the absorption of phosphorus [J. sci. Food Agric, 2015, 95, 878-896]. They provide the release of not only phytate-bound phosphorus, but also proteins, macro- and microelements, increasing the nutritional properties of feed [British Poultry Science, 2004, 45(1), 101-108.].

Various microorganisms are natural sources of phytases: bacteria, fungi [FEMS Microbiology Reviews, 2005, 29 (1), 3-23.].

In industry, phytase is obtained by microbiological synthesis using producer strains, the need for industry in which is constantly growing [Afr. J. Biotechnol, 2009, 8(17), 4229-4232.]. The most promising phytase producers were obtained from recombinant strains of the methylotrophic yeast Komagataella phaffii {Pichia pastoris) [J. Mol. Recognit., 2005, 18(2), 119-138. doi: 10.1002/jmr.687], which have powerful systems for the expression and secretion of recombinant proteins (including phytases) and for which nutrient media have been developed and the fermentation process has been developed using high density culture. The process of cultivating methylotrophic yeast is quite simple, since their growth is not blocked by metabolic products [FEMS Microbiol. Rev., 2000, 24:45-66, doi: 10.1111/j.1574-6976.2000.tb00532.x].

Based on the yeast K. phaffii, the producers of the following phytases were constructed: Citrobacter amalonaticus [ВМС Biotechnology, 2015, 15, 88.], Escherichia coli [J. Agric. Food Chem., 2013, 61(25), 6007-6015., CN 102586294, CN 102943083], Peniophora lycii [Appl. microbiol. Biotechnol, 2006, 72(5), 1039-47.], Citrobacter braakii [Acta Microbiologica Sinica, 46(6), 945-950.], Yersinia rohdei, Yersinia pestis, Y. Intermedia [Appl. microbiol. Biotechnol., 2008, 80(3), 417-426.] and others.

It has been shown that genes encoding phytases of various origins are expressed in yeast K. phaffii with different efficiency, namely, when phytases from Yersinia rohdei, Yersinia pestis, Y. intermedia, E. coli, or Aspergillus niger are expressed in K. phaffii yeast, phytase activity in culture liquid on the 4th day of cultivation is 313, 19, 270, 219 and 16 units/ml, respectively. [Appl. microbiol. Biotechnol, 2008, 80(3), 417-426.]. At the same time, phytases of various origins differ from each other in properties that are essential for use in industry, such as the operating temperature and pH range, resistance to the action of proteolytic enzymes, and others [J. Agric. Food Chem., 2013, 61(25), 6007-6015; Amu. Rev. Anim. Biosci., 2013, 1, 283-309.].

Obtaining new phytases with industrially valuable properties and capable of being efficiently expressed in the yeast K. Phaffii is an urgent task.

The technical problem to be solved by the claimed invention is the expansion of the arsenal of recombinant microorganisms that produce phytase.

The technical result achieved by the implementation of the claimed invention is to obtain a transformant of the yeast Komagataella phaffii - a producer of phytase Citrobacter gillenii.

Obtaining the claimed transformant includes the introduction of the phyCg gene encoding C. gillenii phytase into K. phaffii yeast cells using an expression cassette that includes the phyCg gene, a promoter operating in K. phaffii yeast, a signal peptide for secreting the enzyme into the culture fluid, and also a terminator, a marker gene, and preferably a site for homologous integration into the chromosome.

The nucleotide sequence of the phyCg gene encoding C. gillenii phytase is listed in the international Genbank database under the number NZ_QVEK01000009.1 (22167…23465). Since, due to the “degeneracy” of the genetic code, the same amino acid sequence can be encoded by a large number of nucleotide sequences, not only the nucleotide sequence itself (the phyCg gene) can be used for cloning, but also all its forms determined by the degeneracy of the genetic code.

Integration is carried out by either homologous or non-homologous recombination. Transformation of the expression cassette into K. phaffii yeast cells is carried out in particular by the electroporation method [http://tools.thermofisher.com/content/sfs/manuals/pich_man.pdf], the polyethylene glycol method or protoplasts [http://www. thermofisher.com/order/catalog/product/K173001].

The design of expression cassettes is carried out by standard methods of genetic engineering [Rybchin V.N. Fundamentals of genetic engineering. - SPb.: SPbGTU, 1999; Sambrook J., Maniatis T., Fritsch E. Molecular cloning: a laboratory manual. - N.Y.: Cold Spring Harbor Laboratory, 1989.] using genetic elements suitable for working with the yeast K. phaffii. AOX1, DAS, FLD1, ICL1, PHO89, THI11, ADH1, ENO1, GUT1, GAP, TEF1, PGK1, GCW14, G1, G6 or others are used as promoters [Appl. microbiol. Biotechnol, 2014, 98, 5301-5317]. As signal peptides, a-factor, PHO1, SUC2, PHA-E, KILM1, pGKL, CLY, CLY-L8, K28 pre-pro-toxin or others are used [Appl. microbiol. Biotechnol, 2014, 98, 5301-5317]. Any suitable markers are used as selectable markers, for example, genes for resistance to antibiotics zeocin, geneticin (G418) or blasticidin C, as well as genes complementing auxotrophic mutations in the K. phaffii genome, for example, HIS4, MET2, ADE1, ARG4, URA3, URA5 , GUT1 [Yeast, 2005, 22, 249-270.]. The AOX1, HIS4 gene sequences [http://www.thermofisher.com/order/catalog/product/V17520] or other sequences homologous to regions of the K. phaffii yeast chromosome are used as arms for homologous integration.

The resulting transformants are tested for the presence of the target gene in the chromosomal DNA and the ability to exhibit phytase activity.

The invention is illustrated by the following figures.

Fig. 1. Expression cassette

Fig. 2. Electropherogram of the PCR fragment corresponding to the phyCg gene

Fig. 3. PhyCg phytase activity at different pH values

Example 1 Construction of a K. phaffii yeast transformant producing C. gillenii phytase

When constructing an integrative expression cassette, the "fusion-PCR" method is used [Gene., 1989, 15, 77(1), 61-68.].

The sequence of the phyCg gene, presented in the international database Genbank under the number NZ_QVEK01000009.1 (22167 ... 23465) and encoding C. gillenii phytase, is synthesized by the method described in [J. microbiol. Methods, 2010, 81(2), 147-152]. A DNA sequence is obtained, at the 3'- and 5'-ends of which the EcoRI and NotI restriction sites are provided, shown in the sequence listing under the number SEQ ID NO: 1.

The resulting DNA sequence is inserted into the expression cassette (Fig. 1), which includes the following genetic elements:

1. The phyCg gene, built into a single reading frame with the nucleotide sequence of the signal peptide of the α-factor from Saccharomyces cerevisiae, under the control of the AOX1 promoter;

2. TTAOX1 transcription terminator;

3. Yeast selective marker HIS4 complementing a mutation in the HIS4 gene in the yeast Komagataella phaffii;

4. Integration area - 3' fragment of the nucleotide sequence of the AOX1 gene.

The resulting integrative expression cassette is transformed into the K. phaffii VKPM Y-2837 strain, which is preliminarily grown in a YP liquid nutrient medium (wt %: yeast extract - 1, peptone - 2, water - the rest) with the addition of glucose (2 wt %) to a concentration of 1×10 ⁸ cells per 1 ml. Cells are separated by centrifugation and washed with ice-cold sterile water and then with ice-cold 1 M sorbitol. Cells are then incubated in 25 mM dithiothreitol for 15 minutes and washed in ice-cold 1 M sorbitol. Next, the cells are resuspended in an ice-cold solution of 1 M sorbitol at a concentration of 1-5×10 ⁹ cells per 1 ml. A 40 µl aliquot of the cell suspension is transferred to a chilled eppendorf, 400 ng of DNA expression integration cassette is added and incubated on ice for 5 minutes. The mixture of cells and DNA is transferred to a pre-chilled electroporation cuvette. Electroporation is carried out under the following conditions: 1.5 kV, 400 ohms, 25uF. After portioning, 1 ml of an ice-cold solution of 1 M sorbitol is added.

The selection of transformants is carried out for 5 days at a temperature of 30°C on an agar medium of the following composition (wt.%): Na ₂ HPO ₄ - 0.6; KH ₂ PO ₄ - 0.3; NaCl - 0.05; NH ₄ Cl - 0.1; MgSO ₄ 7H ₂ O - 0.065; agar - 2; glucose - 2; CaCl ₂ - 0.07; biotin, mg - 0.0002; calcium pantothenate - 0.04; folic acid - 0.0002; niacin - 0.04; p-aminobenzoic acid - 0.02; pyridoxine hydrochloride - 0.04; riboflavin - 0.02; thiamine hydrochloride - 0.04; boric acid - 0.05; CuSO ₄ - 0.004; KJ - 0.01; FeCl ₃ - 0.02; sodium molybdate - 0.02; ZnSO ₄ - 0.04, water - the rest.

The presence of the target gene in the chromosomal DNA of the obtained transformants is confirmed by PCR using the primers PhyCg-F (5'-aagaattcgatgaacagagcggaatgcag-3'), PhyCg-R (5'-aagcggccgcttattctcagcacattcggaca-3').

PCR reaction mode: 95°C - 3 min - 1 cycle; 30 cycles: 95°C - 30 s, 56°C - 30 s, 72°C - 90 s; 72°C - 5 min. - 1 cycle.

To control the size of the amplified DNA fragment during electrophoresis, the GeneRuler 1 kb DNA Ladder (Fermentas) molecular marker is used (line 2, Fig. 2, the size of the fragments from bottom to top is 10000, 8000, 6000, 5000, 4000, 3500, 3000, 2500, 2000, 1500 , 1000, 750, 500, 250 b.p.).

The presence of a PCR fragment of 1233 bp. (line 1 of Fig. 2) confirms the presence of the phyCg gene encoding phytase from Citrobacter gillenii in the chromosome of the obtained transformants.

Example 2. Evaluation of the level of phytase activity of Yeast Komagataella phaffii transformants

The selection of the most productive transformant is carried out during cultivation in a liquid nutrient medium according to the following scheme.

The seed culture of each of the transformants was separately grown in test tubes (50 ml) with 5 ml of YP liquid nutrient medium supplemented with glucose (2 wt %) at 30°C for 24 h on a shaker (250 rpm). The inoculation of the fermentation medium is carried out in a ratio of 1/10 for each transformant separately.

Fermentation is carried out at 30°C on a shaker (250 rpm) in YP nutrient medium with the addition of 1% glucose for 24 hours. Phytase gene expression is induced by adding methanol to a final concentration of 1% every 24 hours for 4 days. The productivity of each of the Komagataella phaffii transformants was assessed by the activity of phytase accumulated in the culture liquid. For this, the transformant cells are pelleted by centrifugation, and the supernatant is used to determine the phytase activity by the modified Fiske-Subarrow method [J. microbiol. Methods, 1999, 39(1), 17-22].

The values of phytase activity presented in the table indicate a rather high level of Citrobacter gillenii phytase productivity of the resulting Komagataella phaffii transformants, as well as the effective expression of C. gillenii PhyCg phytase in K. phaffii yeast.

The most productive transformant No. 3, selected based on the results of fermentation, which synthesizes phytase in the amount of 279 U / ml, is deposited at the Bioresource Center All-Russian Collection of Industrial Microorganisms (BRC VKPM) of the National Research Center "Kurchatov Institute" - GosNIIgenetika (117545 Moscow, 1st Dorozhny proezd, d 1) as Komagataella phaffii PCG3 VKPM Y-4839.

The strain is characterized by the following features

Cultural and morphological features

When cultivated at a temperature of 28°C for 48 hours on a YP agar medium of the following composition (wt.%: peptone - 2, yeast extract -1, agar - 2, water - the rest) with the addition of glucose (2 wt.%), cells have an oval shape, 3-4 microns in diameter. Cells bud, while budding is true, multilateral. True mycelium does not form. Sporulation occurs when the culture is incubated on an agar medium of the following composition (wt %): potassium chloride - 1.0, sodium acetate - 0.5, glucose - 1.0, agar - 2.0, water - the rest. Asci have a tetrahedral shape, include 4 ascospores.

On YP agar medium supplemented with glucose (2 wt %), light beige colonies with a smooth edge, matte surface, lenticular profile, and pasty consistency. Growth in a YP liquid medium with the addition of glucose (2 wt %) at 28°C for 24 h of cultivation results in cloudy liquid, white precipitate, no coagulation, and no wall films.

Physiological and biochemical signs

Capable of growing under both aerobic and anaerobic conditions.

It is able to use methanol, ethanol, glucose, glycerol, lactate, succinate as the only source of carbon; it is not able to assimilate maltose, sucrose, acetate, starch, lactose.

When cultivated in the presence of methanol, it is able to synthesize phytase.

Example 3. Working pH range of PhyCg phytase synthesized by the claimed transformant.

At the end of the fermentation process, the cells of the proposed transformant are precipitated by centrifugation, and the supernatant is used to determine phytase activity at various pH values using the modified Fiske-Subarrow method [J. Microbiol, Methods, 1999, 39(1), 17-22.]. Determination of the working pH range of the enzyme is carried out using the following buffer solutions: glycine-HCl (pH 2.0-3.5), Na-acetate (4.0-5.5) and Tris-HCl (pH 6.0-8, 0). The reaction mixture containing 100 µl of the supernatant and 900 µl of 2% sodium phytate solution in the appropriate buffer is incubated at 37°C for 25 minutes. Add 1000 µl of dye (freshly prepared mixture of four volumes of 1.5% ammonium molybdate in 5.5% sulfuric acid solution and 1 volume of 2.5% aqueous iron (II) sulfate solution) to the sample. The mixture is incubated for 5 min and optical density is measured spectrophotometrically at 700 nm. A unit of phytase activity is defined as the amount of enzyme that catalyzes the release of 1 µmol of inorganic phosphate from sodium phytate per minute at 37°C.

In FIG. 3 shows the relative activity of PhyCg phytase of the claimed transformant at various pH values (100% is taken as activity at the optimum pH value of 4.5). From the presented results, it can be seen that the phytase produced by the claimed transformant retains more than 50% of activity in the pH range from 3.0 to 6.0. This pH range favorably distinguishes the phytase obtained using the claimed transformant from most known ones. In particular, commercial phytase from Citrobacter braakii retains about 60% activity at pH 3.0, about 50% activity at pH 5.5, and about 30% activity at pH 6.0 [Biotechnology Letters, 2003,25,1231-1234. ].

The high activity of PhyCg phytase at pH 6 makes it attractive for industrial applications, in particular, for use as a feed additive in aquaculture.

--->

Sequence listing

<110>Federal state budgetary institution "State

Research Institute of Genetics and Selection of Industrial

microorganisms of the National Research Center "Kurchatov

Institute" (NRC "Kurchatov Institute" - GosNIIgenetika).

State Research Institute for Genetics and Selection of Industrial

Microorganisms of National Research Center "Kurchatov Institute"

(NRC "Kurchatov Institute" - GOSNIIGENETIKA)

<120> Komagataellaphaffii yeast transformant – phytase producer

Citrobactergillenii

<130> 20-03

<160>1

<210>1

<211>1251

<212> DNA

<213> Citrobactergillenii

<220>

<223> phyCg gene encoding PhyCg phytase from the bacteria Citrobactergillenii

<400>1

aagaattcgatgaacagagcggaatgcagcttgagcgtgttgtcatcgtcagtcgtcatg 60

gcgtcagggcaccgacaaagttcacgccgcttatgcagcaagtcactcccgaccgctggc 120

cgcaatgggacgttcctctggggtggttgactcctcgcggcggggcactcattactgaat 180

taggacggtatcaacgtttacgcctggcggacaaaggtctgctggataataaaacgtgtc 240

300

aagcattcctggcaggactggccccgaaatgtaaagtacaggttcattatcaacaagata 360

agtcaaaatctgatcccctttttaatcccatcaaggcggggcagtgttcgctgaacacat 420

cgcaggtgaaagaggccatcctgacccgggctggcggaagtcttgatgagtacacgcgcc 480

actaccaacccgcatttcaagccctggaacgggtgttaaatttctcccagtcagaaaagt 540

gtcaagcagctgggcagtctgcacagtgtacgctaaccgacgtcttacctgctgaactca 600

aggtctctccagaaaatatatcgttgtcaggctcatggggactggcttcaaccctgacgg 660

aaatcttcctgctgcaacaagcacaagggatgtcgcaggtggcctgggggcgtattcatg 720

gcgataaagaatggcgtacattattaagtctgcacaatgcgcagtttgaccttctgcaga 780

840

tcgtaacacagggggcaacagaaaataaatacgcaattcagttgcccgtctctttgttgt 900

ttattgcggggcatgacaccaatcttgccaatatcagcggggcattaggccttaacgtgt 960

1020

1080

1140

1200

tcattgattccgttcgcgtgtccgaatgtgctgagaaataagcggccgctt 1251

<---

Claims (1)

Yeast transformant Komagataella phaffii - producer of Citrobacter gillenii phytase, containing the nucleotide sequence of the gene listed in the sequences under the number SEQ ID NO:1, encoding C. gillenii phytase, or its forms, determined by the degeneracy of the genetic code.

Images